5,201 Matching Annotations
  1. Mar 2025
    1. Author response:

      The following is the authors’ response to the original reviews

      Reviewer #3 (Recommendations for the authors):

      Major concerns:

      P.6, lines 223-224: The sentence sounds like the authors produced all the OVGP1s by themselves in their laboratories, which is not completely true. The recombinant human and mouse OVGP1s were purchased from OriGene. It is suggested that the authors should state and explain clearly here which OVGP1 is produced by their laboratories and that recombinant human and mouse OVGP1s were obtained and purchased from Origene.

      It is already clearly included in the M&M.

      P6, lines 227-229: The authors stated that "Western blots of the three OVGP1recombinants indicated expected sizes based on those of the proteins: 75 kDa for human and murine OVGP1 and around 60 kDa for bovine OVGP1 (Fig. 4B and S6)." I pointed out in my last review report that the size of the recombinant human OVGP1shown by the authors in their manuscript is not in agreement with what has been published previously in literature regarding the molecular weight of native human OVGP1 as well as that of recombinant human OVGP1. The authors did not address the above concern adequately. In fact, recombinant human OVGP1 has been produced a few years ago (Reproduction (2016) 152:561-573) and it has been previously demonstrated that a single protein band of approximately 110-130 kDa was detected for both native human OVGP1 (see Microscopy Research and Technique (1995) 32:57-69) and recombinant human OVGP1 (Reproduction (2016) 152:561-573; Carbohydrate Research (2012) 358:47-55) using antibodies specific for human OVGP1. Molecular weight of the protein core or polypeptide of human OVGP1 is approximately 75 kDa, but the glycosylated form of native human OVGP1 and recombinant human OVGP1 is approximately 110-130 kDa. Therefore, the authors might have been using the recombinant core protein of human OVGP1 instead of the fully glycosylated recombinant OVGP1 in their study. The same concern also applies to the commercially obtained mouse recombinant OVGP1 used by the authors in their study. I would also like to mention that the mature and fully glycosylated OVGP1s in mammals vary in molecular weight (90-95 kDa in domestic animals; 110-150 kDa in primates; 160-350 kDa in rodents). Again, the 75kDa of mouse OVGP1 detected by the authors could be the core protein or polypeptide of mouse OVGP1 instead of the fully glycosylated mouse OVGP1.

      In our study, as previously mentioned, we included commercially available recombinant proteins from Origene for human and murine OVGP1, which are produced in mammalian cells, and we also produced and purified bovine OVGP1 in mammalian cells. Therefore, these proteins should be properly glycosylated. Moreover, we performed Western blot assays favouring the blotting of higher molecular weight proteins, ensuring the optimal conditions for the assay. Additionally, we tested the size of OVGP1 from murine and bovine oviductal fluids on the same blot. During oestrus, the size of OVGP1 from oviductal fluids matches that of the recombinant proteins, and this band is downregulated during anoestrus, confirming the proper size of recombinant protein.

      P.7, lines 236 and 237: Please provide a figure or source to support the statement "...as confirmed by proteomics of the bands along with PEAKS Studio v11.5 search engine peptide identification software."

      It is included in the text the amount of unique peptides obtained by Proteomics for OVGP1 identification over all protein groups identified.

      P.7, lines 243 to 245: The statement "...using rabbit polyclonal antibody to human OVGP1 for bOVGP1 and endogenous OVGP1, and mouse monoclonal antibody against Flag (DDK)-tag for hOVGP1 and mOVGP1." is confusing and might be inaccurate. First of all, I wondered why the authors did not use an antibody against bovine OVGP1 for the recombinant bOVGP1 instead of using a rabbit polyclonal antibody to human OVGP1. Secondly, what does the "endogenous OVGP1" refer to in the statement? Thirdly, the authors in their study used the commercially available recombinant human OVGP1 and recombinant mouse OVGP1 purchased from Origene. Based on the data sheet provided by Origene, the tag used for both recombinant human OVGP1 and recombinant mouse is C-Myc/DDK-tag and not Flag-tag. Can the authors explain these discrepancies?

      Firstly, for the recombinant protein of bOVGP1 we used the same antibody that we used in the Western blot for all the proteins and oviductal fluids because we do not have anti-His tag working for Immunofluorescence (the one we had only worked for Western blot) and neither we do not have any antibody against bovine OVGP1. In the case of human and murine since we had anti-Flag antibody that worked for Western blot and for immunofluorescence, we used this one. However, as has been shown in our figure and supplementary material, the antibody against human OVGP1 works properly for both techniques (Western blot and Immunofluorescence). Secondly, endogenous OVGP1 is referred to the OVGP1 present in the oviductal fluid. Thirdly, as you can see in the datasheet of the protein, the recombinant proteins purchased from Origene contains a c-myc tag (EQKLISEEDL) some amino acids and a ddk-tag (DYKDDDDK). The sequence of ddk is the same of Flag-tag (DYKDDDDK). Since the proteins have both tags we used the antibody against Flag (or ddk) epitope.

      P12, lines 429-432: The newly added statement at the end of the Discussion saying "Additionally, future studies would be valuable to investigate whether incubating oocytes with oviductal fluid (or OVGP1) could reduce polyspermy in porcine IVF and whether ZPs could be leveraged to naturally enhance sperm selection in human ICSI" is very concerning and requires further attention. The statement reflects that the authors do not keep pace with and do not pay attention to what has been published in literature regarding porcine and human OVGP1s. In fact, porcine oviduct-specific glycoprotein (OVGP1) has already been reported to reduce the incidence of polyspermy in pig oocytes (Biology of Reproduction (2000) 63:242-250). Porcine oviductal fluid, used in porcine IVF, has also been found to exert a beneficial effect on oocytes by reducing the incidence of polyspermy without decreasing the penetration rate. (Theriogenology (2016) 86:495-502). Therefore, the studies deemed valuable by the authors to be investigated in the future have, in fact, already been carried out two decades ago by several other laboratories. I am surprised the authors were not aware of these published work in literature. All the above should have been incorporated in the Discussion.

      This sentence is modified in the discussion and the references are included.

      Furthermore, as mentioned earlier, recombinant human OVGP1 has also been produced (Reproduction (2016) 152:561-573), and recombinant human OVGP1 has been found to increase tyrosine phosphorylation of sperm proteins, a biochemical hallmark of sperm capacitation, and potentiate the subsequent acrosome reaction (Reproduction (2016) 152:561-573) as well as increase sperm-zona binding (Journal of Assisted Reproduction and Genetics (2019) 36:1363-1377). These earlier findings should be incorporated into the Discussion.

      Thank you for your comment, but in this work we had not performed any experimental setting related to tyrosine phosphorylation and despite is a very interesting topic is not directly related to this work.

      P.19, lines 678-683: Since the human and mouse recombinant oviductin proteins were purchased from Origene, the authors should be aware of the fact that these commercially available recombinant OVGP1s might not be fully glycosylated. While I appreciate the fact that the authors wanted to briefly describe how the human and mouse recombinant OVGP1s were prepared by the manufacturer, I strongly suggest that the authors should contact Origene, the manufacturer, for all information regarding the procedures for producing the human and mouse recombinant oviductin proteins. For example, the authors stated on lines 680-681 that "A sequence expressing FLAG-tagged epitope proteins (DYKDDDDK) was cloned into an expression vector." According to the data sheet provided by Origene, it appears that both human and recombinant oviductin proteins are C-Myc/DDK-tagged and not FLAG-tagged.

      Thank you for your comment, as according to the sequence of Flag-tag it is matching with the sequence of the tag in the datasheet corresponding to DDK (this is in detail in previous comment). Besides, the protein is tagged also by C-Myc tag. Among both tags, the antibody selected to detect it was anti-Flag tag.

      P.19, lines 692-697: The description of the primary and secondary antibodies used for detection of the various recombinant OVGP1s is also very confusing and not clearly presented. For example, it is mentioned here that "...membranes were...incubated with anti-OVGP1 rabbit monoclonal antibody for OVGP1,..". What specifically does "OVGP1" refer to here? The authors then stated that anti-Histamine Tag antibody was used to detect bOVGP1 and mOVGP1 and anti-Flag antibody was used to detect hOVGP1. As pointed out earlier, the human and mouse recombinant OVGP1s were produced using C-Myc/DDK tag and not His-tag or Flag-tag. Can the authors clarify these discrepancies?

      We apologise for the complexity of the antibodies, we included in this paragraph the ones used to Western blot for both figures: anti- human OVGP1 was used for the principal figure that contains the three recombinant proteins and oviductal fluids; and the anti-Histidine and anti-Flag antibodies that are included in supplementary figure, specifically for recombinant bovine OVGP1 (Histidine tag) and for recombinant murine and human OVGP (DDK tag). A clarifying sentence has been included in the text.

      P.31, lines 1143-1149: Figure 10 is not mentioned anywhere in the main text of the manuscript. Rewrite the second half of the sentence "...; being this specificity lost when OVGP1 is heterologous to the ZP (right diagram)." Which sounds awkward and grammatically not correct.

      The figure is already mentioned in the text, thank you for your comment. The sentence is also corrected.

      Other comments: P.1, the statement of "All authors contributed equally to this work" on line 14 can be deleted because detailed and specific contributions from each authors are listed in lines 1009-1017 on page 27.

      Both authors contributed equally to this work, now is clear in authors contribution section.

      P.2, lines 43 and 44: Do the authors mean "sperm-oocyte binding protein" instead of "sperm-oocyte fusion protein" in the sentence? "Fusion protein" is a protein composed of two or more domains encoded by different genes, or a hybrid molecule created by combining two different proteins for various purposes. I believe the term "fusion protein" is wrongly used in the sentence which should be rephrased with a proper term.

      Done.

      P2, line 73: Remove the comma after the word "Both".

      Done.

      P.5, line 179: "...mice ZP..." should be written as "...mouse ZP...".  

      Done.

      P.6, heading of 3rd paragraph on line 207: The term "binding" will be a better term than "fusion" used in the heading because the results do not actually show the fusion of the OVGP1 proteins with the ZP glycoprotein. Instead, binding of the OVGP1 proteins to the ZP occurred.

      Done.

      P.6, lines 215-217: Authors, please provide a reference or references to support the statement "Region A, corresponding to the amino acid end, shows high identity among monotremes, marsupials and placentals."

      In the text was indicated a review (29) which includes the supporting idea of this statement for Figure 4. Moreover, we have included some if the references used for the description of the domains when performing the sequence alignment of Figure S5.

      P.6, line 230 and line 233 on P.7: Authors, please be consistent in the use of either American English or British English. The word "oestrus" is British English whereas "estrus" is American English.

      Done.

      P.7, line 264: The word "sticking" used here means non-specific binding. I believe the author means specific binding here. If so, a more appropriate word should be used here instead of "sticking".

      Done.

      P.7, lines 267-269: This newly added sentence sounds very awkward and should be completely rewritten.

      Done.

      P.8, line 288: This reviewer finds it difficult to understand the meaning of the heading. The heading should be rephrased to bring out exactly what the authors want to say in well-written English.

      Done.

      P.8, line 290: The word "would" should be replaced by "could" in the sentence.

      Done.

      P.13, line 437: Authors, please provide the location of Sigma-Aldrich.

      Done.

      P.13, line 457: Here, the authors used "1800 rpm" to indicate the centrifugation speed but used the g-force elsewhere in the Materials and Methods. Please be consistent. The g-force is preferred.

      Done.

      P.14, lines 483-485: The procedure of sacrificing the cats should be provided in the Materials and Methods

      Cats weren’t sacrificed they were vasectomized. It is now included in the text.

      P.17, line 628: "...the ZPs were exposed or no exposed to..." should be written as "...the ZPs were either exposed or not exposed to...".

      Done.

      P.17, line 629: "...each groups were incubated with..." should be "...each group was incubated with...".

      Done.

      P.19, line 700: "As loading control, was used the primary antibody....." is not a complete sentence and it needs to be rewritten.

      Done.

      P.20, lines 744-754: For scanning electron microscopy and image processing, the procedures of prior treatment of the oocytes with and without oviductal fluid and OVGP1 should be included here.

      Done.

      P.21, line 756: It is stated here that "Two hundred isolated ZPs were treated with Clostridium perfringens neuraminidase....". However, it is not clear whether two hundred isolated ZPs of both porcine and murine ZPs were treated. Authors, please clarify.

      We used 200 isolated ZPs of each specie, bovine and murine. It is classified in the text.

      P.28, lines 1039 and 1040: The author only mentioned the use of bovine and murine sperm here. What about human sperm?

      Done.

      P.29, line 1076: "...in mammalian cells..." is very vague. Be specific what exactly the mammalian cells were.

      Done.

      P.29, line 1079: "Oviductal fluid from ovulated cows or anoestrus cows." is not a complete sentence and it needs to be rewritten.

      Done.

    1. Author response:

      The following is the authors’ response to the original reviews

      eLife Assessment

      In this valuable study, García-Vázquez et al. provide solid evidence suggesting that G2 and S phases expressed protein 1 (GTSE1), is a previously unappreciated non-pocket substrate of cyclin D1-CDK4/6 kinases. To this end, this study holds a promise to significantly contribute to an improved understanding of the mechanisms underpinning cell cycle progression. Notwithstanding these clear strengths of the article, it was thought that the study may benefit from establishing the precise role of cyclin D1-CDK4/6 kinase-dependent GTSE1 phosphorylation in the context of cell cycle progression, …

      We do not claim, as editors and reviewers appear to have interpreted, that GTSE1 is phosphorylated by cyclin D1-CDK4 in the G1 phase of the cell cycle under normal physiologic conditions.  Indeed, we agree with the existing literature indicating that in cells that do not express high levels of cyclin D1, GTSE1 is expressed predominantly during S and G2 phase (hence the name GTSE1, which stands for G-Two and S phases expressed protein 1) and is phosphorylated by mitotic cyclins in early mitosis.  Even during G1, when the levels of cyclin D1 peak, GTSE1 is not phosphorylated in normal cells.  This could be due to either a higher affinity between GTSE1 and mitotic cyclins as compared to D-type cyclins or to a higher concentration of mitotic cyclins compared to D-type cyclins.  In the current manuscript, we show that higher levels of cyclin D1 can drive the sustained phosphorylation of GTSE1 across all cell cycle points. To reach this conclusion, we do not rely only on the overexpression of exogenous cyclin D1. In fact, we observe similar effect when we deplete endogenous AMBRA1, resulting in the stabilization of endogenous cyclin D1 in all cell cycle phases (see Figure 2G and Figure supplement 3B).  As we had already mentioned in the Discussion section, we propose that GTSE1 is phosphorylated by CDK4 and CDK6 particularly in pathological states, such as cancers displaying overexpression of D-type cyclins (i.e., it is possible that the overexpression overcomes the lower affinity of the cyclin D-GTSE1 complex). In turn, phosphorylation of GTSE1 induces its stabilization, leading to increased levels that, as expected based on the existing literature, contribute to enhanced cell proliferation.  So, the role of the cyclin D1-CDK4/6 kinase-dependent GTSE1 phosphorylation is to stabilize GTSE1 independently of the cell cycle.  In sum, our study suggests that overexpression of cyclin D1, which is often observed in cancers cells beyond the G1 phase, induces phosphorylation of GTSE1 at all points in the cell cycle. 

      … obtaining more direct evidence that cyclin D1-CDK4/6 kinase phosphorylate indicated sites on GTSE1 (e.g., S454) …

      We show that treatment of cells with palbociclib completely abolished the effect of cyclin D1-CDK4 on the GTSE1 shift observed using Phos-tag gels (Figure 2H).  Moreover, mutagenesis analysis shows that S91, S262, and S724 are phosphorylated in a cyclin D1-CDK4-dependent manner (Figure 2F and Figure supplement 3A). Compared to wild-type GTSE1, a triple mutant (S91A/S262A/S724A) displayed loss of slower-migrating bands upon co-expression of cyclin D1-CDK4, suggesting diminished phosphorylation. Nevertheless, a residual slow-migrating band persisted, prompting further mutations of the triple GTSE1 mutant in S331 and S454 (individually), which do not have a CDK-phosphorylation consensus, but were identified in several published phospho-proteomics studies. From these two quadruple mutants, only the that containing the S454A mutation demonstrated a complete abrogation of any shift in phos-tagTM gels (Figure 2F). These studies suggest that four major sites (S91, S262, S454, and S724) are phosphorylated (either directly and/or indirectly) in a cyclin D1-CDK4-dependent manner.

      … and mapping a degron in GTSE1 whose function may be blocked by cyclin D1-CDK4/6 kinase-dependent phosphorylation.

      We show that stabilization or overexpression of cyclin D1, which is often observed in human cancers, promotes GTSE1 phosphorylation on S91, S262, S454, and S724, resulting in GTSE1 stabilization.  Similarly, a phospho-mimicking mutant with the 4 serine residues replaced with an aspartate at positions 91, 261, 454, and 724 display increased half-life. While we appreciate the editor’s suggestion and agree on these being interesting questions, we would like to respectfully point out that mapping the GTSE1 degron and understanding how it is affected by cyclin D1-CDK4/6-dependent phosphorylation is outside the scope of the current project and will require an extensive set of experiments and tools. Accordingly, the three reviewers did not ask to map the GTSE1 degron.  We plan on addressing these interesting questions as part of a follow-up study.

      Reviewer #1 (public review):

      Summary:

      García-Vázquez et al. identify GTSE1 as a novel target of the cyclin D1-CDK4/6 kinases. The authors show that GTSE1 is phosphorylated at four distinct serine residues and that this phosphorylation stabilizes GTSE1 protein levels to promote proliferation.

      Strengths:

      The authors support their findings with several previously published results, including databases. In addition, the authors perform a wide range of experiments to support their findings.

      Weaknesses:

      I feel that important controls and considerations in the context of the cell cycle are missing. Cyclin D1 overexpression, Palbociclib treatment and apparently also AMBRA1 depletion can lead to major changes in cell cycle distribution, which could strongly influence many of the observed effects on the cell cycle protein GTSE1. It is therefore important that the authors assess such changes and normalize their results accordingly.

      We have approached the question of GTSE1 phosphorylation to account for potential cell cycle effects from multiple angles: 

      (i) We conducted in vitro experiments with purified, recombinant proteins and shown that GTSE1 is phosphorylated by cyclin D1-CDK4 in a cell-free system (Figure 2A-C). These experiments provide direct evidence of GTSE1 phosphorylation by cyclin D1-CDK4 without the influence of any other cell cycle effectors. 

      (ii) We present data using synchronized AMBRA1 KO cells (new Figure 2G and Figure supplement 3B).  In agreement with what we had shown previously (Simoneschi et al., Nature 2021, PMC8875297), AMBRA1 KO cells progress faster in the cell cycle but they are still synchronized as shown, for example, by the mitotic phosphorylation of Histone H3, peaking at 32 hours after serum readdition like in parental cells. Under these conditions we observed that while phosphorylation of GTSE1 in parental cells is evident in the last two time points, AMBRA1 KO cells exhibited sustained phosphorylation of GTSE1 across all cell cycle phases.  This was evident enough when using Phos-tag gels as in the top panel of the old Figure 2G. We now re-run one the biological triplicates of the synchronized cells using higher concentration of Zn<sup>+2</sup>-Phos-tag reagent and lower voltage to allow better separation of the phosphorylated bands.  Under these conditions, GTSE1 phosphorylation is better appreciable (top panel of the new Figure 2G). This experiment provides evidence that high levels of cyclin D1 in AMBRA1 KO cells affect GTSE1 phosphorylation independently of the specific points in the cell cycle. 

      (iii) The relative short half-life of GTSE1 (<4 hours) makes its levels sensitive to acute treatments such as Palbociclib or acute AMBRA1 depletion. The effects of these treatments on GTSE1 levels are measurable within a time frame too short to significantly affect cell cycle progression. For example, we used cells with fusion of endogenous AMBRA1 to a mini-Auxin Inducible Degron (mAID) at the N-terminus. This system allows for rapid and inducible degradation of AMBRA1 upon addition of auxin, thereby minimizing compensatory cellular rewiring. Again, we observed an increase in GTSE1 levels upon acute ablation of AMBRA1 (i.e., in 8 hours) (Figure 3B), when no significant effects on cell cycle distribution are observed (please see Simoneschi et al., Nature 2021, PMC8875297 and Rona et al., Mol. Cell 2024, PMC10997477).

      Altogether, the above lines of evidence support our conclusion that GTSE1 is a target of cyclin D1-CDK4, independent of cell cycle effects.

      In conclusion, we do not claim that GTSE1 is phosphorylated by cyclin D1-CDK4 in the G1 phase of the cell cycle under normal physiologic conditions.  Indeed, we agree with the existing literature indicating that in cells that do not express high levels of cyclin D1, GTSE1 is expressed predominantly during S and G2 phase (hence the name GTSE1, which stands for G-Two and S phases expressed protein 1) and is phosphorylated by mitotic cyclins in early mitosis.  Even during G1, when the levels of cyclin D1 peak, GTSE1 is not phosphorylated in normal cells. This could be due to either a higher affinity between GTSE1 and mitotic cyclins as compared to D-type cyclins or to a higher concentration of mitotic cyclins compared to D-type cyclins.  In the current manuscript, we show that higher levels of cyclin D1 can drive the sustained phosphorylation of GTSE1 across all cell cycle points. To reach this conclusion, we do not rely only on the overexpression of exogenous cyclin D1. In fact, we observe similar effect when we deplete endogenous AMBRA1, resulting in the stabilization of endogenous cyclin D1 in all cell cycle phases (see Figure 2G and Figure supplement 3B).  As we had already mentioned in the Discussion section of the original submission, we propose that GTSE1 is phosphorylated by CDK4 and CDK6 particularly in pathological states, such as cancers displaying overexpression of D-type cyclins (i.e., it is possible that the overexpression overcomes the lower affinity of the cyclin D1-GTSE1 complex). In turn, phosphorylation of GTSE1 induces its stabilization, leading to increased levels that, as expected based on the existing literature, contribute to enhanced cell proliferation.  In sum, our study suggests that overexpression of cyclin D1, which is often observed in cancers cells beyond the G1 phase, induces phosphorylation of GTSE1 at all points in the cell cycle.    

      Reviewer #2 (public review):

      Summary:

      The manuscript by García-Vázquez et al identifies the G2 and S phases expressed protein 1(GTSE1) as a substrate of the CycD-CDK4/6 complex. CycD-CDK4/6 is a key regulator of the G1/S cell cycle restriction point, which commits cells to enter a new cell cycle. This kinase is also an important therapeutic cancer target by approved drugs including Palbocyclib. Identification of substrates of CycD-CDK4/6 can therefore provide insights into cell cycle regulation and the mechanism of action of cancer therapeutics. A previous study identified GTSE1 as a target of CycB-Cdk1 but this appears to be the first study to address the phosphorylation of the protein by Cdk4/6.

      The authors identified GTSE1 by mining an existing proteomic dataset that is elevated in AMBRA1 knockout cells. The AMBRA1 complex normally targets D cyclins for degradation. From this list, they then identified proteins that contain a CDK4/6 consensus phosphorylation site and were responsive to treatment with Palbocyclib.

      The authors show CycD-CDK4/6 overexpression induces a shift in GTSE1 on phostag gels that can be reversed by Palbocyclib. In vitro kinase assays also showed phosphorylation by CDK4. The phosphorylation sites were then identified by mutagenizing the predicted sites and phostag got to see which eliminated the shift.

      The authors go on to show that phosphorylation of GTSE1 affects the steady state level of the protein. Moreover, they show that expression and phosphorylation of GTSE1 confer a growth advantage on tumor cells and correlate with poor prognosis in patients.

      Strengths:

      The biochemical and mutagenesis evidence presented convincingly show that the GTSE1 protein is indeed a target of the CycD-CDK4 kinase. The follow-up experiments begin to show that the phosphorylation state of the protein affects function and has an impact on patient outcomes.

      Weaknesses:

      It is not clear at which stage in the cell cycle GTSE1 is being phosphorylated and how this is affecting the cell cycle. Considering that the protein is also phosphorylated during mitosis by CycB-Cdk1, it is unclear which phosphorylation events may be regulating the protein.

      Please see point (ii) and the last paragraph in the response to Reviewer #1.  Moreover, we show that, compared to the amino acids phosphorylated by cyclin D1-CDK4, cyclin B1-CDK1 phosphorylates GTSE1 on either additional residues or different sites (Figure 2H). We also show that expression of a phospho-mimicking GTSE1 mutant leads to accelerated growth and an increase in the cell proliferative index (Figure 4B,C and new Figure supplement 4D-E).  Finally, we have evaluated also the cell cycle distributions by flow cytometry (new Figure supplement 4F). These analyses show that the expression of a phospho-mimicking GTSE1 mutant induces a decrease in the percentage of cells in G1 and an increase in the percentage of cells in S, similarly to what observed in AMBRA1 KO cells.

      Reviewer #3 (public review)

      Summary:

      This paper identifies GTSE1 as a potential substrate of cyclin D1-CDK4/6 and shows that GTSE1 correlates with cancer prognosis, probably through an effect on cell proliferation. The main problem is that the phosphorylation analysis relies on the over-expression of cyclin D1. It is unclear if the endogenous cyclin D1 is responsible for any phosphorylation of GTSE1 in vivo, and what, if anything, this moderate amount of GTSE1 phosphorylation does to drive proliferation.

      Strengths:

      There are few bonafide cyclin D1-Cdk4/6 substrates identified to be important in vivo so GTSE1 represents a potentially important finding for the field. Currently, the only cyclin D1 substrates involved in proliferation are the Rb family proteins.

      Weaknesses:

      The main weakness is that it is unclear if the endogenous cyclin D1 is responsible for phosphorylating GTSE1 in the G1 phase. For example, in Figure 2G there doesn't seem to be a higher band in the phos-tag gel in the early time points for the parental cells. This experiment could be redone with the addition of palbociclib to the parental to see if there is a reduction in GTSE1 phosphorylation and an increase in the amount in the G1 phase as predicted by the authors' model. The experiments involving palbociclib do not disentangle cell cycle effects. Adding Cdk4 inhibitors will progressively arrest more and more cells in the G1 phase and so there will be a reduction not just in Cdk4 activity but also in Cdk2 and Cdk1 activity. More experiments, like the serum starvation/release in Figure 2G, with synchronized populations of cells would be needed to disentangle the cell cycle effects of palbociclib treatment.   

      Please see last paragraph in the response to Reviewer #1.  Concerning the experiments involving palbociclib, we limited confounding effects on the cell cycle by treating cells with palbociclib for only 4-6 hours. Under these conditions, there is simply not enough time for S and G2 cells to arrest in G1.

      It is unclear if GTSE1 drives the G1/S transition. Presumably, this is part of the authors' model and should be tested.

      We are not claiming that GTSE1 drives the G1/S transition (please see last paragraph in the response to Reviewer #1). GTSE1 is known to promote cell proliferation, but how it performs this task is not well understood.  Our experiments indicate that, when overexpressed, cyclin D1 promotes GTSE1 phosphorylation and its consequent stabilization.  In agreement with the literature, we show that higher levels of GTSE1 promote cell proliferation.  To measure cell cycle distribution upon expressing various forms of GTSE1, we have now performed FACS analyses (new Figure supplement 4F). These analyses show that the expression of a phospho-mimicking GTSE1 mutant induces a decrease in the percentage of cells in G1 and an increase in the percentage of cells in S, similarly to what observed in AMBRA1 KO cells shown in the same panel and in Simoneschi et al. (Nature 2021, PMC8875297).

      The proliferation assays need to be more quantitative. Figure 4B should be plotted on a log scale so that the slope can be used to infer the proliferation rate of an exponentially increasing population of cells. Figure 4c should be done with more replicates and error analysis since the effects shown in the lower right-hand panel are modest.

      In Figure 4B, we plotted data in a linear scale as done in the past (Donato et al. Nature Cell Biol. 2017, PMC5376241) to better underline the changes in total cell number overtime.  The experiments in Figure 4B were performed in triplicate, statistical significance was determined using unpaired T-tests with p-values<0.05, and error bars represent the mean +/- SEM.  In Figure 4C, error analysis was not included for simplicity, given the complexity of the data.  We have now included the other two sets of experiments (new Figure supplement 4D,E).  While the effects shown in the lower right-hand panel of Figure 4C are modest, they demonstrate the same trend as those observed in the AMBRA KO cells (Figure 4C and Simoneschi et al., Nature 2021, PMC8875297). It's important to note that this effect is achieved through the stable expression of a single phospho-mimicking protein, whereas AMBRA KO cells exhibit changes in numerous cell cycle regulators. Moreover, these effects are obtained by growing cells in culture for only 5 days. A similar impact on cell growth in vivo over an extended period could pose significant risks in the long term.

      Recommendations for the authors:

      Reviewer #1 (Recommendations for the authors):

      Figure 1E is referenced before 1D. The authors should consider switching D and E.

      Done.

      Figure 1D-E: The authors correctly note in the introduction that GTSE1 is encoded by a cell cycle-dependently expressed gene. Given that cell cycle genes are often associated with poor prognosis (e.g., see Whitfield et al., 2006 Nat. Rev. Cancer), this would be expected to correlate with poor prognosis. This should be mentioned in the results section.

      We agree that the overexpression of certain (but not all) cell cycle-regulated genes are prognostically unfavorable across various cancer types, and we cited Whitfield et al., 2006 Nat. Rev. Cancer.  However, our data indicate that phosphorylation of GTSE1 induces its stabilization and, consequently, its levels do not oscillate during the cell cycle any longer (new Figure 2G and Figure supplement 3B).  Moreover, analyzing data from the Clinical Proteomic Tumor Analysis Consortium, we observed an enrichment of GTSE1 phospho-peptides (normalized to total protein) within a pan-cancer cohort as opposed to adjacent, corresponding normal tissues (Figure 2I).

      Figure 2F: Contrast is too high. Blot images should not contain fully saturated black or white.

      We corrected the contrast.

      Figure 2G and Figure Supplement 3B: It looks like AMBRA1 KO cells do not synchronize properly in response to serum withdrawal. The cell cycle distribution should be checked by FACS. Otherwise, it is unclear whether changes in GTSE1 (phosphor) levels are only due to indirect changes in the cell cycle distribution.

      Synchronization of both parental and AMBRA1 KO cells is demonstrated by the fact that the phosphorylation of Histone H3 peaks at 32 hours after serum readdition in both cases (Figure supplement 3B). 

      Figure 2I: It is important that phosphor-GTSE1 levels are normalized to total GTSE1 levels to understand the distinct contribution of changes in GTSE1 levels and from CCND1-CDK4 driven phosphorylation.

      Done.

      Figure 3A-B: These experiments should also be controlled for cell cycle distribution. Is this effect specific to GTSE1 and other AMBRA1 targets or are other G2/M cell cycle proteins also affected?

      The relative short half-life of GTSE1 (<4 hours) makes its levels sensitive to acute treatments such as Palbociclib or acute AMBRA1 depletion. The effects of these treatments on GTSE1 levels are measurable within a time frame too short to significantly affect cell cycle progression. For example, we used cells with fusion of endogenous AMBRA1 to a mini-Auxin Inducible Degron (mAID) at the N-terminus. This system allows for rapid and inducible degradation of AMBRA1 upon addition of auxin, thereby minimizing compensatory cellular rewiring. Again, we observed an increase in GTSE1 levels upon acute ablation of AMBRA1 (i.e., in 8 hours) (Figure 3B), when no significant effects on cell cycle distribution are observed (please see Simoneschi et al., Nature 2021, PMC8875297 and Rona et al., Mol. Cell 2024, PMC10997477).

      Figure 4: It should be noted that the correlation with cell proliferation and cell cycle protein expression is expected for any cell cycle protein, including GTSE1.

      Actually, the main point of Figure 4 is to show that expression of the phospho-mimicking mutant of GTSE1 promotes cell proliferation. Comparative analysis revealed that cells overexpressing either wild-type GTSE1 or its phospho-deficient form exhibited significantly reduced proliferation rates compared to those expressing the phospho-mimicking mutant (Figure 4B,C). 

      The two-decades-old references 33 and 34 are not well suited to support the notion for Cyclin D1 that "the full spectrum of substrates and their impact on cellular function and oncogenesis remain poorly explored." More recent references should be used to show that this is still the case.

      We added more recent references.

      The authors conclude that their "data indicate that cyclin D1-CDK4 is responsible for the phosphorylation of GTSE1 on four residues (S91, S262, S454, and S724)." However, the authors' data do not exclude a role for their siblings cyclin D2, cyclin D3, and CDK6. Reflecting this, the conclusions should be toned down.

      The analysis of the sites phosphorylated in GTSE1 was performed by experimentally co-expressing cyclin D1-CDK4 (Figure 2F, Figure 2H, and Figure supplement 3A), hence our statement.  Yet, we agree that in cells, cyclin D2, cyclin D3, and CDK6 can contribute to GTSE1 phosphorylation. 

      The authors claim that they "observed that in human cells, when D-type cyclins are stabilized in the absence of AMBRA1, GTSE1 becomes phosphorylated also in G1." However, the G1-specific data presented by the authors are not controlled for, and it is unclear whether these phosphorylation events actually occur in G1 cells.

      We now provide a WB in which GTSE1 phosphorylation is more evident (top panel of the new Figure 2G) (please see point (ii) in the response to the public review of Reviewer #1).  This experiment clearly shows that in AMBRA1 KO cells, GTSE1 is phosphorylated at all points in the cell cycle. Synchronization of both parental and AMBRA1 KO cells is demonstrated by the fact that phosphorylation of Histone H3 peaks at 32 hours after serum re-addition in both cases (Figure supplement 3B). 

      Reviewer #2 (Recommendations for the authors):

      (1) It is not clear from the presented data at which point in the cell cycle that phosphorylation of GTSE1 may be affecting the steady state level of the protein. The implication that GTSE1 is a target of CycD-CDK4 would suggest that the protein is stabilized at G1/S. Can this effect be observed?

      Please see the last paragraph in the response to the public review of Reviewer #1.

      (2) Considering the previous study showing that GTSE1 is also phosphorylated during mitosis by CycB-Cdk1, do levels of GTSE1 protein change during the cell cycle? Do changes in GTSE1 levels correlate with phosphorylation during the cell cycle? Cell synchronization experiments such as double thymidine and subsequent phostag analysis could shed some light on these questions.

      Please see the last paragraph in the response to the public review of Reviewer #1.

      (3) The authors show that the phosphomimetic mutants of GTSE1 confer a growth advantage on cells. The mechanism of this growth advantage is unclear. Is this effect due to a shorter cell cycle, enhanced survival, or another mechanism?

      We did not observe increased cell survival when the phosphomimetic mutants of GTSE1 is expressed.  We show that phosphorylation of GTSE1 induces its stabilization, leading to increased levels that, as expected based on the existing literature, contribute to enhanced cell proliferation.  So, the role of the cyclin D1-CDK4/6 kinase-dependent phosphorylation of GTSE1 is to stabilize GTSE1. 

      (4) Other minor points - all of the presented immunoblots do not show molecular weight markers. The IF images require scale bars.

      To prevent overcrowding of the Figures, the sizes of blotted proteins are indicated in the uncropped scans of each blot. Uncropped scans have been deposited in Mendeley at:  https://data.mendeley.com/datasets/xzkw7hrwjr/1. Scale bars have been added to the IF images.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public review):

      Gray and colleagues describe the identification of Integrator complex subunit 12 (INTS12) as a contributor to HIV latency in two different cell lines and in cells isolated from the blood of people living with HIV. The authors employed a high-throughput CRISPR screening strategy to knock down genes and assess their relevance in maintaining HIV latency. They had used a similar approach in two previous studies, finding genes required for latency reactivation or genes preventing it and whose knockdown could enhance the latency-reactivating effect of the NFκB activator AZD5582. This work builds on the latter approach by testing the ability of gene knockdowns to complement the latency-reactivating effects of AZD5582 in combination with the BET inhibitor I-BET151. This drug combination was selected because it has been previously shown to display synergistic effects on latency reactivation.

      The finding that INTS12 may play a role in HIV latency is novel, and the effect of its knockdown in inducing HIV transcription in primary cells, albeit in only a subset of donors, is intriguing. However, there are some data and clarifications that would be important to include to complement the information provided in the current version of the manuscript.

      We have now added the requested data and clarifications. In particular, we show that knockout of INTS12 has no effect on cell proliferation (new data added in Figure 2—figure supplement 3)), we clarify how the degree of knockout and the complementation were accomplished, we clarify the differences between the RNA-seq and the activation scores, and we have bolstered the claim that INTS12 affected transcription elongation by performing CUT&Tag on Ser2 phosphorylation of the C-terminal tail of RNAPII along the length of the provirus (new data added in Figure 5C) Please see detailed responses below.

      Reviewer #2 (Public review):

      Summary:

      Identifying an important role for the Integrator complex in repressing HIV transcription and suggesting that by targeting subunits of this complex specifically, INTS12, reversal of latency with and without latency reversal agents can be enhanced.

      Strengths:

      The strengths of the paper include the general strategy for screening targets that may activate HIV latency and the rigor of exploring the mechanism of INTS12 repression of HIV transcriptional elongation. I found the mechanism of INTS12 interesting and maybe even the most impactful part of the findings.

      Weaknesses:

      I have two minor comments:

      There was an opportunity to examine a larger panel of latency reversal agents that reactivate by different mechanisms to determine whether INTS12 and transcriptional elongation are limiting for a broad spectrum of latency reversal agents.

      I felt the authors could have extended their discussion of how exquisitely sensitive HIV transcription is to pausing and transcriptional elongation and the insights this provides about general HIV transcriptional regulation.

      We have now added data on latency reversal agents of different mechanisms of action. We show that INTS12 affects HIV latency reversal from agents that affect the non-canonical NF-kB pathway (AZD5582), the canonical NF-kB pathway (TNF-alpha), activation via the T-cell receptor (CD3/CD28 antibodies), through bromodomain inhibition (I-BET151), and through a histone deacetylase inhibitor (SAHA). This additional data has been added to the manuscript in Figure 7, panels B and C as well as adding text to the discussion.

      We appreciate the suggestion to extend the discussion to emphasize how important pausing and elongation are to HIV transcription. Additionally, to further support our claim that INTS12KO with AZD5582 & I-BET151 leads to an increase in elongation, that we previously showed with CUT&Tag data showing an increase in total RNAPII seen in within HIV (Figure 5B), we measured RNAPII Ser2 phosphorylation (Figure 5C) and RNAPII Ser5 phosphorylation (Figure 5—figure supplement 2) and added these findings to the manuscript. Upon measuring Ser2 phosphorylation, a marker associated with elongation, we observed evidence of elongation-competent RNAPII in our AZD5582 & I-BET151 condition as well as our INTS12 KO with AZD5582 & I-BET151 condition, as we saw an increase of Ser2 phosphorylation within HIV. Despite seeing elongation-competent RNAPII in both conditions, we only saw a dramatic increase in total RNAPII for our INTS12 KO and AZD5582 & I-BET151 condition (Figure 5B), which supports that there are more elongation events and that an elongation block is overcome specifically with INTS12 KO paired with AZD5582 & I-BET151. This claim is further supported by our data showing an increase in virus in the supernatant only with the INTS12 KO with AZD5582 & I-BET151 condition in cells from PLWH (Figure 6C). We did not observe any statistically significant differences between RNAPII Ser5 phosphorylation, which might be expected as this mark is not associated with elongation (Figure 5—figure supplement 2).

      Reviewer #3 (Public review):

      Summary:

      Transcriptionally silent HIV-1 genomes integrated into the host`s genome represent the main obstacle to an HIV-1 cure. Therefore, agents aimed at promoting HIV transcription, the so-called latency reactivating agents (LRAs) might represent useful tools to render these hidden proviruses visible to the immune system. The authors successfully identified, through multiple techniques, INTS12, a component of the Integrator complex involved in 3' processing of small nuclear RNAs U1 and U2, as a factor promoting HIV-1 latency and hindering elongation of the HIV RNA transcripts. This factor synergizes with a previously identified combination of LRAs, one of which, AZD5582, has been validated in the macaque model for HIV persistence during therapy (https://pubmed.ncbi.nlm.nih.gov/37783968/). The other compound, I-BET151, is known to synergize with AZD5582, and is a inhibitor of BET, factors counteracting the elongation of RNA transcripts.

      Strengths:

      The findings were confirmed through multiple screens and multiple techniques. The authors successfully mapped the identified HIV silencing factor at the HIV promoter.

      Weaknesses:

      (1) Initial bias:

      In the choice of the genes comprised in the library, the authors readdress their previous paper (Hsieh et al.) where it is stated: "To specifically investigate host epigenetic regulators involved in the maintenance of HIV-1 latency, we generated a custom human epigenome specific sgRNA CRISPR library (HuEpi). This library contains sgRNAs targeting epigenome factors such as histones, histone binders (e.g., histone readers and chaperones), histone modifiers (e.g., histone writers and erasers), and general chromatin associated factors (e.g., RNA and DNA modifiers) (Fig 1B and 1C)".

      From these figure panels, it clearly appears that the genes chosen are all belonging to the indicated pathways. While I have nothing to object to on the pertinence to HIV latency of the pathways selected, the authors should spend some words on the criteria followed to select these pathways. Other pathways involving epigenetic modifications and containing genes not represented in the indicated pathways may have been left apart.

      (2) Dereplication:

      From Figure 1 it appears that INTS12 alone reactivates HIV -1 from latency alone without any drug intervention as shown by the MACGeCk score of DMSO-alone controls. If INTS12 knockdown alone shows antilatency effects, why, then were they unable to identify it in their previous article (Hsieh et al., 2023)? The authors should include some words on the comparison of the results using DMSO alone with those of the previous screen that they conducted.

      (3) Translational potential:

      In order to propose a protein as a drug target, it is necessary to adhere to the "primum non nocere" principle in medicine. It is therefore fundamental to show the effects of INTS12 knockdown on cell viability/proliferation (and, advisably, T-cell activation). These data are not reported in the manuscript in its current form, and the authors are strongly encouraged to provide them.

      Finally, as many readers may not be very familiar with the general principles behind CRISPR Cas9 screening techniques, I suggest addressing them in this excellent review: https://pmc.ncbi.nlm.nih.gov/articles/PMC7479249/.

      (1) The CRISPR library used was more completely described in a previous publication (Hsieh et al, PLOS Pathogens, 2023). However, we now more explicitly refer the reader to information about the pathways targeted in the library. We also point out how initial hits in the library lead to finding genes outside of the starting library as in the follow-up screen in Figure 7 where each of the members of the INT complex are interrogated even though only INTS12 was the only member in the initial library.

      (2) We understand the confusion between the hits in this paper and a previous publication. Indeed, INTS12 was observed in Hsieh et al., PLOS Pathogens, 2023 as a hit in the Venn diagram of Figure 3B of that paper, and in Figure 5A, right panel of that paper. However, it was not followed up on in the previous paper since that paper focused on a hit that was unique to increasing the potency of one particular LRA. We added text to the present manuscript to make it clear that the screens identified many of the same hits. We have also added additional data here on hit validation to underscore the reliability of the CRISPR screen. In one of the cell lines (5A8), EZH2 was a strong hit (Figure 1B). We have now added data that shows that an inhibitor to EZH2 augments the latency reversal of AZD5582/I-BET151 as predicted from the screen. This data has been added to Figure 1, figure supplement 1.

      (3) We appreciate the concern that for INTS12 to be a drug target, it should not be essential to cell viability. We now show that knockout of INTS12 has no effect on cell proliferation (new data added in Figure 2—figure supplement 3). In addition, the discussion now adds additional literature references that describe how knockout of INTS12 has relatively minor effects on cell functions in comparison to knockout of other INT members which supports that the proposal that modulation of INTS12 may be more specific than targeting the catalytic modules of Integrator. Nonetheless, we completely agree with the reviewer that many other aspects of how INTS12 affects T cell functions have not been addressed as well as other potential detrimental effect of INTS12 as a drug target in vivo. We now more explicitly describe these caveats in the discussion but feel that the present manuscript is a first step with a long path ahead before the translational potential might be realized.

      (4) We now cite the review of CRISPR screens suggested by the reviewer.

      Responses to recommendations for the authors:

      Reviewer #1 (Recommendations for the authors):

      (1) The authors report in the legend of Figure 2 (and similarly in other figures) that there was "a calculated INTS12 knockout score of 76% (for the one guide used) and 69% (for one of three guides used), respectively." However, it would be helpful to show representative data on the efficiency of INTS12 knockdown in cell lines and primary cells, as well as data on the efficiency of the complementation (Figure 2C).

      The knockout scores cited are the genetic assays for the efficiency based on sequence files. As the knockouts are done with multiple guides the knockout for each guide is an underestimate of the total knockout. The complementation, however, was done by adding back INTS12 in a lentiviral vector that also contains a drug resistance marker (puromycin). Cells were then selected for puromycin resistance, and therefore, all of them contain the complemented gene. What one would ideally like is a Western blot to quantify the amount of INTS12 remaining in the knockout pools. Unfortunately, despite obtaining multiple different commercial sources of INTS12 antibodies, we were unable to identify one that was suitable for Western blotting (as opposed to two that did work for CUT&Tag). Nonetheless, the functional data in primary T cells from PLWH and in J-Lat cells lines does show the even if the knockout is suboptimal, we find activation after INTS12 knockout (e.g., Figure 6).

      (2) Flow cytometry methods are not reported, but was a viability dye included when testing GFP reactivation (Figure S2)? More broadly, showing data on the viability of cells post-knockdown and drug treatments would help, as cell mortality is inherently associated with latency reactivation in J-Lat cells. For the same reason, reporting viability data would be important for primary cells, as the electroporation procedure can lead to significant mortality.

      We did not include viability dyes in the data for GFP activation. However, as described in the public response, we have done growth curves in J-Lat 10.6 cells with and without INTS12 knockout and find no effects on cell proliferation (Figure 2—figure supplement 3). As the reviewer points out, it is not possible to do these experiments in primary cells since the electroporation itself causes a degree of cell death. Nonetheless, we do see effects on HIV activation in these primary cells (Figure 6).

      (3) Figure S2 shows a relatively high baseline expression (approximately 15%) of HIV-GFP, which is not unusual for the J-Lat 10.6 clone. However, Figure 3 appears to show no HIV RNA reads in the control condition of this same cell clone. How do the authors reconcile this discrepancy?

      We believe that the discrepancies in the flow cytometry versus RNA-seq assays are due to differences in the sensitivity of the assays, the linear range of the assays especially at the lower end, and the different half-lives of RNA versus protein. We now clarify that Figure 3 does not show “no” HIV RNA at baseline, but rather values of ~30 copies per million read counts. This increases to ~800 copies per million read counts when INTS12 knockout cells are treated with AZD5582/I-BET151. These values have the same fold change predicted in Figure 4, and more closely resemble the trend in Figure 2—figure supplement 1.

      (4) The combination of AZD5582 and I-BET151 consistently reactivates HIV latency (including GFP protein expression), as previously reported and as shown here by the authors. However, in Figure 5B, RPB3/RNAPII occupancy in the DMSO control appears higher than in the AAVS1KO + AZD5582 and I-BET151 samples. This should be discussed, as it could raise concerns about the robustness of RPB3/RNAPII occupancy results as a proxy for provirus elongation.

      As addressed in the public comments, in order to strengthen our claims about transcriptional elongation control, we measured RNAPII Ser2 and Ser5 phosphorylation levels. We see evidence of elongation with Ser2 in the condition of concern (AAVS1 KO + AZD5582 & I-BET151) as well as our main condition of interest (INTS12 KO + AZD5582 & I-BET151) and no change in Ser5 for any condition. With both the Ser2 phosphorylation and total RNAPII as well as our virus release and transcription data we believe that we are seeing evidence of increased elongation with INTS12 KO with AZD5582 & I-BET151. One potential nuance that may not be gathered from the CUT&Tag data is the turnover rate of the polymerase. Despite the levels of RNAPII appearing lower in the condition of concern (AAVS1 KO + AZD5582 & I-BET151) compared to DMSO it is possible that low levels of elongation are occurring but that in our INTS12 KO + AZD5582 & I-BET151 condition there is more rapid elongation and this is why we can observe more RNAPII within HIV. This new data is added in Figure 5C and Figure 5—supplement 2 and its implications are now described in more detail in the discussion.

      (5) The authors write that "Degree of reactivation was correlated with reservoir size as donors PH504 (star symbol) and PH543 (upside down triangle) have the largest HIV reservoirs (supplemental Figure S2)." I could not find mention of the reservoir size of these donors in the figure provided.

      This confusion was caused by mislabeling of the supplement number, which we fixed, and we added additional labeling to make finding the reservoir size even more clear as this is an important part of the manuscript. This is now found in Supplemental file S4.

      Reviewer #3 (Recommendations for the authors):

      (1) The MAGeCK gene score is a feature that is essential for the interpretation of the results in Figure 1. The authors do quote the Li et al. paper where this score was described for the first time (https://genomebiology.biomedcentral.com/articles/10.1186/s13059-014-0554-4), however, they may understand that not all readers may be familiar with this score. Therefore a didactic short description of this score should be done when introducing the results in Figure 1.

      We have added a short description to the paper to address this.

      (2) Figure 4. The authors write: "Among the host genes most prominently affected by INTS12 knockout with AZD5582 & I-BET151 are MAFA, MAFB, and ID2 (full list of genes in supplemental file S3)." I am a bit confused. In the linked Excel file there is only a list of a few genes. The differentially expressed genes appear to be many more from Figure 4. The full list should be uploaded.

      We believe there was a mistake in our original uploading and naming of the supplements. We have now double-checked numbering on the supplements and added in text clarification of which excel tabs hold the desired information.

      (3) Figure 6: The authors are right in highlighting that there is a high level of variability in viral RNA in supernatants in the early stages of viral reactivation. It is therefore advisable to repeat measurements at Day 7, at which variability decreases and data are more reliable (please, see: https://www.thelancet.com/journals/ebiom/article/PIIS2352-3964(23)00443-7/fulltext).

      While it would have been nice to prolong these measurements, our current assay conditions are not optimal for longer term growth of the cells. We note that the measurements were all done in biological triplicates (independent knockouts) and in different individuals. Because the number of activatable latent proviruses is variable and the number of cells tested is limiting, the variability in the assays is expected.

      (4) Figure 7: The main genes outside the INTS family should be identified, also.

      We include the full list in supplemental file S5 and sort by most enriched.

      (5) Methods: A statistical paragraph should be added in the Methods section, detailing the data analysis procedures and the key parameters utilized (for example, which is the MAGeCK gene score threshold that they used to consider knockdown efficacy on HIV latency?).

      There is no MAGeCK score threshold that we use to determine efficacy on HIV latency. In a previous publication using CRISPR screens for HIV Dependency Factors (Montoya et al, mBio 2023), we showed that there is a relationship between the MAGeCK and the effect of that gene knockout on HIV replication (Figure 5 that paper). However, it is a continuum rather than a strict threshold and we believe that the effects on HIV latency would respond similarly. In the current paper, we have focused on the top hits rather than a comprehensive analysis of all the entire list. In case the reviewer is referring to the average and standard deviation of the non-targeting controls, we have added this to the figure legend and methods.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      This study by Zimyanin et al. examines the role of the C. elegans chromokinesin KLP-19 in the formation and architecture of the anaphase central spindle in C. elegans zygotes. Through a combination of electron and light microscopy, along with RNAi-mediated perturbations, the authors propose that KLP-19 influences central spindle stiffness by regulating microtubule dynamics.

      In Figure 5, the effect of KLP-19 depletion on central spindle microtubules appears unconvincing. The FRAP results show no significant difference with or without KLP-19, and overall microtubule density does not consistently respond to its depletion. Additionally, the double klp-19; gpr-1/2 (RNAi) condition does not exhibit a strong increase in microtubule density, though a statistical test is missing for this condition. Furthermore, the spd-1; gpr-1/2 double depletion produces a similar increase in microtubule density to most klp-19 depletion conditions, suggesting that the effect cannot be solely attributed to the absence of KLP-19.

      Figure 5A shows that depletion of KLP-19 leads to an increase in tubulin signal in the spindle midzone. The reviewer is correct, that there are differences in the microtubule density between KLP-19 depletion alone and KLP-19 + GPR-1/2 depletion. While depletion of KLP-19 alone leads to a significant increase, co-depletion of GPR-1/2 and KLP-19 leads to a slight, but not significant increase. Along this line, we have added Supplementary Table 1 that contains all p-Values for the different conditions for Figure 5A. However, depletion of GPR-1/2 alone does not affect the microtubule density in the midzone, arguing that changes in pulling forces do not affect the microtubule density in the midzone. It is possible, that the double RNAi leads to a decrease in efficiency and thus a reduced effect on microtubule intensity. We will demonstrate the RNAi efficiency by western blot. Another possibility is that there are some feedback mechanisms that responds to presence/ absence of pulling forces and some of our data (not from this manuscript) hints in this direction, but we have not yet worked out the details of this. We are planning to publish this in a follow up publication.

      • *

      In response to the spd-1 + gpr-1/2 (RNAi), the reviewer is correct, that the microtubule density in the midzone is not significantly different from klp-19 (RNAi) conditions and we think it is interesting to note that spd-1 + gpr-1/2 (RNAi) leads to an increased microtubule density in the midzone. This could be, as above mentioned caused by some feedback mechanisms that responds to pulling forces, or also due to some functions of SPD-1 that affects microtubules in the midzone. Interestingly, our data also shows that metaphase spindles are significantly shorter in the absence of SPD-1 in comparison to spindles in control embryos, suggesting that SPD-1 plays a role in regulating microtubules or force transmission. We are currently working on understanding SPD-1's role in this process.

      • *

      We also agree that there is no significant effect on the microtubule turn-over as shown in Figure 5B and we have stated this in the text. Our data does show a trend to a decreased turn-over, but the difference is not significant. This could be due to the low sample number.

      • *

      Overall, we think our data, the light microscopy and even more so the EM data does show a clear effect on midzone microtubules.

      • *

      The use of hcp-6 depletion to argue that KLP-19 depletion affects central spindle elongation independently of stretched chromatin is problematic. hcp-6 encodes a component of the Condensin II complex in C. elegans, and its depletion leads to chromatin decompaction rather than the stretched, dense chromatin observed in the midzone during anaphase in klp-19 (RNAi) embryos. These conditions are not equivalent and do not effectively rule out the possibility that chromatin stretching contributes to the observed phenotype.

      We agree with the reviewer that the HCP-6 experiments do not entirely rule out effects from lagging chromosomes. Proving that the reduced spindle and chromosome separation is not due to lagging chromosomes is challenging. Most of the depletions that lead to lagging chromosomes are based on defective kinetochore microtubule connections, such as depletion of KNL-1, NDC-80 or CLS-2 (CLASP). In C. elegans, this leads to the mass of Chromosomes staying behind in anaphase and increased spindle pole separation, which is not comparable to KLP-19 depletion. Perturbations that do not affect kinetochore microtubules but still lead to lagging chromosomes are often targeting cohesin or condensin. Ultimately none of these conditions are directly comparable.

      A probably better way to test this would be to deplete KLP-19 only after metaphase to prevent its effect on chromosome alignment. However, this is currently not possible as the time window is about 1 minute or less. We currently do not have the tools to conduct this type of experiment. As other reviewers also criticized this experiment and its significance for the paper, we have removed this entirely and have added the following part to the discussion about the potential effect of lagging chromosomes:

      " *We can not unambiguously rule out that failure to properly align chromosomes and the resulting lagging chromosomal material could also lead to some of the observed effects on spindle dynamics, such as slow chromosome segregation and pole separation rates as well as preventing spindle rupture in absence of SPD-1. However, several observations argue in favor of KLP-19 actively changing the midzone cytoskeleton network and thus affecting spindle dynamics. *

      Most of the protein depletions in C. elegans that lead to lagging chromosomes are based on defective kinetochore microtubule connections, such as depletion of CeCENP-A, CeCENP-C, KNL-1 or NDC-80 (70-72). This mostly leads to the Chromosome mass staying behind in anaphase and increased spindle pole separation (70-72), which is not comparable to KLP-19 depletion. Perturbations that do not affect kinetochore microtubules but still lead to lagging chromosomes are often targeting cohesin or condensin, which depletion leads to chromatin decompaction (73-74) rather than the stretched, dense chromatin as observed in the midzone during anaphase in klp-19 (RNAi) embryos. Ultimately none of these conditions are directly comparable, making it difficult to completely rule out an effect of lagging chromosomes. A better way to test this would be to deplete KLP-19 only after metaphase to prevent its effect on chromosome alignment. However, this is currently not possible as the time window is about 1 minute or less and we do not have the tools to conduct this type of experiment.

      *Based on our results we hypothesize that the observed spindle dynamics in absence of KLP-19 are not only caused by lagging chromosomes. Instead, KLP-19 RNAi results in a global rearrangement of the spindle and leads to a significant reduction of the spindle size, microtubule overlap, growth rate, and stability. Furthermore, the increase of microtubule interactions after klp-19 (RNAi) could also contribute to lagging of chromosomes and exacerbation of fragmented extrachromosomal material." *

      Additionally, the authors report that KLP-19 influences astral microtubule dynamics (Figure 5E), yet in Figure 3E, they show that KLP-19 localizes exclusively to kinetochores and spindle microtubules, excluding astral microtubules and spindle poles. How do they reconcile this apparent contradiction?

      We think that KLP-19 localizes also to astral Microtubules. Our KLP-19 GFP CRISPR line is very dim and this makes it hard to see. We are proposing to use a TIRF approach to image KLP-19 GFP on the C. elegans cortex, which we will include in the revised version. In addition, in support of our hypothesis of KLP-19 binding to astral Microtubules as well we would like to note that there is a PhD thesis available from Jack Martin in Josana Rodriguez Sanchez's Lab in Newcastle (LINK, will lead to a download of the thesis! ) that has reported KLP-19s localization to cortical Microtubules in C. elegans. In this thesis the author also reports an effect on astral microtubule growth.

      Figure legends lack consistency and do not adhere to standard C. elegans nomenclature conventions (e.g., protein names should not be capitalized, and genetic perturbations should be italicized). Standardizing these elements would improve clarity and readability.

      We have checked our figure legend and to our best knowledge the legends adhere to the C. elegans nomenclature. All RNAi conditions are lower case italicized and Protein names are capitalized as it is standard in other C. elegans publications. We have however noticed some variation in our Figures, i.e. EB-2 instead of EBP-2 and have corrected this in all figures.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Zimyanin et al, Chromokinesin Klp-19 regulates microtubule overlap and dynamics during anaphase in C. elegans.

      The authors used a myriad of techniques, including confocal live-cell imaging, 2-photon microscopy, second harmonic generation imaging, FRAP, microfluidic-coupled TIRF, EM-tomography, to study spindle midzone assembly dynamics in C. elegans one-cell stage embryos. In particular, they illuminated the role of kinesin-4 KLP-19 in maintaining proper midzone length and organization. Inhibition of KLP-19 results in longer more stable midzones, implying KLP-19 functions in depolymerizing microtubules.

      Indeed, much of the results in the current study are consistent with previously published results elsewhere. Nevertheless, the current work represents a tour-de-force showcase of diverse and state-of-the-art technology application to address spindle assembly dynamics. How KLP-19 functions to define microtubule length at the midzone is still not known. But the current work, with diverse and solid data, serves to highlight where future work should focus.

      Minor comments:

      Fig 3E / There is an unusual diagonal line bisecting the embryo. Visually this does not affect viewing of the His::GFP and KLP-19::GFP signals. However, when these signals are quantified and normalized (as in Fig 3F), the diagonal bisect displaying different background signal may impact the measurements.

      We are very sorry about this line in the images. The line is due to a defect in the camera chip of the spinning disc. We will acquire new images for this Figure using our new spinning disc microscope.

      Fig 4B / While the kymographs clearly show KLP-19::GFP motility on microtubules, they also show that the majority of KLP(-::GFP do not move. Perhaps some quantification and discussion of this result is appropriate?

      The reviewer is correct that only a small fraction small fraction of molecules, maybe ~10%, moves. We will add this quantification to the paper and discussion. This could be due to several reasons: Many of the non-moving particles are not visibly colocalized with microtubules, which could mean they are sticking non-specifically to the surface (or sticking to small tubulin aggregates that aren't long enough to support movement). In addition, as this experiment is done in a lysate it is hard to interpret if the immobile KLP-19 is not moving because other proteins are bound along the microtubule blocking its way or if the KLP-19 requires some activation (i.e. phosphorylations) to become mobiles. We think this could be very interesting and will follow up on this in the future.

      • *

      Reviewer #2 (Significance (Required)):

      Indeed, much of the results in the current study are consistent with previously published results elsewhere. Nevertheless, the current work represents a tour-de-force showcase of diverse and state-of-the-art technology application to address spindle assembly dynamics. How KLP-19 functions to define microtubule length at the midzone is still not known. But the current work, with diverse and solid data, serves to highlight where future work should focus.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary:

      The anaphase spindle midzone is an essential structure for cell division. It consists of antiparallel overlapping microtubules organized by the antiparallel microtubule bundler PRC1, molecular motors and other regulatory proteins. This manuscript investigates the role of KLP-19 (C. elegans ortholog of human kinesin-4 KIF4A) and SPD-1 (C. elegans ortholog of PRC1) for spindle midzone organization in the C. elegans embryo and its relevance for proper spindle function. Advanced fluorescence microscopy, 3D electron tomography, and a fluorescence microscopy-based single molecule assay in embryo lysate are used in a unique combination. The authors confirm several aspects of PRC1 and KIF4A function in anaphase, as reported in previous work, mostly in human cells and Drosophila embryos and also in C. elegans embryos. Measurements are mostly very quantitative and to a high quality standard. The main difference to previous conclusions is that here, the authors propose that KLP-19 does not interact with SPD-1, in contrast to what has been established for other animal kinesin-4s and PRC1, and instead localizes to the spindle midzone independently of PRC1 by a mechanism that remains unknown. The authors provide evidence that KLP-19 nevertheless controls microtubule overlap length as in other species and that it produces outward forces sliding midzone microtubules apart a movement that SPD-1 counteracts (presumably by friction). The manuscript presents a rich resource of carefully measured quantitative structural and dynamic C. elegans anaphase spindle data.

      Major comments:

      Key conclusions convincing?

      (1) The key conclusions that the length of the central anaphase spindle microtubule overlap remains constant as the C.elegans spindle elongates (Fig. 1), that PRC1 indeed localizes quite precisely to these overlaps as previously assumed based on its in vitro (purified protein) behavior (Fig. 3B) and that the kinesin-4 KLP-19 controls overlap length as in other species (Fig. 3B) are all convincingly shown. What's missing are quantitative KLP-19 together with microtubule polarity profiles in the presence and absence of SPD-1, leaving it unclear to which extent this kinesin localizes to microtubule overlaps in the two situations. Such data seem crucial, given the authors' claim that KLP-19 localizes to the midzone and that this localization of KLP-19 is mostly unaffected by the absence of SPD-1.

      If we understand this correctly the reviewer is asking for second harmonic imaging (SHG) together with imaging of KLP-19 GFP. This is currently not possible due to the way this imaging must be done (2-photon of GFP-Tubulin followed by the SHG). The only thing we can do is provide KLP-19 GFP profiles for control and SPD-1 depleted embryos. We can also use the line co-expressing SPD-1 Halo-tag and KLP-19 GFP to plot their respective localizations in control conditions. We are happy to provide such plots. Generally, we see KLP-19 going to the midzone in absence of SPD-1 and the SHG data does show that the overlap is increased. If KLP-19 specifically localizes to microtubule overlap (rather to i.e. microtubule ends) can currently not be distinguished in the spindle midzone. In vitro data from other labs and our in vitro assay suggests that KLP-19 does not specifically bind to antiparallel overlaps but rather microtubules in general.

      (2) 'Normalized KLP-19 intensities' are used to demonstrate that the total amount of this kinesin localizing to the spindle midzone does not depend on the presence of SPD-1 (Fig. 3F). Given that this claim represents a major novelty of the study, the efficiency of the SPD-1 knock-down should be documented, ideally by western blot and fluorescence microscopy.

      We agree with the reviewer and will provide western blots.

      (3) The authors show convincingly that the kinesin KLP-19 contributes to outward microtubule sliding (and can contribute to spindle rupture in the absence of SPD-1) (Fig. 2), which is interesting and in line with the author's main claim.

      (4) The interaction between KIF4a and PRC1 is well established in other species and has been clearly demonstrated both in cells and in vitro (with purified proteins). The authors claim that this concept does not apply to the C. elegans orthologs. To show 'in vitro' (outside of the spindle) that the C. elegans homologs KLP-19 and SPD-1 do not interact, the authors use a novel microfluidic fluorescence-based single-molecule assay in lysate (Fig. 4). Although very original, these experiments do not reach the biochemical standard of previous experiments with purified proteins without appropriate controls. Given that the lysate setup is fairly novel, it's advisable to present at least one positive control demonstrating that interactions between soluble proteins can indeed be detected using this assay. It would also be useful to show the absence of interaction between KLP-19 and SPD-1 by a more conventional method like co-IP, again with a positive control, to support the authors' claim. Eventually, experiments with purified proteins will have to unequivocally demonstrate whether KLP-19 and SPD-1 indeed do not interact - something which appears, however, to be beyond the scope of this study. Without additional experimental proof, the authors may want to indicate that these results are of more preliminary nature.

      *We agree with the reviewer, and we will conduct co-IPs of SPD-1 and KLP-19. We will also add CYK-4 as a positive control as previous publications have shown the interaction of CYK-4 with SPD-1. We are now generating lines co-expressing CYK-4 GFP and SPD-1 Halo-tag for the co-IP experiments. *

      (5) Unfortunately, the authors do not propose an alternative mechanism for KLP-19 localization to the midzone in SPD-1 depleted embryos, limiting the conceptual advance. Does KLP-19 bind directly to antiparallel microtubules, for example in the assay presented in Fig. 4 (where signs of microtubule crosslinking are shown for SPD-1)? If not, how would it accumulate in the midzone (if it does) in the C. elegans embryo anaphase spindle? The authors do also not propose a mechanism explaining why central antiparallel microtubule overlap length does not change as the spindle elongates in anaphase. Moreover, there is no discussion regarding the potential mechanism leading to KLP-19 controlling microtubule dynamics globally instead of locally where the motor accumulates, indicating limitations in mechanistic insight.

      *We agree with the reviewer and will add these points to the discussion. *

      *To address some of the points: *

      *How does KLP-19 end up in the midzone? : Our data shows that localization of KLP-19 does depend on AIR-2 and BUB-1 as previously reported. However, those proteins primarily affect the formation of the midzone. The in vitro assay does not suggest that KLP-19 has a preference for overlaps, unlike SPD-1, but rather binds microtubules in general. One possible mechanism of midzone localization could be microtubule end-tagging, as has been suggested for PRC1 (SPD-1 homolog). This could lead to an accumulation of KLP-19 in the midzone. *

      Why does the central overlap stay constant? : This can be explained by constant microtubule growth at the plus-ends why maintaining the overlap length. Alternatively, this could be explained by some (sophisticated) rearrangements of microtubules that ensure the overlap length stays the same. Generally, this is a very interesting question, as each of this scenario still requires that the overlap length is tightly regulated. Our data suggests that this is correlated with microtubule length in the midzone, as KLP-19 depletion leads to longer microtubules and overlap. This suggests that the regulation of microtubule dynamics might be an important factor in this process. We will add this to the discussion.

      • *

      Potential mechanism leading to KLP-19 controlling microtubule dynamics globally: We think that KLP-19 localizes to spindle and astral microtubules and regulates the dynamics on all of those, leading to a global regulation. By increasing it's concentration locally, microtubule dynamics can be regulated in the midzone. We will add data showing the localization of KLP-19 to astral microtubules.

      Claims justified/preliminary and clearly presented?

      The observation that the spindle length remains constant throughout anaphase in C. elegans is based on elegant, but unconventional fluorescence microscopy data (Fig. 1A & B). It would be helpful to add images of SHG and two-photon microscopy to help the reader understand the graphs. Measurements are presented based on distances between the poles. It is unclear why the distances between 15-20 µm were chosen and how they translate to anaphase progression. Can measurements be carried out across the entire duration of cell division to demonstrate that the overlap's 'constant length' property is unique to anaphase? (This could demonstrate already in Fig. 1 that the method in principle is capable of measuring different overlap lengths.)

      We agree with the reviewer and have moved the SHG images from supplementary Fig. 6 to the main Figure 1A for better visibility. In addition, we have added a plot as an inset in (now) Figure 1B and C explanation of how the used spindle pole distances related to the progression through anaphase. Unfortunately, we can only acquire a single timepoint and not a live movie during the SHG.

      Even though the manuscript contains an impressive amount of data, it appears to be lengthy, the motivation for several experiments is not clearly described, and the order of data presentation can probably be improved. For example, it is unclear why SPD-1 profiles are presented late and why KLP-19 profiles are missing - one would expect to see them early on as an essential characterization of the system under study. The motivation of the paragraph investigating the relation of KLP-19 and SPD-1 to HCP-6 is especially unclear (more than 1 page of text describing supplementary material).

      We will go through our text again and will revise the order of presented experiments. As stated above, we have removed the HCP-6 data.

      The absence of interaction between KLP-19 and SPD-1 is not demonstrated to the same quality standard as the presence of interaction between the orthologs in the literature, which should at least be mentioned.

      Additional experiments essential to support the claims of the paper?

      KLP-19 profiles in the presence and absence of SPD-1 seem to be essential.

      We agree with the reviewer and will add this.

      A co-IP of KLP-19 and SPD-1 (including positive control) to prove that the proteins are not interacting would help to support the claim.

      We agree with the reviewer and will add this

      Data and methods presented so that they can be reproduced? Yes.

      Experiments adequately replicated and statistical analysis adequate? Yes.

      Minor comments:

      Generating cellular electron tomography data is very laborious. It is a pity that no raw data is provided; for example, a slice of a reconstructed tomogram or a video of whole volumes without segmentation would be an informative addition and allow assessment of the data quality.

      We agree with the reviewer and will add movies of the raw electron microscopy data.

      The clear evidence for direct interaction between PRC1 and kinesin-4 in other species should be correctly acknowledged throughout the text.

      We agree with the reviewer and have corrected this

      The average (mean or median?) values and STDs reported in the text do not appear to match those in Fig. 1D.

      *We thank the reviewer for pointing this out and have corrected the figure. The violin lot showed the mean and percentiles, we have now changed the plot to show mean and STD. *

      • *

      The kymograph of spd-1 RNAi in Fig. 2A seems stretched, and the size based on the scale bar does not fit the values stated in the text.

      We thank the reviewer for pointing this out and have corrected the figure.

      The figure numbering, as stated in the text, does not seem to agree with those in Supplementary Figure 8.

      *We thank the reviewer for pointing this out and have corrected the text. *

      Page numbers and/or line numbers and figure numbers on the figures would help the reader to navigate the manuscript more easily.

      We agree with the reviewer and have added this.

      Reviewer #3 (Significance (Required)):

      The manuscript is a rich resource of quantitative measurements of C.elegans' structural and dynamic spindle properties, using advanced light microscopy and 3D electron microscopy imaging. In large parts, the work confirms previous conclusions of the function of PRC1 and kinesin-4 in the anaphase spindle, but also reports some interesting differences, namely that the C.elegans proteins differ from their orthologs in that they do not interact with each other, raising the question of how the kinesin-4 KLP-19 localizes to the central spindle in this organism. This work is of interest for researchers studying cell division, and specifically spindle architecture, dynamics, and function.

    1. Rusia rebaja expectativas de un alto el fuego tras más de 12 horas de negociaciones con Estados UnidosWashington confirma que la situación en el mar Negro ha sido uno de los grandes asuntos en las converesaciones en RiadImagen facilitada por el ministerio de Asuntos Exteriores de Rusia de la delegación rusa saliendo del hotel Ritz-Carltonde Riad (Arabia saudí) después de las conversaciones este lunes con EE UU sobre el fin de la guerra en Ucrania.RUSSIAN FOREIGN MINISTRY PRESS SERVICE HANDOUT (EFE)Lola HierroMacarena Vidal LiyKiev / Washington - 24 MAR 2025 - 23:36 CETCompartir en WhatsappCompartir en FacebookCompartir en TwitterCompartir en BlueskyCompartir en LinkedinCopiar enlace0 Ir a los comentariosUn hermetismo casi absoluto ha rodeado la reunión entre representantes rusos y estadounidenses celebrada este lunes en Riad para negociar un posible alto el fuego en la invasión rusa de Ucrania. La cita ha concluido tras más de 12 horas y la única comunicación ofrecida a su término es que el texto de lo acordado no se publicará hasta este martes. La delegación de Kiev mantendrá nuevas conversaciones con la de Washington después de haberse visto el pasado domingo....Suscríbete 1 año por 144 18 €¡Solo esta semana!Seguir leyendoYa soy suscriptor_Antes de que los delegados se encerraran en una de las salas del Hotel Ritz-Carlton de la capital de Arabia Saudí, apenas habían trascendido detalles sobre el contenido de estas conversaciones. Washington quería arrancar a Moscú una promesa de tregua más allá de los mínimos planteados para proteger las infraestructuras críticas.El Kremlin, y esta es la novedad más reciente, buscaba resucitar el acuerdo de exportaciones de cereales en el mar Negro, una nueva prioridad que no estaba en la ecuación cuando se anunciaron estas rondas de negociaciones la semana pasada. Lo ha asegurado el portavoz del régimen ruso, Dmitri Peskov, este lunes: “El asunto de la iniciativa del mar Negro y todo lo relacionado con la renovación de la iniciativa están en la agenda de hoy”.El laconismo sobre el desarrollo de las conversaciones se extendía también a Washington. La portavoz del Departamento de Estado, Tammy Bruce, apenas ha proporcionado detalles sobre la marcha de las negociaciones en Riad, y se ha limitado a confirmar que la situación en el mar Negro ha sido uno de los grandes asuntos a abordar en el vaivén diplomático en Riad. “Estamos más cerca que nunca de lograr un alto el fuego. Estamos a un suspiro de lograrlo. Se puede conseguir: ahora estamos en el momento preciso en que necesitamos ideas frescas”, ha dicho.Mientras, Ucrania y Rusia han intercambiado ataques en otro día que ha dejado muertos y heridos. Este lunes se ha producido uno de los más graves perpetrados por Rusia en suelo ucranio, cuando un misil ha impactado en una zona residencial de la ciudad de Sumi. Hay al menos 88 heridos, de los que 17 son niños, según el Ayuntamiento. Rusia ha denunciado también la muerte de seis personas, entre ellas tres periodistas, en un ataque de artillería en Lugansk por parte de las Fuerzas Armadas ucranias. Además, en la madrugada, dos civiles murieron por un dron en la región rusa de Belgorod, según las autoridades locales.Durante la maratoniana jornada del lunes, los delegados de ambos países solo han hecho tres recesos para descansar. En el segundo de ellos, el diplomático Serguéi Karasin, al frente del equipo ruso, ha mostrado su satisfacción. “Las conversaciones se encuentran en pleno apogeo. Tiene lugar una interesante discusión de los temas más candentes”, ha dicho.Más allá del optimismo de Karasin, los únicos detalles de la cita han trascendido mediante un par de escuetas declaraciones del Kremlin que han rebajado las expectativas generadas en los últimos días acerca de una posible tregua. La portavoz del Ministerio de Asuntos Exteriores ruso, María Zajarova, ha declarado que aunque se está trabajando “en varias direcciones”, “no debe esperarse que las negociaciones produzcan un gran avance”, según Kommersant. El portavoz del presidente ruso, Vladímir Putin, ha afirmado que por ahora no planean firmar ningún documento.Mientras, Estados Unidos y Rusia siguen debatiendo sobre el futuro de Ucrania, los representantes de este país aguardan a que les vuelva a tocar el turno de entrar a la sala de reuniones con los portavoces de la Casa Blanca. Ambas delegaciones ya se reunieron el domingo también en Riad, y de esa cita, mucho más corta —apenas cuatro horas— trascendió que se abordaron cuestiones técnicas relacionadas con infraestructura y seguridad marítima. Fueron unas conversaciones “productivas y centradas”, en palabras del ministro de Defensa ucranio, Rustem Umerov, que encabeza el grupo de delegados de Kiev.Los planes de la Casa Blanca pasaban por reunirse por separado con los dos países enfrentados este lunes, y que de esos encuentros resultara algún compromiso rubricado por ambos. Lo que el representante de Donald Trump para las negociaciones más delicadas, Steve Witkoff, califica de “diplomacia de transbordo”, por la frecuencia en la que los mediadores estadounidenses van y vienen entre las partes.Ucrania, en principio, se mostró reticente, pero finalmente su delegación ha permanecido en Riad y el asesor del jefe de la oficina de Zelenski, Serhii Leshchenko, ha informado de que mantendrían un nuevo encuentro con los estadounidenses, que previsiblemente será este martes. El negociador ucranio también ha rebajado las expectativas: “Normalmente, las negociaciones no duran un día. A veces duran meses, y algunas, como los acuerdos en Oriente Próximo, duran años”, ha declarado a la agencia de noticias ucrania Unian.Leshchenko también ha asegurado que las fuerzas rusas no están atacando las instalaciones y puertos ucranios. Esta decisión del Kremlin subraya la importancia de reanudar el acuerdo sobre los cereales en el mar Negro, firmado en 2022 gracias a la mediación de Turquía y de la ONU para permitir la navegación segura para las exportaciones agrícolas ucranias. Un año después, Rusia lo rompió de manera unilateral con el argumento de que los países occidentales, socios estratégicos de Kiev, habían incumplido su compromiso de retirar las sanciones impuestas a sus exportaciones. Desde entonces, Ucrania ha mantenido abierto su corredor marítimo a golpe de bombardeo con misiles y drones contra las fuerzas navales enemigas.Estados Unidos también se ha mostrado a favor de resucitar el pacto. Si vuelve a rubricarse, Moscú podría exportar sus productos agrícolas y sus fertilizantes a través del mar Negro: a efectos prácticos, una eliminación de algunas de las sanciones económicas internacionales que han mantenido cojeando a su economía a lo largo de los tres años de guerra. Pero también interesa a Ucrania, para la que el tráfico marítimo es una línea vital para sus exportaciones, especialmente hacia Asia.Los acuerdos del mar Negro son la última de las condiciones impuestas por el Kremlin para encaminarse hacia una paz duradera con Ucrania. Pero Washington y Kiev también han presentado sus exigencias para seguir adelante. Para empezar, está el alto el fuego parcial que Trump lleva semanas intentando acordar con Zelenski y Putin. En las reuniones previas, ambos mandatarios habían accedido a una tregua para las instalaciones energéticas y otras infraestructuras críticas, pero ninguna de las dos partes ha cesado en sus ataques.Otro punto de gran interés para Estados Unidos es el control de las plantas de energía nuclear ucranias. El pasado 19 de marzo, Trump y Zelenski plantearon en una conversación telefónica que EE UU podría poseer o ayudar a administrar estas instalaciones, al menos de la Zaporiyia, la mayor de Europa, a cambio de su protección. Zelenski negó que se hubiese hablado de traspasar la propiedad, pero se mostró abierto a negociar algún tipo de acuerdo intermedio.Trump ha puesto otra condición a cambio de ofrecer protección y ayuda militar: la explotación de minerales y tierras raras ucranias. El acuerdo, cuya firma se truncó el pasado 28 de febrero, cuando Zelenski fue abroncado en público en el Despacho Oval, está a punto de cerrarse, según ha vuelto a afirmar Trump este lunes. Y el presidente estadounidense reiteraba el interés de Washington en gestionar Zaporiyia.Tu suscripción se está usando en otro dispositivo¿Quieres añadir otro usuario a tu suscripción?Añadir usuarioContinuar leyendo aquíSi continúas leyendo en este dispositivo, no se podrá leer en el otro.¿Por qué estás viendo esto?Flecha Tu suscripción se está usando en otro dispositivo y solo puedes acceder a EL PAÍS desde un dispositivo a la vez. Si quieres compartir tu cuenta, cambia tu suscripción a la modalidad Premium, así podrás añadir otro usuario. Cada uno accederá con su propia cuenta de email, lo que os permitirá personalizar vuestra experiencia en EL PAÍS.¿Tienes una suscripción de empresa? Accede aquí para contratar más cuentas.En el caso de no saber quién está usando tu cuenta, te recomendamos cambiar tu contraseña aquí.Si decides continuar compartiendo tu cuenta, este mensaje se mostrará en tu dispositivo y en el de la otra persona que está usando tu cuenta de forma indefinida, afectando a tu experiencia de lectura. Puedes consultar aquí los términos y condiciones de la suscripción digital.Recibe el boletín de InternacionalInternacional El País en FacebookInternacional El País en InstagramInternacional El País en TwitterComentarios0 Ir a los comentariosNormas ›Mis comentariosNormasRellena tu nombre y apellido para comentarcompletar datosSuscríbete en El País para participarYa tengo una suscripciónvar disqus_config = function () { this.page.url = 'https://elpais.com/internacional/2025-03-24/rusia-rebaja-expectativas-de-un-alto-el-fuego-tras-mas-de-12-horas-de-negociaciones-con-estados-unidos.html'; this.page.identifier = 'WESDELUYXFD3LCDS7DLGLFJNWE'; };Please enable JavaScript to view the &lt;a href=&quot;https://disqus.com/?ref_noscript&quot; rel=&quot;nofollow&quot;&gt; comments powered by Disqus.&lt;/a&gt;Más informaciónUn diálogo a tres bandas, el riesgo del ‘teléfono roto’ sobre UcraniaCristian Segura | KievEstados Unidos intenta ampliar el alcance del alto el fuego entre Rusia y UcraniaLola Hierro (enviada especial) / Miguel Jiménez | Kiev / WashingtonArchivado EnGuerra de Rusia en UcraniaUcraniaRusiaGuerraConflictosUnión EuropeaOTANAtaques militaresConflictos armadosConflictos internacionalesEuropaEstados UnidosDonald TrumpArabia SaudíNegociaciones pazAlto el fuegoMar NegroVladímir PutinVolodimir ZelenskiSe adhiere a los criterios deMás informaciónSi está interesado en licenciar este contenido, pinche aquíCONTENIDO PATROCINADOLos expertos coinciden: La energía solar solo vale la pena si tu techo...EcoExperts|PatrocinadoPatrocinadoDeshacerAlarma antiocupación arrasa en Tanos, no vas a creer su precioSecuritas Alarma|PatrocinadoPatrocinadoDeshacerIncreíble: la calculadora muestra el valor de su casa al instante (eche un vistazo)Valor de la vivienda | Anuncios de búsqueda|PatrocinadoPatrocinadoMás informaciónDeshacerY ADEMÁS...Del icónico vestido de novia de Vivienne Westwood al nuevo ‘bridalcore’: así será la edición más grande de Barcelona Bridal Fashion WeekEl PaísDeshacerCarmen Lomana cuenta qué le hizo Miguel Bosé cuando se enteró de que ella se había vacunado contra el CovidHuffpostDeshacer"Pablo Motos ha muerto": sorpresa en Antena 3 por la forma en la que ha anunciado la vuelta de 'El Hormiguero'Cadena SERDeshacer window._taboola = window._taboola || []; _taboola.push({mode:'thumbs-feed-01',container:'taboola-below-article-thumbnails',placement:'Below Article Thumbnails',target_type:'mix'}); Últimas noticias23:21Accidente automovilístico en Cola de Caballo mata a 12 personas y genera incendio forestal22:57Agentes israelíes detienen en Cisjordania a uno de los ganadores del Oscar por el documental ‘No other land’22:44El Gobierno de Milei profundiza su discurso negacionista del terrorismo de Estado en Argentina22:43Decenas de miles de argentinos marchan contra el negacionismo de la dictadura que promueve MileiInteligencIAs¿Ser o no ser? la inteligencia artificial como clave del futuro laboral y educativo window.audioList = window.audioList || []; window.audioList.push({"container":"audio_1741685495014","id_media":"1741685495014","id_cuenta":"elpais","id_player":469,"media_type":"audio","autoplay":false,"floating":false,"ads":{"enabled":false},"title_integration":"InteligencIA educativa – Episodio 2"}); InteligencIA educativa – Episodio 2 00:00 00:00 {"container":"audio_1741685495014","id_media":"1741685495014","id_cuenta":"elpais","id_player":469,"media_type":"audio","autoplay":false,"floating":false,"ads":{"enabled":false},"title_integration":"InteligencIA educativa – Episodio 2"}{"brandedId":""}Lo más vistoÚltima hora de la guerra de Rusia y Ucrania, en directo | Rusia y EE UU anuncian que mañana darán detalles sobre sus más de 12 horas de reuniónTrump dice que impondrá aranceles del 25% a todos los países que compren petróleo a VenezuelaTrump desata la ira de Groenlandia al enviar una delegación a la isla encabezada por la segunda damaPresos que cambian la celda por el campo de batalla para reforzar al ejército de UcraniaLos ataques rusos matan a nueve personas en Ucrania en las horas previas a las negociaciones de paz en Arabia SaudíRecomendaciones EL PAÍSEscaparateCursosCursos onlineIdiomas onlineEscaparateescaparateSUPERVENTAS PARA TU HOGAR: Freidora Cosori (la más vendida) con 36% de descuento. SOLO 89,99€escaparateQuitapelusas eléctrico de Philips con más de 135.000 valoraciones. Apto para retirar bolas y pelusas de todo tipo de tejidos, incluidos los más delicados. SOLO 11,95€escaparateBandejas de papel para freidora de aire. Pack de 100 unidades desechables en diferentes tamaños para no tener que fregar la cesta. SOLO 8,89€escaparateJuego de sábanas de 4 piezas con más de 50.000 opiniones. Disponibles en diferentes colores y medidas. 23% de descuento, desde SOLO 15,32€CursoscursosTu próximo gran paso empieza aquí: formación práctica para cambiar tu vida profesionalcursosDescubre el futuro con la IA. Desarrolla, innova y lidera la revolución tecnológicacursosTransforma tu visión empresarial y adquiere las habilidades estratégicas necesariascursosDomina la gestión de proyectos y aprende metodologías ágiles y estrategias efectivasCursos onlinecursosonlineConviértete en un experto desde casa: formación 'online' que se adapta a tu ritmocursosonlineDescubre herramientas digitales para potenciar y mejorar la enseñanza en la era digitalcursosonlineAprende estrategias clave para la prevención de riesgos y el cumplimiento normativocursosonlineAprende a optimizar recursos y asegurar el crecimiento económico de cualquier empresaIdiomas onlinecursosinglesAprende idiomas con EL PAÍS con 15 minutos al díacursosinglesMejora tu inglés con 21 días gratis sin compromisocursosinglesPrueba a aprender italiano con lecciones personalizadascursosinglesAprende francés y obtén tu certificado__ window.DTM.dataLayerDelay = true; window.ENP = window.ENP || {}; window.ENP.paywallInfo = {"arcSite":"el-pais","paywallModalHiddenSections":"/economia/especial-rsc,/espana/mujeres-y-viajeras,/sociedad/en-progreso,/deportes/es-laliga,/economia/estar-donde-estes,/sociedad/somos-futuro,/sociedad/las-coordenadas-de-kepa,/sociedad/ecoembes-espacio-eco,/tecnologia/con-proposito,/economia/entorno-seguro,/sociedad/cuando-el-descanso-es-un-sueno,/sociedad/futuros-educacion,/sociedad/ve-mas-alla,/espana/en-clave-de-bienestar,/tecnologia/haz-cosas-extraordinarias,/sociedad/pienso-luego-actuo,/sociedad/origenes,/sociedad/esta-en-nuestras-manos,/economia/de-experto-a-experto,/economia/fondos-europeos-la-guia,/economia/hablemos-de-futuro,/economia/si-lo-hubiera-sabido,/economia/foro-futuro,/sociedad/en-tu-piel,/sociedad/mas-corazon-menos-diabetes-2,/economia/entorno-seguro,/economia/repensando-el-futuro,/tecnología/radar-pyme,/sociedad/la-ciencia-que-nos-une,/economia/nuevos_tiempos,/sociedad/educacion-online,/sociedad/comer-sano-en-familia,/sociedad/generacion-futura,/sociedad/la-huella,/deportes/lo-inteligente-es-seguir,/cultura/museo-del-prado,/sociedad/vidas-nuevas,/sociedad/no-estas-solo,/cultura/territorio-paradores,/economia/horizonte-4-0,/espana/un-futuro-cercano,/tecnologia/5g-el-futuro-es-ahora,/sociedad/vihda-positiva,/economia/mucho-por-hacer,/television/nueva-tele,/espana/madrid/muchas-gracias-madrid,/cultura/festival-internacional-de-musica-de-canarias,/economia/el-observatorio-vodafone-de-la-empresa,https://elpais.com/especiales/2020/25-aniversario-muerte-de-lola-flores/exito-transgresion-y-pena,","paywallCounterHidden":false,"paywallModalOfferUrl":"https://elpais.com/subscriptions/#/register#?prod=REGCONTADOR&o=popup_regwall&prm=signwall_contadorpopup_registro_el-pais","paywallScript":"https://elpais.com/arc/subs/p.min.js","contentType":"story","subscribeWithGoogle":false,"contentSection":"/internacional","contentRestriction":"freemium","contentId":"WESDELUYXFD3LCDS7DLGLFJNWE","apiOrigin":"https://publicapi.elpais.com","apiOriginOther":"https://publicapi.brasil.elpais.com","baseUrlApiGateway":"https://wdnf3ec6zb.execute-api.eu-west-1.amazonaws.com/PRO/api/","socialSignOn":"https://elpais.com/subscriptions/#/social-signon","newsGoogleScript":"https://news.google.com/swg/js/v1/swg.js","isExcludedPaywall":false,"test":{"testName":"Experiment Paywall layer","testVersion":"01","storageVariableName":"EP-pwTest","firstSegmentName":"A","firstSegmentWeight":"50","firstSegmentValue":"1","secondSegmentName":"B","secondSegmentWeight":"50","secondSegmentValue":"5"},"counterLayer":{"articleTextOneSingle":"Este es tu último artículo gratis este mes","articleTextOne":"Te quedan","articleTextTwo":"artículos gratis este mes","subscriptionOneEuro":"Suscríbete","articleTextOneSingular":"Te queda","articleTextTwoSingle":"artículo gratis este mes","subscriptionUnlimited":"Sigue leyendo sin límites","subscriptionWeekEuro":"Descubre las promociones disponibles","subscriptionButton":"Suscríbete"},"blockLayer":{"lang":{"ES":{"paywallModalHeaderText":"Regístrate gratis para seguir leyendo","paywallModalSubheaderText":"","paywallModalDescriptionText":"","paywallModalOfferText":"CREAR CUENTA","paywallModalAllOffersText":"","paywallModalSignInText":"O suscríbete para leer sin límites","paywallModalSignInMessageText":"","paywallModalOfferUrl":"https://elpais.com/subscriptions/#/register#?prod=REGCONTADOR&o=popup_regwall&prm=signwall_contadorpopup_registro_el-pais&backURL=https%3A%2F%2Felpais.com%2Finternacional%2F2025-03-24%2Frusia-rebaja-expectativas-de-un-alto-el-fuego-tras-mas-de-12-horas-de-negociaciones-con-estados-unidos.html","paywallModalAllOffersUrl":"https://elpais.com/subscriptions/#/register#?prod=REGCONTADOR&o=popup_regwall&prm=signwall_contadorpopup_registro_el-pais","paywallIconButtonUrl":"/","paywallModalSignInUrl":"https://elpais.com/suscripciones/#/sign-in#?prod=SUSDIG&o=popup_regwall&prm=signwall_contadorpopup_landing_el-pais&backURL=https%3A%2F%2Felpais.com%2Finternacional%2F2025-03-24%2Frusia-rebaja-expectativas-de-un-alto-el-fuego-tras-mas-de-12-horas-de-negociaciones-con-estados-unidos.html","paywallModalSignUpMessageText":"","paywallModalSignUpUrl":"https://elpais.com/subscriptions/#/sign-in#?prod=REGCONTADOR&o=popup_regwall&backURL=https%3A%2F%2Felpais.com%2Finternacional%2F2025-03-24%2Frusia-rebaja-expectativas-de-un-alto-el-fuego-tras-mas-de-12-horas-de-negociaciones-con-estados-unidos.html","paywallModalSignUpText":"INICIA SESIÓN","paywallModalHiddenSections":"/economia/especial-rsc,/espana/mujeres-y-viajeras,/sociedad/en-progreso,/deportes/es-laliga,/economia/estar-donde-estes,/sociedad/somos-futuro,/sociedad/las-coordenadas-de-kepa,/sociedad/ecoembes-espacio-eco,/tecnologia/con-proposito,/economia/entorno-seguro,/sociedad/cuando-el-descanso-es-un-sueno,/sociedad/futuros-educacion,/sociedad/ve-mas-alla,/espana/en-clave-de-bienestar,/tecnologia/haz-cosas-extraordinarias,/sociedad/pienso-luego-actuo,/sociedad/origenes,/sociedad/esta-en-nuestras-manos,/economia/de-experto-a-experto,/economia/fondos-europeos-la-guia,/economia/hablemos-de-futuro,/economia/si-lo-hubiera-sabido,/economia/foro-futuro,/sociedad/en-tu-piel,/sociedad/mas-corazon-menos-diabetes-2,/economia/entorno-seguro,/economia/repensando-el-futuro,/tecnología/radar-pyme,/sociedad/la-ciencia-que-nos-une,/economia/nuevos_tiempos,/sociedad/educacion-online,/sociedad/comer-sano-en-familia,/sociedad/generacion-futura,/sociedad/la-huella,/deportes/lo-inteligente-es-seguir,/cultura/museo-del-prado,/sociedad/vidas-nuevas,/sociedad/no-estas-solo,/cultura/territorio-paradores,/economia/horizonte-4-0,/espana/un-futuro-cercano,/tecnologia/5g-el-futuro-es-ahora,/sociedad/vihda-positiva,/economia/mucho-por-hacer,/television/nueva-tele,/espana/madrid/muchas-gracias-madrid,/cultura/festival-internacional-de-musica-de-canarias,/economia/el-observatorio-vodafone-de-la-empresa,https://elpais.com/especiales/2020/25-aniversario-muerte-de-lola-flores/exito-transgresion-y-pena,","paywallIncognitoModalActivate":true,"paywallIncognitoModalLoginURL":"https://elpais.com/subscriptions/#/sign-in","paywallIncognitoModalHeaderText":"Inicia sesión o regístrate gratis para continuar leyendo en incógnito","paywallIncognitoModalLoginButton":"Inicia sesión","paywallIncognitoModalRegister":"Regístrate gratis","paywallIncognitoModalRegisterURL":"https://elpais.com/subscriptions/#/register","paywallIncognitoModalFoot":"Suscríbete y lee sin límites","paywallIncognitoModalSubsOptions":"Ver opciones de suscripción","paywallIncognitoModalSubsOptionsURL":"https://elpais.com/suscripciones/#/campaign"},"BR":{"paywallModalHeaderText":"Assine para continuar lendo","paywallModalSubheaderText":"Você não pode ler mais textos gratuitos este mês.","paywallModalDescriptionText":"Aproveite o acesso ilimitado com a sua assinatura","paywallModalOfferText":"ASSINAR","paywallModalAllOffersText":"","paywallModalSignInText":"Já sou assinante","paywallModalSignInMessageText":"","paywallModalOfferUrl":"","paywallModalAllOffersUrl":"","paywallIconButtonUrl":"/","paywallModalSignInUrl":"https://elpais.com/subscriptions/#/sign-in?prod=SUSDIGBR&o=popupbr_paywall&backURL=https%3A%2F%2Felpais.com%2Finternacional%2F2025-03-24%2Frusia-rebaja-expectativas-de-un-alto-el-fuego-tras-mas-de-12-horas-de-negociaciones-con-estados-unidos.html","paywallModalSignUpMessageText":"","paywallModalSignUpUrl":"","paywallModalSignUpText":"","paywallModalHiddenSections":"","paywallIncognitoModalActivate":false,"paywallIncognitoModalHeaderText":"Iniciar sessão ou registar-se gratuitamente para continuar a ler incógnito","paywallIncognitoModalLoginURL":"/","paywallIncognitoModalLoginButton":"Iniciar sessão","paywallIncognitoModalRegisterURL":"/","paywallIncognitoModalRegister":"Registar gratuitamente","paywallIncognitoModalFoot":"E se subscrever, poderá ler todas as notícias sem limites.","paywallIncognitoModalSubsOptionsURL":"/","paywallIncognitoModalSubsOptions":"Ver opções de subscrição"}}},"isPremiumArticle":false,"isFreemiumArticle":true}; Regístrate gratis para seguir leyendoINICIA SESIÓNCREAR CUENTAO suscríbete para leer sin límitesInicia sesión o regístrate gratis para continuar leyendo en incógnitoRegístrate gratisInicia sesiónSuscríbete y lee sin límitesVer opciones de suscripciónHOLAsuscríbete por 1€Mi actividadMi suscripciónMis datosMis newslettersDerechos y bajaExperiencias para míAsistente Vera IAdesconectaralto contraste:BuscarSeleccione:- - -EspañaAméricaMéxicoColombiaChileArgentinaUS EspañolUS EnglishSi quieres seguir toda la actualidad sin límites, únete a EL PAÍS por 1€ el primer mesSUSCRÍBETE AHORAInternacionalOpiniónEditorialesTribunasViñetasCartas a la DirectoraDefensora del lectorEspañaAndalucíaCataluñaComunidad ValencianaGaliciaMadridPaís VascoEconomíaMercadosViviendaMis derechosFormaciónSociedadEducaciónClima y Medio AmbienteCienciaSaludTecnologíaCulturaDeportesFútbolBaloncestoTenisCiclismoFórmula 1MotociclismoGolfAtletismoAjedrezTelevisiónGente y Estilo de vidaEl País ExprésFotografíaVídeosCanal EL PAÍSPodcastsel país semanalideasNegociosBabeliaQuadernel viajeroplaneta futuros modaiconGastroEl ComidistaCinco DíasMotorMamas & PapasAmérica FuturaEscaparateExtrasCrucigramas y JuegosEL PAÍS +NewsletterÚltimas noticiasHemerotecaEspecialesSolucionesDescuentosColeccionesEntradasSíguenos en:El País en FacebookEl País en TwitterEl País en YoutubeEl País en Instagram window.ENP.PBS_SSR = {"ads":[{"targeting":{"pos":"skin"},"display":"desktop"},{"targeting":{"pos":"inter"},"display":"desktop"},{"dimensions":[[[728,90],[970,90],[980,90],[980,180],[980,220],[970,250],[980,250],[1200,90],[1200,180],[1200,250]],[[728,90]]],"targeting":{"pos":"ldb1"},"display":"desktop","sizemap":{"breakpoints":[[980,0],[728,0]]}},{"dimensions":[[[728,90]],[[320,100],[320,50]]],"targeting":{"pos":"mldb1"},"display":"mobile","sizemap":{"breakpoints":[[728,0],[0,0]]}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu1"}},{"dimensions":[[300,250]],"targeting":{"pos":"mpu2"}},{"dimensions":[[[728,90],[970,90],[980,90],[980,250],[1200,90],[1200,180],[1200,250]],[[728,90]]],"targeting":{"pos":"ldb2"},"display":"desktop","sizemap":{"breakpoints":[[980,0],[728,0]]}},{"dimensions":[[[728,90]],[[320,100],[320,50]]],"targeting":{"pos":"mldb2"},"display":"mobile","sizemap":{"breakpoints":[[728,0],[0,0]]}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu3"}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu4"}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu5"}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu6"}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu8"}},{"dimensions":[[300,100]],"targeting":{"pos":"nstd2"},"display":"all"},{"dimensions":[[300,100]],"targeting":{"pos":"nstd3"},"display":"all"},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu9"}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu10"}},{"dimensions":[[300,250],[300,600]],"targeting":{"pos":"mpu7"}}],"adUnitPageLevel":"elpais/internacional","PREFIX":"elpais_gpt","keyValuePageLevel":["ofensiva_rusia_ucrania_a","ucrania_a","rusia_a","guerra_a","conflictos_a","ue_union_europea_a","otan_organizacion_tratado_atlantico_norte_a","ataques_militares_a","conflictos_armados_a","conflictos_internacionales_a","europa_a","estados_unidos_a","donald_trump_a","arabia_saudi_a","negociaciones_paz_a","alto_el_fuego_a","mar_negro_a","vladimir_putin_a","volodymyr_oleksandrovych_zelenskiy_a","internacional","internacional_europa"],"excludedPaywall":false};<link rel="stylesheet" href="https://static.elpais.com/dist/resources/css/db9f21acfcdfe7a43f434e07c4c38a74/ENP/el-pais/article-basic.css"/> var loadDeferredStyles = function() { var elm = document.getElementById('deferred-styles'); elm.rel = 'stylesheet'; }; var raf = window.requestAnimationFrame || window.mozRequestAnimationFrame || window.webkitRequestAnimationFrame || window.msRequestAnimationFrame; if (raf) raf(function() { window.setTimeout(loadDeferredStyles, 0); }); else window.addEventListener('load', loadDeferredStyles); window._taboola = window._taboola || []; _taboola.push({flush: true}); {"@context":"https://schema.org/","@type":"ItemList","mainEntityOfPage":{"@type":"CollectionPage","@id":"https://elpais.com/internacional/2025-03-24/rusia-rebaja-expectativas-de-un-alto-el-fuego-tras-mas-de-12-horas-de-negociaciones-con-estados-unidos.html"},"itemListElement":[{"@type":"ListItem","position":1,"url":"https://elpais.com/mexico/2025-03-24/accidente-automovilistico-en-cola-de-caballo-mata-a-12-personas-y-genera-incendio-forestal.html"},{"@type":"ListItem","position":2,"url":"https://elpais.com/internacional/2025-03-24/agentes-israelies-detienen-en-cisjordania-a-uno-de-los-ganadores-del-oscar-por-el-documental-no-other-land.html"},{"@type":"ListItem","position":3,"url":"https://elpais.com/argentina/2025-03-24/el-gobierno-de-milei-profundiza-su-discurso-negacionista-del-terrorismo-de-estado-en-argentina.html"},{"@type":"ListItem","position":4,"url":"https://elpais.com/argentina/2025-03-24/decenas-de-miles-de-argentinos-marchan-contra-el-negacionismo-de-la-dictadura-que-promueve-milei.html"}]}_satellite["_runScript1"](function(event, target, Promise) { window.DTM={version:"launch-ep-8.21",initialized:!0,dateInit:new Date,internalTest:"",PLATFORM:{AMP:"amp",FBIA:"fbia",WEB:"web",WIDGET:"widget"},CONSENTS:{ACCEPT:1,REJECT:0,WAITING:2,DEFAULT:-1},config:"undefined"!=typeof DTM&&void 0!==DTM.config?DTM.config:{},pageDataLayer:"undefined"!=typeof DTM&&(DTM.pageDataLayer,1)?DTM.pageDataLayer:{},eventQueue:"undefined"!=typeof DTM&&void 0!==DTM.eventQueue?DTM.eventQueue:[],paywallOn:"undefined"!=typeof DTM&&void 0!==DTM.paywallOn?DTM.paywallOn:"",delayDataLayer:"undefined"!=typeof DTM&&void 0!==DTM.delayDataLayer?DTM.delayDataLayer:"",notify:function(e,t){t=void 0!==t?t:"info";try{var a=(new Date).getTime()-DTM.dateInit.getTime();e="DTM: "+e+" ("+(a=(a/=1e3).toFixed(2))+"s)","warn"==t?_satellite.logger.warn(e):"error"==t?_satellite.logger.error(e):_satellite.logger.info(e)}catch(e){console.info("Error DTM.notify")}},init:function(){DTM.tools.marfeel.utils.markTimeLoads("DTM init"),this.notify("Version <"+this.version+"> fired "+_satellite.environment.stage,!0),this.notify("Page <"+window.location.href+">"),DTM.utils.addEvent(document,"DTMDataLayerGenerated",(function(){if(DTM.tools.marfeel.utils.markTimeLoads("DTMDataLayerGenerated"),!0!==DTM.dataLayer.asyncPV){DTM.dataLayer.generated=!0,DTM.tools.init();var e=0;1!=window.cmp_impression&&(e=500),setTimeout((function(){DTM.trackPV(),DTM.events.init(),DTM.utils.dispatchEvent("DTMCompleted")}),e)}else DTM.events.init()})),this.dataLayer.init()},dataLayer:{delay:!1,sync:"no-needed",asyncPV:!1,generated:!1,timeOutTime:6e3,timeOutCompleted:!1,vars:{cms:"arc",siteID:"elpaiscom",platform:"",urlParams:!1,tags:[],secondaryCategories:"",server:window.location.host,pageType:"",brandedContent:"0",primaryCategory:"desconocido",translatePage:!1,destinationURL:location.href,referringURL:document.referrer,pageTitle:document.title},flags:{userInfo:!1,paywallInfo:!1},init:function(){DTM.tools.marfeel.utils.markTimeLoads("Datalayer init"),this.delay=!1,this.sync="no-needed",this.generated=!1,this.timeOutCompleted=!1,this.flags={userInfo:!1,paywallInfo:!1},this.vars.siteID=this.pageDataLayerParamExists("siteID")?DTM.pageDataLayer.siteID:this.vars.siteID,this.vars.platform=this.pageDataLayerParamExists("platform")?DTM.pageDataLayer.platform:DTM.PLATFORM.WEB,this.vars.urlParams=DTM.dataLayer.getUrlParams(),this.vars.tags=this.pageDataLayerParamExists("tags")?DTM.pageDataLayer.tags:this.vars.tags,this.vars.secondaryCategories=this.pageDataLayerParamExists("secondaryCategories")?this.formatDataLayerParam("secondaryCategories"):this.vars.secondaryCategories,this.vars.server=this.pageDataLayerParamExists("server")?DTM.pageDataLayer.server:this.vars.server,this.vars.pageType=this.pageDataLayerParamExists("pageType")?this.formatDataLayerParam("pageType"):this.vars.pageType,this.vars.brandedContent=this.isBrandedContent(),this.vars.primaryCategory=this.pageDataLayerParamExists("primaryCategory")?this.formatDataLayerParam("primaryCategory"):this.vars.primaryCategory,this.vars.translatePage=-1!=this.vars.server.indexOf("translate.goog"),this.vars.referringURL=this.getReferringURL(),this.vars.destinationURL=this.pageDataLayerParamExists("destinationURL")&&!this.asyncPV?DTM.pageDataLayer.destinationURL:location.href,this.vars.pageTitle=this.pageDataLayerParamExists("pageTitle")?this.formatDataLayerParam("pageTitle"):document.getElementsByTagName("title")[0]?document.getElementsByTagName("title")[0].innerHTML:"",window.digitalData={page:{pageInstanceID:this.pageDataLayerParamExists("pageInstanceID")?DTM.pageDataLayer.pageInstanceID:(new Date).getTime()+"_"+Math.floor(1e7*Math.random()),pageInfo:{articleID:this.pageDataLayerParamExists("articleID")?DTM.pageDataLayer.articleID:this.getArticleID(),articleLength:this.pageDataLayerParamExists("articleLength")?DTM.pageDataLayer.articleLength:"",articleTitle:this.pageDataLayerParamExists("articleTitle")?DTM.pageDataLayer.articleTitle:this.getArticleTitle(),audioContent:this.pageDataLayerParamExists("audioContent")?DTM.pageDataLayer.audioContent:"not-set",author:this.pageDataLayerParamExists("author")?DTM.pageDataLayer.author:[],brandedContent:this.vars.brandedContent,businessUnit:this.pageDataLayerParamExists("businessUnit")?DTM.pageDataLayer.businessUnit:"noticias",campaign:this.getCampaign(),canonicalURL:this.getCanonical(),cleanURL:this.pageDataLayerParamExists("cleanURL")?DTM.pageDataLayer.cleanURL:this.vars.destinationURL.replace(/[\?#].*?$/g,""),clickOrigin:this.pageDataLayerParamExists("clickOrigin")?DTM.pageDataLayer.clickOrigin:DTM.utils.getQueryParam("rel"),cms:this.vars.cms,creationDate:this.pageDataLayerParamExists("creationDate")?DTM.pageDataLayer.creationDate:"",date:{dstStart:"1/1/"+DTM.dateInit.getFullYear(),dstEnd:"12/31/"+DTM.dateInit.getFullYear(),seconds:DTM.utils.formatDate(DTM.dateInit.getSeconds()),minutes:DTM.utils.formatDate(DTM.dateInit.getMinutes()),hours:DTM.utils.formatDate(DTM.dateInit.getHours()),day:DTM.utils.formatDate(DTM.dateInit.getDate()),month:DTM.utils.formatDate(DTM.dateInit.getMonth()+1),year:DTM.dateInit.getFullYear(),fullYear:DTM.dateInit.getFullYear(),gmt:-DTM.dateInit.getTimezoneOffset()/60-1>=0?"+"+(-DTM.dateInit.getTimezoneOffset()/60-1).toString():-DTM.dateInit.getTimezoneOffset()/60-1},destinationURL:this.vars.destinationURL,domain:this.pageDataLayerParamExists("domain")?DTM.pageDataLayer.domain:"elpais.com",edition:this.pageDataLayerParamExists("edition")?DTM.pageDataLayer.edition:"not-set",editionNavigation:this.pageDataLayerParamExists("editionNavigation")?DTM.pageDataLayer.editionNavigation:this.pageDataLayerParamExists("edition")?DTM.pageDataLayer.edition:"not-set",editorialTone:this.pageDataLayerParamExists("editorialTone")?DTM.pageDataLayer.editorialTone:"",geoRegion:this.pageDataLayerParamExists("geoRegion")?DTM.pageDataLayer.geoRegion:"espa\xf1a",language:this.pageDataLayerParamExists("language")?DTM.pageDataLayer.language.toLowerCase():document.documentElement.lang?document.documentElement.lang:"es",liveContent:this.pageDataLayerParamExists("liveContent")?!0===DTM.pageDataLayer.liveContent||"true"===DTM.pageDataLayer.liveContent?"1":!1===DTM.pageDataLayer.liveContent||"false"===DTM.pageDataLayer.liveContent?"0":"not-set":"not-set",loadType:this.pageDataLayerParamExists("loadType")?DTM.pageDataLayer.loadType:!0===this.asyncPV?"spa":"secuencial",onsiteSearch:this.pageDataLayerParamExists("onsiteSearch")?DTM.pageDataLayer.onsiteSearch:"0",onsiteSearchTerm:this.pageDataLayerParamExists("onsiteSearchTerm")?DTM.pageDataLayer.onsiteSearchTerm:"",onsiteSearchResults:this.pageDataLayerParamExists("onsiteSearchResults")?DTM.pageDataLayer.onsiteSearchResults:"",org:this.pageDataLayerParamExists("org")?DTM.pageDataLayer.org:"prisa",pageHeight:this.pageDataLayerParamExists("pageHeight")?DTM.pageDataLayer.pageHeight:this.getPageHeight(),pageID:this.pageDataLayerParamExists("pageID")?DTM.pageDataLayer.pageID:document.location.href,pageName:this.pageDataLayerParamExists("pageName")?DTM.pageDataLayer.pageName:this.vars.siteID+this.vars.destinationURL.replace(/[\?#].*?$/g,"").replace(/http.?:\/\/[^\/]*/,""),pageTitle:this.vars.pageTitle,pageTypology:this.pageDataLayerParamExists("pageTypology")?DTM.pageDataLayer.pageTypology:"",platform:this.vars.platform,privateMode:this.pageDataLayerParamExists("privateMode")?DTM.pageDataLayer.privateMode:"not-set",publishDate:this.pageDataLayerParamExists("publishDate")?DTM.pageDataLayer.publishDate:"",publisher:this.pageDataLayerParamExists("publisher")?DTM.pageDataLayer.publisher:"el pais",publisherID:this.pageDataLayerParamExists("publisherID")?DTM.pageDataLayer.publisherID:this.getPublisherID(),referringDomain:this.getReferringDomain(this.vars.referringURL),referringURL:this.vars.referringURL,server:this.vars.server,siteID:this.vars.siteID,ssl:this.pageDataLayerParamExists("ssl")?DTM.pageDataLayer.ssl:"https:"==document.location.protocol?"1":"0",sysEnv:this.pageDataLayerParamExists("sysEnv")?DTM.pageDataLayer.sysEnv:DTM.PLATFORM.WEB,tags:this.vars.tags,test:this.pageDataLayerParamExists("test")?DTM.pageDataLayer.test:"",thematic:this.pageDataLayerParamExists("thematic")?DTM.pageDataLayer.thematic:"informacion",translatePage:this.vars.translatePage,updateDate:this.pageDataLayerParamExists("updateDate")?DTM.pageDataLayer.updateDate:"",urlParams:this.vars.urlParams,validPage:this.isValidPage(),videoContent:this.pageDataLayerParamExists("videoContent")?DTM.pageDataLayer.videoContent:"not-set"},category:{pageType:this.vars.pageType,primaryCategory:this.vars.primaryCategory,subCategory1:this.pageDataLayerParamExists("subCategory1")?this.formatDataLayerParam("subCategory1"):"",subCategory2:this.pageDataLayerParamExists("subCategory2")?this.formatDataLayerParam("subCategory2"):"",secondaryCategories:this.vars.secondaryCategories}},user:{country:this.pageDataLayerParamExists("country")?DTM.pageDataLayer.country:"",experienceCloudID:window.s.visitor.getMarketingCloudVisitorID(),ID:this.getARCID(),name:this.pageDataLayerParamExists("userName")?DTM.pageDataLayer.userName:"not-set",profileID:this.pageDataLayerParamExists("profileID")?DTM.pageDataLayer.profileID:"not-set",registeredUserAMP:this.pageDataLayerParamExists("registeredUserAMP")?DTM.pageDataLayer.registeredUserAMP.toString():"",registeredUser:this.pageDataLayerParamExists("registeredUser")&&""!==DTM.pageDataLayer.registeredUser?DTM.pageDataLayer.registeredUser.toString():"not-set",subscriptions:this.pageDataLayerParamExists("paywallProduct")&&""!=DTM.pageDataLayer.paywallProduct?DTM.pageDataLayer.paywallProduct:"not-set",type:this.pageDataLayerParamExists("userType")?DTM.pageDataLayer.userType:"not-set",subscriptionType:"",arcID:this.getARCID()},device:{cookieEnabled:navigator.cookieEnabled,language:navigator.language,platform:navigator.platform,type:this.getDeviceType(),userAgent:navigator.userAgent},paywall:{access:this.pageDataLayerParamExists("paywallAccess")?DTM.pageDataLayer.paywallAccess:"not-set",active:this.pageDataLayerParamExists("paywallActive")?DTM.pageDataLayer.paywallActive:"not-set",cartProduct:this.pageDataLayerParamExists("paywallCartProduct")?DTM.pageDataLayer.paywallCartProduct:"not-set",contentAdType:this.pageDataLayerParamExists("contentAdType")?DTM.pageDataLayer.contentAdType:this.pageDataLayerParamExists("paywallAd")?DTM.pageDataLayer.paywallAd:"none",contentBlocked:this.pageDataLayerParamExists("paywallStatus")?DTM.pageDataLayer.paywallStatus.toString():this.pageDataLayerParamExists("contentBlocked")?DTM.pageDataLayer.contentBlocked:"not-set",counter:this.pageDataLayerParamExists("paywallCounter")?DTM.pageDataLayer.paywallCounter.toString():"not-set",signwallType:this.pageDataLayerParamExists("signwallType")?DTM.pageDataLayer.signwallType:this.pageDataLayerParamExists("paywallType")?DTM.pageDataLayer.paywallType:"free",transactionID:this.pageDataLayerParamExists("paywallTransactionID")?DTM.pageDataLayer.paywallTransactionID:"",transactionOrigin:this.pageDataLayerParamExists("transactionOrigin")?DTM.pageDataLayer.transactionOrigin:"",transactionType:this.pageDataLayerParamExists("paywallTransactionType")?DTM.pageDataLayer.paywallTransactionType:this.pageDataLayerParamExists("paywallSubsType")?DTM.pageDataLayer.paywallSubsType:"",type:this.pageDataLayerParamExists("dataLayerVersion")&&"v2"==DTM.pageDataLayer.dataLayerVersion?"freemium":"none",id:this.pageDataLayerParamExists("paywallID")&&""!=this.pageDataLayerParamExists("paywallID")?DTM.pageDataLayer.paywallID:"not-set"},event:[]},_satellite.track("websdk_marfeel"),this.fixes(),DTM.tools.marfeel.utils.markTimeLoads("Datalayer predelay"),this.delay=this.isPageDataLayerDelay(),!0===this.delay?"undefined"!=typeof _dtm_dataLayerUpdate&&!0===_dtm_dataLayerUpdate?(this.sync="direct",DTM.notify("Data Layer sync completed <"+DTM.dataLayer.sync+">"),this.getUserInfo()):DTM.utils.addEvent(document,"DTMDataLayerUpdate",(function(){DTM.dataLayer.sync="event",DTM.notify("Data Layer sync completed <"+DTM.dataLayer.sync+">"),DTM.dataLayer.getUserInfo()})):(DTM.notify("Data Layer sync completed <"+DTM.dataLayer.sync+">"),this.getUserInfo()),DTM.tools.marfeel.utils.markTimeLoads("Datalayer postdelay"),setTimeout((function(){DTM.dataLayer.generated||(DTM.dataLayer.timeOutCompleted=!0,_satellite.getVar("platform")==DTM.PLATFORM.WEB&&!1===DTM.dataLayer.flags.paywallInfo&&(DTM.dataLayer.sync="timeout",DTM.dataLayer.getUserInfo(),DTM.notify("Paywall sync completed <"+DTM.dataLayer.sync+">")),DTM.dataLayer.generated=!0,DTM.notify("Data Layer "+(!0===DTM.dataLayer.asyncPV?"re":"")+"generated (timeOut)"),DTM.utils.dispatchEvent("DTMDataLayerGenerated"),DTM.tools.marfeel.utils.markTimeLoads("timeout DTMDataLayerGenerated"))}),DTM.dataLayer.timeOutTime)},getCanonical:function(){var e="";if(DTM.dataLayer.pageDataLayerParamExists("canonicalURL"))e=DTM.pageDataLayer.canonicalURL;else if("undefined"!=typeof document&&"function"==typeof document.querySelector)e=null!=(e=document.querySelector("link[rel='canonical']"))?e.href:location.href.replace(/[\?#].*?$/g,"");else for(var t=document.getElementsByTagName("link"),a=0,r=t.length;a<r&&""==e;a++)"canonical"===t[a].getAttribute("rel")&&(e=t[a].getAttribute("href"));"portada"!=DTM.pageDataLayer.pageType&&"portadilla"!=DTM.pageDataLayer.pageType&&"tags"!=DTM.pageDataLayer.pageType||(null!=new RegExp("([/]$)").exec(e)||(e+="/"));return e},isPageDataLayerDelay:function(){var e=this.pageDataLayerParamExists("dataLayerDelay")?DTM.pageDataLayer.dataLayerDelay:"",t=this.pageDataLayerParamExists("paywallOn")?DTM.pageDataLayer.paywallOn:"";return""!=e?e:""!=t&&t},setFlag:function(e){if(void 0===this.flags[e]||!0===DTM.dataLayer.generated||!0===this.flags[e]||"timeout"==DTM.dataLayer.sync)return!1;this.flags[e]=!0;var t=!0;for(var a in this.flags)!1===this.flags[a]&&(t=!1);t&&!DTM.dataLayer.generated&&(DTM.dataLayer.generated=!0,DTM.notify("Data Layer "+(!0===DTM.dataLayer.asyncPV?"re":"")+"generated (all flags completed)"),DTM.utils.dispatchEvent("DTMDataLayerGenerated"),DTM.tools.marfeel.utils.markTimeLoads("Flags completed"))},fixes:function(){if(DTM.tools.marfeel.utils.markTimeLoads("Fixes start"),"multi ia"==_satellite.getVar("sysEnv")&&(this.setParam("page.pageInfo.sysEnv","fbia"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:fbia:sysEnv":"arc:fbia:sysEnv"),"portada"==_satellite.getVar("pageType")&&"home"!=_satellite.getVar("primaryCategory")&&(this.setParam("page.category.pageType","portadilla"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:pageType:portadillas":"arc:pageType:portadillas"),"brasil.elpais.com"==_satellite.getVar("server")&&0!=_satellite.getVar("pageName").indexOf("elpaiscom/brasil/")&&(this.setParam("page.pageInfo.pageName",_satellite.getVar("pageName").replace(/^elpaiscom\//gi,"elpaiscom/brasil/")),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-pageName-brasil":"arc:error-dataLayer-pageName-brasil"),_satellite.getVar("platform")==DTM.PLATFORM.FBIA&&(this.setParam("page.pageInfo.brandedContent",this.isBrandedContent(!1)),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-brandedcontent-ia":"arc:error-dataLayer-brandedcontent-ia"),"epmas"==_satellite.getVar("primaryCategory")){if("epmas>suscripcion>checkout"==_satellite.getVar("subCategory2")||"epmas>suscripcion>payment"==_satellite.getVar("subCategory2"))if(""!=DTM.utils.getQueryParam("wrongPayment",location.href)){var e=(-1!=_satellite.getVar("pageName").indexOf("elpaiscom/brasil")?"elpaiscom/brasil":"elpaiscom")+location.pathname+("epmas>suscripcion>checkout"==_satellite.getVar("subCategory2")?"checkout/errorpago":"payment/errorPago");this.setParam("page.pageInfo.pageName",e),this.setParam("page.category.subCategory2","epmas>suscripcion>proceso_pago_fallo"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-wrongPayment":"arc:error-dataLayer-wrongPayment"}for(var t=["/suscripciones/promo-96-euros/","/suscripciones/promo-euro/","elpais.com/promo-3meses-1euro/","/promo-1-euro-dos-meses/","/promo-14-meses-96-euros/","/suscripciones/condiciones-servicios/empresas/","/suscripciones/america/digital/","/assinaturas/digital/","/assinatura/digital/","/assinatura/promo","assinaturas/condicoes","suscripciones/digital/semestral/condiciones","suscripciones/digital/bienal/condiciones","suscripciones/digital/promo","/condiciones/","assinaturas/clausula-privacidade","suscripciones/america/condiciones","suscripciones/condiciones","suscripciones/clausula","suscripciones/promo-todo","suscripciones/fin-de-semana","suscripciones/lunes-viernes","/condicoes/"],a=0,r=t.length;a<r;a++)-1!=location.pathname.indexOf(t[a])&&-1!=_satellite.getVar("pageName").indexOf("subscriptions/sign-in/")&&(this.setParam("page.pageInfo.pageName",-1!=_satellite.getVar("pageName").indexOf("elpaiscom/brasil")?"elpaiscom/brasil"+location.pathname:"elpaiscom"+location.pathname),this.setParam("page.category.subCategory2","epmas>suscripcion>productos"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-conditionsPage-"+t[a]:"arc:error-conditionsPage-"+t[a]);-1!=_satellite.getVar("destinationURL").indexOf("elpais.com/preguntas-frecuentes/")&&"elpaiscom/preguntas-frecuentes/"!=_satellite.getVar("pageName")&&(this.setParam("page.pageInfo.pageName","elpaiscom/preguntas-frecuentes/"),this.setParam("page.category.primaryCategory","epmas"),this.setParam("page.category.subCategory1","epmas>suscripcion"),this.setParam("page.category.subCategory2","epmas>suscripcion>preguntas-frecuentes"),this.setParam("page.category.pageType","suscripcion"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-faq":"arc:error-dataLayer-faq"),-1!=_satellite.getVar("destinationURL").indexOf("elpais.com/aviso-impago")&&-1==_satellite.getVar("pageName").indexOf("aviso-impago")&&(this.setParam("page.pageInfo.pageName","elpaiscom/aviso-impago/"),this.setParam("page.category.primaryCategory","epmas"),this.setParam("page.category.subCategory1","epmas>suscripcion"),this.setParam("page.category.subCategory2","epmas>suscripcion>aviso-impago"),this.setParam("page.category.pageType","suscripcion"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-avisoImpago":"arc:error-dataLayer-avisoImpago"),-1!=_satellite.getVar("destinationURL").indexOf("elpais.com/aviso-datos-de-facturacion")&&-1==_satellite.getVar("pageName").indexOf("aviso-datos-de-facturacion")&&(this.setParam("page.pageInfo.pageName","elpaiscom/aviso-datos-de-facturacion/"),this.setParam("page.category.primaryCategory","epmas"),this.setParam("page.category.subCategory1","epmas>suscripcion"),this.setParam("page.category.subCategory2","epmas>suscripcion>aviso-datos-de-facturacion"),this.setParam("page.category.pageType","suscripcion"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-aviso-datos-de-facturacion":"arc:error-dataLayer-aviso-datos-de-facturacion")}-1!=_satellite.getVar("pageName").indexOf("elpaiscom/mexico")&&"mexico"!=_satellite.getVar("edition")?(this.setParam("page.pageInfo.edition","mexico"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"):-1==_satellite.getVar("pageName").indexOf("elpaiscom/america/")&&-1==_satellite.getVar("pageName").indexOf("elpaiscom/suscripciones/america")||"america"==_satellite.getVar("edition")?-1!=_satellite.getVar("pageName").indexOf("elpaiscom/english")&&"english"!=_satellite.getVar("edition")?(this.setParam("page.pageInfo.edition","english"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"):-1!=_satellite.getVar("pageName").indexOf("elpaiscom/brasil")&&"brasil"!=_satellite.getVar("edition")?(this.setParam("page.pageInfo.edition","brasil"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"):-1!=_satellite.getVar("pageName").indexOf("elpaiscom/chile")&&"chile"!=_satellite.getVar("edition")?(this.setParam("page.pageInfo.edition","chile"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"):-1!=_satellite.getVar("pageName").indexOf("elpaiscom/argentina")&&"argentina"!=_satellite.getVar("edition")?(this.setParam("page.pageInfo.edition","argentina"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"):-1!=_satellite.getVar("pageName").indexOf("elpaiscom/america-colombia")&&"colombia"!=_satellite.getVar("edition")&&(this.setParam("page.pageInfo.edition","colombia"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"):(this.setParam("page.pageInfo.edition","america"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-edition":"arc:error-dataLayer-edition"),"1"!=_satellite.getVar("onsiteSearch")||DTM.utils.getQueryParam("q")||(this.setParam("page.pageInfo.onsiteSearch","0"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", buscador:onsiteSearch":"buscador:onsiteSearch"),DTM.tools.marfeel.utils.markTimeLoads("Fixes End")},pageDataLayerParamExists:function(e){return"undefined"!=typeof DTM&&void 0!==DTM.pageDataLayer&&(void 0!==DTM.pageDataLayer[e]||"string"==typeof DTM.pageDataLayer[e]&&""==DTM.pageDataLayer[e])},paramExists:function(e){if("string"==typeof e){var t=e.split("."),a=t.length,r=window.digitalData[t[0]];if(void 0===r)return!1;if(a>1){for(var i=1;i<a;i++)if(void 0===(r=r[t[i]]))return!1;return!0}return!0}return!1},setParam:function(e,t){if(!this.paramExists(e)||"string"!=typeof e||void 0===t)return!1;var a=e.split(".");switch(a.length){case 1:digitalData[a[0]]=t;break;case 2:digitalData[a[0]][a[1]]=t;break;case 3:digitalData[a[0]][a[1]][a[2]]=t;break;default:return!1}},formatDataLayerParam:function(e){return!!DTM.dataLayer.pageDataLayerParamExists(e)&&("string"!=typeof DTM.pageDataLayer[e]||"pageTitle"==e?DTM.pageDataLayer[e]:DTM.pageDataLayer[e].toLowerCase().trim())},isValidPage:function(){return-1!=this.vars.server.indexOf("elpais.com")||this.vars.translatePage||"production"!=_satellite.environment.stage&&-1!=this.vars.server.indexOf("prisa-el-pais-sandbox.cdn.arcpublishing.com")},getReferringURL:function(){var e=this.vars.referringURL;if(this.asyncPV)e=this.vars.destinationURL.replace(/[\?].*?$/g,"");else if(this.vars.platform==DTM.PLATFORM.FBIA){var t=DTM.utils.getQueryParam("ia_referrer",location.href);e=""!=t?-1==t.indexOf("https://")?"https://"+t:t:this.pageDataLayerParamExists("referringURL")?DTM.pageDataLayer.referringURL:document.referrer}else e=this.pageDataLayerParamExists("referringURL")?DTM.pageDataLayer.referringURL:document.referrer;return e},getReferringDomain:function(e){if(""==(e="string"==typeof e?e:"string"==typeof document.referrer?document.referrer:""))return"";try{e=new URL(e).hostname}catch(e){DTM.notify("Error al recuperar el referringDomain: "+e,"error")}return e},getPageHeight:function(){return this.vars.platform==DTM.PLATFORM.WEB&&void 0!==document.body&&void 0!==document.body.clientHeight?document.body.clientHeight:"not-set"},getPublisherID:function(){var e="";if(this.vars.platform==DTM.PLATFORM.WEB&&(e="ElpaisWeb","elpais.com"==this.vars.server||"cincodias.elpais.com"==this.vars.server)){var t={deportes:"ElpaisdeportesWeb","mamas-papas":"ElpaismamasypapasWeb",tecnologia:"ElpaistecnologiaWeb",icon:"ElpaisiconWeb","icon-design":"IcondesignWeb"},a=/http.?:\/\/([^\/]*)\/([^\/]*)\//i.exec(this.vars.destinationURL);e=this.vars.destinationURL.indexOf("el-comidista")>-1?"ElcomidistaelpaisWeb":this.vars.destinationURL.indexOf("cincodias")>-1?"CincodiaselpaisWeb":a&&t.hasOwnProperty(a[2])?t[a[2]]:"ElpaisWeb"}return e},getArticleID:function(){var e=this.pageDataLayerParamExists("destinationURL")?DTM.pageDataLayer.destinationURL:location.href,t=/http.?:\/\/([^\/]*)\/([^\/]*)\/(\d+)\/(\d+)\/(\d+)\/([^\/]*)\/(.*)\.html/i.exec(e);return t?t[7]:""},getArticleTitle:function(){if("articulo"!=this.vars.pageType)return"";var e=DTM.utils.getMetas("property","og:title");return""!=e?e[0]:this.vars.pageTitle},getCampaign:function(){for(var e="",t="",a=["id_externo_display","id_externo_sem","id_externo_nwl","id_externo_promo","id_externo_rsoc","id_externo_ref","id_externo_portada","id_externo_noti","sdi","sse","sma","prm","sap","ssm","afl","agr","int","noti","idexterno","cid","utm_campaign"],r=0,i=a.length;r<i;r++){var s=DTM.utils.getQueryParam(a[r]);""!=s&&(e=s,t=a[r])}if("id_externo_rsoc"==t||"ssm"==t){var n=DTM.utils.getQueryParam("id_externo_ads");e=""!=(n=""==n?DTM.utils.getQueryParam("ads"):n)?e+"-"+n:e}else if("prm"==t){var o=DTM.utils.getQueryParam("csl");e=""!=o?e+"_"+o:e}else"cid"==t&&(e=DTM.utils.encoder.decode(DTM.utils.decodeURIComponent(e)));return document.location.href.indexOf("utm_campaign")>-1&&(e=document.location.href.match(/utm\_campaign.*/gi)[0].split("&")[0].split("=")[1]),e},isBrandedContent:function(e){var t=!1;if(!1===e||!this.pageDataLayerParamExists("brandedContent")||"1"!=DTM.pageDataLayer.brandedContent&&1!=DTM.pageDataLayer.brandedContent){var a=JSON.stringify(this.vars.tags);!0!==(t=-1!=a.indexOf('"192925"')||-1!=a.indexOf('"197500"')||-1!=a.indexOf('"197760"')||-1!=a.indexOf('"branded_content'))&&(t=-1!=this.vars.secondaryCategories.indexOf("branded_content")||-1!=this.vars.secondaryCategories.indexOf("brandedContent"))}else t=!0;return!0===t?"1":"0"},getUrlParams:function(){var e=location.href;return this.vars.platform==DTM.PLATFORM.FBIA&&(e=DTM.utils.getQueryParam("destinationURL",location.href)),e=""!=e?e:location.href,DTM.utils.getQueryParam("",e)},getDeviceType:function(){var e=navigator.userAgent;return/(tablet|ipad|playbook|silk)|(android(?!.*mobi))/i.test(e)?"tablet":/Mobile|iP(hone|od)|Android|BlackBerry|IEMobile|Kindle|Silk-Accelerated|(hpw|web)OS|Opera M(obi|ini)/.test(e)?"mobile":"desktop"},getARCID:function(){var e="not-set";try{var t=DTM.utils.localStorage.getItem("ArcId.USER_INFO"),a=DTM.utils.localStorage.getItem("ArcP");null!=t?e=null!=(t=JSON.parse(t))&&t.hasOwnProperty("uuid")?t.uuid:"not-set":null!=a&&(a=JSON.parse(DTM.utils.localStorage.getItem("ArcP"))).hasOwnProperty("anonymous")&&a.anonymous.hasOwnProperty("reg")&&a.anonymous.reg.hasOwnProperty("l")&&!0===a.anonymous.reg.l&&(e=null!=t&&t.hasOwnProperty("uuid")?t.uuid:"not-set")}catch(t){DTM.notify("Error al acceder al item ArcId.USER_INFO de localStorage","error"),e="not-set"}return e},getUserInfo:function(){if(DTM.tools.marfeel.utils.markTimeLoads("getUserInfo pre execute"),null!=DTM.utils.getCookie("pmuser"))try{var e="not-set",t="",a="",r="not-set",i=DTM.utils.getCookie("eptz");t=null!=(s=JSON.parse(DTM.utils.getCookie("pmuser"))).NOM?s.NOM:"",e=null!=s.uid?s.uid:DTM.utils.getVisitorID(),a="T1"==s.UT||"T2"==s.UT?"suscriptor":"REGISTERED"==s.UT?"registrado":"anonimo","T1"==s.UT&&(r="T1"),"T2"==s.UT&&(r="T2"),DTM.dataLayer.setParam("user.registeredUser","ANONYMOUS"!=s.UT?"1":"0"),DTM.dataLayer.setParam("user.type",a),DTM.dataLayer.setParam("user.subscriptionType",r),DTM.dataLayer.setParam("user.profileID",""!=e?e:"not-set"),DTM.dataLayer.setParam("user.name",t),DTM.dataLayer.setParam("user.country",null==i?"not-set":i),DTM.dataLayer.setParam("user.experienceCloudID",DTM.utils.getVisitorID())}catch(e){console.log(e)}else if(null!=DTM.utils.getCookie("uid_ns"))try{var s;e="not-set",t="",i=DTM.utils.getCookie("eptz");t=null!=(s=DTM.utils.getCookie("uid_ns").split("#"))[s.length-3]?s[s.length-3]:"",e=null!=s[0]?s[0]:"",DTM.dataLayer.setParam("user.registeredUser",null!=s[s.length-3]?"1":"0"),DTM.dataLayer.setParam("user.type",null!=s[s.length-3]?"registrado":"anonimo"),DTM.dataLayer.setParam("user.profileID",""!=e?e:"not-set"),DTM.dataLayer.setParam("user.name",t),DTM.dataLayer.setParam("user.country",null==i?"not-set":i),DTM.dataLayer.setParam("user.experienceCloudID",DTM.utils.getVisitorID())}catch(e){console.log(e)}else 1==DTM.dataLayer.delay&&DTM.dataLayer.pageDataLayerParamExists("profileID")&&"not-set"!=DTM.pageDataLayer.profileID?(DTM.dataLayer.setParam("user.country",DTM.dataLayer.pageDataLayerParamExists("country")?DTM.pageDataLayer.country:""),DTM.dataLayer.setParam("user.profileID",DTM.dataLayer.pageDataLayerParamExists("profileID")?DTM.pageDataLayer.profileID:"not-set"),DTM.dataLayer.setParam("user.registeredUser",DTM.dataLayer.pageDataLayerParamExists("registeredUser")?"number"==typeof DTM.pageDataLayer.registeredUser?DTM.pageDataLayer.registeredUser.toString():DTM.pageDataLayer.registeredUser:"not-set"),DTM.dataLayer.setParam("user.ID",DTM.dataLayer.pageDataLayerParamExists("userID")?DTM.pageDataLayer.userID:DTM.dataLayer.getARCID()),DTM.dataLayer.setParam("user.name",DTM.dataLayer.pageDataLayerParamExists("userName")?DTM.pageDataLayer.userName:"not-set"),DTM.dataLayer.setParam("page.pageInfo.editionNavigation",DTM.dataLayer.pageDataLayerParamExists("editionNavigation")?DTM.pageDataLayer.editionNavigation:"not-set"),DTM.dataLayer.setParam("user.experienceCloudID",DTM.utils.getVisitorID()),DTM.notify("User Info received from Data Layer updated")):(DTM.notify("User info not calculated","error"),DTM.dataLayer.setParam("user.experienceCloudID",DTM.utils.getVisitorID()),DTM.dataLayer.setParam("user.profileID",DTM.utils.getVisitorID()),DTM.dataLayer.setParam("user.registeredUser","0"),DTM.dataLayer.setParam("user.type","anonimo"));DTM.dataLayer.setFlag("userInfo"),DTM.dataLayer.paywall.getPaywallInfo(),DTM.tools.marfeel.utils.markTimeLoads("getUserInfo post execute")},paywall:{cookieSusc:"pmuser",products:_satellite.getVar("paywall:productList"),cartSections:["epmas>suscripcion>home","epmas>suscripcion>checkout","epmas>suscripcion>confirmation","epmas>suscripcion>payment","epmas>suscripcion>login","epmas>suscripcion>registro","epmas>suscripcion>verify-gift","epmas>suscripcion>regalo-aniversario"],cookiePaywallProduct:!1,getPaywallInfo:function(){this.getPaywallAccess(),this.getPaywallType(),this.getUserType(),this.getUserSubscriptions(),this.getSignwallType(),this.getPaywallActive(),this.getPaywallContentAdType(),this.getPaywallCounter(),this.getPaywallContentBlocked(),this.getPaywallCartProduct(),this.getPaywallTransactionOrigin(),this.getPaywallTransactionType(),DTM.notify("Paywall info calculated"),DTM.dataLayer.setFlag("paywallInfo")},getUserType:function(){var e=DTM.dataLayer.pageDataLayerParamExists("userType")?DTM.pageDataLayer.userType:"not-set",t="not-set",a=e,r=[];if("0"==_satellite.getVar("user:registeredUser"))return DTM.dataLayer.setParam("user.type","anonimo"),void(this.cookiePaywallProduct="no-suscriptor");try{var i=DTM.utils.getCookie(this.cookieSusc);if(null!=i){var s=JSON.parse(i);r=s.skus;var n=!1;"T1"!=s.UT&&"T2"!=s.UT||(n=!0,t="suscriptor"),n||(t="1"==_satellite.getVar("user:registeredUser")?"registrado":"not-set")}}catch(e){DTM.notify("Error al calcular el userType","error"),t="not-set"}return a="not-set"!=e&&DTM.dataLayer.delay?e:t,DTM.dataLayer.setParam("user.type",a),r.length>0&&(this.cookiePaywallProduct=r.join(",")),a},getPaywallAccess:function(){"not-set"==_satellite.getVar("paywall:access")&&("brasil.elpais.com"==_satellite.getVar("server")||"english.elpais.com"==_satellite.getVar("server")?DTM.dataLayer.setParam("paywall.access",_satellite.getVar("server")):DTM.dataLayer.setParam("paywall.access","elpais.com"))},getSignwallType:function(){DTM.dataLayer.pageDataLayerParamExists("signwallType")?DTM.dataLayer.setParam("paywall.signwallType",DTM.pageDataLayer.signwallType):DTM.dataLayer.pageDataLayerParamExists("paywallType")?DTM.dataLayer.setParam("paywall.signwallType",DTM.pageDataLayer.paywallType):DTM.dataLayer.setParam("paywall.signwallType","free"),"freemium"==_satellite.getVar("paywall:type")&&"reg_metered"==_satellite.getVar("paywall:signwallType")&&"elpais.com"!=_satellite.getVar("server")&&(DTM.dataLayer.setParam("paywall.signwallType","free"),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer:signwallType:ediciones":"arc:error-dataLayer:signwallType:ediciones")},getPaywallActive:function(){DTM.dataLayer.pageDataLayerParamExists("paywallActive")?(DTM.dataLayer.setParam("paywall.active",DTM.pageDataLayer.paywallActive),"freemium"==_satellite.getVar("paywall:type")&&"reg_metered"==_satellite.getVar("paywall:signwallType")&&!0===DTM.pageDataLayer.paywallActive&&(DTM.dataLayer.setParam("paywall.active",!1),DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer:reg_metered:paywallActive":"arc:error-dataLayer:reg_metered:paywallActive")):0==DTM.dataLayer.delay?DTM.dataLayer.setParam("paywall.active",!1):"timeout"!=DTM.dataLayer.sync?(DTM.dataLayer.setParam("paywall.active",!1), DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-paywallActive":"arc:error-dataLayer-paywallActive"):DTM.dataLayer.setParam("paywall.active","not-set")},getPaywallTransactionOrigin:function(){if(DTM.dataLayer.setParam("paywall.transactionOrigin",DTM.dataLayer.pageDataLayerParamExists("transactionOrigin")?DTM.pageDataLayer.transactionOrigin:""),""==_satellite.getVar("paywall:transactionOrigin")&&"epmas>suscripcion>home"==_satellite.getVar("subCategory2")||"epmas>landing_campaign_premium_user"==_satellite.getVar("subCategory2")){var e="",t=DTM.utils.decodeURIComponent(DTM.utils.getQueryParam("backURL")),a=DTM.utils.decodeURIComponent(DTM.utils.getQueryParam("adobe_mc_ref")),r=DTM.utils.decodeURIComponent(DTM.utils.getQueryParam("backURLAMP")),i=-1!=_satellite.getVar("referringURL").indexOf("elpais.com")?_satellite.getVar("referringURL"):"";if(""!=r?e=r:""!=t&&-1==e.indexOf("/subscriptions/")&&-1==e.indexOf("/suscripciones/")?e=t:""!=a?e=a:""!=i&&(e=i),-1==e.indexOf("/subscriptions/")&&-1==e.indexOf("/suscripciones/")||(e=""),""!=e)e=e.replace(/[\?#].*?$/g,""),/^((.*)elpais.com)$/.exec(e)&&(e+="/");DTM.dataLayer.setParam("paywall.transactionOrigin",e)}},getPaywallCartProduct:function(){if("not-set"==_satellite.getVar("paywall:cartProduct")&&-1!=this.cartSections.indexOf(_satellite.getVar("subCategory2"))&&"epmas>suscripcion>home"!=_satellite.getVar("subCategory2")){var e=DTM.dataLayer.pageDataLayerParamExists("paywallProduct")&&DTM.pageDataLayer.paywallProduct?DTM.pageDataLayer.paywallProduct:"not-set";if("not-set"==e){var t=DTM.utils.localStorage.getItem("sku");t&&DTM.dataLayer.setParam("paywall.cartProduct",t)}else DTM.dataLayer.setParam("paywall.cartProduct",e)}},getPaywallCounter:function(){var e=DTM.dataLayer.pageDataLayerParamExists("paywallCounter")?DTM.pageDataLayer.paywallCounter.toString():"not-set";"freemium"==_satellite.getVar("paywall:type")&&("reg_metered"!=_satellite.getVar("paywall:signwallType")&&"not-set"!=e&&(e="not-set",DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer:paywallCounter:no-reg_metered":"arc:error-dataLayer:paywallCounter:no-reg_metered"),"reg_metered"==_satellite.getVar("paywall:signwallType")&&"1"==_satellite.getVar("user:registeredUser")&&(e="usuario-logueado",DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer:paywallCounter:logueados":"arc:error-dataLayer:paywallCounter:logueados"),"reg_metered"==_satellite.getVar("paywall:signwallType")&&"signwall"==_satellite.getVar("paywall:contentAdType")&&(e="-1",DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer:paywallCounter:signwall:bloqueante":"arc:error-dataLayer:paywallCounter:signwall:bloqueante")),DTM.dataLayer.setParam("paywall.counter",e)},getPaywallContentAdType:function(){var e=DTM.dataLayer.pageDataLayerParamExists("contentAdType")?DTM.pageDataLayer.contentAdType:"",t=DTM.dataLayer.pageDataLayerParamExists("paywallAd")?DTM.pageDataLayer.paywallAd:"",a=""!=e?e:""!=t?t:(DTM.dataLayer.delay,"none");"freemium"==_satellite.getVar("paywall:type")&&"reg_metered"==_satellite.getVar("paywall:signwallType")&&"signwall"==_satellite.getVar("paywall:contentAdType")&&"1"==_satellite.getVar("user:registeredUser")&&(a="none"),DTM.dataLayer.setParam("paywall.contentAdType",a)},getPaywallContentBlocked:function(){var e=DTM.dataLayer.pageDataLayerParamExists("contentBlocked")?DTM.pageDataLayer.contentBlocked:DTM.dataLayer.pageDataLayerParamExists("paywallStatus")?DTM.pageDataLayer.paywallStatus.toString():"not-set";0==DTM.dataLayer.delay&&"free"==_satellite.getVar("paywall:signwallType")&&"0"!=_satellite.getVar("paywall:contentBlocked")?(e="0",DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-paywallStatus":"arc:error-dataLayer-paywallStatus"):1==DTM.dataLayer.delay&&"timeout"!=DTM.dataLayer.sync&&"not-set"==e&&(e="reg"==_satellite.getVar("paywall:signwallType")&&"0"==_satellite.getVar("user:registeredUser")?"1":"0",DTM.internalTest=""!=DTM.internalTest?DTM.internalTest+", arc:error-dataLayer-contentBlocked-vacio":"arc:error-dataLayer-contentBlocked-vacio"),DTM.dataLayer.setParam("paywall.contentBlocked",e)},getUserSubscriptions:function(){var e=DTM.dataLayer.pageDataLayerParamExists("paywallProduct")&&DTM.pageDataLayer.paywallProduct?DTM.pageDataLayer.paywallProduct:"not-set",t=e,a=DTM.dataLayer.pageDataLayerParamExists("paywallProduct")&&"not-set"!=DTM.pageDataLayer.paywallProduct&&""!=DTM.pageDataLayer.paywallProduct?DTM.pageDataLayer.paywallProduct:"",r=DTM.dataLayer.pageDataLayerParamExists("paywallProductOther")&&"not-set"!=DTM.pageDataLayer.paywallProductOther&&""!=DTM.pageDataLayer.paywallProductOther?DTM.pageDataLayer.paywallProductOther:"";if("not-set"!=e&&-1==this.cartSections.indexOf(_satellite.getVar("subCategory2"))&&DTM.dataLayer.delay&&a!=r){t=""!=a&&""!=r?"brasil.elpais.com"==_satellite.getVar("server")?r+","+a:a+","+r:""!=a?e:""!=r?r:"suscriptor"==_satellite.getVar("user:type")?"not-set":"no-suscriptor"}else{t=!1!==this.cookiePaywallProduct?this.cookiePaywallProduct:"suscriptor"==_satellite.getVar("user:type")?"not-set":"no-suscriptor"}("0"==_satellite.getVar("user:registeredUser")||"registrado"==_satellite.getVar("user:type")&&"not-set"==_satellite.getVar("user:subscriptions"))&&(t="no-suscriptor"),DTM.dataLayer.setParam("user.subscriptions",t),_satellite.setVar("mboxSubscriptions",t)},getPaywallTransactionType:function(){if("epmas>suscripcion>confirmation"==_satellite.getVar("subCategory2")||"epmas>suscripcion>checkout"==_satellite.getVar("subCategory2")){var e=DTM.dataLayer.pageDataLayerParamExists("paywallTransactionType")?DTM.pageDataLayer.paywallTransactionType:"",t=DTM.dataLayer.pageDataLayerParamExists("paywallSubsType")?DTM.pageDataLayer.paywallSubsType:"",a=""!=e?e:""!=t?t:"clasico";DTM.dataLayer.setParam("paywall.transactionType",a)}},getPaywallType:function(){var e="none";DTM.dataLayer.pageDataLayerParamExists("dataLayerVersion")&&"v2"==DTM.pageDataLayer.dataLayerVersion?e="freemium":!0===DTM.dataLayer.delay&&DTM.dataLayer.pageDataLayerParamExists("videoContent")&&(e="metered"),DTM.dataLayer.setParam("paywall.type",e)}}},utils:{addEvent:function(e,t,a){document.addEventListener?e.addEventListener(t,a,!1):e.attachEvent("on"+t,a)},copyObject:function(e){if("object"!=typeof e)return!1;var t={};for(var a in e)t[a]=e[a];return t},dispatchEvent:function(e){var t;"function"==typeof Event?t=new Event(e):(t=document.createEvent("Event")).initEvent(e,!0,!0),document.dispatchEvent&&document.dispatchEvent(t)},decodeURIComponent:function(e){var t=e;try{t=decodeURIComponent(e)}catch(a){t=e,DTM.notify("decodedComponent: error al decodificar el componente: "+e,"error")}return t},encoder:{_keyStr:"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=",encode:function(e){var t,a,r,i,s,n,o,l="",d=0;for(e=this._utf8_encode(e);d<e.length;)i=(t=e.charCodeAt(d++))>>2,s=(3&t)<<4|(a=e.charCodeAt(d++))>>4,n=(15&a)<<2|(r=e.charCodeAt(d++))>>6,o=63&r,isNaN(a)?n=o=64:isNaN(r)&&(o=64),l=l+this._keyStr.charAt(i)+this._keyStr.charAt(s)+this._keyStr.charAt(n)+this._keyStr.charAt(o);return l},decode:function(e){var t,a,r,i,s,n,o="",l=0;for(e=e.replace(/[^A-Za-z0-9\+\/\=]/g,"");l<e.length;)t=this._keyStr.indexOf(e.charAt(l++))<<2|(i=this._keyStr.indexOf(e.charAt(l++)))>>4,a=(15&i)<<4|(s=this._keyStr.indexOf(e.charAt(l++)))>>2,r=(3&s)<<6|(n=this._keyStr.indexOf(e.charAt(l++))),o+=String.fromCharCode(t),64!=s&&(o+=String.fromCharCode(a)),64!=n&&(o+=String.fromCharCode(r));return this._utf8_decode(o)},_utf8_encode:function(e){e=e.replace(/\r\n/g,"\n");for(var t="",a=0;a<e.length;a++){var r=e.charCodeAt(a);r<128?t+=String.fromCharCode(r):r>127&&r<2048?(t+=String.fromCharCode(r>>6|192),t+=String.fromCharCode(63&r|128)):(t+=String.fromCharCode(r>>12|224),t+=String.fromCharCode(r>>6&63|128),t+=String.fromCharCode(63&r|128))}return t},_utf8_decode:function(e){for(var t="",a=0,r=c1=c2=0;a<e.length;)(r=e.charCodeAt(a))<128?(t+=String.fromCharCode(r),a++):r>191&&r<224?(c2=e.charCodeAt(a+1),t+=String.fromCharCode((31&r)<<6|63&c2),a+=2):(c2=e.charCodeAt(a+1),c3=e.charCodeAt(a+2),t+=String.fromCharCode((15&r)<<12|(63&c2)<<6|63&c3),a+=3);return t}},formatData:function(e){var t={};for(var a in e)if(null!=e[a]){if("videoName"==a)var r="object"!=typeof e[a]?e[a].toString().replace(/"/g,'\\"'):e[a];else r="object"!=typeof e[a]?e[a].toString().toLowerCase().replace(/"/g,'\\"'):e[a];switch(a){case"videoName":r=r.replace(/\-\d+$/,"").replace(/#/g,"");break;case"userID":case"pageTitle":case"videoYoutubeChannel":case"articleTitle":case"uniqueVideoID":case"photoURL":case"registerOrigin":case"registerProd":r=e[a];break;case"pageName":r=_satellite.getVar("siteID")+e[a].replace(/[\?#].*?$/g,"").replace(/http.?:\/\/[^\/]*/,"")}t[a]=r}else t[a]="";return t},formatDate:function(e){return e<10?"0"+e:e},getCookie:function(e){for(var t=e+"=",a=document.cookie.split(";"),r=0,i=a.length;r<i;r++){for(var s=a[r];" "==s.charAt(0);)s=s.substring(1,s.length);if(0==s.indexOf(t))return s.substring(t.length,s.length)}return null},checkShownBlock:function(){var e="NA",t="elpais";if(document.querySelectorAll(".b-t-ipcatalunya").length>0){var a=".b-t-ipcatalunya",r=document.querySelectorAll(".b-t-ipcatalunya > div article"),i=0;if(window.seteoVariableControl=function(){localStorage.setItem("reto_bloque_portada","reto_bloque_portada")},document.querySelector(a)&&"block"==window.getComputedStyle(document.querySelector(a)).display&&"undefined"!=typeof digitalData){for(i=0;i<r.length-1;i++)r[i].addEventListener("click",seteoVariableControl);e=e.indexOf("NA")>-1?t+":EP-R001:reto bloque portada":e+"|"+t+":EP-R001:reto bloque portada"}}document.querySelectorAll(".tooltip").length>0&&(window.seteoVariableControlTooltip=function(){localStorage.setItem("reto_tooltip","reto_tooltip")},document.querySelectorAll(".tooltip").length>0&&"undefined"!=typeof digitalData&&document.querySelector(".tooltip > article")&&(document.querySelector(".tooltip > article").addEventListener("click",seteoVariableControlTooltip),e=e.indexOf("NA")>-1?t+":tooltip":e+"|"+t+":tooltip"));return e},checkOriginBlock:function(){var e="elpais";return"reto_bloque_portada"==localStorage.getItem("reto_bloque_portada")&&"undefined"!=typeof digitalData&&document.location.href.indexOf("/espana/catalunya/")>-1?(localStorage.removeItem("reto_bloque_portada"),e+":EP-R001:reto bloque portada"):"reto_tooltip"==localStorage.getItem("reto_tooltip")&&"undefined"!=typeof digitalData?(localStorage.removeItem("reto_tooltip"),e+":tooltip"):""},checkBrowser:function(e){return e.match(/FB\_IAB|FB4A\;FBAV/i)?"Facebook":e.match(/FBAN\/EMA/i)?"Facebook Lite":e.indexOf("FB_AIB")>-1?"Facebook Messenger":e.indexOf("MessengerLite")>-1?"Facebook Messenger Lite":e.indexOf("FBAN")>-1?"Facebook Groups":e.indexOf("Instagram")>-1?"Instagram":e.indexOf("Twitter")>-1?"Twitter":e.indexOf("Twitterrific")>-1?"Twitterrific":e.indexOf("WhatsApp")>-1?"WhatsApp":e.indexOf("edge")>-1?"MS Edge":e.indexOf("edg/")>-1?"Edge (chromium based)":e.indexOf("opr")>-1&&window.opr?"Opera":e.match(/chrome|chromium|crios/i)?"Chrome":e.indexOf("trident")>-1?"IE":e.match(/firefox|fxios/i)?"Mozilla Firefox":e.match(/LinkedInApp|LinkedIn/i)?"LinkedIn":e.match(/musical\_ly|TikTokLIVEStudio/i)?"TikTok":e.indexOf("safari")>-1?"Safari":e.indexOf("Pinterest")>-1?"Pinterest":"Otros"},getMetas:function(e,t){if(!e||!t||"function"!=typeof document.getElementsByTagName)return[];e=e.toLowerCase(),t=t.toLowerCase();var a=[];if("function"==typeof document.querySelectorAll)document.querySelectorAll("meta["+e+"='"+t+"']").forEach((function(e){a.push(e.getAttribute("content"))}));else{var r=document.getElementsByTagName("meta");for(i=0,j=r.length;i<j;i++)r[i].getAttribute(e)==t&&a.push(r[i].getAttribute("content"))}return a},getQueryParam:function(e,t){var a="";if(e=void 0===e||""==e?-1:e,url=void 0===t||""==t?window.location.href:t,!1!==DTM.dataLayer.vars.urlParams&&void 0===t){var r=DTM.dataLayer.vars.urlParams;return-1!=e?r.hasOwnProperty(e)?r[e]:"":DTM.dataLayer.vars.urlParams}if(-1==e){if(a=[],-1!=url.indexOf("?"))for(var i=url.substr(url.indexOf("?")+1).replace(/\?/g,"&"),s=0,n=(i=i.split("&")).length;s<n;s++)if(-1!=i[s].indexOf("=")){var o=i[s].substr(0,i[s].indexOf("=")),l=i[s].substr(i[s].indexOf("=")+1);a[o]=l.replace(/#(.*)/g,"")}else a[i[s]]=""}else{a="",e=e.replace(/[\[]/,"\\[").replace(/[\]]/,"\\]");var d=new RegExp("[\\?&]"+e+"=([^&#]*)").exec(url);a=null==d?"":DTM.utils.decodeURIComponent(d[1].replace(/\+/g," ").replace(/#(.*)/g,""))}return a},getMarfeelExp:function(){var e=JSON.parse(localStorage.getItem("No_Consent")),t={};if(null!=e){var a=Object.keys(e);for(i=0;i<a.length;i++){t[a[i]+"_capping"]=e[a[i]][a[i]+"_capping"]}}return t},getVisitorID:function(){var e="";if(window.s.visitor.getMarketingCloudVisitorID()&&(e=window.s.visitor.getMarketingCloudVisitorID()),""==e){var t=DTM.utils.getCookie("AMCV_2387401053DB208C0A490D4C%40AdobeOrg");if(void 0!==DTM.s&&void 0!==DTM.s.marketingCloudVisitorID)e=DTM.s.marketingCloudVisitorID;else if(void 0!==t){var a=/(MCMID)\/([^\/]*)\/(.*)/.exec(DTM.utils.decodeURIComponent(t).replace(/\|/g,"/"));e=null!=a?a[2]:""}else e=_satellite.getVar("ecid")}return DTM.tools.marfeel.utils.markTimeLoads("ecidLoad"),e},loadScript:function(e,t,a){var r=document.createElement("script");r.type="text/javascript",r.async=!0;var i=document.getElementsByTagName("head")[0];r.addEventListener?r.addEventListener("load",(function(){t(a)}),!1):r.onload?r.onload=function(){t(a)}:document.all&&(s.onreadystatechange=function(){var e=s.readyState;"loaded"!==e&&"complete"!==e||(t(a),s.onreadystatechange=null)}),r.src=e,i.appendChild(r)},getPlayerType:function(e){var t="html5";return"string"==typeof e&&(e=e.toLowerCase()),null!=e&&(-1!=e.indexOf("youtube")?t="youtube":-1!=e.indexOf("triton")?t="triton":-1!=e.indexOf("dailymotion")?t="dailymotion":-1!=e.indexOf("jwplayer")?t="jwplayer":-1!=e.indexOf("realhls")?t="realhls":-1!=e.indexOf("html5")&&(t="html5")),t},localStorage:{getItem:function(e){var t=!1;try{"undefined"!=typeof localStorage&&"function"==typeof localStorage.getItem&&(t=localStorage.getItem(e))}catch(e){t=!1,DTM.notify("Error in getItem in localStorage","error")}return t},removeItem:function(e){var t=!1;try{"undefined"!=typeof localStorage&&"function"==typeof localStorage.removeItem&&(localStorage.removeItem(e),t=!0)}catch(e){t=!1,DTM.notify("Error in removeItem in localStorage","error")}return t},setItem:function(e,t){var a=!1;try{"undefined"!=typeof localStorage&&"function"==typeof localStorage.setItem&&(localStorage.setItem(e,t),a=!0)}catch(e){a=!1,DTM.notify("Error in setItem in localStorage","error")}return a}},parseJSON:function(e){try{return JSON.parse(e.replace(/\'/g,'"'))}catch(e){return{}}},sendBeacon:function(e,t,a,r,i){if("string"!=typeof e||"object"!=typeof t)return!1;var s=!1;try{if("undefined"==typeof navigator||"function"!=typeof navigator.sendBeacon||void 0!==a&&!0!==a){var n=new Image(1,1),o=[];for(var l in t)void 0!==i&&!1===i?o.push(l+"="+t[l]):o.push(l+"="+encodeURIComponent(t[l]));var d="";"string"==typeof r&&(d=r+"="+String(Math.random()).substr(2,9)),n.src=e.replace(/\?/gi,"")+"?"+o.join("&")+(o.length>0&&""!=d?"&":"")+d,s=!0}else s=navigator.sendBeacon(e,JSON.stringify(t))}catch(e){DTM.notify("Error in sendBeacon: "+e,"error"),s=!1}return s},setCookie:function(e,t,a,r){var i="";if(r){var s=new Date;s.setTime(s.getTime()+r),i="; expires="+s.toGMTString()}document.cookie=e+"="+t+i+";domain="+a+";path=/"},isUE:function(){try{var t=Intl.DateTimeFormat().resolvedOptions().timeZone;return!(void 0===t||!t.startsWith("Europe")&&"Atlantic/Canary"!=t)||(void 0===t||t.length<=3&&-1==t.indexOf("/"))}catch{return console.log("DTM Utils - isUE",e),!0}}},events:{ABDESACT:"ABdesact",ABDETECTED:"ABdetected",ADEND:"adEnd",ADPLAY:"adPlay",ADERROR:"adError",ADSKIP:"adSkip",ADPAUSED:"adPaused",ADRESUMED:"adResumed",ADTIMEOUT:"adTimeout",AUDIOPLAY:"audioPlay",AUDIO50:"audio50",AUDIOEND:"audioEnd",AUDIOPAUSED:"audioPaused",AUDIORESUMED:"audioResumed",AUDIOREADY:"audioReady",BUTTONCLICK:"buttonClick",USERFLOWINIT:"userFlowInit",USERFLOWEND:"userFlowEnd",NOTICEDISPLAYED:"noticeDisplayed",CHECKOUT:"checkout",COMMENTS:"comments",CONC:"conc",CONCPARTICIPATE:"concParticipate",DOWNLOADLINK:"downloadLink",EDITIONCHANGE:"editionChange",EMAILREGISTER:"emailRegister",EXITLINK:"exitLink",EXTERNALLINK:"externalLink",EXTERNALLINKART:"externalLinkArticle",FAVADD:"favAdd",FAVREMOVE:"favRemove",FORMABANDON:"formAbandon",FORMERROR:"formError",FORMSUCESS:"formSucess",GAMEPLAY:"gamePlay",GAMECOMPLETE:"gameComplete",GAMEPICKER:"gamePicker",INTERNALPIXEL:"internalPixel",INTERNALSEARCH:"internalSearch",INTERNALSEARCHEMPTY:"internalSearchEmpty",INTERNALSEARCHRESULTS:"internalSearchResults",PAGEVIEW:"pageView",PAYERROR:"payError",PAYOK:"payOK",PHOTOGALLERY:"photogallery",PHOTOZOOM:"photoZoom",POPUPIMPRESSION:"popupImpression",PRODVIEW:"prodView",PURCHASE:"purchase",READARTICLE:"readArticle",RECOMMENDERIMPRESSION:"recommenderImpression",REELPLAY:"reelPlay",REELEND:"reelEnd",SALEBUTTON:"saleButton",SCADD:"scAdd",SCCHECKOUT:"scCheckout",SCREMOVE:"scRemove",SCROLL:"scroll",SCROLLINF:"scrollInf",SCVIEW:"scView",SHARE:"share",SORT:"sort",SWIPEH:"swipeH",TEST:"test",USERCONNECT:"userConnect",USERDISCONNECT:"userDisconnect",USERLOGIN:"userLogin",USERLOGININIT:"userLoginInit",USERLOGINREGISTER:"userLoginRegister",USERLOGOFF:"userLogOFF",USERNEWSLETTERIN:"userNewsletterIN",USERNEWSLETTEROFF:"userNewsletterOFF",USERPREREGISTER:"userPreRegister",USERREGISTER:"userRegister",USERUNREGISTER:"userUnregister",USERSUBSCRIPTION:"userSubscription",USERVINC:"userVinc",UUVINC:"UUvinc",VIDEOADSERVERRESPONSE:"videoAdserverResponse",VIDEOPLAY:"videoPlay",VIDEOEND:"videoEnd",VIDEO25:"video25",VIDEO50:"video50",VIDEO75:"video75",VIDEORESUMED:"videoResumed",VIDEOPAUSED:"videoPaused",VIDEOPLAYEROK:"videoPlayerOK",VIDEOREADY:"videoReady",VIDEOSEEKINIT:"videoSeekInit",VIDEOSEEKCOMPLETE:"videoSeekComplete",VIEWARTICLE:"viewArticle",VIDEORELOAD:"videoReload",VIDEOREPLAY:"videoReplay",init:function(){function e(){var e=DTM.utils.getQueryParam("o"),t=DTM.utils.getQueryParam("prod"),a=DTM.utils.getQueryParam("event_log"),r=DTM.utils.getQueryParam("event");if("epmas>suscripcion>verify-email"==_satellite.getVar("subCategory2"))DTM.trackEvent(DTM.events.USERREGISTER,{registerType:"clasico",registerOrigin:e,registerProd:t,registerBackURL:DTM.utils.decodeURIComponent(DTM.utils.getQueryParam("backURL")),validEvent:!0});else{if(""!=r&&"1"!=_satellite.getVar("user:registeredUser"))return!1;if("okdesc"==a&&"0"!=_satellite.getVar("user:registeredUser"))return!1;if(""!=a&&"okdesc"!=a&&"1"!=_satellite.getVar("user:registeredUser"))return!1;if(""!=a){var i={oklogin:"clasico",okdesc:"clasico",okvinculacion:"clasico",fa:"facebook",tw:"twitter",go:"google",me:"msn",li:"linkedin"};if(i.hasOwnProperty(a)){var s="okdesc"==a?DTM.events.USERLOGOFF:"okvinculacion"==a?DTM.events.UUVINC:DTM.events.USERLOGIN;DTM.trackEvent(s,{registerType:i[a],registerOrigin:e,registerProd:t,validEvent:!0})}}if(""!=r){var n={okregistro:"clasico",fa:"facebook",tw:"twitter",go:"google",me:"msn",li:"linkedin"};n.hasOwnProperty(r)&&DTM.trackEvent(DTM.events.USERREGISTER,{registerType:n[r],registerOrigin:e,registerProd:t,validEvent:!0})}}DTM.notify("Event Listener added <Registers & Logins>")}if(DTM.eventQueue.length>0)for(var t=0,a=DTM.eventQueue.length;t<a;t++)DTM.eventQueue[t].hasOwnProperty("eventName")&&DTM.eventQueue[t].hasOwnProperty("data")&&(DTM.notify("Event <"+DTM.eventQueue[t].eventName+"> fired from DTM.eventQueue"),DTM.trackEvent(DTM.eventQueue[t].eventName,DTM.eventQueue[t].data));DTM.dataLayer.generated?e():DTM.utils.addEvent(document,"DTMCompleted",(function(){e()})),"articulo"==_satellite.getVar("pageType")&&(setTimeout((function(){DTM.trackEvent(DTM.events.READARTICLE)}),6e4),DTM.notify("Event Listener added <Read Article>")),"1"!=_satellite.getVar("liveContent")&&"juegos"!=_satellite.getVar("primaryCategory")||(DTM.utils.addEvent(window,"message",(function(e){try{if(void 0!==e&&void 0!==e.data)if(void 0!==e.data.eventType&&"object"==typeof e.data.data)DTM.trackEvent(e.data.eventType,e.data.data);else if("juegos"==_satellite.getVar("primaryCategory")&&-1!=e.origin.indexOf("amuselabs")&&"string"==typeof e.data&&0==e.data.indexOf("{")){var t=JSON.parse(e.data);if(t.hasOwnProperty("src")&&"crossword"==t.src&&t.hasOwnProperty("progress")){var a=t.hasOwnProperty("title")?t.title:"not-set",r=t.hasOwnProperty("id")?t.id:"not-set";"puzzleCompleted"==t.progress?DTM.trackEvent(DTM.events.GAMECOMPLETE,{gameName:a,gameID:r}):"puzzleLoaded"==t.progress&&DTM.trackEvent(DTM.events.GAMEPLAY,{gameName:a,gameID:r})}}}catch(e){DTM.notify("Error en video iframe")}}),!1),DTM.notify("Event Listener added <Video Iframes>")),function(){function e(){if(!DTM.dataLayer.generated||"escaparate"!=_satellite.getVar("primaryCategory")||"articulo"!=_satellite.getVar("pageType")||void 0===document.querySelectorAll)return!1;var e=document.querySelectorAll(".article_body a.escaparate[data-link-track-dtm]"),t=document.querySelectorAll("article .a_btn a");if(e.length>0||t.length>0)for(var a=e.length>0?e:t,r=1,i=0,s=a.length;i<s;i++){var n=a[i];if(""!=n.href&&-1==n.href.indexOf("javascript")&&-1==n.href.indexOf("//elpais.com")){n.escOrder="btn-esc-"+r++,n.escBoton=n.innerHTML.trim().toLowerCase();var o=/^(.*) en (.*)$/gi.exec(n.escBoton);n.escVendor=null!=o?o[2]:"not-set",DTM.utils.addEvent(n,"click",(function(){DTM.trackEvent(DTM.events.SALEBUTTON,{articleTitle:_satellite.getVar("pageTitle"),buttonName:this.escBoton+" ("+this.escOrder+")",externalURL:this.escVendor+":"+this.href})}))}}}"escaparate"==_satellite.getVar("primaryCategory")&&"articulo"==_satellite.getVar("pageType")&&_satellite.getVar("platform")===DTM.PLATFORM.WEB&&("complete"==document.readyState?e():DTM.utils.addEvent(window,"load",(function(){e()}),!1))}(),function(){if(""!=DTM.utils.getQueryParam("ed")){var e=DTM.utils.localStorage.getItem("dtm_changeEdition");if(null!=e){var t=(e=DTM.utils.parseJSON(e)).hasOwnProperty("editionDestination")?e.editionDestination:"not-set",a=e.hasOwnProperty("editionOrigin")?e.editionOrigin:"not-set";DTM.trackEvent("editionChange",{editionChange:a+":"+t}),DTM.utils.localStorage.removeItem("dtm_changeEdition"),DTM.notify("Event Listener added <Event Change>")}}}()},setEffect:function(e,t,a){void 0===a&&(a=!0),void 0!==e&&void 0!==t&&void 0!==window.digitalData.event[e]&&(window.digitalData.event[e].eventInfo.effect[t]=a)},validEvent:function(e){var t=!1;for(var a in this)if("string"==typeof this[a]&&this[a]==e)return!0;return t}},tools:{allowAll:!0,DISABLED:0,ENABLED:1,ONLYEVENTS:2,initialized:!1,init:function(){for(var e in DTM.tools.allowAll=void 0===DTM.config.allowAll||DTM.config.allowAll,this)"function"==typeof this[e].init&&"object"==typeof this[e].dl&&this[e].init();this.initialized=!0,DTM.notify("Tools initialized")},list:[],omniture:{enabled:1,dl:{},eventQueue:[],loaded:!1,trackedPV:!1,map:{events:{},vars:{},consents:{}},init:function(){DTM.tools.marfeel.utils.markTimeLoads("Omniture init"),this.enabled=this.isEnabled(),this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("omniture"),this.createMap(),this.initTracker(),this.setDL({authors:this.formatListVar(_satellite.getVar("author"),"id"),cartProductPages:["epmas>suscripcion>checkout","epmas>suscripcion>payment","epmas>suscripcion>confirmation","epmas>suscripcion>verify-gift"],secondaryCategories:this.formatListVar(_satellite.getVar("secondaryCategories")),tags:this.formatListVar(_satellite.getVar("tags"),"id")})},createMap:function(){this.map.events[DTM.events.INTERNALSEARCH]="event1",this.map.events[DTM.events.PAGEVIEW]="event2",this.map.events[DTM.events.SCROLL]="event5",this.map.events[DTM.events.VIDEO25]="event8",this.map.events[DTM.events.VIDEO75]="event9",this.map.events[DTM.events.SCROLLINF]="event10",this.map.events[DTM.events.VIDEOPLAY]="event11",this.map.events[DTM.events.REELPLAY]="event48",this.map.events[DTM.events.VIDEOREPLAY]="event11",this.map.events[DTM.events.VIDEOEND]="event12",this.map.events[DTM.events.REELEND]="event49",this.map.events[DTM.events.ADPLAY]="event13",this.map.events[DTM.events.ADEND]="event14",this.map.events[DTM.events.ADSKIP]="event15",this.map.events[DTM.events.AUDIOPLAY]="event16",this.map.events[DTM.events.AUDIOEND]="event17",this.map.events[DTM.events.AUDIO50]="event18",this.map.events[DTM.events.USERPREREGISTER]="event19",this.map.events[DTM.events.USERLOGINREGISTER]="event20",this.map.events[DTM.events.USERREGISTER]="event21",this.map.events[DTM.events.EXTERNALLINK]="event22",this.map.events[DTM.events.USERLOGIN]="event23",this.map.events[DTM.events.USERLOGININIT]="event24",this.map.events[DTM.events.USERUNREGISTER]="event25",this.map.events[DTM.events.FORMABANDON]="event26",this.map.events[DTM.events.FORMSUCESS]="event27",this.map.events[DTM.events.FORMERROR]="event28",this.map.events[DTM.events.USERFLOWINIT]="event29",this.map.events[DTM.events.USERFLOWEND]="event30",this.map.events[DTM.events.BUTTONCLICK]="event33",this.map.events[DTM.events.COMMENTS]="event34",this.map.events[DTM.events.SALEBUTTON]="event35",this.map.events[DTM.events.EDITIONCHANGE]="event37",this.map.events[DTM.events.USERNEWSLETTERIN]="event38",this.map.events[DTM.events.USERNEWSLETTEROFF]="event39",this.map.events[DTM.events.SWIPEH]="event43",this.map.events[DTM.events.AUDIOPAUSED]="event44",this.map.events[DTM.events.AUDIORESUMED]="event45",this.map.events[DTM.events.CONC]="event50",this.map.events[DTM.events.GAMEPLAY]="event55",this.map.events[DTM.events.GAMECOMPLETE]="event56",this.map.events[DTM.events.GAMEPICKER]="event57",this.map.events[DTM.events.VIDEOPLAYEROK]="event59",this.map.events[DTM.events.CHECKOUT]="event60,scCheckout",this.map.events[DTM.events.PURCHASE]="event61,purchase",this.map.events[DTM.events.SHARE]="event69",this.map.events[DTM.events.PHOTOZOOM]="event76",this.map.events[DTM.events.VIEWARTICLE]="event77",this.map.events[DTM.events.PHOTOGALLERY]="event78",this.map.events[DTM.events.VIDEO50]="event79",this.map.events[DTM.events.READARTICLE]="event80",this.map.events[DTM.events.CONCPARTICIPATE]="event81",this.map.events[DTM.events.NOTICEDISPLAYED]="event89",this.map.events[DTM.events.EXTERNALLINKART]="event99",this.map.events[DTM.events.TEST]="event100",this.map.events[DTM.events.PAYOK]="event102",this.map.events[DTM.events.PAYERROR]="event103",this.map.events[DTM.events.POPUPIMPRESSION]="event113",this.map.events[DTM.events.DOWNLOADLINK]="",this.map.events[DTM.events.EXITLINK]="",this.map.vars.destinationURL="eVar1",this.map.vars.playerType="eVar2",this.map.vars.pageName="eVar3",this.map.vars.videoName="eVar8",this.map.vars.mediaName="eVar8",this.map.vars.adTitle="eVar9",this.map.vars.searchKeyword="eVar16",this.map.vars.onsiteSearchTerm="eVar16",this.map.vars.adMode="eVar24",this.map.vars.videoSource="eVar25",this.map.vars.mediaSource="eVar25",this.map.vars.videoRepMode="eVar26",this.map.vars.mediaRepMode="eVar26",this.map.vars.onsiteSearchResults="eVar33",this.map.vars.formAnalysis="eVar34",this.map.vars.registerType="eVar37",this.map.vars.regType="eVar37",this.map.vars.videoID="eVar38",this.map.vars.mediaID="eVar38",this.map.vars.videoRepType="eVar42",this.map.vars.mediaRepType="eVar42",this.map.vars.photoURL="eVar46",this.map.vars.scrollPercent="eVar56",this.map.vars.videoOriented="eVar57",this.map.vars.buttonName="eVar58",this.map.vars.formName="eVar65",this.map.vars.adEnable="eVar67",this.map.vars.adEnabled="eVar67",this.map.vars.externalURL="eVar68",this.map.vars.externalLink="eVar68",this.map.vars.downloadLink="eVar68",this.map.vars.shareRRSS="eVar69",this.map.vars.uniqueVideoID="eVar71",this.map.vars.uniquemediaID="eVar71",this.map.vars.videoDuration="eVar74",this.map.vars.mediaDuration="eVar74",this.map.vars.videoChannels="eVar75",this.map.vars.mediaChannels="eVar75",this.map.vars.videoOrder="eVar76",this.map.vars.mediaOrder="eVar76",this.map.vars.videoCreateSection="eVar77",this.map.vars.mediaCreateSection="eVar77",this.map.vars.mediaPlayerContext="eVar78",this.map.vars.registerOrigin="eVar85",this.map.vars.registerProd="eVar86",this.map.vars.videoYoutubeChannel="eVar95",this.map.vars.videoIframe="eVar98",this.map.vars.mediaIframe="eVar98",this.map.vars.videoContractID="eVar99",this.map.vars.mediaContractID="eVar99",this.map.vars.paywallTransactionType="eVar152",this.map.vars.noticeName="eVar155",this.map.vars.pageNameEP="eVar166",this.map.vars.pageTitleEP="eVar170",this.map.vars.registerBackURL="eVar175",this.map.vars.gameName="eVar176",this.map.vars.gameID="eVar177",this.map.vars.swipeMod="eVar183",this.map.vars.swipeDir="eVar184",this.map.vars.mediaReelPosition="eVar188",this.map.vars.popupName="prop9"},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=void 0!==DTM.config.omn_enabled?DTM.config.omn_enabled:DTM.tools.allowAll;return e&&_satellite.getVar("platform")==DTM.PLATFORM.WIDGET&&(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED},initTracker:function(){DTM.s=window.s,"production"!=_satellite.environment.stage||_satellite.getVar("validPage")||(s.account="prisacomfiltradourls"),DTM.s.debugTracking=!1,DTM.s.dstStart=_satellite.getVar("date:dstStart"),DTM.s.dstEnd=_satellite.getVar("date:dstEnd"),DTM.s.currentYear=_satellite.getVar("date:year"),DTM.s.cookieDomainPeriods=document.URL.indexOf(".com.")>0?"3":"2",DTM.s.siteID=_satellite.getVar("siteID"),DTM.s.trackInlineStats=!0,DTM.s.linkTrackVars="None",DTM.s.linkTrackEvents="None"},formatListVar:function(e,t){if("string"==typeof e)return e.replace(/,;|,/g,";").replace(/^;/,"");var a=[];t=void 0===t?"id":t;try{for(var r=0,i=e.length;r<i;r++)"id"==t&&""!=e[r][t]?a.push(e[r][t]):"id"==t&&e[r].hasOwnProperty("name")&&a.push(e[r].name.toLowerCase().replace(/ /g,"_").replace(/\xe1/gi,"a").replace(/\xe9/gi,"e").replace(/\xf3/gi,"o").replace(/\xed/gi,"i").replace(/\xfa/gi,"u").replace(/\xf1/gi,"n")+"_a")}catch(e){a=[]}return"id"==t?a.join(";"):a.join(",")},trackPV:function(e){if(this.enabled!=DTM.tools.ENABLED||void 0===e&&this.trackedPV)return!1;for(var t in _satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&!0!==e||(DTM.s.pageURL=_satellite.getVar("destinationURL"),DTM.s.referrer=_satellite.getVar("referringURL")),DTM.s.dstStart=_satellite.getVar("date:dstStart"),DTM.s.dstEnd=_satellite.getVar("date:dstEnd"),DTM.s.currentYear=_satellite.getVar("date:year"),DTM.s.siteID=_satellite.getVar("siteID"),DTM.s.pageName=_satellite.getVar("pageName"),DTM.s.channel=_satellite.getVar("primaryCategory"),DTM.s.server=_satellite.getVar("server"),DTM.s.pageType="error-404"==_satellite.getVar("primaryCategory")?"errorPage":"",DTM.s.hier1='D=c18+">"+c19+">"+c20+">"+c1+">"pageName',DTM.s.list1=_satellite.getVar("omniture:tags"),DTM.s.list2=_satellite.getVar("omniture:author"),DTM.s.list3=_satellite.getVar("omniture:secondaryCategories"),DTM.s.campaign||(DTM.s.campaign=_satellite.getVar("campaign"),DTM.s.campaign=DTM.s.getValOnce(DTM.s.campaign,"s_campaign",0)),DTM.s.prop1=_satellite.getVar("subCategory1"),DTM.s.prop2=_satellite.getVar("subCategory2"),void 0!==_satellite.getVar("pageTypology")&&""!=_satellite.getVar("pageTypology")?DTM.s.prop3=_satellite.getVar("pageType")+">"+_satellite.getVar("pageTypology"):DTM.s.prop3=_satellite.getVar("pageType"),DTM.s.prop5="D=g",DTM.s.prop6="D=r",DTM.s.prop7=_satellite.getVar("referringDomain"),DTM.s.prop10=_satellite.getVar("articleLength"),DTM.s.prop16=_satellite.getVar("onsiteSearchTerm"),DTM.s.prop17=_satellite.getVar("sysEnv"),DTM.s.prop19=_satellite.getVar("publisher"),DTM.s.prop20=_satellite.getVar("domain"),DTM.s.prop21=_satellite.getVar("omniture:newRepeat"),DTM.s.prop23=_satellite.getVar("articleID"),DTM.s.prop28=_satellite.getVar("omniture:visitNumDay"),DTM.s.prop31=_satellite.getVar("thematic"),DTM.s.prop34=_satellite.getVar("user:profileID"),DTM.s.prop39=_satellite.getVar("articleTitle"),DTM.s.prop42=_satellite.getVar("user:type"),"suscriptorT2"==DTM.s.prop42&&(DTM.s.prop42="suscriptor"),DTM.s.prop44=_satellite.getVar("creationDate"),DTM.s.prop45=_satellite.getVar("pageTitle"),DTM.s.prop47=_satellite.getVar("edition"),DTM.s.prop49=_satellite.getVar("liveContent"),DTM.s.prop50=_satellite.getVar("cms"),DTM.s.prop51=_satellite.getVar("omniture:brandedContent"),DTM.s.prop53=_satellite.getVar("canonicalURL"),DTM.s.prop54=_satellite.getVar("clickOrigin"),DTM.s.prop61=_satellite.getVar("editionNavigation"),DTM.s.prop66=_satellite.getVar("loadType"),DTM.s.prop67=DTM.utils.checkShownBlock(),DTM.s.prop68=DTM.utils.checkOriginBlock(),DTM.s.prop72=_satellite.getVar("omniture:articleDays"),void 0!==window.pmUserComparison&&(DTM.s.prop69=window.pmUserComparison.replace("OK","PMUser|OK")),this.map.vars)DTM.s[this.map.vars[t]]="" ;for(var a in DTM.s.eVar1="D=g",DTM.s.eVar3="D=pageName",DTM.s.eVar4="D=ch",DTM.s.eVar5=DTM.s.prop1?"D=c1":"",DTM.s.eVar6=DTM.s.prop2?"D=c2":"",DTM.s.eVar7=DTM.s.prop3?"D=c3":"",DTM.s.eVar10=DTM.s.prop10?"D=c10":"",DTM.s.eVar16=DTM.s.prop16?"D=c16":"",DTM.s.eVar17=DTM.s.prop17?"D=c17":"",DTM.s.eVar19=DTM.s.prop19?"D=c19":"",DTM.s.eVar20=DTM.s.prop20?"D=c20":"",DTM.s.eVar21=DTM.s.prop21?"D=c21":"",DTM.s.eVar23=DTM.s.prop23?"D=c23":"",DTM.s.eVar27=_satellite.getVar("cleanURL"),DTM.s.eVar28=DTM.s.prop28?"D=c28":"",DTM.s.eVar31=_satellite.getVar("pageInstanceID"),DTM.s.eVar33=_satellite.getVar("onsiteSearchResults"),DTM.s.eVar36=_satellite.getVar("omniture:registeredUserAMP"),DTM.s.eVar39=DTM.s.prop39?"D=c39":"",DTM.s.eVar41=_satellite.getVar("publisherID"),DTM.s.eVar43=DTM.s.prop34?"D=c34":"",DTM.s.eVar44=DTM.s.prop44?"D=c44":"",DTM.s.eVar45=_satellite.getVar("pageTitle"),DTM.s.eVar47=DTM.s.prop47?"D=c47":"",DTM.s.eVar49=DTM.s.prop49?"D=c49":"",DTM.s.eVar50=DTM.s.prop50?"D=c50":"",DTM.s.eVar51=DTM.s.prop51?"D=c51":"",DTM.s.eVar53=DTM.s.prop53?"D=c53":"",DTM.s.eVar54=DTM.s.prop54?"D=c54":"",DTM.s.eVar55=_satellite.getVar("omniture:videoContent"),DTM.s.eVar59=_satellite.getVar("editorialTone"),DTM.s.eVar61=DTM.s.prop61?"D=c61":"",DTM.s.eVar62=DTM.s.prop31?"D=c31":"",DTM.s.eVar63=DTM.s.prop6?DTM.s.prop6:"",DTM.s.eVar64=DTM.s.prop7?"D=c7":"",DTM.s.eVar66=DTM.s.prop66?"D=c66":"",DTM.s.eVar72=DTM.s.prop72?"D=c72":"",DTM.s.eVar73=_satellite.getVar("test"),DTM.s.eVar81="D=mid",DTM.s.eVar83=DTM.utils.getQueryParam("mid"),DTM.s.eVar84=DTM.utils.getQueryParam("bid"),DTM.s.eVar85=DTM.utils.getQueryParam("o"),DTM.s.eVar86=DTM.utils.getQueryParam("prod"),DTM.s.eVar92=_satellite.getVar("user:type"),DTM.s.eVar93=_satellite.getVar("user:ID"),DTM.s.eVar94=_satellite.getVar("updateDate"),DTM.s.eVar96=_satellite.getVar("pageHeight"),DTM.s.eVar100=_satellite.getVar("publishDate"),DTM.s.eVar101=_satellite.getVar("DTM:version"),DTM.s.eVar102=_satellite.getVar("AppMeasurement:version"),DTM.s.eVar103=_satellite.getVar("Visitor:version"),DTM.s.eVar104=_satellite.getVar("omniture:trackingServer"),DTM.s.eVar105=DTM.dataLayer.sync,DTM.s.eVar106=DTM.internalTest,DTM.s.eVar107=_satellite.getVar("adunit:pbs"),DTM.s.eVar109=_satellite.getVar("user:subscriptionType"),DTM.s.eVar110=_satellite.getVar("paywall:id"),DTM.s.eVar112=_satellite.getVar("urlParameters"),DTM.s.eVar151=_satellite.getVar("paywall:signwallType"),DTM.s.eVar152=_satellite.getVar("paywall:transactionType"),DTM.s.eVar153=_satellite.getVar("omniture:paywall:contentBlocked"),DTM.s.eVar154=_satellite.getVar("paywall:counter"),DTM.s.eVar155=_satellite.getVar("paywall:contentAdType"),DTM.s.eVar156=_satellite.getVar("user:subscriptions"),DTM.s.eVar157=_satellite.getVar("omniture:paywall:active"),DTM.s.eVar158="epmas>suscripcion>confirmation"==_satellite.getVar("subCategory2")?_satellite.getVar("paywall:transactionID"):"",DTM.s.eVar161=_satellite.getVar("omniture:privateMode"),DTM.s.eVar162=_satellite.getVar("paywall:transactionOrigin"),DTM.s.eVar166=_satellite.getVar("pageName"),DTM.s.eVar170=_satellite.getVar("pageTitle"),DTM.s.eVar193=_satellite.getVar("paywall:type"),"suscriptorT2"==DTM.s.eVar92&&(DTM.s.eVar92="suscriptor"),!0===e&&(DTM.s.products=""),"not-set"!=_satellite.getVar("paywall:cartProduct")&&-1!=_satellite.getVar("omniture:cartProductPages").indexOf(_satellite.getVar("subCategory2"))&&(DTM.s.products=";"+_satellite.getVar("paywall:cartProduct")+";1;"),"epmas>suscripcion>confirmation"!=_satellite.getVar("subCategory2")&&"epmas>suscripcion>premium_confirmation"!=_satellite.getVar("subCategory2")||(DTM.s.purchaseID=_satellite.getVar("paywall:transactionID")),DTM.s.events="event2","1"==_satellite.getVar("onsiteSearch")&&(DTM.s.events+=",event1"),"articulo"==_satellite.getVar("pageType")&&(DTM.s.events+=",event77"),"epmas>suscripcion>home"!=_satellite.getVar("subCategory2")&&"epmas>landing_campaign_premium_user"!=_satellite.getVar("subCategory2")||(DTM.s.events+=",event59"),"epmas>suscripcion>checkout"==_satellite.getVar("subCategory2")&&(DTM.s.events+=",scCheckout,event60"),("epmas>suscripcion>confirmation"!=_satellite.getVar("subCategory2")&&"epmas>suscripcion>premium_confirmation"!=_satellite.getVar("subCategory2")||""==_satellite.getVar("paywall:transactionID"))&&"epmas>upgrade_premium>confirmation"!=_satellite.getVar("subCategory2")||(DTM.s.events+=",purchase,event61"),-1!=_satellite.getVar("subCategory2").indexOf("epmas>suscripcion>verify-gift>confirmation")&&(DTM.s.events+=",purchase,event62"),!0===_satellite.getVar("omniture:adobeTargetEnabled")&&(DTM.s.events+=",event91"),""!=_satellite.getVar("test")&&(DTM.s.events+=",event100"),DTM.s.t(),DTM.s.linkTrackEvents="None",DTM.s.linkTrackVars="None",DTM.tools.marfeel.utils.markTimeLoads("omnitureTrackedPV"),this.trackedPV=!0,this.eventQueue)this.trackEvent(a)},trackAsyncPV:function(){this.trackPV(!0)},trackEvent:function(e){if(this.enabled!=DTM.tools.DISABLED){if(this.enabled==DTM.tools.ENABLED&&!this.trackedPV)return this.eventQueue.push(e),DTM.events.setEffect(e,"omniture",!1),!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("Omniture event past not valid <"+t+">","error"),!1;var t=_satellite.getVar("event")[e].eventInfo.eventName,a=_satellite.getVar("event")[e].attributes;if(!this.map.events.hasOwnProperty(t))return DTM.events.setEffect(e,"omniture",!1),!1;var r=this.map.events[t],i=_satellite.getVar("omniture:tags"),s=void 0!==a.eventTags?this.formatListVar(a.eventTags,"id"):"";if(DTM.s.linkTrackEvents=r,DTM.s.events=r,DTM.s.server=void 0!==a.server?a.server:DTM.s.server,DTM.s.pageName=void 0!==a.pageName?a.pageName:_satellite.getVar("pageName"),DTM.s.linkTrackVars="events,server,list1,list2,list3,eVar1,eVar3,eVar4,eVar5,eVar6,eVar7,eVar10,eVar16,eVar17,eVar18,eVar19,eVar20,eVar22,eVar23,eVar30,eVar31,eVar35,eVar36,eVar39,eVar41,eVar43,eVar45,eVar47,eVar48,eVar49,eVar50,eVar51,eVar53,eVar54,eVar55,eVar59,eVar60,eVar61,eVar63,eVar64,eVar66,eVar72,eVar73,eVar81,eVar85,eVar86,eVar92,eVar93,eVar94,eVar96,eVar100,eVar101,eVar102,eVar103,eVar104,eVar106,eVar109,eVar110,eVar112,eVar151,eVar153,eVar154,eVar155,eVar156,eVar157,eVar161,eVar166,eVar170,eVar193",(a.hasOwnProperty("paywallCartProduct")||-1!=_satellite.getVar("omniture:cartProductPages").indexOf(_satellite.getVar("subCategory2")))&&(DTM.s.products=";"+(void 0!==a.paywallCartProduct?a.paywallCartProduct:_satellite.getVar("paywall:cartProduct"))+";1;",DTM.s.linkTrackVars+=",products"),DTM.s.list1=""==s?i:""==i?s:i+";"+s,DTM.s.list2=void 0!==a.authors?this.formatListVar(a.authors,"id"):_satellite.getVar("omniture:author"),DTM.s.list3=_satellite.getVar("omniture:secondaryCategories"),DTM.s.eVar1=_satellite.getVar("destinationURL"),DTM.s.eVar3=_satellite.getVar("pageName"),DTM.s.eVar4=_satellite.getVar("primaryCategory"),DTM.s.eVar5=_satellite.getVar("subCategory1"),DTM.s.eVar6=_satellite.getVar("subCategory2"),DTM.s.eVar7=_satellite.getVar("pageType"),DTM.s.eVar10=_satellite.getVar("articleLength"),DTM.s.eVar16=_satellite.getVar("onsiteSearchTerm"),DTM.s.eVar17=_satellite.getVar("sysEnv"),DTM.s.eVar19=_satellite.getVar("publisher"),DTM.s.eVar20=_satellite.getVar("domain"),DTM.s.eVar23=_satellite.getVar("articleID"),DTM.s.eVar31=_satellite.getVar("pageInstanceID"),DTM.s.eVar36=_satellite.getVar("omniture:registeredUserAMP"),DTM.s.eVar39=_satellite.getVar("articleTitle"),DTM.s.eVar41=_satellite.getVar("publisherID"),DTM.s.eVar43=_satellite.getVar("user:profileID"),DTM.s.eVar45=_satellite.getVar("pageTitle"),DTM.s.eVar47=_satellite.getVar("edition"),DTM.s.eVar49=_satellite.getVar("liveContent"),DTM.s.eVar50=_satellite.getVar("cms"),DTM.s.eVar51=_satellite.getVar("omniture:brandedContent"),DTM.s.eVar53=_satellite.getVar("canonicalURL"),DTM.s.eVar54=_satellite.getVar("clickOrigin"),DTM.s.eVar55=_satellite.getVar("omniture:videoContent"),DTM.s.eVar59=_satellite.getVar("editorialTone"),DTM.s.eVar61=_satellite.getVar("editionNavigation"),DTM.s.eVar63=_satellite.getVar("referringURL"),DTM.s.eVar64=_satellite.getVar("referringDomain"),DTM.s.eVar66=_satellite.getVar("loadType"),DTM.s.eVar72=_satellite.getVar("omniture:articleDays"),DTM.s.eVar73=_satellite.getVar("test"),DTM.s.eVar78=_satellite.getVar("mediaPlayerContext"),DTM.s.eVar81="D=mid",DTM.s.eVar85=DTM.utils.getQueryParam("o"),DTM.s.eVar86=DTM.utils.getQueryParam("prod"),DTM.s.eVar92=_satellite.getVar("user:type"),DTM.s.eVar93=_satellite.getVar("user:ID"),DTM.s.eVar94=_satellite.getVar("updateDate"),DTM.s.eVar96=_satellite.getVar("pageHeight"),DTM.s.eVar100=_satellite.getVar("publishDate"),DTM.s.eVar101=_satellite.getVar("DTM:version"),DTM.s.eVar102=_satellite.getVar("AppMeasurement:version"),DTM.s.eVar103=_satellite.getVar("Visitor:version"),DTM.s.eVar104=_satellite.getVar("omniture:trackingServer"),DTM.s.eVar106=DTM.internalTest,DTM.s.eVar109=_satellite.getVar("user:subscriptionType"),DTM.s.eVar110=_satellite.getVar("paywall:id"),DTM.s.eVar112=_satellite.getVar("urlParameters"),DTM.s.eVar151=_satellite.getVar("paywall:signwallType"),DTM.s.eVar153=_satellite.getVar("omniture:paywall:contentBlocked"),DTM.s.eVar154=_satellite.getVar("paywall:counter"),DTM.s.eVar155=_satellite.getVar("paywall:contentAdType"),DTM.s.eVar156=_satellite.getVar("user:subscriptions"),DTM.s.eVar157=_satellite.getVar("omniture:paywall:active"),DTM.s.eVar161=_satellite.getVar("omniture:privateMode"),DTM.s.eVar166=void 0!==a.pageName?a.pageName:_satellite.getVar("pageName"),DTM.s.eVar170=_satellite.getVar("pageTitle"),DTM.s.eVar193=_satellite.getVar("paywall:type"),"suscriptorT2"==DTM.s.eVar92&&(DTM.s.eVar92="suscriptor"),_satellite.getVar("event")[e]&&_satellite.getVar("event")[e].attributes&&_satellite.getVar("event")[e].attributes.mediaTagsMediateca&&_satellite.getVar("event")[e].attributes.mediaTagsMediateca.length>0){DTM.s.list1=DTM.s.list1||"",""!=DTM.s.list1&&(DTM.s.list1=DTM.s.list1+";");for(let t=0;t<_satellite.getVar("event")[e].attributes.mediaTagsMediateca.length;t++)_satellite.getVar("event")[e].attributes.mediaTagsMediateca[t].is_documental?DTM.s.list1+="multimedia-"+_satellite.getVar("event")[e].attributes.mediaTagsMediateca[t].name+";":void 0!==_satellite.getVar("event")[e].attributes.mediaTagsMediateca[t].name&&(DTM.s.list1+="multimediav-"+_satellite.getVar("event")[e].attributes.mediaTagsMediateca[t].name+";")}for(var n in a.hasOwnProperty("pageName")&&(a.pageNameEP=a.pageName),a.hasOwnProperty("pageTitle")&&(a.pageTitleEP=a.pageTitle),this.map.vars)a.hasOwnProperty(n)&&(DTM.s[this.map.vars[n]]=a[n],DTM.s.linkTrackVars+=","+this.map.vars[n]);return(DTM.s.eVar155.indexOf("capping:")>-1||DTM.s.eVar58.indexOf("capping:")>-1||DTM.s.eVar58.indexOf("popup fecha")>-1||DTM.s.eVar155.indexOf("popup fecha")>-1)&&(DTM.s.eVar108=_satellite.getVar("user:arcid"),DTM.s.linkTrackVars+=",eVar108"),t!=DTM.events.EXITLINK&&t!=DTM.events.DOWNLOADLINK&&(DTM.s.tl(this,"o",t),DTM.s.linkTrackEvents="None",DTM.s.linkTrackVars="None"),DTM.notify("Event <"+t+"> tracked in tool <Adobe Analytics>"),DTM.events.setEffect(e,"omniture",!0),!0}}},gfk:{enabled:1,dl:{},trackedPV:!1,init:function(){DTM.tools.marfeel.utils.markTimeLoads("GFK init"),DTM.tools.gfk.enabled=DTM.tools.gfk.isEnabled(),DTM.tools.gfk.enabled==DTM.tools.ENABLED&&DTM.tools.list.push("gfk"),DTM.tools.gfk.setDL({mediaID:_satellite.getVar("publisherID"),regionID:"ES",hosts:{staging:"ES-config-preproduction.sensic.net",production:"ES-config.sensic.net"},environment:"production"!=_satellite.environment.stage||!_satellite.getVar("validPage")||_satellite.getVar("translatePage")?"staging":"production",libs:{page:"s2s-web.js",html5:"html5vodextension.js",html5live:"html5liveextension.js",youtube:"youtubevodextension.js",playerextension:"playerextension.js"},url:"",type:"WEB",optin:!0,logLevel:"none"}),DTM.tools.gfk.trackPV()},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=void 0!==DTM.config.gfk_enabled?DTM.config.gfk_enabled:DTM.tools.allowAll;return e&&_satellite.getVar("platform")!=DTM.PLATFORM.WEB&&(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||!0===this.trackedPV)return!1;this.getDL();this.loadCoreLib();var e=gfkS2s.getAgent(),t={c1:_satellite.getVar("server"),c2:this.getPrimaryCategory()};e.impression("default",t),DTM.tools.marfeel.utils.markTimeLoads("gfkTrackedPV"),this.trackedPV=!0},trackAsyncPV:function(){if(this.enabled!=DTM.tools.ENABLED)return!1;var e=gfkS2s.getAgent(),t={c1:_satellite.getVar("server"),c2:this.getPrimaryCategory()};e.impression("default",t),this.trackedPV=!0},trackEvent:function(e){if(this.enabled==DTM.tools.DISABLED)return DTM.events.setEffect(e,"gfk",!1),!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("GFK event past not valid <"+t+">","error"),!1;var t=_satellite.getVar("event")[e].eventInfo.eventName,a=_satellite.getVar("event")[e].attributes,r=!1;switch(t){case"photogallery":case"scrollInf":var i=gfkS2s.getAgent(),s={c1:_satellite.getVar("server"),c2:this.getPrimaryCategory()};i.impression("default",s),r=!0;break;case"videoReady":case"audioReady":if(!a.hasOwnProperty("player")||!a.hasOwnProperty("mediaID")||this.streaming.myStreamingAnalytics.hasOwnProperty(a.mediaID))return!1;r=this.streaming.init(t,a);break;case"videoPlay":case"reelPlay":case"videoResumed":if(!a.hasOwnProperty("mediaID")||!this.streaming.myStreamingAnalytics.hasOwnProperty(a.mediaID))return!1;r=this.streaming.play(t,a);break;case"videoPaused":case"reelEnd":case"videoEnd":if(!a.hasOwnProperty("mediaID")||!this.streaming.myStreamingAnalytics.hasOwnProperty(a.mediaID))return!1;r=this.streaming.pause(t,a);break;case"videoSeekInit":case"videoSeekComplete":if(!a.hasOwnProperty("mediaID")||!this.streaming.myStreamingAnalytics.hasOwnProperty(a.mediaID))return!1;r=this.streaming.seek(t,a);break;default:r=!1}return!0===r&&DTM.notify("Event <"+t+"> tracked in tool <GFK>"),DTM.events.setEffect(e,"gfk",r),r},getLibURL:function(e){var t=!1,a=this.dl,r=a.hosts[a.environment];return a.libs.hasOwnProperty(e)&&(t="https://"+r+"/"+a.libs[e]),t},getPrimaryCategory:function(){var e="";if(""!=_satellite.getVar("primaryCategory"))e=_satellite.getVar("primaryCategory"),"home"==_satellite.getVar("primaryCategory")?e="homepage":"tag"==_satellite.getVar("primaryCategory")&&(e="noticias");else{var t=/http.?:\/\/([^\/]*)\/([^\/]*)\//i.exec(_satellite.getVar("destinationURL"));e=t?t[2]:"homepage"}return e},loadCoreLib:function(){var e=this.getDL();window.gfkS2sConf={media:e.mediaID,url:this.getLibURL("page"),type:e.type};var t=window,a=document,r=gfkS2sConf,i="script",s="gfkS2s",n="visUrl";if(!a.getElementById(s)){t.gfkS2sConf=r,t[s]={},t[s].agents=[];var o=["playStreamLive","playStreamOnDemand","stop","skip","screen","volume","impression"];t.gfks=function(){function e(e,t,a){return function(){e.p=a(),e.queue.push({f:t,a:arguments})}}function t(t,a,r){for(var i={queue:[],config:t,cb:r,pId:a},s=0;s<o.length;s++){var n=o[s];i[n]=e(i,n,r)}return i}return t}(),t[s].getAgent=function(e,a){function i(e,t){return function(){return e.a[t].apply(e.a,arguments)}}for(var n={a:new t.gfks(r,a||"",e||function(){return 0})},l=0;l<o.length;l++){var d=o[l];n[d]=i(n,d)}return t[s].agents.push(n),n};var l=function(e,t){var r=a.createElement(i),s=a.getElementsByTagName(i)[0];r.id=e,r.async=!0,r.type="text/javascript",r.src=t,s.parentNode.insertBefore(r,s)};r.hasOwnProperty(n)&&l(s+n,r[n]),l(s,r.url)}},streaming:{myStreamingAnalytics:[],libsLoaded:{html5:!1,html5live:!1,youtube:!1,playerextension:!1},loadLib:function(e,t,a){if(_satellite.getVar("platform")!=DTM.PLATFORM.WEB)return!1;if(this.libsLoaded.hasOwnProperty(e)&&!1===this.libsLoaded[e]){var r=DTM.tools.gfk.getLibURL(e);DTM.utils.loadScript(r,t,a)}else this.libsLoaded.hasOwnProperty(e)&&!0===this.libsLoaded[e]&&t.call(this,a)},init:function(e,t){var a=!1,r=t.player,i=t.hasOwnProperty("mediaName")?t.mediaName:r.hasOwnProperty("title")?r.title:"",s=_satellite.getVar("publisher")+"-"+i,n=t.hasOwnProperty("mediaDuration")?t.mediaDuration:r.hasOwnProperty("duration")?parseInt(r.duration):"",o=t.hasOwnProperty("playerType")?DTM.utils.getPlayerType(t.playerType):"html5";o=t.controllerName?t.controllerName:o;var l=t.hasOwnProperty("mediaRepType")?t.mediaRepType:"vod",d=t.hasOwnProperty("mediaFormat")?t.mediaFormat:r.hasOwnProperty("mediaFormat")?r.mediaFormat:"";switch(o){case"html5":case"realhls":if("streaming"==l)this.loadLib("html5live",(function(e){DTM.tools.gfk.streaming.libsLoaded.html5live=!0,DTM.tools.gfk.streaming.myStreamingAnalytics[e.mediaID]={gfkObject:new window.gfkS2sExtension.HTML5LiveExtension(e.player,window.gfkS2sConf,"default",{programmname:e.mediaName,channelname:_satellite.getVar("publisher"),streamtype:d,c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}),player:r}}),{mediaID:t.mediaID,player:r,streamtype:d,mediaName:s,mediaDuration:n}),a=!0;else{if(""==d&&"aod"==l){if(d="audio",void 0!==window.mediaTopEmbedCs&&void 0!==window.mediaTopEmbedCs.API&&void 0!==window.mediaTopEmbedCs.API.getSettings()){var c=window.mediaTopEmbedCs.API.getSettings();s=_satellite.getVar("publisher")+"-"+c.topPlayer.media.tags.programa}}else""==d&&"vod"==l&&(d="video");this.loadLib("html5",(function(e){DTM.tools.gfk.streaming.libsLoaded.html5=!0,DTM.tools.gfk.streaming.myStreamingAnalytics[e.mediaID]={gfkObject:new window.gfkS2sExtension.HTML5VODExtension(e.player,window.gfkS2sConf,"default",{programmname:e.mediaName,channelname:_satellite.getVar("publisher"),streamtype:d,streamlength:e.mediaDuration,c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}),player:r}}),{mediaID:t.mediaID,player:r,streamtype:d,mediaName:s,mediaDuration:n}),a=!0}break;case"youtube":"vod"==l&&(this.loadLib("youtube",(function(e){DTM.tools.gfk.streaming.libsLoaded.youtube=!0,DTM.tools.gfk.streaming.myStreamingAnalytics[e.mediaID]={gfkObject:new window.gfkS2sExtension.YoutubeVODExtension(e.player,window.gfkS2sConf,"default",{programmname:e.mediaName,channelname:_satellite.getVar("publisher"),streamtype:d,streamlength:e.mediaDuration,c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}),player:e.player}}),{mediaID:t.mediaID,player:r,streamtype:d,mediaName:s,mediaDuration:n}),a=!0);break;case"triton":case"ser_especial":r.dtm_status="paused",this.myStreamingAnalytics[t.mediaID]={gfkObject:gfkS2s.getAgent((function(){return r.hasOwnProperty("currentTime")?r.currentTime:r.hasOwnProperty("MediaElement")?r.MediaElement.audioNode.currentTime:0}),r),player:r},a=!0;break;case"dailymotion":"vod"!=l&&"secuencial"!=l||(this.loadLib("playerextension",(async function(e){DTM.tools.gfk.streaming.libsLoaded.playerextension=!0;document.querySelector("iframe[class*=dailymotion]");var t={instance:e.player,vendor:"dailymotion",type:"vod",dailyMotionState:await e.player.getState()};DTM.tools.gfk.streaming.myStreamingAnalytics[e.mediaID]={gfkObject:new window.gfkS2sExtension.PlayerExtension(t,window.gfkS2sConf,"default",{programmname:e.mediaName,channelname:_satellite.getVar("publisher"),streamtype:d,streamlength:e.mediaDuration,c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}),player:e.player}}),{mediaID:t.mediaID,player:r,streamtype:d,mediaName:s,mediaDuration:n}),a=!0);break;default:a=!1}return a},play:function(e,t){var a=t.hasOwnProperty("playerType")?DTM.utils.getPlayerType(t.playerType):"html5",r=!1;if("youtube"==a&&"videoPlay"==e){let e=this.myStreamingAnalytics[t.mediaID].gfkObject,a=this.myStreamingAnalytics[t.mediaID].player,r=_satellite.getVar("publisher")+"_"+t.hasOwnProperty("mediaName")?t.mediaName:a.hasOwnProperty("videoTitle")?a.videoTitle:"",i=t.hasOwnProperty("mediaDuration")?t.mediaDuration:"function"==typeof a.getDuration?parseInt(a.getDuration()):"",s=t.hasOwnProperty("mediaFormat")?t.mediaFormat:a.hasOwnProperty("mediaFormat")?a.mediaFormat:"";e.setParameter("default",{programmname:r,channelname:_satellite.getVar("publisher"),streamtype:s,streamlength:i,c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()})}else if("triton"==a||"ser_especial"==a){let e=this.myStreamingAnalytics[t.mediaID].gfkObject,a=this.myStreamingAnalytics[t.mediaID].player,s=t.hasOwnProperty("mediaDuration")?t.mediaDuration:a.hasOwnProperty("duration")?parseInt(a.duration):"",n=t.hasOwnProperty("mediaFormat")?t.mediaFormat:a.hasOwnProperty("mediaFormat")?a.mediaFormat:"";if("streaming"==t.mediaRepType)var i=_satellite.getVar("publisher")+"-"+t.mediaName;else i=_satellite.getVar("publisher")+"-"+t.hasOwnProperty("mediaName")?t.mediaName:a.hasOwnProperty("videoTitle")?a.videoTitle:"";a.dtm_status="playing",t.hasOwnProperty("mediaRepType")&&"streaming"==t.mediaRepType?e.playStreamLive("default","",0,t.mediaID,{},{programmname:i,channelname:_satellite.getVar("publisher"),streamtype:n,cliptype:"live",channel:"channel1",c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}):e.playStreamOnDemand("default",t.mediaID,{},{programmname:i,streamlength:s,channelname:_satellite.getVar("publisher"),streamtype:n,cliptype:"Sendung",channel:"channel1",c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}),r=!0}return r},pause:function(e,t){var a=!1;if("dailymotion"!=(t.hasOwnProperty("playerType")?DTM.utils.getPlayerType(t.playerType):"html5"))return a;var r=this.myStreamingAnalytics[t.mediaID].gfkObject;return this.myStreamingAnalytics[t.mediaID].player.dtm_status="paused",r.stop(),a=!0},seek:function(e,t){var a=!1;if("dailymotion"!=(t.hasOwnProperty("playerType")?DTM.utils.getPlayerType(t.playerType):"html5"))return a;if("videoSeekInit"==e){var r=this.myStreamingAnalytics[t.mediaID].gfkObject;"playing"==(i=this.myStreamingAnalytics[t.mediaID].player).dtm_status&&(r.stop(),a=!0)}else if("videoSeekComplete"==e){r=this.myStreamingAnalytics[t.mediaID].gfkObject;var i=this.myStreamingAnalytics[t.mediaID].player,s=t.hasOwnProperty("mediaName")?t.mediaName:i.hasOwnProperty("title")?i.title:"",n=t.hasOwnProperty("mediaDuration")?t.mediaDuration:i.hasOwnProperty("duration")?parseInt(i.duration):"";i.getState().then((e=>{var t=JSON.parse(JSON.stringify(e));i.dtm_currentTime=1e3*parseInt(t.videoTime)})),"playing"==i.dtm_status&&(r.playStreamOnDemand("default",t.mediaID,{},{programmname:s,streamlength:n,channelname:_satellite.getVar("publisher"),cliptype:"Sendung",channel:"channel1",airdate:new Date,c1:_satellite.getVar("server"),c2:DTM.tools.gfk.getPrimaryCategory()}),a=!0)}return a}}},marfeel:{enabled:1,dl:{proId:"2223",environment:"",filterId:"1059",contentVisibility:"",mapEvents:{adPlay:"adPlay",videoPlay:"play",reelPlay:"play",videoResumed:"play",videoPaused:"pause",videoEnd:"end",reelEnd:"end",audioPlay:"play",audioPaused:"pause",audioResumed:"play",audioEnd:"end"},mediaControls:{},mediaReady:{}},lib:{init:function(){function e(e){var t=!(arguments.length>1&&void 0!==arguments[1])||arguments[1],a=document.createElement("script");a.src=e,t?a.type="module":(a.async=!0,a.type="text/javascript",a.setAttribute("nomodule",""));var r=document.getElementsByTagName("script")[0];r.parentNode.insertBefore(a,r)}function t(t,a,r){var i,s,n;null!==(i=t.marfeel)&&void 0!==i||(t.marfeel={}),null!==(s=(n=t.marfeel).cmd)&&void 0!==s||(n.cmd=[]),t.marfeel.config=r,t.marfeel.config.accountId=a;var o="https://sdk.mrf.io/statics";e("".concat(o,"/marfeel-sdk.js?id=").concat(a),!0),e("".concat(o,"/marfeel-sdk.es5.js?id=").concat(a),!1)}DTM.tools.marfeel.utils.markTimeLoads("MArfeel lib init");var a=DTM.tools.marfeel.dl;!function(e,a){t(e,a,arguments.length>2&&void 0!==arguments[2]?arguments[2]:{})}(window,a.environment,{pageType:_satellite.getVar("platform"),multimedia:{},experiences:{targeting:DTM.utils.getMarfeelExp()}}),DTM.tools.marfeel.ABTesting()},testab:function(e){var t=DTM.tools.marfeel.dl,a="",r=document.querySelector("link[rel='canonical']")?document.querySelector("link[rel='canonical']").getAttribute("href"):_satellite.getVar("canonicalURL");return"module"==e?a="https://marfeelexperimentsexperienceengine.mrf.io/experimentsexperience/render?siteId="+t.environment+"&url="+r+"&experimentType=HeadlineAB&lang=es&version=esnext":"nomodule"==e&&(a="https://marfeelexperimentsexperienceengine.mrf.io/experimentsexperience/render?siteId="+t.environment+"&url="+r+"&experimentType=HeadlineAB&lang=es&version=legacy"),a}},trackedPV:!1,init:function(){DTM.tools.marfeel.utils.markTimeLoads("MArfeel init"),"fbia"==_satellite.getVar("platform")&&(window.ia_document={shareURL:_satellite.getVar("destinationURL"),referrer:_satellite.getVar("referringURL")}),this.enabled=this.isEnabled();var e=DTM.tools.marfeel.dl;"production"!=_satellite.environment.stage||!_satellite.getVar("validPage")||_satellite.getVar("translatePage")?this.dl.environment=e.filterId:this.dl.environment=e.proId,null!=_satellite.getVar("paywall:active")&&null!=_satellite.getVar("paywall:signwallType")&&(e.contentVisibility=_satellite.getVar("paywall:active")&&"suscriptor"!=_satellite.getVar("user:type")?"hard-paywall":"",e.contentVisibility=_satellite.getVar("paywall:signwallType").indexOf("reg")>-1&&"1"==_satellite.getVar("paywall:contentBlocked")?"dynamic-signwall":""),this.enabled!=DTM.tools.DISABLED&&(DTM.tools.list.push("marfeel"),this.lib.init())},trackPV:function(){var e=0;switch(_satellite.getVar("user:type")){case"suscriptor":e=3;break;case"registrado":e=2}window.marfeel.cmd.push(["compass",function(t){t.setUserType(e),void 0!==_satellite.getVar("user:profileID")&&"anonimo"!=_satellite.getVar("user:type")&&"undefined"!=_satellite.getVar("user:profileID")&&"not-set"!=_satellite.getVar("user:profileID")&&""!=_satellite.getVar("user:profileID")&&t.setSiteUserId(_satellite.getVar("user:profileID")),_satellite.getVar("user:experienceCloudID")&&t.setUserVar("ecid",_satellite.getVar("user:experienceCloudID")),""!=DTM.tools.marfeel.dl.contentVisibility&&null!=DTM.tools.marfeel.dl.contentVisibility&&t.setPageVar("closed",DTM.tools.marfeel.dl.contentVisibility),"T1"!=_satellite.getVar("user:subscriptionType")&&"T2"!=_satellite.getVar("user:subscriptionType")?t.setUserVar("subscriberType","not-set"):t.setUserVar("subscriberType",_satellite.getVar("user:subscriptionType")),t.setPageVar("sub-section",_satellite.getVar("subCategory1")),t.setPageVar("sub-sub-section",_satellite.getVar("subCategory2")),t.setPageVar("contentType",_satellite.getVar("pageType")),t.setPageVar("organizacion",_satellite.getVar("org")),t.setPageVar("producto-medio",_satellite.getVar("publisher")),t.setPageVar("domain",_satellite.getVar("domain")),t.setUserVar("usuario-recurrente",_satellite.getVar("omniture:newRepeat")),t.setPageVar("noticia-id",_satellite.getVar("articleID")),t.setPageVar("id-instancia",_satellite.getVar("pageInstanceID")),t.setUserVar("user-id",_satellite.getVar("user:profileID")),t.setPageVar("edicion-contenido",_satellite.getVar("edition")),t.setPageVar("cms",_satellite.getVar("cms")),t.setPageVar("edicion-navegacion",_satellite.getVar("editionNavigation")),t.setPageVar("tematica",_satellite.getVar("thematic")),t.setPageVar("cms",_satellite.getVar("loadType")),t.setUserVar("user-arc-id",_satellite.getVar("user:ID"));try{_satellite.getVar("subCategory2").indexOf("epmas")>-1&&_satellite.getVar("subCategory2").indexOf("confirmation")>-1&&-1==_satellite.getVar("subCategory2").indexOf("invitation")&&-1==_satellite.getVar("subCategory2").indexOf("verify-gift")&&(t.setPageVar("test_DTM",_satellite.getVar("subCategory2")),DTM.trackEvent("userSubscription",{}))}catch(e){}}]);var t=JSON.parse(localStorage.getItem("No_Consent")),a=Date.now();return null!=t&&Object.keys(t).forEach((e=>{var r=new Date(t[e].creation);(r=r.getTime())+24*parseInt(t[e][e+"_expiration"])*60*60*1e3<a&&delete t[e]})),localStorage.setItem("No_Consent",JSON.stringify(t)),DTM.tools.marfeel.utils.markTimeLoads("marfeelTrackedPV"),this.trackedPV=!0,DTM.notify("PV tracked in tool <marfeel> (Data Layer)"),!0},trackAsyncPV:function(){if(this.enabled==DTM.tools.DISABLED)return!1;this.trackPV()},trackEvent:function(e){if(this.enabled==DTM.tools.DISABLED)return DTM.events.setEffect(e,"marfeel",!1),!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("Marfeel event past not valid <"+t+">","error"),!1;var t=_satellite.getVar("event")[e].eventInfo.eventName,a=_satellite.getVar("event")[e].attributes;switch("T1"!=_satellite.getVar("user:subscriptionType")&&"T2"!=_satellite.getVar("user:subscriptionType")?window.marfeel.cmd.push(["compass",function(e){e.setUserVar("subscriberType","not-set")}]):window.marfeel.cmd.push(["compass",function(e){e.setUserVar("subscriberType",_satellite.getVar("user:subscriptionType"))}]),t){case"userNewsletterIN":window.marfeel.cmd.push(["compass",function(e){var t="";for(code in a.newsletters)t=t+" "+a.newsletters[codes];e.trackNewPage({rs:"userNewsletterIN "+t})}]),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>"),DTM.events.setEffect(e,"marfeel",!0);break;case"userLogin":window.marfeel.cmd.push(["compass",function(e){e.trackNewPage({rs:"userLogin"})}]),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>"),DTM.events.setEffect(e,"marfeel",!0);break;case"userRegister":window.marfeel.cmd.push(["compass",function(e){e.trackNewPage({rs:"userRegister"})}]),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>"),DTM.events.setEffect(e,"marfeel",!0);break;case"audioReady":case"videoReady":void 0===DTM.tools.marfeel.dl.mediaReady[a.mediaID]&&(window.marfeel.cmd.push(["multimedia",function(e){var r="";null==a.mediaID&&null!=a.mediaId&&(a.mediaID=a.mediaId),r=null==a.mediaFormat?"audioReady"==t?"audio":"videoReady"==t?"video":"not-set":a.mediaFormat,"streaming"==a.mediaRepType&&(a.mediaDuration=-1),e.initializeItem(null!=a.mediaID?a.mediaID:"not-set",DTM.utils.getPlayerType(a.playerType),null!=a.mediaID?a.mediaID:"not-set",r,{isLive:null!=a.mediaRepType&&"streaming"==a.mediaRepType,title:null!=a.mediaName?a.mediaName:"not-set",description:null!=a.mediaName?a.mediaName:"not-set",url:null!=a.mediaUrl?a.mediaUrl:"not-set",thumbnail:null!=a.mediaThumbnail?a.mediaThumbnail:"not-set",authors:null!=a.mediaAuthors?a.mediAuthors:"not-set",publishTime:null!=a.mediaPlublishTime?a.mediaPlublishTime:"not-set",duration:null!=a.mediaDuration?a.mediaDuration:"not-set"})}]),DTM.tools.marfeel.dl.mediaReady[a.mediaID]=!0,DTM.events.setEffect(e,"marfeel",!0),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>"));break;case"adPlay":case"videoPlay":case"reelPlay":case"videoPaused":case"videoResumed":case"videoEnd":case"reelEnd":case"audioPlay":case"audioResumed":case"audioPaused":case"audioEnd":if(null==a.mediaID&&null==a.mediaId)return!1;null==a.mediaID&&null!=a.mediaId&&(a.mediaID=a.mediaId),void 0!==DTM.tools&&void 0!==DTM.tools.marfeel&&void 0!==DTM.tools.marfeel.dl&&void 0!==DTM.tools.marfeel.dl.mediaReady&&void 0!==DTM.tools.marfeel.dl.mediaReady[a.mediaID]?(window.marfeel.cmd.push(["multimedia",function(e){e.registerEvent(a.mediaID,DTM.tools.marfeel.dl.mapEvents[t],parseInt(a.currentTime))}]),void 0===DTM.tools.marfeel.dl.mediaControls[a.mediaID]?"audioPlay"!=t&&"videoPlay"!=t&&"reelPlay"!=t&&"audioResumed"!=t&&"videoResumed"!=t&&"adEnd"!=t||DTM.tools.marfeel.utils.mediaIntervals(a.mediaID,"set",parseInt(a.currentTime)):"audioPaused"!=t&&"videoPaused"!=t&&"audioEnd"!=t&&"videoEnd"!=t&&"reelEnd"!=t&&"adPlay"!=t||DTM.tools.marfeel.utils.mediaIntervals(a.mediaID,"clear"),DTM.events.setEffect(e,"marfeel",!0),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>")):DTM.notify("Alert evento Media sin Ready en tool <Marfeel>");break;case"share":window.marfeel.cmd.push(["compass",function(e){e.setPageVar("share",a.shareRRSS)}]),DTM.events.setEffect(e,"marfeel",!0),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>");break;case"photogallery":window.marfeel.cmd.push(["compass",function(e){e.trackConversion("photogallery")}]),DTM.events.setEffect(e,"marfeel",!0),DTM.notify("Event <"+t+"> tracked in tool <Marfeel>");break;case"userSubscription":var r={"epmas>suscripcion>confirmation":"basica","epmas>suscripcion>premium_confirmation":"premium","epmas>upgrade_premium>confirmation":"upgrade"};window.marfeel.cmd.push(["compass",function(e){e.setPageVar("test_DTM",_satellite.getVar("subCategory2")),e.setPageVar("tipoSuscripcion",r[_satellite.getVar("subCategory2")]),e.trackConversion("subscribe"),DTM.notify("Event <userSubscription> tracked in tool <Marfeel>")}]);break;default:return DTM.events.setEffect(e,"marfeel",!1),!1}return!0},isEnabled:function(){var e=void 0!==DTM.config.mrf_enabled?DTM.config.mrf_enabled:DTM.tools.allowAll;(!e||_satellite.getVar("platform")!=DTM.PLATFORM.AMP&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(e=!1),e)&&(e=-1==["autor","buscador","concursos","desconocido","diarioas","ecuador#","formularios","promocionespapel","republica-dominicana","scripts","player"].indexOf(_satellite.getVar("primaryCategory")));return e=e?DTM.tools.ENABLED:DTM.tools.DISABLED },ABTesting:function(){if(_satellite.getVar("platform")==DTM.PLATFORM.FBIA)return!1;if("portada"!=_satellite.getVar("pageType")&&"portadilla"!=_satellite.getVar("pageType")&&"articulo"!=_satellite.getVar("pageType"))return!1;var e=document.createElement("script");e.setAttribute("language","javascript"),e.setAttribute("type","module"),e.setAttribute("src",DTM.tools.marfeel.lib.testab("module")),document.head.appendChild(e);var t=document.createElement("script");t.setAttribute("language","javascript"),t.setAttribute("type","text/javascript"),t.setAttribute("nomodule",""),t.setAttribute("src",DTM.tools.marfeel.lib.testab("nomodule")),document.head.appendChild(t)},utils:{mediaTimeFunction:function(e){void 0!==DTM.tools.marfeel.dl.mediaControls[e]&&(DTM.tools.marfeel.dl.mediaControls[e].currentTime+=5,window.marfeel.cmd.push(["multimedia",function(t){t.registerEvent(e,"updateCurrentTime",DTM.tools.marfeel.dl.mediaControls[e].currentTime)}]))},markTimeLoads:function(e){"object"!=typeof window.targetTimeLoad&&(window.targetTimeLoad={}),"object"!=typeof window.targetTimeLoad.markedEvents&&(window.targetTimeLoad.markedEvents={}),void 0===window.targetTimeLoad.markedEvents[e]&&(window.targetTimeLoad[e]=performance.now(),window.targetTimeLoad.markedEvents[e]=!0),Object.keys(targetTimeLoad).length>=26&&!window.targetTimeLoad.isAllMarkedEvents&&(window.marfeel=window.marfeel||{cmd:[]},window.marfeel.cmd.push(["compass",function(e){for(let t in window.targetTimeLoad)e.setPageVar(t,window.targetTimeLoad[t]);e.trackConversion("MarkTimeLoad"),window.targetTimeLoad.isAllMarkedEvents=!0}]))},mediaIntervals:function(e,t,a){if("set"==t){if(void 0===DTM.tools.marfeel.dl.mediaControls[e]){DTM.tools.marfeel.dl.mediaControls[e]={};var r={intervalo:setInterval((function(){DTM.tools.marfeel.utils.mediaTimeFunction(e)}),5e3),currentTime:a};DTM.tools.marfeel.dl.mediaControls[e]=r}}else"clear"==t&&(clearInterval(DTM.tools.marfeel.dl.mediaControls[e].intervalo),delete DTM.tools.marfeel.dl.mediaControls[e])}}},comscore:{enabled:1,dl:{},consents:-1,consentsID:77,map:{consents:{}},trackedPV:!1,init:function(){DTM.utils.isUE()?(window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){Didomi.getUserStatus().vendors.consent.enabled.indexOf(77)>-1&&(DTM.tools.comscore.enabled=DTM.tools.comscore.isEnabled(),DTM.tools.comscore.consents=DTM.CONSENTS.DEFAULT,DTM.tools.comscore.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("comscore"),DTM.tools.comscore.createMap(),DTM.tools.comscore.setDL({id:"production"==_satellite.environment.stage&&_satellite.getVar("validPage")?"8671776":"-1",pbn:"PRISA",src:"1"==_satellite.getVar("ssl")?"https://sb.scorecardresearch.com":"http://b.scorecardresearch.com",c3:encodeURIComponent("ELPAIS.COM Sites"),c4:encodeURIComponent("ELPAIS.COM"),img:new Image(1,1)}),DTM.tools.comscore.enabled!=DTM.tools.DISABLED&&!1!==_satellite.getVar("videoContent")&&(DTM.tools.comscore.videoMetrix.enabled=!0,DTM.tools.comscore.videoMetrix.load())),window.didomiEventListeners=window.didomiEventListeners||[],window.didomiEventListeners.push({event:"consent.changed",listener:function(){Didomi.getUserStatus().vendors.consent.enabled.indexOf(77)>-1&&(DTM.tools.comscore.enabled=DTM.tools.comscore.isEnabled(),DTM.tools.comscore.consents=DTM.CONSENTS.DEFAULT,DTM.tools.comscore.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("comscore"),DTM.tools.comscore.createMap(),DTM.tools.comscore.setDL({id:"production"==_satellite.environment.stage&&_satellite.getVar("validPage")?"8671776":"-1",pbn:"PRISA",src:"1"==_satellite.getVar("ssl")?"https://sb.scorecardresearch.com":"http://b.scorecardresearch.com",c3:encodeURIComponent("ELPAIS.COM Sites"),c4:encodeURIComponent("ELPAIS.COM"),img:new Image(1,1)}),DTM.tools.comscore.enabled!=DTM.tools.DISABLED&&!1!==_satellite.getVar("videoContent")&&(DTM.tools.comscore.videoMetrix.enabled=!0,DTM.tools.comscore.videoMetrix.load()),DTM.tools.comscore.trackPV())}})}))):(DTM.tools.comscore.enabled=DTM.tools.comscore.isEnabled(),DTM.tools.comscore.consents=DTM.CONSENTS.DEFAULT,DTM.tools.comscore.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("comscore"),DTM.tools.comscore.createMap(),DTM.tools.comscore.setDL({id:"production"==_satellite.environment.stage&&_satellite.getVar("validPage")?"8671776":"-1",pbn:"PRISA",src:"1"==_satellite.getVar("ssl")?"https://sb.scorecardresearch.com":"http://b.scorecardresearch.com",c3:encodeURIComponent("ELPAIS.COM Sites"),c4:encodeURIComponent("ELPAIS.COM"),img:new Image(1,1)}),DTM.tools.comscore.enabled!=DTM.tools.DISABLED&&!1!==_satellite.getVar("videoContent")&&(DTM.tools.comscore.videoMetrix.enabled=!0,DTM.tools.comscore.videoMetrix.load()),DTM.tools.comscore.trackPV())},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=void 0!==DTM.config.csc_enabled?DTM.config.csc_enabled:DTM.tools.allowAll;return!e||_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(e=!1),e&&"brasil.elpais.com"==_satellite.getVar("server")&&(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED},createMap:function(){this.map.consents[DTM.CONSENTS.WAITING]="",this.map.consents[DTM.CONSENTS.DEFAULT]="1",this.map.consents[DTM.CONSENTS.ACCEPT]="1",this.map.consents[DTM.CONSENTS.REJECT]="0"},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||!0===this.trackedPV)return!1;if(this.consents==DTM.CONSENTS.WAITING)return!1;this.getDL();window._comscore=window._comscore||[],window._comscore.push({c1:"2",c2:"8671776",options:{enableFirstPartyCookie:!0},cs_ucfr:this.map.consents[this.consents]}),function(){var e=document.createElement("script"),t=document.getElementsByTagName("script")[0];e.async=!0,e.src="https://sb.scorecardresearch.com/cs/8671776/beacon.js",t.parentNode.insertBefore(e,t)}(),this.trackedPV=!0},trackAsyncPV:function(){if(this.enabled!=DTM.tools.ENABLED)return!1;this.getDL();"undefined"!=typeof COMSCORE&&COMSCORE.beacon({c1:"2",c2:"8671776",options:{enableFirstPartyCookie:!0},cs_ucfr:this.map.consents[this.consents]})},trackEvent:function(e){if(this.enabled==DTM.tools.DISABLED)return DTM.events.setEffect(e,"comscore",!1),!1;this.getDL();var t=!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("ComScore event past not valid <"+a+">","error"),!1;var a=_satellite.getVar("event")[e].eventInfo.eventName,r=_satellite.getVar("event")[e].attributes,i=r.hasOwnProperty("currentTime")?1e3*r.currentTime:-1,s=r.hasOwnProperty("mediaID")?r.mediaID:!!r.hasOwnProperty("videoID")&&r.videoID,n=r.hasOwnProperty("playerType")?DTM.utils.getPlayerType(r.playerType):"";switch(a){case"photogallery":"undefined"!=typeof COMSCORE&&(COMSCORE.beacon({c1:"2",c2:"8671776",options:{enableFirstPartyCookie:!0},cs_ucfr:this.map.consents[this.consents]}),t=!0);break;case DTM.events.VIDEOREADY:t=!(!1===this.videoMetrix.enabled||!this.videoMetrix.isValidPlayer(n)||!1===s||!this.videoMetrix.init(s));break;case DTM.events.VIDEORELOAD:!1!==this.videoMetrix.enabled&&this.videoMetrix.isValidPlayer(n)&&!1!==s?(this.videoMetrix.replay(s),t=!0):t=!1;break;case DTM.events.ADPLAY:case DTM.events.ADRESUMED:case DTM.events.VIDEOPLAY:case DTM.events.VIDEORESUMED:!1!==this.videoMetrix.enabled&&this.videoMetrix.isValidPlayer(n)&&!1!==s&&this.videoMetrix.init(s)?(a==DTM.events.ADPLAY||a==DTM.events.ADRESUMED?this.videoMetrix.setAdMetadata(r,s):this.videoMetrix.setMetadata(r,s),this.videoMetrix.play(s,a,i),t=!0):t=!1;break;case DTM.events.VIDEOEND:case DTM.events.ADEND:case DTM.events.ADSKIP:!1!==this.videoMetrix.enabled&&this.videoMetrix.isValidPlayer(n)&&!1!==s&&this.videoMetrix.init(s)?(this.videoMetrix.end(s,a,i),t=!0):t=!1;break;case DTM.events.VIDEOPAUSED:case DTM.events.ADPAUSED:!1!==this.videoMetrix.enabled&&this.videoMetrix.isValidPlayer(n)&&!1!==s&&this.videoMetrix.init(s)?(this.videoMetrix.pause(s,a,i),t=!0):t=!1;break;default:t=!1}return t&&DTM.notify("Event <"+a+"> tracked in tool <ComScore>"),DTM.events.setEffect(e,"comscore",t),t},videoMetrix:{enabled:!1,initialized:!1,myStreamingAnalytics:[],lib:"https://ep00.epimg.net/js/comun/streamsense.js",load:function(){var e=DTM.tools.comscore.dl;DTM.utils.loadScript(this.lib,(function(){window.ns_=ns_.analytics,window.ns_.PlatformApi.setPlatformAPI(window.ns_.PlatformApi.PlatformApis.WebBrowser),window.ns_.configuration.addClient(new window.ns_.configuration.PublisherConfiguration({publisherId:e.id})),window.ns_.configuration.setUsagePropertiesAutoUpdateMode(window.ns_.configuration.UsagePropertiesAutoUpdateMode.FOREGROUND_AND_BACKGROUND)}))},init:function(e){return!1!==this.enabled&&void 0!==window.ns_&&void 0!==e&&(this.initialized||(this.initialized=!0,window.ns_.start()),void 0===this.myStreamingAnalytics[e]&&(this.myStreamingAnalytics[e]={sa:new window.ns_.StreamingAnalytics,state:"",currentTime:0},this.myStreamingAnalytics[e].sa.createPlaybackSession()),!0)},isValidPlayer:function(e){return-1==["youtube"].indexOf(e)},setMetadata:function(e,t){if(void 0===window.ns_||void 0===e||!1===t)return!1;var a=DTM.tools.comscore.dl,r=e.hasOwnProperty("mediaRepType")?e.mediaRepType:e.hasOwnProperty("videoRepType")?e.videoRepType:"";r=""!=r?"streaming"==r?window.ns_.StreamingAnalytics.ContentMetadata.ContentType.LIVE:window.ns_.StreamingAnalytics.ContentMetadata.ContentType.SHORT_FORM_ON_DEMAND:"";var i=e.hasOwnProperty("mediaDuration")?e.mediaDuration:e.hasOwnProperty("videoDuration")?e.videoDuration:"";i=""!=i?1e3*parseInt(i):0;var s=new ns_.StreamingAnalytics.ContentMetadata;s.setMediaType(r),s.setUniqueId(!1===t?"null":t),s.setLength(i),s.setDictionaryClassificationC3(a.c3),s.setDictionaryClassificationC4(a.c4),s.setDictionaryClassificationC6("*null"),s.setPublisherName(a.pbn),this.myStreamingAnalytics[t].sa.setMetadata(s)},setAdMetadata:function(e,t){if(void 0===window.ns_||void 0===e||!1===t)return!1;var a=DTM.tools.comscore.dl,r=e.hasOwnProperty("mediaRepType")?e.mediaRepType:e.hasOwnProperty("videoRepType")?e.videoRepType:"";r=""!=r?"streaming"==r?window.ns_.StreamingAnalytics.ContentMetadata.ContentType.LIVE:window.ns_.StreamingAnalytics.ContentMetadata.ContentType.SHORT_FORM_ON_DEMAND:"";var i=e.hasOwnProperty("mediaDuration")?e.mediaDuration:e.hasOwnProperty("videoDuration")?e.videoDuration:"";i=""!=i?1e3*parseInt(i):0;var s=new ns_.StreamingAnalytics.ContentMetadata;s.setMediaType(r),s.setUniqueId(!1===t?"null":t),s.setLength(i),s.setDictionaryClassificationC3(a.c3),s.setDictionaryClassificationC4(a.c4),s.setDictionaryClassificationC6("*null"),s.setPublisherName(a.pbn);var n=new window.ns_.StreamingAnalytics.AdvertisementMetadata,o="";if(void 0!==e.adMode)switch(e.adMode){case"post-roll":case"postroll":o=window.ns_.StreamingAnalytics.AdvertisementMetadata.AdvertisementType.ON_DEMAND_POST_ROLL;break;case"pre-roll":case"preroll":o=window.ns_.StreamingAnalytics.AdvertisementMetadata.AdvertisementType.ON_DEMAND_PRE_ROLL;break;case"mid-roll":case"midroll":o=window.ns_.StreamingAnalytics.AdvertisementMetadata.AdvertisementType.ON_DEMAND_MID_ROLL}n.setMediaType(o),n.setRelatedContentMetadata(s),this.myStreamingAnalytics[t].sa.setMetadata(n)},play:function(e,t,a){if(void 0===window.ns_||void 0===e)return!1;t==DTM.events.VIDEORESUMED&&this.myStreamingAnalytics[e].state===DTM.events.VIDEOPAUSED&&a!=this.myStreamingAnalytics[e].currentTime?(this.myStreamingAnalytics[e].sa.startFromPosition(a),this.myStreamingAnalytics[e].sa.notifySeekStart()):this.myStreamingAnalytics[e].sa.notifyPlay(),this.myStreamingAnalytics[e].state=t,this.myStreamingAnalytics[e].currentTime=a},replay:function(e){if(void 0===window.ns_||void 0===e)return!1;void 0!==this.myStreamingAnalytics[e]&&delete this.myStreamingAnalytics[e]},pause:function(e,t,a){if(void 0===window.ns_||void 0===e)return!1;this.myStreamingAnalytics[e].sa.notifyPause(),this.myStreamingAnalytics[e].state=t,this.myStreamingAnalytics[e].currentTime=a},end:function(e,t,a){if(void 0===window.ns_||void 0===e)return!1;this.myStreamingAnalytics[e].sa.notifyEnd(),this.myStreamingAnalytics[e].state=t,this.myStreamingAnalytics[e].currentTime=a}}},facebook:{enabled:1,dl:{},consents:-1,consentsID:"c:facebook-YyJRAyed",trackedPV:!1,init:function(){this.enabled=this.isEnabled(),this.consents=DTM.CONSENTS.DEFAULT,this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("facebook"),this.setDL({id:"1461658713846525",idHavas:"807598982615379",src:"https://www.facebook.com/tr",trackingCode:""!=_satellite.getVar("campaign")?_satellite.getVar("campaign"):"none",campaign:""!=_satellite.getVar("campaign")?_satellite.getVar("campaign"):"none"})},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=void 0!==DTM.config.fbk_enabled?DTM.config.fbk_enabled:DTM.tools.allowAll;return e&&_satellite.getVar("platform")==DTM.PLATFORM.WIDGET&&(e=!1),e=(e=e&&!0===_satellite.getVar("validPage")&&!1===_satellite.getVar("translatePage"))?DTM.tools.ENABLED:DTM.tools.DISABLED},trackPV:function(e){if("undefined"!=typeof Didomi&&void 0!==Didomi.getUserConsentStatusForVendor&&Didomi.getUserConsentStatusForVendor("c:facebook-YyJRAyed")&&(this.consents=1),this.enabled!=DTM.tools.ENABLED||void 0===e&&this.trackedPV||_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&this.consents!==DTM.CONSENTS.ACCEPT)return!1;var t=this.getDL();DTM.utils.sendBeacon(t.src,{id:t.id,ev:"PageView",dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL")},!1,"ts"),DTM.utils.sendBeacon(t.src,{id:t.id,ev:"ViewContent",dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL"),"cd[campaign]":t.campaign,"cd[content_name]":_satellite.getVar("pageName"),"cd[content_category]":_satellite.getVar("primaryCategory"),"cd[registeredUser]":"1"==_satellite.getVar("user:registeredUser")?"reg":"anon","cd[sysEnv]":_satellite.getVar("sysEnv"),"cd[trackingCode]":t.trackingCode,"cd[userType]":_satellite.getVar("user:type"),"cd[paywallBlock]":"bloqueante"==_satellite.getVar("paywall:contentAdType")?"1":"0"},!1,"ts"),"epmas>suscripcion>confirmation"==_satellite.getVar("subCategory2")&&DTM.utils.sendBeacon(t.src,{id:t.id,ev:"SubsComplete",dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL"),"cd[content_name]":_satellite.getVar("pageName"),"cd[content_category]":_satellite.getVar("primaryCategory"),"cd[sysEnv]":_satellite.getVar("sysEnv"),"cd[sku]":_satellite.getVar("paywall:cartProduct"),"cd[userType]":_satellite.getVar("user:type")},!1,"ts");var a={"epmas>suscripcion>checkout":"InitiateCheckout","epmas>suscripcion>payment":"AddPaymentInfo","epmas>suscripcion>confirmation":"Purchase"};a.hasOwnProperty(_satellite.getVar("subCategory2"))&&DTM.utils.sendBeacon(t.src,{id:t.idHavas,ev:a[_satellite.getVar("subCategory2")],dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL")},!1,"ts"),DTM.utils.sendBeacon(t.src,{id:t.idHavas,ev:"PageView",dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL")},!1,"ts"),this.trackedPV=!0},trackAsyncPV:function(){this.trackPV(!0)},trackEvent:function(e){if(this.enabled==DTM.tools.DISABLED||this.consents!==DTM.CONSENTS.ACCEPT)return DTM.events.setEffect(e,"facebook",!0),!1;var t=this.getDL(),a=!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("Facebook event past not valid <"+r+">","error"),!1;var r=_satellite.getVar("event")[e].eventInfo.eventName,i=_satellite.getVar("event")[e].attributes;return r==DTM.events.UUVINC||r==DTM.events.USERREGISTER?(DTM.utils.sendBeacon(t.src,{id:t.id,ev:"CompleteRegistration",dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL"),"cd[campaign]":t.campaign,"cd[content_name]":_satellite.getVar("pageName"),"cd[content_category]":_satellite.getVar("primaryCategory"),"cd[registeredUser]":"1"==_satellite.getVar("user:registeredUser")?"reg":"anon","cd[sysEnv]":_satellite.getVar("sysEnv"),"cd[trackingCode]":t.trackingCode,"cd[userType]":_satellite.getVar("user:type"),"cd[status]":r==DTM.events.USERREGISTER?"register":"vinculation","cd[reg_origin]":void 0!==i.registerOrigin?i.registerOrigin:"","cd[reg_prod_origin]":void 0!==i.registerProd?i.registerProd:"","cd[reg_type]":r==DTM.events.UUVINC?"vinculation":"undefined"!=i.registerType?"clasico"==i.registerType?"classic":"social("+i.registerType+")":""},!1,"ts"),a=!0):r==DTM.events.CHECKOUT&&(DTM.utils.sendBeacon(t.src,{id:t.id,ev:"InitiateCheckout",dl:_satellite.getVar("destinationURL"),rl:_satellite.getVar("referringURL")},!1,"ts"),a=!0),a&&DTM.notify("Event <"+r+"> tracked in tool <Facebook>"),DTM.events.setEffect(e,"facebook",a),a}},elpais:{enabled:1,dl:{},trackedPV:!1,eventQueue:[],map:{events:{},vars:{}},init:function(){this.enabled=this.isEnabled(),this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("elpais"),this.createMap(),this.setDL({img:null,src:{realTime:("production"==_satellite.environment.stage&&_satellite.getVar("validPage"),""),pep:"//pxlctl.elpais.com/pxlctl.gif",cloudfront:"//d30wo2lffetbp8.cloudfront.net/"},realTime:{piid:"not-set",pn:"not-set",g:"not-set",ch:"not-set",tit:"not-set",typ:"not-set",h:"not-set",r:"not-set",cms:"not-set",edn:"not-set",edc:"not-set",ts:"not-set",co:"not-set",sys:"not-set",uid:"not-set",arcid:"not-set",aid:"not-set",ust:"not-set",ustamp:"not-set",usty:"not-set",pwt:"not-set",pws:"not-set",pwp:"not-set",pwcart:"not-set",pwstep:"not-set",pwact:"not-set",pwcou:"not-set",pwad:"not-set",pwori:"not-set",pwmod:"not-set",pwtrty:"not-set"}})},createMap:function(){this.map.events[DTM.events.PHOTOGALLERY]="photogallery",this.map.events[DTM.events.SCROLLINF]="scrollInf",this.map.events[DTM.events.RECOMMENDERIMPRESSION]="r",this.map.events[DTM.events.INTERNALPIXEL]="internalPixel",this.map.events[DTM.events.USERREGISTER]="okreg",this.map.events[DTM.events.USERLOGIN]="oklog",this.map.events[DTM.events.READARTICLE]="readArticle",this.map.events[DTM.events.VIDEOPLAY]="videoPlay",this.map.events[DTM.events.VIDEO25]="video25",this.map.events[DTM.events.VIDEO50]="video50",this.map.events[DTM.events.VIDEO75]="video75",this.map.events[DTM.events.VIDEOEND]="videoEnd",this.map.events[DTM.events.CHECKOUT]="checkout",this.map.vars.recommenderTime1="t1",this.map.vars.recommenderTime="t",this.map.vars.recommenderError="e",this.map.vars.recommenderTo="to",this.map.vars.recommenderS="s",this.map.vars.userID="u",this.map.vars.registerType="rgt",this.map.vars.registerOrigin="rgo",this.map.vars.registerProd="rgp",this.map.vars.videoName="vn",this.map.vars.mediaName="vn",this.map.vars.registerBackURL="rbu",this.map.vars.paywallTransactionType="pwtrty"},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=void 0!==DTM.config.ep_enabled?DTM.config.ep_enabled:DTM.tools.allowAll;return e&&_satellite.getVar("platform")==DTM.PLATFORM.WIDGET&&(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED},trackPV:function(e){if(this.enabled!=DTM.tools.ENABLED||void 0===e&&this.trackedPV)return!1;var t=this.getDL();t.realTime.piid=_satellite.getVar("pageInstanceID"),t.realTime.pn=_satellite.getVar("pageName"),t.realTime.g=_satellite.getVar("destinationURL"),t.realTime.ch=_satellite.getVar("primaryCategory"),t.realTime.tit=_satellite.getVar("pageTitle"),t.realTime.typ=_satellite.getVar("pageType"),t.realTime.h=_satellite.getVar("server"),t.realTime.r=_satellite.getVar("referringURL"),t.realTime.edn=_satellite.getVar("editionNavigation"),t.realTime.edc=_satellite.getVar("edition"),t.realTime.cms=_satellite.getVar("cms"),t.realTime.sys=_satellite.getVar("sysEnv"),t.realTime.ts=this.getTimeStamp(),t.realTime.aid=_satellite.getVar("user:experienceCloudID"),t.realTime.uid=_satellite.getVar("user:profileID"),t.realTime.arcid=_satellite.getVar("user:ID"),t.realTime.co=_satellite.getVar("user:country"),t.realTime.ust=_satellite.getVar("user:registeredUser"),t.realTime.ustamp=_satellite.getVar("user:registeredUserAMP"),t.realTime.usty=_satellite.getVar("user:type"),t.realTime.pwt=_satellite.getVar("paywall:signwallType"),t.realTime.pws="1"==_satellite.getVar("paywall:contentBlocked")?"cerrado":"abierto",t.realTime.pwp=_satellite.getVar("user:subscriptions"),t.realTime.pwstep=this.getPaywallStep(),t.realTime.pwact=!0===_satellite.getVar("paywall:active")?"activo":!1===_satellite.getVar("paywall:active")?"inactivo":"not-set",t.realTime.pwcou=_satellite.getVar("paywall:counter"),t.realTime.pwad=_satellite.getVar("paywall:contentAdType"),t.realTime.pwcart="not-set"!=_satellite.getVar("paywall:cartProduct")?_satellite.getVar("paywall:cartProduct"):"",t.realTime.pwori=_satellite.getVar("paywall:transactionOrigin"),t.realTime.pwmod=_satellite.getVar("paywall:type"),t.realTime.pwtrty=_satellite.getVar("paywall:transactionType");var a=DTM.utils.copyObject(t.realTime);for(var r in a.ev="pageView",this.trackedPV=!1,this.eventQueue)this.trackEvent(r)},trackAsyncPV:function(){this.trackPV(!0)},trackEvent:function(e){if(this.enabled==DTM.tools.DISABLED)return DTM.events.setEffect(e,"elpais",!1),!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("EL PAIS event past not valid <"+t+">","error"),!1;var t=_satellite.getVar("event")[e].eventInfo.eventName,a=_satellite.getVar("event")[e].attributes,r=this.map.events[t];if(!this.map.events.hasOwnProperty(t))return DTM.events.setEffect(e,"elpais",!1),!1;if(this.isEnabled==DTM.tools.ENABLED&&!this.trackedPV)return this.eventQueue.push(e),DTM.events.setEffect(e,"elpais",!1),!1;var i=this.getDL(),s=!1;switch(t){case DTM.events.USERREGISTER:case DTM.events.USERLOGIN:case DTM.events.READARTICLE:case DTM.events.CHECKOUT:i.realTime.ts=this.getTimeStamp(),t==DTM.events.CHECKOUT&&(i.realTime.pwstep="checkout",i.realTime.pwcart=void 0!==a.paywallCartProduct?a.paywallCartProduct:"not-set"!=_satellite.getVar("paywall:cartProduct")?_satellite.getVar("paywall:cartProduct"):"");var n=DTM.utils.copyObject(i.realTime);for(var o in n.ev=r,this.map.vars)a.hasOwnProperty(o)&&(n[this.map.vars[o]]=a[o]);s=!1;break;case DTM.events.INTERNALPIXEL:case DTM.events.RECOMMENDERIMPRESSION:if((n=[]).ch=_satellite.getVar("primaryCategory"),a.hasOwnProperty("userID")||(a.userID=_satellite.getVar("user:profileID")),"object"==typeof a.extraParams)for(var l in a.extraParams)n[l]=a.extraParams[l];for(var o in this.map.vars)a.hasOwnProperty(o)&&(n[this.map.vars[o]]="e"==this.map.vars[o]?a[o].toUpperCase():a[o]);r=a.hasOwnProperty("pixelName")?a.pixelName:"r";s=DTM.utils.sendBeacon(i.src.cloudfront+encodeURIComponent(r)+".gif",n,!1,!1,!1);break;default:s=!1}return s&&DTM.notify("Event <"+t+"> tracked in tool <EL PAIS>"),DTM.events.setEffect(e,"elpais",s),s},getTimeStamp:function(e){var t="";if(e)t=_satellite.getVar("date:fullYear")+"/"+_satellite.getVar("date:month")+"/"+_satellite.getVar("date:day")+"T"+_satellite.getVar("date:hours")+":"+_satellite.getVar("date:minutes")+":"+_satellite.getVar("date:seconds");else{var a=new Date;t=a.getFullYear()+"/"+DTM.utils.formatDate(a.getMonth()+1)+"/"+DTM.utils.formatDate(a.getDate())+"T"+DTM.utils.formatDate(a.getHours())+":"+DTM.utils.formatDate(a.getMinutes())+":"+DTM.utils.formatDate(a.getSeconds())}return t},getPaywallStep:function(){var e="";if("epmas"==_satellite.getVar("primaryCategory"))switch(_satellite.getVar("subCategory2")){case"epmas>suscripcion>home":e="landing";break;case"epmas>suscripcion>registro":-1==_satellite.getVar("referringURL").indexOf("elpais.com/landing_oferta")&&-1==document.referrer.indexOf("elpais.com/landing_oferta")&&-1==_satellite.getVar("referringURL").indexOf("elpais.com/suscripciones")&&-1==document.referrer.indexOf("elpais.com/suscripciones")||(e="registro");break;case"epmas>suscripcion>login":-1==_satellite.getVar("referringURL").indexOf("elpais.com/landing_oferta")&&-1==document.referrer.indexOf("elpais.com/landing_oferta")&&-1==_satellite.getVar("referringURL").indexOf("elpais.com/suscripciones")&&-1==document.referrer.indexOf("elpais.com/suscripciones")||(e="login");break;case"epmas>suscripcion>checkout":e="checkout";break;case"epmas>suscripcion>payment":e="payment";break;case"epmas>suscripcion>confirmation":e=""!=_satellite.getVar("paywall:transactionID")?"confirmation":"";break;default:-1!=_satellite.getVar("pageName").indexOf("elpaiscom/suscripciones/oferta/")&&(e="")}return e}},google:{enabled:!0,dl:{},trackedPV:!1,consents:-1,consentsID:"google",init:function(){if("undefined"!=typeof Didomi&&Didomi.getUserConsentStatusForVendor("google")){this.enabled=this.isEnabled(),this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("google"),this.consents=DTM.CONSENTS.DEFAULT,this.setDL({ep:"//googleads.g.doubleclick.net/pagead/viewthroughconversion/",pbs:"https://pubads.g.doubleclick.net/activity;",floodlight:"https://ad.doubleclick.net/ddm/activity"});var e=document.createElement("script");e.async=!0,e.src="https://www.googletagmanager.com/gtag/js?id=AW-10850525560",document.querySelector("head").appendChild(e)}},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=void 0!==DTM.config.goo_enabled?DTM.config.goo_enabled:DTM.tools.allowAll;return!e||_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||this.consents!==DTM.CONSENTS.ACCEPT)return!1;var e=this.getDL();if(DTM.utils.sendBeacon(e.ep+"965296472/",{value:"0",guid:"ON",script:"0"},!1,"rnd"),"mx"==_satellite.getVar("user:country")&&DTM.utils.sendBeacon(e.ep+"802913665/",{value:"0",guid:"ON",script:"0"},!1,"rnd"),"epmas"==_satellite.getVar("primaryCategory"))switch(_satellite.getVar("subCategory2")){case"epmas>suscripcion>home":DTM.utils.sendBeacon(e.floodlight+"/src=8310699;type=visit_ep;cat=lpg_s0;u9="+_satellite.getVar("server")+";dc_lat=;dc_rdid=;tag_for_child_directed_treatment=;tfua=;npa=;gdpr=${GDPR};gdpr_consent=${GDPR_CONSENT_755};ord="+1e13*Math.random()+"?",{},!1);break;case"epmas>suscripcion>checkout":DTM.utils.sendBeacon(e.floodlight+"/src=8310699;type=visit_ep;cat=cnv_s0;u9="+_satellite.getVar("server")+";dc_lat=;dc_rdid=;tag_for_child_directed_treatment=;tfua=;npa=;gdpr=${GDPR};gdpr_consent=${GDPR_CONSENT_755};ord="+1e13*Math.random()+"?",{},!1),DTM.utils.sendBeacon(e.pbs+"xsp=4617931;ord="+1e13*Math.random()+"?",{},!1);break;case"epmas>suscripcion>payment":DTM.utils.sendBeacon(e.floodlight+"/src=8310699;type=visit_ep;cat=cnv_s00u2="+_satellite.getVar("user:subscriptions")+";u9="+_satellite.getVar("server")+";dc_lat=;dc_rdid=;tag_for_child_directed_treatment=;tfua=;npa=;gdpr=${GDPR};gdpr_consent=${GDPR_CONSENT_755};ord="+1e13*Math.random()+"?",{},!1);break;case"epmas>suscripcion>confirmation":DTM.utils.sendBeacon(e.floodlight+"/src=8310699;type=sales;cat=cnv_s0;qty=1;cost=[Revenue];u2="+_satellite.getVar("user:subscriptions")+";u9="+_satellite.getVar("server")+";dc_lat=;dc_rdid=;tag_for_child_directed_treatment=;tfua=;npa=;gdpr=${GDPR};gdpr_consent=${GDPR_CONSENT_755};ord="+_satellite.getVar("paywall:transactionID")+"?",{},!1),DTM.utils.sendBeacon(e.pbs+"xsp=4623404;ord="+1e13*Math.random()+"?",{},!1)}if(document.location.href.indexOf("captacion-especial-5")>-1){function t(){dataLayer.push(arguments)}window.dataLayer=window.dataLayer||[],t("js",new Date),t("config","AW-10850525560")}document.location.href.indexOf("captacion-especial-5/#/confirmation")>-1&&t("event","conversion",{send_to:"AW-10850525560/vKSmCNbopvMZEPjC97Uo",value:18,currency:"EUR"}),this.trackedPV=!0},trackEvent:function(e){if(this.enabled!=DTM.tools.ENABLED||this.consents!==DTM.CONSENTS.ACCEPT)return DTM.events.setEffect(e,"google",!1),!1;var t=this.getDL(),a=!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("Google event past not valid <"+r+">","error"),!1;var r=_satellite.getVar("event")[e].eventInfo.eventName;_satellite.getVar("event")[e].attributes;return r==DTM.events.CHECKOUT&&(DTM.utils.sendBeacon(t.floodlight+"/src=8310699;type=visit_ep;cat=cnv_s0;u9="+_satellite.getVar("server")+";dc_lat=;dc_rdid=;tag_for_child_directed_treatment=;tfua=;npa=;gdpr=${GDPR};gdpr_consent=${GDPR_CONSENT_755};ord="+1e13*Math.random(),{},!1),DTM.utils.sendBeacon(t.pbs+"xsp=4617931;ord="+1e13*Math.random(),{},!1),a=!0),a&&DTM.notify("Event <"+r+"> tracked in tool <Google>"),DTM.events.setEffect(e,"google",a),a},trackAsyncPV:function(){this.trackPV()}},triton:{enabled:1,dl:{stationID:693093},trackedPV:!1,init:function(){"object"!=typeof tdIdsync&&document.URL.indexOf("suscr")<0&&_satellite.getVar("subCategory1").indexOf("suscr")<0&&(window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(e){if(void 0!==e){if(e.getUserStatus().vendors.consent.enabled.indexOf(239)>-1){window.mm_didomi_cs_t=e.getUserConsentStatusForVendor("239");var t=window.cmpConsentString,a=(window.mm_didomi_cs_t,e.isRegulationApplied("gdpr")?1:0),r=document.createElement("script");r.type="text/javascript",r.src="https://playerservices.live.streamtheworld.com/api/idsync.js?stationId="+DTM.tools.triton.dl.stationID+"&gdpr="+a+"&gdpr_consent="+t,r.onload=function(){"undefined"!=typeof mm_demo&&mm_demo&&console.log("%cCookie Sync loaded","font-weight:bold;color:orange")};var i=document.getElementsByTagName("script")[0];i.parentNode.insertBefore(r,i)}}else{window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(e){e.getObservableOnUserConsentStatusForVendor("239").subscribe((function(t){if(void 0===t)window.mm_didomi_cs_t=!1;else if(!0===t){window.mm_didomi_cs_t=e.getUserConsentStatusForVendor("239");var a=window.cmpConsentString,r=(window.mm_didomi_cs_t,e.isRegulationApplied("gdpr")?1:0),i=document.createElement("script");i.type="text/javascript",i.src="https://playerservices.live.streamtheworld.com/api/idsync.js?stationId="+DTM.tools.triton.dl.stationID+"&gdpr="+r+"&gdpr_consent="+a,i.onload=function(){"undefined"!=typeof mm_demo&&mm_demo&&console.log("%cCookie Sync loaded","font-weight:bold;color:orange")};var s=document.getElementsByTagName("script")[0];s.parentNode.insertBefore(i,s)}else!1===t&&(window.mm_didomi_cs_t=!1)}))}))}})))}},AEPConsents:{enabled:!0,dl:{},trackedPV:!1,vendors_list:{"c:0anuncian-BzrcXrYe":"la_liga","c:anunciante_la_liga":"la_liga"},init:function(){this.enabled=this.isEnabled(),this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("AEPConsents")},isEnabled:function(){var e=void 0!==DTM.config.consent_send_enabled?DTM.config.consent_send_enabled:DTM.tools.allowAll;return!e||_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED)return!1;window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(e){function t(t){consentData=e.getUserStatus(),acceptedPurposses=consentData.purposes.consent.enabled,rejectedPurposses=consentData.purposes.consent.disabled,enabled_json={};for(const e of acceptedPurposses)switch(e){case"sharingda-aQwVWdxj":enabled_json.data_sharing_web="y";break;case"sharingof-wG7bxM8E":enabled_json.data_sharing="y";break;default:enabled_json[e]="y"}disabled_json={};for(const e of rejectedPurposses)switch(e){case"sharingda-aQwVWdxj":disabled_json.data_sharing_web="n";break;case"sharingof-wG7bxM8E":disabled_json.data_sharing="n";break;default:disabled_json[e]="n"}acceptedVendors=consentData.vendors.consent.enabled,rejectedVendors=consentData.vendors.consent.disabled,vendors_enabled_json={};for(const e of acceptedVendors)void 0!==DTM.tools.AEPConsents.vendors_list[e]&&(vendors_enabled_json[DTM.tools.AEPConsents.vendors_list[e]]="y");vendors_disabled_json={};for(const e of rejectedVendors)void 0!==DTM.tools.AEPConsents.vendors_list[e]&&(vendors_disabled_json[DTM.tools.AEPConsents.vendors_list[e]]="n");var a={};a="1"==digitalData.user.registeredUser&&""!=digitalData.user.profileID&&_satellite.getVar("user:experienceCloudID")?{ECID:[{id:_satellite.getVar("user:experienceCloudID"),primary:!1}],USUNUID:[{id:digitalData.user.profileID,primary:!0}]}:{ECID:[{id:_satellite.getVar("user:experienceCloudID"),primary:!0}]};var r=Object.assign(enabled_json,disabled_json),i=Object.assign(vendors_enabled_json,vendors_disabled_json);r.partners=i;var s="";"undefined"!=typeof didomiRemoteConfig&&void 0!==didomiRemoteConfig.notices[0]&&void 0!==didomiRemoteConfig.notices[0].notice_id&&(s="-"+didomiRemoteConfig.notices[0].notice_id);var n="pageview";t&&(n="consent update");var o={header:{schemaRef:{id:"https://ns.adobe.com/prisacom/schemas/8e2617119901b47918ccaf4d7e375a8be0842e54ba682af1",contentType:"application/vnd.adobe.xed-full+json;version=1"},imsOrgId:"2387401053DB208C0A490D4C@AdobeOrg",datasetId:"644125ae1894cf1c06549900",flowId:"766d9358-aa82-40f8-bf37-127e65cf06e1"},body:{xdmMeta:{schemaRef:{id:"https://ns.adobe.com/prisacom/schemas/8e2617119901b47918ccaf4d7e375a8be0842e54ba682af1",contentType:"application/vnd.adobe.xed-full+json;version=1"}},xdmEntity:{_prisacom:{consent:r}, identityMap:a,extSourceSystemAudit:{lastUpdatedBy:"didomi "+e.getTCFVersion()+s+"-"+_satellite.getVar("publisher").toLowerCase()+"-"+n,lastUpdatedDate:(new Date).toISOString()}}}};fetch("https://dcs.adobedc.net/collection/e571fc265fac50018a554f5329fd64e442c402492069befe67bd5410c95afea7",{method:"POST",body:JSON.stringify(o),headers:{"Content-Type":"application/json",Accept:"application/json"}}),DTM.tools.AEPConsents.trackedPV=!0}_satellite.getVar("user:experienceCloudID")&&38==_satellite.getVar("user:experienceCloudID").length&&new RegExp("^[0-9]+$").test(_satellite.getVar("user:experienceCloudID"))&&(e.shouldConsentBeCollected()?e.getObservableOnUserConsentStatusForVendor("565").subscribe((function(e){void 0===e||(!0===e||!1===e)&&t(!0)})):(window.didomiEventListeners=window.didomiEventListeners||[],window.didomiEventListeners.push({event:"consent.changed",listener:function(){t(!0)}}),t()))}))}},liveramp:{enabled:1,dl:{},consents:-1,consentsID:97,map:{consents:{}},trackedPV:!1,init:function(){this.enabled=this.isEnabled(),this.consents=DTM.CONSENTS.DEFAULT,this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("liveramp"),this.createMap(),this.setDL({id:"a95fc332-885d-40c0-aa11-3c7c55aa0d7d"})},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=DTM.utils.getQueryParam("liveramp_enabled"),t=void 0!==DTM.config.liveramp_enabled?DTM.config.liveramp_enabled:"1"==e||"0"!=e&&DTM.tools.allowAll;return!t||_satellite.getVar("platform")!=DTM.PLATFORM.AMP&&_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(t=!1),t=t?DTM.tools.ENABLED:DTM.tools.DISABLED,_satellite.getVar("platform")==DTM.PLATFORM.AMPPLAYER&&(t=DTM.tools.ONLYEVENTS),t},createMap:function(){this.map.consents[DTM.CONSENTS.WAITING]="",this.map.consents[DTM.CONSENTS.DEFAULT]="1",this.map.consents[DTM.CONSENTS.ACCEPT]="1",this.map.consents[DTM.CONSENTS.REJECT]="0"},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||!0===this.trackedPV)return!1;if("undefined"==typeof ats){var e=this.getDL(),t=document.createElement("script"),a=document.getElementsByTagName("script")[0];t.setAttribute("defer",""),t.async=!0,t.src="https://ats-wrapper.privacymanager.io/ats-modules/"+e.id+"/ats.js",a.parentNode.insertBefore(t,a)}null!=DTM.utils.getCookie("hem")&&("undefined"==typeof ats?window.addEventListener("envelopeModuleReady",(()=>{atsenvelopemodule.setAdditionalData({type:"emailHashes",id:[DTM.utils.getCookie("hem")]})})):null!=DTM.utils.getCookie("hem")&&atsenvelopemodule.setAdditionalData({type:"emailHashes",id:[DTM.utils.getCookie("hem")]})),this.trackedPV=!0,DTM.notify("PV tracked in tool <LiveRamp> (Data Layer)")}},amazonaps:{enabled:1,dl:{src:"https://c.amazon-adsystem.com",path:"/aax2/apstag.js"},consents:-1,consentsID:394,map:{consents:{}},trackedPV:!1,init:function(){this.enabled=this.isEnabled(),this.consents=DTM.CONSENTS.DEFAULT,DTM.tools.list.push("amazonaps"),DTM.trackGDPRPV("amazonaps")},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=DTM.utils.getQueryParam("amzaps_enabled"),t=void 0!==DTM.config.amzaps_enabled?DTM.config.amzaps_enabled:"1"==e||"0"!=e&&DTM.tools.allowAll;return!t||_satellite.getVar("platform")!=DTM.PLATFORM.AMP&&_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(t=!1),t=t?DTM.tools.ENABLED:DTM.tools.DISABLED,_satellite.getVar("platform")==DTM.PLATFORM.AMPPLAYER&&(t=DTM.tools.ONLYEVENTS),t},createMap:function(){this.map.consents[DTM.CONSENTS.WAITING]="",this.map.consents[DTM.CONSENTS.DEFAULT]="1",this.map.consents[DTM.CONSENTS.ACCEPT]="1",this.map.consents[DTM.CONSENTS.REJECT]="0"},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||!0===this.trackedPV)return!1;try{if("undefined"==typeof apstag){!function(e,t){function a(a,r){t[e]._Q.push([a,r])}t[e]||(t[e]={init:function(){a("i",arguments)},fetchBids:function(){a("f",arguments)},setDisplayBids:function(){},targetingKeys:function(){return[]},dpa:function(){a("di",arguments)},rpa:function(){a("ri",arguments)},upa:function(){a("ui",arguments)},_Q:[]})}("apstag",window),apstag.init({pubID:"3226",adServer:"googletag",videoAdServer:"DFP",bidTimeout:800,gdpr:{cmpTimeout:700},deals:!0});var e=this.getDL(),t=document.createElement("script"),a=document.getElementsByTagName("script")[0];t.async=!0,t.src=e.src+e.path,a.parentNode.insertBefore(t,a);var r=document.createElement("link"),i=document.createElement("link");if(r.setAttribute("rel","dns-prefetch"),i.setAttribute("rel","preconnect"),r.src=e.src,i.src=e.src,a.parentNode.insertBefore(r,a),a.parentNode.insertBefore(i,a),null!=DTM.utils.getCookie("hem")&&"undefined"!=typeof apstag)if(void 0!==apstag.rpa)apstag.rpa({gdpr:{enabled:!0,consent:DTM.utils.getCookie("euconsent-v2")},hashedRecords:[{type:"email",record:DTM.utils.getCookie("hem")}],ttl:604800});else{setTimeout((function(){"undefined"!=typeof apstag&&void 0!==apstag.rpa&&apstag.rpa({gdpr:{enabled:!0,consent:DTM.utils.getCookie("euconsent-v2")},hashedRecords:[{type:"email",record:DTM.utils.getCookie("hem")}],ttl:604800})}),3e3)}}else void 0!==apstag.rpa&&null!=DTM.utils.getCookie("hem")&&apstag.rpa({gdpr:{enabled:!0,consent:DTM.utils.getCookie("euconsent-v2")},hashedRecords:[{type:"email",record:DTM.utils.getCookie("hem")}],ttl:604800})}catch(t){}this.trackedPV=!0,DTM.notify("PV tracked in tool <Amazon APS> (Data Layer)")}},target:{enabled:!0,dl:{},trackedPV:!1,getDL:function(){return this.dl},setDL:function(e){this.dl=e},init:function(){this.enabled=this.isEnabled(),this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("target")},isEnabled:function(){return!0===DTM.config.atg_enabled?DTM.tools.ENABLED:DTM.tools.DISABLED},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||"undefined"==typeof adobe||void 0===adobe.target||"function"!=typeof adobe.target.getOffer||"function"!=typeof adobe.target.triggerView||"function"!=typeof adobe.target.trackEvent)return!1;adobe.target.trackEvent({mbox:"userTypeMBox",params:{userType:_satellite.getVar("user:type")}});var e={"epmas>suscripcion>confirmation":"orderConfirmPage","epmas>suscripcion>checkout":"orderCheckoutPage","epmas>suscripcion>payment":"orderPaymentPage"};if(e.hasOwnProperty(_satellite.getVar("subCategory2"))){var t={sku:_satellite.getVar("paywall:cartProduct"),transactionType:_satellite.getVar("paywall:transactionType")};"epmas>suscripcion>confirmation"==_satellite.getVar("subCategory2")&&(t.orderId=_satellite.getVar("paywall:transactionID")),adobe.target.trackEvent({mbox:e[_satellite.getVar("subCategory2")],params:t}),"epmas>suscripcion>confirmation"==_satellite.getVar("subCategory2")&&adobe.target.getOffer({mbox:"orderConfirm"+_satellite.getVar("paywall:cartProduct"),params:{sku:_satellite.getVar("paywall:cartProduct"),transactionType:_satellite.getVar("paywall:transactionType")},success:function(){},error:function(){}})}this.trackedPV=!0},trackEvent:function(e){if(this.enabled!=DTM.tools.ENABLED)return DTM.events.setEffect(e,"target",!1),!1;if(void 0===_satellite.getVar("event")[e])return DTM.notify("Target event past not valid <"+t+">","error"),!1;var t=_satellite.getVar("event")[e].eventInfo.eventName,a=_satellite.getVar("event")[e].attributes,r=!1;if(t==DTM.events.CHECKOUT){var i=a.hasOwnProperty("paywallTransactionType")&&"google"===a.paywallTransactionType?"orderCheckoutButtonSWG":"orderCheckoutButton";adobe.target.getOffer({mbox:i,params:{orderId:_satellite.getVar("paywall:transactionID"),"productPurchasedId ":_satellite.getVar("paywall:cartProduct")},success:function(){},error:function(){}}),r=!0}else if(t==DTM.events.BUTTONCLICK&&a.hasOwnProperty("buttonName")){var s={"epmas:checkout:pago":"orderCheckoutButton","epmas:checkout:chat:abrir:boton":"chatCheckoutButton","epmas:checkout:chat:abrir:icono":"chatCheckoutIcon","epmas:checkout:faq":"faqCheckoutButton","epmas:payment:pago":"orderPaymentButton","epmas:payment:chat:abrir:boton":"chatPaymentButton","epmas:payment:chat:abrir:icono":"chatPaymentIcon","epmas:payment:faq":"faqPaymentButton"};s.hasOwnProperty(a.buttonName)&&(adobe.target.getOffer({mbox:s[a.buttonName],params:{orderId:"","productPurchasedId ":_satellite.getVar("paywall:cartProduct")},success:function(){},error:function(){}}),r=!0)}else t==DTM.events.USERREGISTER&&(adobe.target.getOffer({mbox:"userRegisterOK",params:{originURL:a.hasOwnProperty("registerBackURL")?a.registerBackURL:location.href.replace(/[\?#].*?$/g,""),registerType:a.hasOwnProperty("registerType")?a.registerType:"not-set"},success:function(){},error:function(){}}),r=!0);return r&&DTM.notify("Event <"+t+"> tracked in tool <Target>"),DTM.events.setEffect(e,"target",r),r},trackAsyncPV:function(){this.enabled==DTM.tools.ENABLED&&"undefined"!=typeof adobe&&void 0!==adobe.target&&"function"==typeof adobe.target.triggerView&&adobe.target.triggerView(_satellite.getVar("pageName")),this.trackPV()}},wemass:{enabled:1,consents:-1,consentsID:968,trackedPV:!1,dl:{},init:function(){this.enabled=this.isEnabled()},getDL:function(){return this.dl},setDL:function(e){this.dl=e},lib:{init:function(){window.__wmass=window.__wmass||{},window.__wmass.bff=window.__wmass.bff||[],window.__wmass.getSegments=window.__wmass.getSegments||function(){try{pSegs=JSON.parse(window.localStorage._papns||"[]").slice(0,250).map(String)}catch(e){pSegs=[]}return{permutive:pSegs}};var e=document.createElement("script");e.src="https://service.wemass.com/dmp/30fcc5b151d263b41e36afc371fa61be.js",e.async=!0,document.body.appendChild(e)}},isEnabled:function(){this.canInitWemassByCountry()&&(window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){return-1!=Didomi.getUserStatus().vendors.consent.enabled.indexOf(968)?(DTM.tools.list.push("wemass"),DTM.tools.wemass.lib.init(),DTM.tools.wemass.trackedPV=DTM.tools.wemass.trackPV(),!0):-1==Didomi.getUserStatus().vendors.consent.disabled.indexOf(968)&&void Didomi.getObservableOnUserConsentStatusForVendor(this.consentID).subscribe((function(e){return void 0!==e&&(!0===e?(DTM.tools.list.push("wemass"),this.lib.init(),this.trackedPV=this.trackPV(),!0):!1!==e&&void 0)}))})))},canInitWemassByCountry:function(){var e="";DTM.utils.getCookie("arc-geo")?e=JSON.parse(DTM.utils.getCookie("arc-geo")).countrycode:DTM.utils.getCookie("pbsCountry")?e=DTM.utils.getCookie("pbsCountry"):DTM.utils.getCookie("eptz")?e=DTM.utils.getCookie("eptz"):"undefined"!=typeof PBS&&PBS.env.country&&(e=PBS.env.countryByTimeZone);return"ES"==e},getMeta:function(e){return"function"==typeof document.querySelectorAll&&document.querySelector('meta[name="'+e+'"]')&&document.querySelector('meta[name="'+e+'"]').content?document.querySelector('meta[name="'+e+'"]').content:""},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||!0===this.trackedPV)return!1;try{let e=[];digitalData.page.pageInfo.tags&&Array.isArray(digitalData.page.pageInfo.tags)&&digitalData.page.pageInfo.tags.forEach((t=>{t.name&&e.push(t.name)}));let t=[];return digitalData.page.pageInfo.author&&Array.isArray(digitalData.page.pageInfo.author)&&digitalData.page.pageInfo.author.forEach((e=>{e.name&&t.push(e.name)})),__wmass.bff.push((function(){"undefined"!=typeof digitalData&&(digitalData.user,1)&&void 0!==digitalData.user.profileID&&""!=digitalData.user.profileID&&__wmass.dmp.identify([{tag:"prisaProfile",id:digitalData.user.profileID}]),__wmass.dmp.addon("web",{page:{type:_satellite.getVar("pageType"),article:{topics:e,section:_satellite.getVar("primaryCategory"),subsection:_satellite.getVar("subCategory1"),description:DTM.tools.wemass.getMeta("description"),authors:t,id:digitalData.page.pageInfo.articleID},content:{categories:[_satellite.getVar("primaryCategory")]}}})})),DTM.notify("PV tracked in tool <wemass> (Data Layer)"),!0}catch(e){}this.trackedPV=!0,DTM.notify("PV tracked in tool <wemass> (Data Layer)")}},zeotap:{enabled:1,dl:{proId:"c54999bd-9dcc-4165-9bc7-565630567c7a",environment:"",filterId:"pruebaZeotap",consent:!0},consents:-1,consentsID:301,map:{consents:{}},lib:{init:function(){DTM.tools.zeotap.dl;!function(e,t){var a=t.createElement("script");a.type="text/javascript",a.crossorigin="anonymous",a.async=!0,a.src="https://content.zeotap.com/sdk/idp.min.js",a.onload=function(){},(t=t.getElementsByTagName("script")[0]).parentNode.insertBefore(a,t),function(e,t,a){for(var r=0;r<t.length;r++)!function(t){e[t]=function(){e[a].push([t].concat(Array.prototype.slice.call(arguments,0)))}}(t[r])}(t=e.zeotap||{_q:[],_qcmp:[]},["callMethod"],"_q"),e.zeotap=t,e.zeotap.callMethod("init",{partnerId:"c54999bd-9dcc-4165-9bc7-565630567c7a",useConsent:!0,checkForCMP:!1})}(window,document)}},trackedPV:!1,init:function(){window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){if(Didomi.getUserStatus().vendors.consent.enabled.indexOf(301)>-1){"fbia"==_satellite.getVar("platform")&&(window.ia_document={shareURL:_satellite.getVar("destinationURL"),referrer:_satellite.getVar("referringURL")});DTM.tools.zeotap.getDL();DTM.tools.zeotap.enabled=DTM.tools.zeotap.isEnabled();DTM.tools.zeotap.getDL();DTM.tools.zeotap.enabled!=DTM.tools.DISABLED&&(DTM.tools.list.push("zeotap"),window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){didomiState,didomiState.didomiVendorsConsentDenied,-1==didomiState.didomiVendorsConsentDenied.indexOf(":301,")&&(DTM.tools.zeotap.lib.init(),document.addEventListener("readystatechange",(()=>{"complete"==document.readyState?DTM.tools.zeotap.trackedPV=DTM.tools.zeotap.trackPV():window.addEventListener("DOMContentLoaded",(()=>{DTM.tools.zeotap.trackedPV=DTM.tools.zeotap.trackPV()}))})))}))),DTM.tools.zeotap.trackedPV=!0}window.didomiEventListeners=window.didomiEventListeners||[],window.didomiEventListeners.push({event:"consent.changed",listener:function(){if(Didomi.getUserStatus().vendors.consent.enabled.indexOf(301)>-1){"fbia"==_satellite.getVar("platform")&&(window.ia_document={shareURL:_satellite.getVar("destinationURL"),referrer:_satellite.getVar("referringURL")});DTM.tools.zeotap.getDL();DTM.tools.zeotap.enabled=DTM.tools.zeotap.isEnabled();DTM.tools.zeotap.getDL();DTM.tools.zeotap.enabled!=DTM.tools.DISABLED&&(DTM.tools.list.push("zeotap"),window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){didomiState,didomiState.didomiVendorsConsentDenied,-1==didomiState.didomiVendorsConsentDenied.indexOf(":301,")&&(DTM.tools.zeotap.lib.init(),document.addEventListener("readystatechange",(()=>{"complete"==document.readyState?DTM.tools.zeotap.trackedPV=DTM.tools.zeotap.trackPV():window.addEventListener("DOMContentLoaded",(()=>{DTM.tools.zeotap.trackedPV=DTM.tools.zeotap.trackPV()}))})))}))),DTM.tools.zeotap.trackedPV=!0}}})}))},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){var e=DTM.utils.getQueryParam("zeotap_enabled"),t=void 0!==DTM.config.zeotap_enabled?DTM.config.zeotap_enabled:"1"==e||"0"!=e&&DTM.tools.allowAll;return!t||_satellite.getVar("platform")!=DTM.PLATFORM.AMP&&_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(t=!1),t=t?DTM.tools.ENABLED:DTM.tools.DISABLED,_satellite.getVar("platform")==DTM.PLATFORM.AMPPLAYER&&(t=DTM.tools.ONLYEVENTS),t},createMap:function(){this.map.consents[DTM.CONSENTS.WAITING]="",this.map.consents[DTM.CONSENTS.DEFAULT]="1",this.map.consents[DTM.CONSENTS.ACCEPT]="1",this.map.consents[DTM.CONSENTS.REJECT]="0"},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||!0===this.trackedPV)return!1;var e=this.getDL();void 0!==zeotap.setConsent&&(zeotap.setConsent(e.consent,7),zeotap.setUserIdentities({email:DTM.utils.getCookie("hem")},!0),DTM.notify("PV tracked in tool <zeotap> (Data Layer) consent: true")),this.trackedPV=!0}},critnam:{enabled:1,dl:{id:"PRRA_827_738_836",src:"prra.spxl.socy.es"},trackedPV:!1,init:function(){this.enabled=this.isEnabled();var e=this.enabled;window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){Didomi.getUserStatus().vendors.consent.enabled.indexOf(85)>-1&&e==DTM.tools.ENABLED&&_satellite.getVar("validPage")&&(!function(e,t,a,r){function i(a,r){var i;let s;i=function(){e.consenTag?e.consenTag.init({containerId:a,silentMode:!0},r||!1):console.warn("consenTag was not available")},(s=t.createElement("script")).src="https://consentag.eu/public/3.1.1/consenTag.js",s.async=!0,s.onload=i,t.head.appendChild(s)}r=r||2,!0?e.__tcfapi("ping",r,(function(t){t.cmpLoaded&&(t.gdprApplies?e.__tcfapi("addEventListener",r,(function(e,t){t&&("useractioncomplete"===e.eventStatus||"tcloaded"===e.eventStatus)&&e.tcString&&i(a,e.tcString)})):i(a,!0))})):i(a,!0)}(window,document,"79722161",2),DTM.tools.list.push("critnam")),window.didomiEventListeners=window.didomiEventListeners||[],window.didomiEventListeners.push({event:"consent.changed",listener:function(){Didomi.getUserStatus().vendors.consent.enabled.indexOf(85)>-1&&e==DTM.tools.ENABLED&&_satellite.getVar("validPage")&&(!function(e,t,a,r){function i(a,r){var i;let s;i=function(){e.consenTag?e.consenTag.init({containerId:a,silentMode:!0},r||!1):console.warn("consenTag was not available")},(s=t.createElement("script")).src="https://consentag.eu/public/3.1.1/consenTag.js",s.async=!0,s.onload=i,t.head.appendChild(s)}r=r||2,!0?e.__tcfapi("ping",r,(function(t){t.cmpLoaded&&(t.gdprApplies?e.__tcfapi("addEventListener",r,(function(e,t){t&&("useractioncomplete"===e.eventStatus||"tcloaded"===e.eventStatus)&&e.tcString&&i(a,e.tcString)})):i(a,!0))})):i(a,!0)}(window,document,"79722161",2),DTM.tools.list.push("critnam"))}})}))},isEnabled:function(){let e=void 0!==DTM.config.critnam_enabled?DTM.config.critnam_enabled:DTM.tools.allowAll;return!e||_satellite.getVar("platform")!=DTM.PLATFORM.AMP&&_satellite.getVar("platform")!=DTM.PLATFORM.FBIA&&_satellite.getVar("platform")!=DTM.PLATFORM.WIDGET||(e=!1),e=e?DTM.tools.ENABLED:DTM.tools.DISABLED,e},trackPV:function(){return this.enabled==DTM.tools.ENABLED&&!0!==this.trackedPV&&(this.trackedPV=!0,DTM.notify("PV tracked in tool <critnam> (Data Layer)"),!0)}},nicequest:{enabled:1,dl:{},trackedPV:!1,consents:-1,consentsID:1296,init:function(){this.enabled=this.isEnabled(),this.enabled!=DTM.tools.DISABLED&&DTM.tools.list.push("nicequest"),this.consents=DTM.CONSENTS.DEFAULT,this.setDL({src:{domain:"https://mpc.nicequest.com",end_point:"/mpc/ConsumerServlet"},parameters:{p:"FLUZES_261164",s:"PRISA",gdpr:"{GDPR}",gdpr_consent:"{GDPR_CONSENT_1296}"}})},getDL:function(){return this.dl},setDL:function(e){this.dl=e},isEnabled:function(){return window.location.href.indexOf("clima-y-medio-ambiente")>-1||"https://elpais.com/"==window.location.href},trackPV:function(){if(this.enabled!=DTM.tools.ENABLED||this.consents!==DTM.CONSENTS.ACCEPT)return!1;var e=this.getDL();DTM.utils.sendBeacon(e.src.domain+e.src.end_point,e.parameters,!1,!1,!0),this.trackedPV=!0},trackAsyncPV:function(){this.trackPV()}}},trackGDPRPV:function(e,t){var a=DTM.tools[e].consentsID;"undefined"!=typeof Didomi&&"function"==typeof Didomi.getObservableOnUserConsentStatusForVendor?Didomi.getObservableOnUserConsentStatusForVendor(a).subscribe((function(a){DTM.tools[e].consents=void 0===a?DTM.CONSENTS.WAITING:!0===a?DTM.CONSENTS.ACCEPT:DTM.CONSENTS.REJECT,!1!==DTM.tools[e].trackPV()&&DTM.notify("PV tracked in tool <"+e+"> ("+t+")")})):void 0!==window.gdprAppliesGlobally?function(e){window.didomiOnReady=window.didomiOnReady||[],window.didomiOnReady.push((function(){Didomi.getObservableOnUserConsentStatusForVendor(a).subscribe((function(t){DTM.tools[e].consents=void 0===t?DTM.CONSENTS.WAITING:!0===t?DTM.CONSENTS.ACCEPT:DTM.CONSENTS.REJECT,DTM.tools[e].trackPV()}))}))}(e):(DTM.tools[e].consents=DTM.CONSENTS.DEFAULT,DTM.tools[e].trackPV())},trackPV:function(){if(DTM.tools.initialized)for(var e in this.tools.list){var t=this.tools.list[e];if(this.tools.hasOwnProperty(t)&&"function"==typeof this.tools[t].trackPV)if(void 0!==this.tools[t].consentsID&&void 0!==window.gdprAppliesGlobally)DTM.trackGDPRPV(t,"data layer + consents");else!1!==DTM.tools[t].trackPV()&&DTM.notify("PV tracked in tool <"+t+"> (data layer)")}else this.notify("Uninitialized tools")},trackAsyncPV:function(){var e=_satellite.getVar("pageName");if(DTM.dateInit=new Date,DTM.internalTest="",DTM.dataLayer.asyncPV=!0,DTM.dataLayer.init(),e==_satellite.getVar("pageName")&&"epmas"==_satellite.getVar("primaryCategory"))return DTM.notify("Async PV duplicate (not tracked)","warn"),!1;for(var t in this.tools.list){var a=this.tools.list[t];if(this.tools.hasOwnProperty(a)&&void 0!==this.tools[a].trackAsyncPV)!1!==this.tools[a].trackAsyncPV()&&DTM.notify("Async PV tracked in tool <"+a+"> (async)")}},trackEvent:function(e,t){if(this.notify("DTM.trackEvent fired <"+e+">",!0),"string"==typeof e&&(void 0===t||"object"==typeof t))if(this.tools.initialized)if(this.events.validEvent(e))if(("videoPaused"==e||"audioPaused"==e)&&t.hasOwnProperty("currentTime")&&t.hasOwnProperty("mediaDuration")&&parseInt(t.currentTime)>0&&parseInt(t.mediaDuration)-parseInt(t.currentTime)<2)DTM.notify("Event not valid <"+e+">");else if((t=this.utils.formatData(t)).hasOwnProperty("validEvent")||e!=DTM.events.USERLOGIN&&e!=DTM.events.USERREGISTER){var a=window.digitalData.event.length;for(var r in window.digitalData.event.push({eventInfo:{eventName:e,eventAction:e,timeStamp:new Date,effect:[]},category:{primaryCategory:_satellite.getVar("primaryCategory"),subCategory1:_satellite.getVar("subCategory1"),pageType:_satellite.getVar("pageType")},attributes:t}),DTM.tools.list){var i=DTM.tools.list[r];"object"==typeof DTM.tools[i]&&"function"==typeof DTM.tools[i].trackEvent&&DTM.tools[i].trackEvent(a)}}else DTM.notify("Event from page not valid <"+e+">","error");else DTM.notify("Event not valid <"+e+">","error");else this.eventQueue.push({eventName:e,data:t})}},DTM.init(); });_satellite["_runScript2"](function(event, target, Promise) { try{DTM.tools.marfeel.utils.markTimeLoads("pmSegmentsMappingInit");var ecid=null;let e=new Event("pmSegmentsUpdated");window.pmSegmentsUpdated=!1,alloy("getIdentity").then((function(t){ecid=t.identity.ECID;var i={},s="",a="";i={ECID:[{id:ecid,primary:!1}]},void 0!==JSON.parse(DTM.utils.getCookie("pmuser")).uid&&(a=JSON.parse(DTM.utils.getCookie("pmuser")).uid,i.USUNUID=[{id:a,authenticatedState:"authenticated",primary:!1}]),null!=event.detail&&null!=event.detail.arcid?s=event.detail.arcid:void 0!==JSON.parse(DTM.utils.getCookie("pmuser")).uuid&&(s=JSON.parse(DTM.utils.getCookie("pmuser")).uuid),""!=s&&(i.ARCID=[{id:s,authenticatedState:"authenticated",primary:!0}]),alloy("sendEvent",{xdm:{identityMap:i}}).then((function(t){DTM.tools.marfeel.utils.markTimeLoads("ecidLoadFromPMSegments"),console.log("Results: ",t.destinations);for(var i=t.destinations,n="",d=[],o=0;o<i.length;o++)for(var l in i[o])if("marfeel"==i[o].alias){n=i[o].segments;for(var r=0;r<n.length;r++)d.push(n[r].id);break}window.marfeel=window.marfeel||{cmd:[]},0==d.length?window.marfeel.cmd.push(["compass",function(e){e.clearUserSegments()}]):window.marfeel.cmd.push(["compass",function(e){e.setUserSegments(d)}]);var m={};i=t.destinations;if(""!=s||""!=a)for(""!=s&&(m[s]={}),m[a]={},o=0;o<i.length;o++)if(""!=s&&"arcid"==i[o].alias.split("|")[1])for(m[s][i[o].alias]=[],r=0;r<i[o].segments.length;r++){var p='{"id":"'+i[o].segments[r].id+'"}';m[s][i[o].alias].push(JSON.parse(p))}else for(m[a][i[o].alias]=[],r=0;r<i[o].segments.length;r++){p='{"id":"'+i[o].segments[r].id+'"}';m[a][i[o].alias].push(JSON.parse(p))}else for(m[ecid]={},o=0;o<i.length;o++)for(m[ecid][i[o].alias]=[],r=0;r<i[o].segments.length;r++){p='{"id":"'+i[o].segments[r].id+'"}';m[ecid][i[o].alias].push(JSON.parse(p))}m.lastUpdated=Date.now();let c=new Date;c.setTime(c.getTime()+6048e5);let u="; expires="+c.toUTCString();document.cookie="pmsegments="+JSON.stringify(m)+"; domain=elpais.com ; expires = "+u+"; path=/",document.cookie="pmsegments="+JSON.stringify(m)+"; domain=.prisa.arcpublishing.com ; expires = "+u+"; path=/",pmSegmentsUpdated=!0,window.dispatchEvent(e),DTM.tools.marfeel.utils.markTimeLoads("pmSegmentsLoad")}))})).catch((function(){console.error("No se ha podido obtener el ECID del servicio alloy.getIdentity")}))}catch(e){} });#r_c_pbs {height:-872px;margin-top:0px;} .mpu_scrollfix > div {position:sticky; top:60px} .mpu_scrollfix {height:1600px;margin-top:2rem!important} .mpu_scrollfix:last-child {height:600px;}.sky1-ad {position: fixed; top: 0; left: 50%; margin-left: -1049px; z-index: 0; font-size: 16px; width:450px; justify-content:flex-end;display:flex;text-align: right;} .sky2-ad {position: fixed; top: 0; left: 50%; margin-left: 600px; z-index: 0; font-size: 16px; display:flex; width:450px;}#elpais_gpt-MLDB11 {margin-top:10px;} #ctn_freemium_article+#elpais_gpt-INTEXT {margin-top:40px !important;} .ad-loaded {display:flex !important} [id*="-MPU"] [id*="INTEXT"] {height:0px;width:0px;} .lateral > .widget_herramientas+.envoltorio_publi {position:sticky;top:0px;} div[id*="sinUso"] {display:none;} @media screen and (max-width: 767px) {.ad[id*=MPU],#elpais_gpt-MLDB3 {margin:20px 0; padding:6px 0px} .ad[id*=MPU] > div {position:sticky; top:70px;}} .ad-giga-1 {background-color:#fff} .ad-center-rail,.pbs-a-c {text-align: center;margin: 40px auto} .pbs-a-c-s, .pbs-a-c-s, .pbs-a-c-s iframe, .pbs-a-c-s div {text-align: center; margin:auto} .pbs-a-c iframe,.pbs-a-c div {text-align: center; margin:auto} .ad-text-center > div {padding:4px;box-sizing: content-box;} .ad-text-center {margin: 8px 0px 14px 0px;box-sizing: content-box;text-align:center;background-color: #f6f6f6;box-shadow: inset 0 0 1px #000000;} .envoltorio_pbs > div {padding-top: 0.25rem; padding-bottom: 0.25rem; margin: 0.5rem auto;}@keyframes fade-sticky { from {opacity: 0;} to {opacity: 1;} } @keyframes fade-btn { from {opacity: 0;} to {opacity: 1;} } #tbl-explore-more-container {z-index:5000} .s-h-pbs{-webkit-transform:translate(0px, 160%);-moz-transform:translate(0px, 160%);-o-transform:translate(0px, 160%);-ms-transform:translate(0px, 160%);transform:translate(0px, 160%)}.s-s-pbs{-webkit-transform:translate(0px, 0%);-moz-transform:translate(0px, 0%);-o-transform:translate(0px, 0%);-ms-transform:translate(0px, 0%);transform:translate(0px, 0%)}.s-d-pbs{-webkit-transform:translate(0px, 50%);-moz-transform:translate(0px, 50%);-o-transform:translate(0px, 50%);-ms-transform:translate(0px, 50%);transform:translate(0px, 50%)} #sticky-pbs {display: none;opacity: 0; animation: fade-sticky 0s ease-in-out 1s forwards} .show_container {display: block !important} #sticky-pbs{position:fixed;bottom:0;z-index:4980;width:100%;height:100px;-webkit-box-shadow:0 0 5px 2px rgba(0, 0, 0, 0.21);-moz-box-shadow:0 0 5px 2px rgba(0, 0, 0, 0.21);box-shadow:0 0 5px 2px rgba(0, 0, 0, 0.21)}#container_pbs{position:relative;height:100px;width:100%;display:flex;flex-direction:column;scroll-snap-type:y mandatory;scroll-behavior:smooth;overflow-y:hidden;-webkit-overflow-scrolling:touch;z-index:20;background-color:#fff}#container_pbs > div{height:100px;width:100%;flex-shrink:0;display:flex;justify-content:center;align-items:center;scroll-snap-align:start;position:relative;margin:10px 0;box-sizing:border-box}#container_pbs > div > p{color:blanchedalmond}#s-btn-pbs{opacity: 0; animation: fade-btn 1s ease-in-out 3s forwards;background-color:#fff;background-image:none !important;position:absolute;width:28px;height:28px;top:-27px;z-index:10;right:0;-webkit-box-shadow:0 0 5px 2px rgba(0, 0, 0, 0.21);-moz-box-shadow:0 0 5px 2px rgba(0, 0, 0, 0.21);box-shadow:0 0 5px 2px rgba(0, 0, 0, 0.21);border:none;border-radius:12px 0 0 0}#s-btn-pbss:after,#s-btn-pbs:after{content:'';position:absolute;left:50%;top:50%;height:16px;width:2px;background-color:#1d1d1d}#s-btn-pbs:before{content:'';position:absolute;left:50%;top:50%;height:16px;width:2px;background-color:#1d1d1d}#s-btn-pbs:before{transform:translate(-50%, -50%) rotate(-45deg)}#s-btn-pbs:after{transform:translate(-50%, -50%) rotate(45deg)} #sticky-pbs span {opacity: 0; animation: fade-btn 1s ease-in-out 3s forwards;z-index: 100;width:0;height:0;border-top:8px solid transparent;border-right:8px solid #000;border-bottom:8px solid transparent;position:absolute;right:0;top:5px} #sticky-pbs{width:990px;left:0;right:0;margin:auto;} #s-btn-pbs {right:-28px !important;padding:0px !important;top:-1px !important;box-shadow:none !important;background-color:#000 !important;border-radius:0px !important;cursor:pointer;} #s-btn-pbs:before, #s-btn-pbs:after {opacity: 0; animation: fade-btn 1s ease-in-out 3s forwards;background-color:#fff !important} #sticky-pbs {display:none !important;}.st-placement .st-adunit { z-index: 9999 !important; } .background-video-16-9 { background: linear-gradient(rgb(0, 0, 0) 0%, rgb(0, 0, 0) 23%, rgb(0, 0, 0) 40%, rgb(0, 0, 0) 55%, rgb(0, 0, 0) 76%, rgb(0, 0, 0) 97%, rgb(0, 0, 0) 99%, rgb(0, 0, 0) 100%, rgb(0, 0, 0) 100%) !important; } /* .fzls7a1 { color: #000; background: rgb(255, 255, 255) 0% } !important; */ .st-adunit-ad{ height: inherit; }

      Prueba

    1. Author response:

      Reviewer #1:

      The manuscript Xu et al. explores the regulation of the microtubule minus end protein CAMSAP2 localization to the Golgi by the Serine/threonine-protein kinase MARK2 (PAR1, PAR1B). The authors utilize immunofluorescence and biochemical approaches to demonstrate that MARK2 is localized at the Golgi apparatus via its spacer domain. They show that depletion of this protein alters Golgi morphology and diminishes CAMSAP2 localization to the Golgi apparatus. The authors combine mass spectroscopy and immunoprecipitation to show that CAMSAP2 is phosphorylated at S835 by MARK2, and that this phosphorylation regulates localization of CAMSAP2 at Golgi membranes. Further, the authors identify USO1 (p115) as the Golgi resident protein mediating CAMSAP2 recruitment to the Golgi apparatus following S835 phosphorylation. The authors would need to address the following queries to support their conclusions.

      We sincerely thank the reviewer for their valuable time and effort in evaluating our manuscript. We deeply appreciate the constructive feedback and insightful suggestions, which have been instrumental in improving the quality and clarity of our study. We have carefully considered all the comments and have made the necessary revisions to address the concerns raised.

      Major Comments 

      (1) Dynamic localization of CAMSAP2 during Golgi reorientation

      - The authors use fixed wound edges assays and co-localization analysis to describe changes in CAMSAP2 positioning during Golgi reorientation in response to polarizing cues (a free wound edge in this case). In Figure 1C, they present a graphical representation of quantified immunofluorescence images, using color coding to to describe the three states of Golgi reorientation in response to a wound (green, blue, red indicating non-polarised, partial and complete Golgi reorientation, respectively). They then use these 'colour coded' classifications to quantitate CAMSAP2/GM130 co-localization.It is unclear why the authors have not just used representative immunofluorescence images in the main figures. Transparent, color overlays could be placed over the cells in the representative images to indicate which of the three described states each cell is currently exhibiting. However, for clarity, I would recommend changing the color coded 'states' to a descriptor rather than a color. i.e. Figure 1D x axis labels should be 'complete' and 'partial', instead of 'red' and 'blue'. 

      Thank you for this insightful suggestion. We have added representative immunofluorescence images with transparent color overlay to indicate the three Golgi orientation states. These images are included in Supplementary Figure 2B-C, providing a clear visual reference for the quantitative data. Additionally, we have revised the x-axis labels in Figure 1E from "Red" and "Blue" to "Complete" and "Partial" to ensure clarity and consistency with the descriptive terminology in the text. These changes are described in the Results section (page 7, lines 15-19) and the figure legend (page 29, lines 27-29).

      We believe these updates improve the clarity and accessibility of our figures and hope they address the reviewer’s concerns.

      - note- figure 2 F-G, is semi quantitative, why did the authors not just measure Golgi angle using the nucleus and Golgi distribution?

      We appreciate the reviewer’s comment on this point. Following the recommendation, we have performed an additional analysis measuring Golgi orientation angles based on the nucleus-Golgi distribution. This quantitative approach complements our initial semi-quantitative analysis and provides a more precise assessment of Golgi orientation during cell migration.

      The new data have been incorporated into Supplementary Figure 1F-H. These results clearly demonstrate the consistency between the quantitative and semi-quantitative methods, further validating our findings and highlighting the dynamic changes in Golgi orientation during cell migration. These changes are described in the Results section (page 6, lines 24-31).

      - While it is established that the Golgi is dispersed during reorientation in wound edge migration, the Golgi apparatus also becomes dispersed/less condensed prior to cell division. As the authors have used fixed images - how are they sure that the Golgi morphology or CAMSAP2 localization in 'blue cells' are indicative of Golgi reorientation and not division? Live imaging of cells expressing CAMSAP2, and an additional Golgi marker could be used to demonstrate that the described changes in Golgi morphology and CAMSAP2 localization are occurring during the rear-to-front transition of the Golgi.

      Thank you for raising this important question. To address this concern, we carefully examined the nuclear morphology of dispersed Golgi cells and found no evidence of mitotic features, indicating that these cells are not undergoing division (Figure 1A, Supplemental Figure 2A). Furthermore, during the scratch wound assay, we use 2% serum to culture the cells, which helps minimize the impact of cell division. This analysis has been added to the Results section (page7, lines 19-22 in the revised manuscript).

      Additionally, we conducted live-cell imaging, as suggested, using cells expressing a Golgi marker. This approach confirmed that Golgi dispersion occurs transiently during reorientation in cell migration. The new live-cell imaging data have been incorporated into Supplementary Figure 2A, and the corresponding description has been updated in the Results section (page 7, lines 2-5).

      Finally, considering that overexpression of CAMSAP2 can lead to artifactually condensed Golgi structures, we used endogenous staining to observe CAMSAP2 localization at different stages of migration. These observations provide a clearer understanding of CAMSAP2 dynamics during Golgi reorientation and are now presented in revised Figure 1A-B. This information has been described in the Results section (page 7, lines 5-10).

      We hope these additions and clarifications address the reviewer’s concerns. Once again, we are deeply grateful for this constructive feedback, which has greatly improved the robustness of our study.

      (2) MARK2 localization to the Golgi apparatus

      - The authors investigated the positioning of endogenous MARK2 via immunofluorescence staining, and exogenous flag-tagged MARK2 in a KO background. The description of the protocol required to visualize Golgi localization of MARK2 is inconsistent between the results and methods text. The results text reads as through the 2% serum incubation occurs as a blocking step following fixation. Conversely, the methods section describes the 2% serum incubation as occurring just prior to fixation as a form of serum starvation. The authors need to clarify which of these protocols is correct. Further, whilst I can appreciate that the mechanistic understanding of why serum starvation is required for MARK2 Golgi localization is beyond the scope of the current work, the authors should at a minimum speculate in the discussion as to why they think it might occur.

      We sincerely thank the reviewer for the constructive feedback on the localization of MARK2 at the Golgi. Due to the complexity and variability of this phenomenon, we decided to remove the related data from the current manuscript to maintain the rigor of our study. However, we have included a discussion of this phenomenon in the Discussion section (page 13, lines 31-39 and page 14, 1-6in the revised manuscript) and plan to further investigate it in future studies.

      The localization of MARK2 at the Golgi was initially observed in experiments following serum starvation, where cells were fixed and stained (The data is not displayed). This observation was supported by the loss of Golgi localization in MARK2 knockdown cells, indicating the specificity of the antibody (The data is not displayed). However, this phenomenon was not consistently observed across all cells, likely due to its transient nature.We speculate that the localization of MARK2 to the Golgi depends on its activity and post-translational modifications. For example, phosphorylation at T595 has been reported to regulate the translocation of MARK2 from the plasma membrane to the cytoplasm (Hurov et al., 2004). Serum starvation might induce modifications or conformational changes in MARK2, leading to its temporary Golgi localization. Additionally, we hypothesize that this localization may coincide with specific Golgi dynamics, such as the transition from dispersed to ribbon-like structures during cell migration.

      We also acknowledge the inconsistency in the Results and Methods sections regarding serum starvation. We confirm that serum starvation was performed prior to fixation as an experimental condition, rather than as a blocking step in immunostaining. This clarification has been incorporated into the revised Methods section (page 24, lines 11-12).

      We hope this clarification, along with our planned future studies, adequately addresses the reviewer’s concerns. Once again, we deeply appreciate the reviewer’s valuable comments, which have provided important insights for our ongoing work. References:

      Hurov, J.B., Watkins, J.L., and Piwnica-Worms, H. (2004). Atypical PKC phosphorylates PAR-1 kinases to regulate localization and activity. Curr Biol 14 (8): 736-741.

      - The authors should strengthen their findings by using validated tools/methods consistent with previous publications. i.e. Waterman lab has published two MARK2 constructs- Apple and eGFP tagged versions (doi.org/10.1016/j.cub.2022.04.088), and the localization of MARK2 in U2Os cells (using the same antibody (Anti- MARK2 C-terminal, ABCAM Cat# ab136872). The authors should (1) image the cells live using eGFP-tagged MARK2 during serum starvation to show the dynamics of this localization, (2) image U2Os cells using the abcam ab136872 antibody +/- 2% serum starve. Two MARK2 antibodies are listed in Table 2. Does abcam (ab133724) show a similar localisation?

      - The Golgi localization of MARK2 occurs in the absence of the T structural domain, but not when full length MARK2 is expressed. The authors conclude the T- domain is likely inhibitory. When combined with the requirement for serum starvation for this interaction to occur, the authors should clarify the physiological relevance of these observations.

      We sincerely thank the reviewer for their valuable suggestions regarding the use of tools and methods and the physiological relevance of MARK2 localization to the Golgi. Regarding the question of how MARK2 itself localizes to the Golgi, we are currently unable to fully elucidate the underlying mechanism. Therefore, we have removed the discussion of MARK2’s Golgi localization from the manuscript to ensure scientific accuracy. However, Below, we provide our detailed response as soon as possible:

      First, regarding the suggestion to use tools and methods developed by the Waterman lab to strengthen our findings, we have carefully evaluated their applicability. In our live-cell imaging experiments, we found that full-length MARK2 does not stably localize to the Golgi, even under serum starvation conditions. However, truncated MARK2 mutants lacking the Tail (T) domain exhibit robust Golgi localization. Furthermore, our immunofluorescence staining results indicate that the Spacer domain is the minimal region required for MARK2 localization at the Golgi. Based on these findings, we believe that live-cell imaging of EGFP-tagged full-length MARK2 may not effectively reveal the dynamics of its Golgi localization. However, we plan to focus on the truncated constructs in future studies to better explore the mechanisms underlying MARK2's dynamic behavior. 

      Regarding the use of the ab136872 antibody to stain U2OS cells with and without serum starvation, we note that the protocol described by the Waterman lab involves pre-fixation and permeabilization steps, which are not compatible with live-cell imaging. Additionally, we observed that MARK2 Golgi localization appears to be condition-dependent and may coincide with specific Golgi dynamics, such as transitions from dispersed stacks to intact ribbon structures. These events are likely brief and challenging to capture consistently. Nevertheless, we recognize the value of this experimental design and plan to adapt the staining conditions in future work to validate our results further. As for the ab133724 antibody listed in Table 2, we clarify that it has only been validated for Western blotting in our study and does not yield reliable results in immunofluorescence experiments. For this reason, all immunofluorescence staining in this study relied exclusively on ab136872. This distinction has been clarified in the revised Table 2 .

      Regarding the hypothesis that the Tail domain of MARK2 is inhibitory, our observations showed that truncated MARK2 mutants lacking the T domain stably localized to the Golgi, whereas fulllength MARK2 did not. Literature evidence supports this hypothesis, as studies on the yeast homolog Kin2 indicate that the C-terminal region (including the Tail domain) binds to the Nterminal catalytic domain to inhibit kinase activity (Elbert et al., 2005). We speculate that serum starvation disrupts this intramolecular interaction, relieving the inhibition by the T domain, activating MARK2, and promoting its localization to the Golgi. Moreover, we hypothesize that the transient nature of MARK2 localization to the Golgi may be related to specific Golgi remodeling processes, such as the transition from dispersed stacks to intact ribbon structures during cell migration or polarity establishment. 

      References:

      Elbert, M., Rossi, G., and Brennwald, P. (2005). The yeast par-1 homologs kin1 and kin2 show genetic and physical interactions with components of the exocytic machinery. Mol Biol Cell 16 (2): 532-549.

      (3) Phosphorylation of CAMSAP2 by MARK2

      - The authors examined the effects of MARK2 phosphorylation of CAMSAP2 on Golgi architecture through expression of WT-CAMSAP2 and two CAMSAP2 S835 mutants in CAMSAP2 KO cells. They find that CAMSAP2 S835A (non-phosphorylatable) was less capable of rescuing Golgi morphology than CAMSAP2 S835D (phosphomimetic). Golgi area has been measured to demonstrate this phenomenon. Representative immunofluorescence images in Fig. 4D appear to indicate that this is the case. However, quantification in Fig. 4E does not show significance between HA-CAMSAP2 and HA-CAMSAP2A that would support the initial claim. The authors could analyze other aspects of Golgi morphology (e.g. number of Golgi fragments, degree of dispersal around the nucleus) to capture the clear structural defects demonstrated in HACAMSAP2A cells.

      We sincerely thank the reviewer for their valuable feedback and for pointing out potential areas of improvement in our analysis of Golgi morphology. We apologize for any misunderstanding caused by our description of the results in Figure 4E.

      The quantification indeed shows a significant difference between HA-CAMSAP2 and HACAMSAP2A in terms of Golgi area, as indicated in the figure by the statistical annotations (pvalue provided in the legend). To ensure clarity, we have revised the figure legend (page 32, lines 19-23 in the revised manuscript) to explicitly describe the statistical significance, and the method used for quantification.

      Because the quantification indeed shows a significant difference between HA-CAMSAP2 and HA-CAMSAP2A in terms of Golgi area, and to maintain consistency throughout the manuscript, we did not further analyze other aspects of Golgi morphology.

      We hope this clarification, along with the additional analyses, will address the reviewer’s concerns. Once again, we are deeply grateful for these constructive comments, which have helped us improve the quality and robustness of our study.

      - Wound edge assays are used to capture the difference in Golgi reorientation towards the leading edge between CAMSAP2 S835A and CAMSAP2 S835D. However, these studies lack comparison to WT-CAMSAP2 that would support the role of phosphorylated CAMSAP2 in reorienting the Golgi in this context.

      We sincerely thank the reviewer for their insightful suggestion. In response, we have added a comparison between CAMSAP2 S835A/D and WT-CAMSAP2, in addition to HT1080 and MARK2 KO cells, to better evaluate the role of phosphorylated CAMSAP2 in Golgi reorientation.

      The results, now shown in Figure 5A-C, indicate that in the absence of MARK2, there is no significant difference in Golgi reorientation between WT-CAMSAP2 and CAMSAP2 S835A. This observation supports the conclusion that MARK2-mediated phosphorylation of CAMSAP2 at S835 is essential for effective Golgi reorientation.

      To enhance clarity, we have updated the corresponding Results section (page 9, lines 37-40 and page 10, line 1 in the revised manuscript) to describe this additional comparison. We believe this analysis strengthens our findings and provides a clearer understanding of the role of phosphorylated CAMSAP2 in Golgi dynamics.

      We hope this additional data addresses the reviewer’s concerns. Once again, we are grateful for the constructive feedback, which has helped improve the clarity and robustness of our study.

      (4) Identification of CAMSAP2 interaction partners

      - Quantification of interaction ability between CAMSAP2 and CG-NAP, CLASP2, or USO1 in Fig. 5D, 5F and 5J respectively, lack WT-CAMSAP2 comparisons.

      We sincerely thank the reviewer for their valuable suggestion. In response, we have included WT-CAMSAP2 data in the quantification of interaction ability between CAMSAP2 and CG-NAP, CLASP2, and USO1. These results, now shown in revised Figures 5 D-G and Figures 6 C-D, provide a direct comparison that further validates the differential interaction abilities of CAMSAP2 mutants.

      The inclusion of WT-CAMSAP2 allows us to better contextualize the effects of specific mutations on CAMSAP2 interactions and strengthens our conclusions regarding the role of these interactions in Golgi dynamics.

      We hope this addition addresses the reviewer’s concerns and enhances the clarity and robustness of our study. We deeply appreciate the constructive feedback, which has been instrumental in improving our manuscript.

      - The CG-NAP immunoblot presented in Fig. 5C shows that the protein is 310 kDa, which is the incorrect molecular weight. CG-NAP (AKAP450) should appear at around 450 kDa. Further, no CG-NAP antibody is included in Table 2 - Information of Antibodies. The authors need to explain this discrepancy.

      We sincerely apologize for the lack of clarity in our annotation and description, which may have caused confusion regarding the CG-NAP immunoblot presented in Figure 5C (Figure 5D in the revised manuscript). To clarify, CG-NAP (AKAP450) is indeed a 450 kDa protein, and the marker at 310 kDa represents the molecular weight marker’s upper limit, above which CG-NAP is observed. This has been clarified in the figure legend (page 33, lines 21-23 in the revised manuscript).

      Regarding the CG-NAP antibody, it was custom-made and purified in our laboratory. Polyclonal antisera against CG-NAP, designated as αEE, were generated by immunizing rabbits with GSTfused fragments of CG-NAP (aa 423–542). This antibody has been validated extensively in our previous research, demonstrating its specificity and reliability (Wang et al., 2017). The details of the antibody preparation are included in the footnote of Table 2 for reference.

      We hope this clarification, along with the additional context regarding the antibody validation, resolves the reviewer’s concerns. We are deeply grateful for the reviewer’s attention to detail, which has helped us improve the clarity and rigor of our manuscript.

      References:

      Wang, J., Xu, H., Jiang, Y., Takahashi, M., Takeichi, M., and Meng, W. (2017). CAMSAP3dependent microtubule dynamics regulates Golgi assembly in epithelial cells. Journal of genetics and genomics = Yi chuan xue bao 44 (1): 39-49.

      Minor Comments

      - Authors should change immunofluorescence images to colorblind friendly colors. The current presentation of merged overlays makes it really difficult to interpret- I would strongly encourage inverted or at a minimum greyscale individual images of key proteins of interest.

      We sincerely thank the reviewer for their valuable suggestion regarding the presentation of immunofluorescence images. In response, we have converted the images in Figure 1C to greyscale individual images for each key protein of interest. This adjustment ensures that the figures are more accessible and interpretable, including for readers with color vision deficiencies.

      We hope this modification addresses the reviewer’s concern and improves the clarity of our data presentation. We are grateful for the constructive feedback, which has helped us enhance the overall quality of our figures.

      - On p. 8 text should be amended to 'Previous literature has documented MARK2's localization to the microtubules, microtubule-organizing center (MTOC), focal adhesions..'

      We sincerely thank the reviewer for their comment regarding the text on page 8. Considering the reasoning provided in response to question 2, where we clarified that MARK2's Golgi localization is not fully understood, we have decided to remove this section from the manuscript to maintain the accuracy and rigor of our study.

      We appreciate the reviewer’s attention to detail and constructive feedback, which has helped us improve the clarity and focus of our manuscript. 

      - In Fig.1A scale bars are not shown on individual channel images of CAMSAP or GM130

      We sincerely thank the reviewer for pointing out the omission of scale bars in the individual channel images of CAMSAP and GM130 in Figure 1A (Figure 1C in the revised manuscript). In response, we have added a scale bar (5 μm) to the CAMSAP2 channel, as shown in the revised Figure 1C. These updates have been described in the figure legend (page 29, line 21).

      We hope this modification addresses the reviewer’s concern and improves the accuracy and clarity of our figure presentation. We greatly appreciate the reviewer’s constructive feedback, which has helped enhance the quality of our manuscript.

      - In Fig. 1B the title should be amended to 'Colocalization of CAMSAP2/GM130'

      We sincerely thank the reviewer for their suggestion to amend the title in Figure 1B (Figure 1D in the revised manuscript). In response, we have updated the title to "Colocalization of CAMSAP2/GM130," as shown in the revised Figure 1D.

      We hope this modification addresses the reviewer’s concern and improves the clarity and accuracy of the figure. We greatly appreciate the reviewer’s valuable feedback, which has helped us refine the presentation of our results.

      - In Fig. 2F, 5A, and Sup Fig 3C scale bars have been presented vertically

      We sincerely thank the reviewer for pointing out the issue with the vertical orientation of scale bars in Figures 2F (Figure 2D in the revised manuscript), 5A, and Supplementary Figure 3C. In response, we have modified the scale bars in revised Figures 2D and 5A to a horizontal orientation for improved consistency and clarity. Additionally, Supplementary Figure 3C has been removed from the revised manuscript.

      We hope these adjustments address the reviewer’s concerns and enhance the overall presentation quality of the figures. We greatly appreciate the reviewer’s constructive feedback, which has helped us refine our manuscript.

      - Panels are not correctly aligned, and images are not evenly spaced or sized in multiple figures - Fig. 2F, 4D, Sup Fig. 1F, Sup Fig. 2C, Sup Fig. 3E, Sup Fig. 4C

      We sincerely thank the reviewer for pointing out the misalignment and uneven spacing or sizing of panels in multiple figures, including Figures 2F, 4D, Supplementary Figures 1F, 2C, 3E, and 4C (Figure 2D, 4D, Supplementary Figures 1F, 2C, and 3H in the revised manuscript.

      Supplementary Figure 3E was removed from our manuscript). In response, we have standardized the spacing and sizing of all panels throughout the manuscript to ensure consistency and improve visual clarity.

      We hope this modification addresses the reviewer’s concerns and enhances the overall presentation quality of our figures. We greatly appreciate the reviewer’s constructive feedback, which has helped us improve the organization and professionalism of our manuscript.

      - An uncolored additional data point is present in Fig. 3F

      We sincerely thank the reviewer for pointing out the presence of an uncolored additional data point in Figure 3F. In response, we have removed this data point from the revised figure to ensure accuracy and clarity.

      We hope this adjustment resolves the reviewer’s concern and improves the overall quality of the figure. We greatly appreciate the reviewer’s careful review and constructive feedback, which have helped us refine our manuscript.

      - In Fig. 3A 'GAMSAP2/GM130' in the vertical axis label should be amended to 'CAMSAP2/GM130'

      We sincerely thank the reviewer for pointing out the error in the vertical axis label of Figure 3A. In response, we have corrected "GAMSAP2/GM130" to "CAMSAP2/GM130," as shown in the revised Figure 3I.

      We hope this correction resolves the reviewer’s concern and improves the accuracy of our figure. We greatly appreciate the reviewer’s careful review and constructive feedback, which have helped us refine our manuscript.

      - In Fig 5A the green label should be amended to 'GFP-CAMSAP2' instead of 'GFP'

      We sincerely apologize for the confusion caused by our labeling in Figure 5A. To clarify, the green label “GFP” refers to the antibody used, while “GFP-CAMSAP2” is indicated at the top of the figure to specify the construct being analyzed.

      We hope this explanation resolves the misunderstanding and provides clarity regarding the labeling in Figure 5A. We greatly appreciate the reviewer’s feedback, which has allowed us to address this issue and improve the precision of our figure annotations.

      - The repeated use of contractions throughout the manuscript was distracting, I would strongly encourage removing these.

      We sincerely thank the reviewer for pointing out the distracting use of contractions in the manuscript. In response, we have removed and replaced all contractions with their full forms to improve the clarity and formal tone of the text.

      We hope this modification addresses the reviewer’s concern and enhances the readability and professionalism of our manuscript. We greatly appreciate the reviewer’s constructive feedback, which has helped us refine the quality of our writing.

      Reviewer #2: 

      Summary  

      This work by the Meng lab investigates the role of the proteins MARK2 and CAMSAP2 in the Golgi reorientation during cell polarisation and migration. They identified that both proteins interact together and that MARK2 phosphorylates CAMSAP2 on the residue S835. They show that the phosphorylation affects the localisation of CAMSAP2 at the Golgi apparatus and in turn influences the Golgi structure itself. Using the TurboID experimental approach, the author identified the USO1 protein as a protein that binds differentially to CAMSAP2 when it is itself phosphorylated at residue 835. Dissecting the molecular mechanisms controlling Golgi polarisation during cell migration is a highly complex but fundamental issue in cell biology and the author may have identified one important key step in this process. However, although the authors have made a genuine iconographic effort to help the reader understand their point of view, the data presented in this study appear sometimes fragile, lacking rigour in the analysis or over-interpreted. Additional analyses need to be conducted to strengthen this study and elevate it to the level it deserves.

      We sincerely thank the reviewer for their thoughtful evaluation and recognition of our study's significance in understanding Golgi reorientation during cell migration. We appreciate the constructive feedback regarding data robustness, clarity, and interpretation. In response, we have conducted additional analyses, revised data presentation, and ensured cautious interpretation throughout the manuscript. These changes aim to address the reviewer’s concerns comprehensively and strengthen the scientific rigor of our study.

      Major comments

      In order to conclude as they do about the putative role of USO1, the authors need to perform a siRNA/CRISPR of USO1 to validate its role in anchoring CAMSAP2 to the Golgi apparatus in a MARK2 phosphorylation-dependent manner. In other words, does depletion of USO1 affect the recruitment of CAMSAP2 to the Golgi apparatus?

      We sincerely thank the reviewer for their insightful suggestion regarding the role of USO1 in anchoring CAMSAP2 to the Golgi apparatus. In response, we performed USO1 knockdown using siRNA and quantified the Pearson correlation coefficient of CAMSAP2 and GM130 colocalization in control and USO1-knockdown cells.

      The results show that CAMSAP2 localization to the Golgi is significantly reduced in USO1knockdown cells, confirming that USO1 plays a critical role in recruiting CAMSAP2 to the Golgi apparatus. These results are now presented in Figures 6 E–G, and corresponding updates have been incorporated into the Results section (page 10, lines 36-37 in the revised manuscript).

      We hope this additional experiment addresses the reviewer’s concern and strengthens our conclusions regarding the role of USO1. We are grateful for the reviewer’s constructive feedback, which has greatly improved the robustness of our study.  

      It is not clear from this study exactly when and where MARK2 phosphorylates CAMSAP2. What is the result of overexpression of the two proteins in their respective localisation to the Golgi apparatus? As binding between CAMSAP2 and MARK2 appears robust in the immunoprecipitation assay, this should be readily investigated. 

      We sincerely thank the reviewer for their insightful comments and questions. To address the role of MARK2 in regulating CAMSAP2 localization to the Golgi apparatus, we overexpressed GFPMARK2 in cells and compared its effects on CAMSAP2 localization to the Golgi with control cells overexpressing GFP alone. Our results show that CAMSAP2 localization to the Golgi is significantly increased in GFP-MARK2-overexpressing cells, as shown in Supplementary Figures 3C and 3E. Corresponding updates have been incorporated into the Results section (page 8, lines 25-27 in the revised manuscript).

      Regarding the question of how MARK2 itself localizes to the Golgi, we are currently unable to fully elucidate the underlying mechanism. Therefore, we have removed the discussion of MARK2’s Golgi localization from the manuscript to ensure scientific accuracy. Consequently, we have not conducted experiments to assess the effects of CAMSAP2 overexpression on MARK2’s localization to the Golgi.

      We hope this explanation clarifies the reviewer’s concerns. We are grateful for the reviewer’s constructive feedback, which has guided us in improving the clarity and focus of our study.

      To strengthen their results, can the author map the interaction domains between CAMSAP2 and MARK2? The authors have at their disposal all the constructs necessary for this dissection.

      We sincerely thank the reviewer for their insightful suggestion to map the interaction domains between CAMSAP2 and MARK2. In response, we performed immunoprecipitation experiments using truncated constructs of CAMSAP2. Our results reveal that MARK2 interacts specifically with the C-terminus (1149F) of CAMSAP2, as shown in Supplementary Figures 3A and 3B. Corresponding updates have been incorporated into the Results section (page 7, lines 41-42 and page 8, line 1 in the revised manuscript).

      We hope this additional analysis addresses the reviewer’s suggestion and further strengthens our conclusions. We greatly appreciate the reviewer’s constructive feedback, which has helped improve the depth of our study.

      Minor comments

      Sup-fig1  

      H: It is not clear if the polarisation experiment has been repeated three times (as it should) and pooled or is just the result of one experiment?

      We sincerely apologize for the lack of clarity regarding the experimental details for Supplementary Figure 1H. To clarify, the polarization experiment was repeated three times, and the results were pooled to generate the data presented. We have updated the figure legend for Supplementary Figure 1H to explicitly state this information (page 35, lines 27-29 in the revised manuscript).

      We hope this clarification resolves the reviewer’s concern. We greatly appreciate the reviewer’s careful review and constructive feedback, which have helped us improve the accuracy and transparency of our manuscript.

      Sup-fig2  

      C: "Immunofluorescence staining plots" formula used in the legend is not clear. Which condition is presented in the panel, parental HT1080 or CAMSAP2 KO cells?  

      We thank the reviewer for pointing out the lack of clarity regarding the conditions presented in Supplementary Figure 2C. To clarify, the immunofluorescence staining plots shown in this panel are from parental HT1080 cells. We have updated the figure legend to include this information (page 36, line 14 in the revised manuscript).

      We hope this clarification resolves the reviewer’s concern and improves the transparency of our data presentation. We greatly appreciate the reviewer’s feedback, which has helped us refine the manuscript.

      Figure 1  

      D: In the plot, the colour of the points for the "red cells" are red but the one for the "blue cells" are green, this is confusing.

      E: Once again, the colour choice is confusing as blue cells (t=0.5h) are quantified using red dots and red cells (t=2h) quantified using green dots. The t=0h condition should be quantified as well and added to the graph.  

      F: Representative CAMSAP2 immunofluorescence pictures for the three time points should be provided in addition to the drawings.  

      We thank the reviewer for their valuable comments regarding Figure 1D (revised Figure 1E), Figure 1E (revised Figure 1B), and Figure 1F (revised Supplementary Figure 2C).

      - Figure 1D (revised Figure 1E): we have modified the x-axis labels and adjusted the color scheme of the data points to ensure consistency and avoid confusion.

      - Figure 1E (revised Figure 1B): we have updated the x-axis and included the quantification of the t=0h condition, which has been added to the graph.

      - Figure 1F (revised Supplementary Figure 2C): we have provided representative immunofluorescence images of CAMSAP2 for the three-time points to complement the schematic drawings.

      We hope these revisions address the reviewer’s concerns and improve the clarity and completeness of our data presentation. We greatly appreciate the reviewer’s constructive feedback, which has significantly contributed to enhancing our manuscript.

      Figure 2  

      A: No methodology in the material and methods is provided for this analysis.  

      B: Can the authors be more precise regarding the source of the CAMSAP2 interactants? Can the author provide the citation of the publication describing the CAMSAP2-MARK2 interaction?  

      D: Genotyping for the MARK2 KO cell line should be provided the same way it was provided for the CAMSAP2 cell line in Sup-fig1. "MARK2 was enriched around the Golgi apparatus in a  significant proportion of HT1080 cells": which proportion of the cells?  

      F: The time point of fixation is missing  

      G: It is not clear if the polarisation experiment has been repeated three times (as it should) and pooled or is just the result of one experiment?  

      We thank the reviewer for their detailed comments and suggestions regarding Figure 2. Below, we provide clarifications and outline the modifications made:

      - Figure 2A: The methodology for this analysis has been added to section 5.14 (Data statistics). Specifically, we have stated: “GO analysis of proteins was plotted using https://www.bioinformatics.com.cn, an online platform for data analysis and visualization” (page 26 lines 5-6 in the revised manuscript).

      - Figure 2B: The CAMSAP2 interactants were derived from the study by Wu et al., 2016, which provides the source of these interactants. The interaction between CAMSAP2 and MARK2 is referenced from Zhou et al., 2020. These citations have been added to the relevant sections of the manuscript (page 30, lines 10-11 and 13-14).

      - Figure 2D (removed in the revised manuscript): Genotyping for the MARK2 KO cell line has been provided in the same format as for the CAMSAP2 KO cell line in Figure 2G. Additionally, as the MARK2 Golgi localization discussion cannot yet be fully elucidated, we have removed this portion from the manuscript.

      - Figure 2F (revised Figure 2D): The time point of fixation, which occurred 2 hours after the scratch wound assay, has been added to the figure legend (page 30, lines 15-16).

      - Figure 2G (revised Figure 2E-F): The polarization experiment was repeated three times, and the results were pooled. This information has been included in the figure legend (page 30, lines 26 and 29).

      We hope these updates address the reviewer’s concerns and improve the clarity and completeness of the manuscript. We are grateful for the reviewer’s constructive feedback, which has greatly enhanced the rigor of our study. References:

      Wu, J., de Heus, C., Liu, Q., Bouchet, B.P., Noordstra, I., Jiang, K., Hua, S., Martin, M., Yang, C., Grigoriev, I., et al. (2016). Molecular Pathway of Microtubule Organization at the Golgi Apparatus. Dev Cell 39 (1): 44-60.

      Sup-fig3  

      E: Although colocalisation between CAMSAP2 and MARK2 is clear in your serum conditions in HT1080 and RPE1 cells, the deletion domain analysis appears weak and insufficient to implicate the role of the spacer domain. This part should be deleted or strengthened, but the data do not satisfactorily support your conclusion as it stands.  

      We sincerely thank the reviewer for their critical comments regarding the deletion domain analysis of MARK2 and its role in colocalization with CAMSAP2. As the current data do not satisfactorily support our conclusions, we have removed all related content on MARK2 and the deletion domain analysis from the manuscript to maintain scientific rigor.

      We appreciate the reviewer’s valuable feedback, which has helped us refine and improve the quality and focus of our study.

      Figure 3  

      A: Can the reduced CAMSAP2 Golgi localisation phenotype be rescued by the overexpression of MARK2 cDNA in the MARK2 KO cells?  

      F: Presence of a white dot on the HT1080 plot  

      G: The composition of the homogenization buffer is not indicated in the material and methods  

      We thank the reviewer for their valuable comments and suggestions regarding Figure 3. Below, we detail the modifications made:

      - Figure 3A: To address whether the reduced CAMSAP2 Golgi localization phenotype can be rescued, we overexpressed MARK2 cDNA in MARK2 KO cells. Our results show that overexpression of MARK2 successfully rescues the reduced CAMSAP2 localization to the Golgi, as demonstrated in Supplementary Figures 3C and 3E (page 8, lines 5-7).

      - Figure 3F: We have removed the white dot on the HT1080 plot to ensure clarity and accuracy.

      - Figure 3G: The composition of the homogenization buffer used in the experiment has been added to the Materials and Methods section for completeness (page 24, lines 34-41 and page 25, lines 1-10).

      We hope these revisions address the reviewer’s concerns and enhance the clarity and rigor of our study. We are grateful for the reviewer’s constructive feedback, which has significantly improved the quality of our manuscript.

      Figure 4  

      B: Quantification of the effect of the S835A mutation should be provided  

      D: Top left panel: Why Ha antibody stains Golgi structure in absence of Ha-CAMSAP2 transfection ? IF the Ha antibody has unspecific affinity towards the Golgi apparatus, may be it is not the good tag to use in this assay?  

      E: The number of cells studied should be standardized. 119 cells were analyzed in the CAMSAP KO vs only 35 cells in the CAMSAP2 KO (HA-CAMSAP2-S835D) conditions. This could introduce strong bias to the analysis. Furthermore the CAMSAP2 S835A seems to provide a certain level of rescue. It would be interesting to see what is the result of the T test between the HT1080 and HA-CAMSAP S835A conditions.  

      We thank the reviewer for their thoughtful comments and suggestions regarding Figure 4. Below, we detail the revisions and clarifications made:

      - Figure 4B: The S835A mutation renders CAMSAP2 non-phosphorylatable by MARK2. This conclusion is based on our experimental observations and previously reported mechanisms.

      - Figure 4D: The HA antibody does not exhibit non-specific affinity toward the Golgi apparatus. The observed labeling in the top left panel was due to an error in our annotation. We have corrected the label, replacing "HA" with "CAMSAP2" to accurately reflect the experimental conditions.

      - Figure 4E: To standardize the number of cells analyzed across conditions, we reduced the number of CAMSAP2 KO cells analyzed to 50 and balanced the sample sizes for comparison. Additionally, we performed a t-test between the HT1080 and HACAMSAP2 S835A conditions. The results support that CAMSAP2 S835A provides partial rescue, as reflected in the updated analysis (page 32, lines 19-23).

      We hope these revisions address the reviewer’s concerns and improve the accuracy and reliability of our results. We greatly appreciate the reviewer’s constructive feedback, which has significantly enhanced the quality of our study.

      Figure 6  

      6A: The wound position should be indicated on the picture.  

      6B: Given that microtubule labelling is present on the vast majority of the cell surface, this type of quantification provides very little information using conventional light microscopy and should not be used to conclude any change in the microtubule network using Pearson's coefficient.  The text describing the figure 6A and 6B needs re written as I do not understand what the author want to say. "In cells located before the wound edge..." : I do not understand how a cell could be located before the wound edge. Which figure corresponds to the trailing edge of the wounding?

      We thank the reviewer for their valuable comments on Figure 6A (revised Supplementary Figure 6E) and Figure 6B (revised Supplementary Figure 6F). Below, we detail the modifications made:

      - Figure 6A (revised Supplementary Figure 6E), we have added arrows to indicate the wound position, providing clearer guidance for interpreting the image.

      - Figure 6B (revised Supplementary Figure 6F), we revised our quantification method based on the approach used in literature (Wu et al., 2016). Specifically, we analyzed the relationship between microtubules and the Golgi apparatus in cells at the leading edge of the wound. The x-axis represents the distance from the Golgi center, while the y-axis shows the normalized radial fluorescence intensity of microtubules and the Golgi apparatus.

      Additionally, we revised the accompanying text for clarity and accuracy. The original description:

      “In cells located before the wound edge, the Golgi apparatus maintained a ribbon-like shape, with a higher density of microtubules. In contrast, at the trailing edge of the wounding, the Golgi apparatus appeared more as stacks around the nucleus, with fewer microtubules”  was replaced with:

      “Finally, to comprehensively understand the dynamics between non-centrosomal microtubules and the Golgi apparatus during Golgi reorientation, we conducted cell wound-healing experiments (Supplementary Figure 6 E-F). Our observations revealed notable changes in the Golgi apparatus and microtubule network distribution in relation to the wounding. These findings corroborate our earlier results and suggest a highly dynamic interaction between the Golgi apparatus and microtubules during Golgi reorientation” (Revised manuscript page 11 lines 3-10).

      We hope these changes address the reviewer’s concerns and improve the clarity and robustness of our study. We greatly appreciate the reviewer’s constructive feedback, which has significantly enhanced the presentation and interpretation of our data. References:

      Wu, J., de Heus, C., Liu, Q., Bouchet, B.P., Noordstra, I., Jiang, K., Hua, S., Martin, M., Yang, C., Grigoriev, I., et al. (2016). Molecular Pathway of Microtubule Organization at the Golgi Apparatus. Dev Cell 39 (1): 44-60.

      Reviewer #3:  

      Summary  

      In this study, Xu et al. analyzed the wound healing process of HT1080 cells to elucidate the molecular mechanisms by which the Golgi apparatus exhibits transient dispersion before reorienting to the wound edge in the compact assembly structure. They focused on the role of the microtubule minus-end binding protein CAMSAP2, which mediates the linkage between microtubules and the Golgi membrane. At first, they noticed that CAMSAP2 transiently lost Golgi colocalization during the initial phase of the wound healing process. They further found that the cell polarity-regulating kinase MARK2 binds and phosphorylates S835 of CAMSAP2, thereby enhancing the interaction between CAMSAP2 and the Golgi protein Uso1. Together with the phenotypes of CAMSAP2, MARK2, and Uso1 KO cells, these authors argue that the MARK2dependent phosphorylation of CAMSAP2 plays an important role in the reassembly and reorientation of the Golgi apparatus after a transient dispersion observed during the wound healing process.

      We sincerely thank the reviewer for their thoughtful summary of our study and constructive feedback. Your comments have been invaluable in refining our research and enhancing the clarity and impact of our manuscript.

      Major comments

      (1) The premise of this study was that during the wound healing process, the Golgi apparatus exhibits transient dispersion before reorientation to the front of the nucleus.  

      In the first place, this claim has not been well established in previous studies or this paper. Therefore, the authors should present a proof of this claim in a clearer manner.  

      To introduce this cellular event, the authors cite several papers in the introduction (page 4) and the results (page 6) sections. However, many papers cited are review articles, and some of them do not describe this change in the Golgi assembly structure before reorientation. Only two original articles discussed this phenomenon (Bisel et al. 2008 and Wu et al. 2016), and direct evidence was provided by only one paper (Wu et al. 2016) in which changes in the Golgi apparatus in wound-healing RPE1 cells were recorded by live imaging (Fig.7A in Wu et al. 2016).

      Furthermore, it should be noted that this previous paper demonstrated that depletion of CAMSAP2 inhibits Golgi dispersion. Obviously, this conclusion is inconsistent with their statement to introduce this study (page4) that ‟This emphasizes CAMSAP2's role in sustaining Golgi integrity during critical cellular events like migration." In addition, it also contradicts the authors' model of the present paper (Fig. 6E), which argued that disruption of the Golgi association of CAMSAP2 facilitates the Golgi dispersion.  

      We sincerely thank the reviewer for their detailed comments and for providing us with the opportunity to clarify the premise and conclusions of our study. Below, we address the main concerns raised:

      First, to provide direct evidence of Golgi apparatus changes during the wound-healing process, we conducted live-cell imaging experiments. Our observations, presented in revised Supplementary Figure 2A, clearly demonstrate that the Golgi apparatus exhibits a transient dispersion state before reorienting toward the leading edge of the nucleus during migration.

      Regarding the interpretation of previous studies, we acknowledge the reviewer’s concerns about the citation of review articles. To address this, we have revisited the literature and clarified that the phenomenon of Golgi dispersion during reorientation has been directly demonstrated in Wu et al (Wu et al., 2016), where live imaging of wound-healing RPE1 cells showed this dynamic behavior. Furthermore, we note that in Wu et al paper explicitly demonstrates that CAMSAP2 depletion promotes Golgi dispersion, contrary to the reviewer’s interpretation that "depletion of CAMSAP2 inhibits Golgi dispersion."

      Our model focuses on the role of CAMSAP2 in restoring the Golgi from a transiently dispersed structure back to an intact ribbon-like structure during reorientation. Specifically, we propose that during this process, the disruption of CAMSAP2’s association with the Golgi affects this restoration, rather than directly promoting Golgi dispersion as suggested by the reviewer. We believe this distinction aligns with our data and the existing literature.

      To strengthen the background of our study, we have revised the introduction and results sections (page 6, lines 6-13 and page 7, lines 1-17) to minimize reliance on review articles and have provided more explicit citations to original research papers. We hope this addresses the reviewer’s concern about the sufficiency of the cited literature.

      We trust these clarifications and revisions resolve the reviewer’s concerns and enhance the robustness of our study. Once again, we are grateful for the reviewer’s constructive feedback, which has greatly helped refine our manuscript. References:

      Wu, J., de Heus, C., Liu, Q., Bouchet, B.P., Noordstra, I., Jiang, K., Hua, S., Martin, M., Yang, C., Grigoriev, I., et al. (2016). Molecular Pathway of Microtubule Organization at the Golgi Apparatus. Dev Cell 39 (1): 44-60.

      The authors did not provide experimental data for this temporal change in the Golgi assembly structures during the wound-healing process of HT1080 that they analyzed. They only provide an illustration of wound-healing cells (Fig.1F), in which cells are qualitatively discriminated and colored based on the Golgi states, without indicating the experimental basis of the discrimination.

      According to their ambiguous descriptions in the text (page7), the reader can speculate that Fig. 1F is illustrated based on the images in Supplementary Fig. 2C. However, because of the low quality and presentation style of these data, it is impossible to recognize the assembly structures of the Golgi apparatus in wound-edge cells.  

      If the authors hope to establish this premise claim for the present paper, they should provide their own data corresponding to the present Supplementary Fig. 2C in more clarity and present qualitative data verifying this claim, as Wu et al. did in Fig. 7A in their paper.

      We sincerely thank the reviewer for their constructive feedback and the opportunity to address the concern regarding the lack of experimental data supporting the temporal changes in Golgi assembly during the wound-healing process.

      To establish this premise, we conducted live-cell imaging experiments to observe the dynamic changes in the Golgi apparatus during directed cell migration. Our data, now presented in Supplementary Figure 2A, clearly demonstrate that the Golgi apparatus undergoes a transient dispersed state before reorganizing into an intact structure. These findings provide direct experimental evidence supporting our claim.

      In addition, we have revised the data originally presented in Supplementary Figure 2C and enhanced its quality and presentation style. This supplementary figure now includes clearer images and annotations to better illustrate the Golgi assembly structures in wound-edge cells. The improved data presentation aligns with the standards set by Wu et al reported (Wu et al., 2016) and provides qualitative support for our observations.

      We hope these additions and revisions address the reviewer’s concerns and strengthen the scientific rigor and clarity of our manuscript. We are grateful for the reviewer’s valuable suggestions, which have significantly improved the quality of our study. References:

      Wu, J., de Heus, C., Liu, Q., Bouchet, B.P., Noordstra, I., Jiang, K., Hua, S., Martin, M., Yang, C., Grigoriev, I., et al. (2016). Molecular Pathway of Microtubule Organization at the Golgi Apparatus. Dev Cell 39 (1): 44-60.

      (2) In Fig.1A-D, the authors claim that CAMSAP2 dissociates from the Golgi apparatus in cells "that have not yet completed Golgi reorientation and exhibit a transitional Golgi structure, characterized by relative dispersion and loss of polarity (page7)." However, I these analyses, they do not analyze the initial stage (0.5h after wound addition) of cells facing the wound edge, as they do in Supplementary Fig. 2C. Instead, they analyze cells separated from the wound edge at 2 h after wound addition when the wound-edge cells complete their polarization. These data are highly misleading because there is no evidence that the cells separated from the wound edge are really in the transitional state before polarization.  

      In this regard, Fig. 1E shows the analysis of the wound-edge cells at 0.5 and 2 h after the addition of wound, which provides suitable data to verify the authors' claim. However, the corresponding legend indicates that these statistical data are based on the illustration in Fig. 1F, which is probably based on highly ambiguous data in Supplementary Fig. 2C (see above).  

      Taken together, I strongly recommend the authors to remove Fig.1A-D. Instead, they should include the improved figure corresponding to the present Supplementary Fig.2C and present its statistical analysis similar to the present Fig.1E for this claim.

      We sincerely thank the reviewer for their constructive feedback and recommendations. Below, we address the concerns raised regarding Figure 1A-D and Supplementary Figure 2C.

      To provide stronger evidence for the transitional state of the Golgi apparatus during reorientation and the dynamic regulation of CAMSAP2 localization, we conducted live-cell imaging experiments. These results, now presented in Supplementary Figure 2A, clearly demonstrate that the Golgi apparatus undergoes a transitional state characterized by dispersion before reorienting toward the leading edge.

      Additionally, we analyzed fixed wound-edge cells at different time points during directed migration to observe CAMSAP2’s colocalization with the Golgi apparatus. The results, shown in Figures 1A and 1B, reveal dynamic changes in CAMSAP2 localization, confirm its regulation during Golgi reorientation, and include a corresponding statistical analysis (page 7, lines 1-17).

      These updates ensure that our claims are supported by robust and unambiguous data.

      We hope these revisions address the reviewer’s concerns and provide clear and reliable evidence for the transitional state of the Golgi apparatus and CAMSAP2’s dynamic regulation. We are grateful for the reviewer’s constructive suggestions, which have greatly improved the quality and focus of our manuscript.

      (3) In Supplementary Fig. 5 and Fig. 4, the authors claim that MARK2 phosphorylates S835 of CAMSAP2.  

      There are many issues to be addressed. Otherwise, the above claim cannot be assumed to be reliable.  

      First, the descriptions (in the text and method sections) and figures (Supplementary Fig.5) concerning the in vitro kinase assay and subsequent phosphoproteomic analysis are too immature and contain many errors.  

      Legend to Supplementary Fig. 5 is too immature for comprehension. It should be completely rewritten in a more comprehensive manner. The figure in Supplementary Fig. 5C is also too immature for understanding. They simply paste raw mass spectrometric data without any modification for presentation.  

      We sincerely apologize for the lack of clarity and inaccuracies in the original descriptions and figure legends for the in vitro kinase assay and phosphoproteomic analysis. We greatly appreciate the reviewer’s detailed comments, which have allowed us to address these issues comprehensively.

      To improve clarity and accuracy, we have rewritten the figure legend for the original Supplementary Figure 5 (now Supplementary Figure 4) as follows:

      (A): CBB staining of a gel with GFP-CAMSAP2, GST, and GST-MARK2. GFP-CAMSAP2 was expressed in Sf9 cells and purified. GST and GST-MARK2 were expressed in E. coli and purified.

      (B): Western blot analysis of an in vitro kinase assay. GST or GST-MARK2 was incubated with GFP-CAMSAP2 in kinase buffer (50 mM Tris-HCl pH 7.5, 12.5 mM MgCl2, 1 mM DTT, 400 μM ATP) at 30°C for 30 minutes. Reactions were stopped by boiling in the loading buffer.

      (C): Detection of phosphorylation at S835 in CAMSAP2 by mass spectrometry. The observed mass increases in b4, b5, b6, b7, b8, b10, b11, and b12 fragments indicate phosphorylation at Ser835.

      (D): Kinase assay samples analyzed using Phos-tag SDS-PAGE. HEK293 cells were cotransfected with the indicated plasmids. Band shifts of CAMSAP2 mutants were examined via western blot. Phos-tag was used in SDS-PAGE, and arrowheads indicate the shifted bands caused by phosphorylation.

      To address the reviewer’s concern about Supplementary Figure 5C, we have reformatted the mass spectrometry data to improve readability and presentation quality. The revised figure includes clearer annotations and graphical representations of the mass spectrometric evidence for phosphorylation at S835.

      We believe these updates enhance the comprehensibility and reliability of our data, providing robust support for our claim that MARK2 phosphorylates CAMSAP2 at S835. We hope these

      revisions address the reviewer’s concerns and demonstrate our commitment to improving the quality of our manuscript.

      The readers cannot understand how the authors purified GFP-CAMSAP2 for the kinase assay.

      The method section incorrectly states that the product was purified using Ni-resin.  

      We thank the reviewer for their comment regarding the purification of GFP-CAMSAP2 for the kinase assay. We would like to clarify that GFP-CAMSAP2 carries a His-tag, which allows for purification using Ni-resin, as described in the Methods section (page 23, Lines 32-40). Therefore, the description in the Methods section is correct.

      To avoid any potential misunderstanding, we have revised the Methods section to provide more detailed and precise descriptions of the purification process. Specifically, GFP-CAMSAP2 was cloned into the pOCC6_pOEM1-N-HIS6-EGFP vector, which includes a His-tag, and was expressed in Sf9 cells. The His-GFP-CAMSAP2 protein was purified using Ni-resin chromatography. Relevant details have been added to the Methods section (page 21, Lines 34-36:

      “CAMSAP2 was cloned into the pOCC6_pOEM1-N-HIS6-EGFP vector expressed in Sf9, purified as His-GFP-CAMSAP2.”; page 23, Lines 32-33: “His-GFP-CAMSAP2 was cotransfected with bacmids into Sf9 cells to generate the passage 1 (P1) virus.”).

      We hope these clarifications and revisions address the reviewer’s concern and improve the comprehensibility of our experimental details. We appreciate the reviewer’s feedback, which has helped us refine the manuscript.

      In this relation, GST and GST-MARK2 are described as having been purified from Sf9 insect cells in the text section (page9) and legend to Supplementary Fig. 5, but from E. coli in the method section. Which is correct?  

      We thank the reviewer for pointing out the inconsistencies in the descriptions regarding the source of GST and GST-MARK2. To clarify, both GST and GST-MARK2 were purified from E. coli, as stated in the Methods section (page 23, Lines 26-31). We have corrected the erroneous descriptions in the main text (page 8, Lines 35-36) and the legend to Supplementary Figure 4 to ensure consistency.

      Additionally, we have updated the legend for Supplementary Figure 4A to state the sources of each protein explicitly:

      “GFP-CAMSAP2 were expressed in Sf9 cells and purified. GST and GST-MARK2 were expressed in E. coli and purified.” (page 38, Lines 2-3)

      These revisions ensure that the experimental details are accurate and consistent across the manuscript, eliminating any potential confusion. We appreciate the reviewer’s careful review and constructive feedback, which have helped us improve the clarity and reliability of our study.

      Because the phosphoproteomic data (Supplementary Fig. 5C) are not provided clearly, the experimental data for Fig.4A, in which possible CAMSAP2 phosphorylation sites are illustrated, are completely unknown. For me, it is highly strange that only the serine residues are listed in Fig. 4A.

      We sincerely thank the reviewer for raising this important point regarding Figure 4A and the phosphoproteomic data in Supplementary Figure 5C.

      - Phosphorylation Sites in Figure 4A

      The phosphorylation sites illustrated in Figure 4A are derived from our analysis of the original mass spectrometry data. These sites were included based on their high confidence scores and data reliability. Importantly, only serine residues met the stringent criteria for inclusion, as no threonine or tyrosine residues had sufficient evidence for phosphorylation. To clarify this, we have updated the figure legend for Figure 4A (page 32, Lines3-7).

      - Improvements to Supplementary Figure 5C (Supplementary Figure 4D in the revised manuscript)

      To enhance transparency and clarity, we have reformatted Supplementary Figure 4D to include clearer annotations. The revised figure highlights the phosphopeptides used to identify the phosphorylation sites and provides a more comprehensive presentation of the mass spectrometry data. To clarify this, we have updated the figure legend for Supplementary Figure 4D (page 38, Lines 11-13).

      - Data Availability

      We will follow the journal’s guidelines by uploading the raw mass spectrometry data to the required public database upon manuscript acceptance. This ensures that the data are accessible and reproducible in compliance with journal standards.

      We hope these clarifications and updates address the reviewer’s concerns and improve the reliability and comprehensibility of our data presentation. We greatly appreciate the reviewer’s constructive feedback, which has helped us enhance the rigor and clarity of our manuscript.

      Considering the crude nature of the GST-MARK2 sample used for the in vitro kinase assay (Supplementary Fig. 5A), it is unclear whether MARK2 is responsible for all phosphorylation sites on CAMSAP2 detected in the phosphoproteomic analysis. Furthermore, if GFP-CAMSAP2 was purified from Sf9 insect cells, these sites might have been phosphorylated before incubation for the in vitro kinase assay. The authors should address these issues by including a negative control using the kinase-dead mutant of MARK2 in their in vitro kinase assay.

      We sincerely thank the reviewer for raising these important points regarding the potential prephosphorylation of GFP-CAMSAP2 and the role of MARK2 in the phosphorylation sites detected in our analysis.

      To address the possibility that GFP-CAMSAP2 may have been pre-phosphorylated during its expression in Sf9 insect cells, we conducted an in vitro comparison. Specifically, we compared the band shifts observed in GST-MARK2 + GFP-CAMSAP2 versus GST + GFP-CAMSAP2 under identical conditions. As shown in Supplementary Figure 4B, the GST-MARK2 + GFP-CAMSAP2 group exhibited a clear upward band shift compared to the GST + GFP-CAMSAP2 group, indicating additional phosphorylation events induced by MARK2.

      Regarding the inclusion of a kinase-dead MARK2 mutant as a negative control, we acknowledge this as a valuable suggestion for further confirming the specificity of MARK2 in phosphorylating CAMSAP2. While this experiment is not currently included, we plan to conduct it in our future studies to strengthen our findings.

      We hope this clarification and the provided evidence address the reviewer’s concerns. We are grateful for this constructive feedback, which has helped us critically evaluate and refine our experimental approach.

      (4) In Supplementary Fig.6A-C and Fig.5A-B, the authors claim that the phosphorylation of CAMSAP2 S835 is required for restoring the reduced reorientation of the Golgi in wound-healing cells and the delay in wound closure observed in MARK2 KO cells.  

      If the aforementioned claim is adequately supported by experimental data, it indicates that the defects in Golgi repolarization and wound closure in MARK2 KO cells can be mainly attributed to the reduced phosphorylation of S835 of CAMSAP2 in HT1080. Considering the presence of many well-known substrates of MARK2 for regulating cell polarity, this claim is highly striking.  

      However, to strongly support this conclusion, the authors should first perform a rescue experiment using MARK2 KO cells exogenously expressing MARK2. This step is essential for determining whether the defects observed in MARK2 KO cells are caused by the loss of MARK2 expression, but not by other artificial effects that were accidentally raised during the generation of the present MARK2 KO clone.  

      We sincerely thank the reviewer for their insightful suggestion regarding the rescue experiment to confirm that the defects observed in MARK2 KO cells are specifically caused by the loss of MARK2 expression.

      To address this, we performed a rescue experiment in MARK2 KO HT1080 cells by exogenously expressing GFP-MARK2. Our results, presented in Supplementary Figures 3C-E, demonstrate that GFP-MARK2 expression successfully restores the localization of CAMSAP2 on the Golgi apparatus in MARK2 KO cells.

      These findings strongly support the conclusion that the defects in Golgi architecture and CAMSAP2 Golgi localization are directly attributable to the loss of MARK2 expression, rather than any artificial effects potentially introduced during the generation of the MARK2 KO clone.

      We hope these additional experimental results address the reviewer’s concerns and provide robust evidence for the role of MARK2 in regulating Golgi reorientation and wound closure. We are grateful for the reviewer’s constructive feedback, which has significantly improved the rigor and clarity of our study.

      In addition, to evaluate the impact of the rescue effect of CAMSAP2, the authors should include the data of wild-type HT1080 and MARK2 KO cells in Fig. 5B to reliably demonstrate the aforementioned claim.  

      We thank the reviewer for their valuable suggestion to include data from wild-type HT1080 and MARK2 KO cells in Figure 5A-C to better evaluate the rescue effects of CAMSAP2.

      In response, we have incorporated data from wild-type HT1080 and MARK2 KO cells into Figure 5A-C. These additions provide a comprehensive comparison and further demonstrate the impact of CAMSAP2-S835A and CAMSAP2-S835D on Golgi reorientation relative to the wild-type and MARK2 KO conditions.

      These changes are reflected in Figures 5A-C.

      We hope these updates address the reviewer’s concerns and strengthen the reliability of our conclusions. We greatly appreciate the reviewer’s constructive feedback, which has significantly enhanced the robustness of our study.

      Principally, before checking the rescue effects in MARK2 KO cells, the authors should examine the rescue activity of the CAMSAP2 S835 mutants in restoring the reduced reorientation of the Golgi in wound-healing cells and the delay in wound closure observed in CAMSAP2 KO cells (Supplementary Fig.1F-H and Supplementary Fig.2A, B). These experiments are more essential experiments to substantiate the authors' claim.

      We thank the reviewer for their insightful suggestion to examine the rescue activity of CAMSAP2 S835 mutants in CAMSAP2 KO cells to further substantiate our claims.

      In Figure 4D-F, we observed significant differences between CAMSAP2 S835 mutants in their ability to restore Golgi structure and localization, indicating functional differences between these mutants. To better reflect the regulatory role of MARK2-mediated phosphorylation of CAMSAP2, we performed scratch wound-healing experiments in MARK2 KO cells by establishing stable cell lines expressing CAMSAP2 S835 mutants. These experiments allowed us to assess Golgi reorientation during wound healing and are presented in Figure 5A-C.

      We also attempted to generate stable cell lines expressing GFP-CAMSAP2 and its mutants in CAMSAP2 KO cells. Unfortunately, these cells consistently failed to survive, preventing successful construction of the cell lines.

      We hope these experiments and explanations address the reviewer’s concerns. We are grateful for the reviewer’s constructive feedback, which has helped us refine and improve our study.

      (5) The data presented in Fig. 6A and B are not sufficient to support the authors' notion that "our observation revealed notable changes in the Golgi apparatus and microtubule network distribution in relation to the wounding. (page 11)"  

      Fig. 6A, which includes only a single-cell image in each panel, does not demonstrate the general state of microtubules and the Golgi in the wound-edge cells. The reader cannot even know the migration direction of each cell.  

      Fig.6 B are not suitable to quantitatively support the authors' claim. The authors should find a way to quantitatively estimate the microtubule density around the Golgi and the shape and compactness of the Golgi in each cell facing the wound, not estimating the colocalization of microtubules and the Golgi, as in the present Fig. 6B.  

      We sincerely apologize for the confusion caused by our unclear descriptions and presentation.

      Here, we clarify the purpose and improvements made to address the reviewer’s concerns. In this study, we primarily aimed to observe the relationship between microtubules and the Golgi apparatus in cells at the leading edge of the wound during directed migration. In Figure 6A (now Supplementary Figure 6E), the images represent cells located at the wound edge at different time points. To improve clarity, we have added arrows indicating the migration direction and updated the figure legend to describe these details (page 40 lines 13-14).

      To better quantify the relationship between microtubules and the Golgi apparatus, we revised our analysis by referring to the quantitative method used in Figure 3F of the paper Molecular Pathway of Microtubule Organization at the Golgi Apparatus. Specifically, we performed a radial analysis of fluorescence intensity in cells at the wound edge, measuring the distance from the Golgi center (x-axis) and the normalized radial fluorescence intensity of microtubules and the Golgi (y-axis). These results are now presented in Supplementary Figure 6E and 6F.

      We hope these improvements address the reviewer’s concerns and provide stronger evidence for the changes in the Golgi apparatus and microtubule network distribution in relation to wound healing. We greatly appreciate the reviewer’s constructive feedback, which has significantly enhanced the clarity and rigor of our study.

      The legends to Fig. 6A and B indicate that they compared immunofluorescent staining of cells at the edge of the wound after 0.5h and 2 h of migration. However, the authors state in the text that they compared "the cells located before the wound" and "the cells at the trailing edge of the wounding (page 11)."Although this description is highly ambiguous and misleading, if they compared the wound-edge cells and the cells separated from the wound edge at 2 h after cell migration here, they should improve the experimental design as I pointed out in the 2nd major comment.  

      We thank the reviewer for their detailed feedback regarding the experimental design and the need to clarify our descriptions. We have addressed these concerns as follows:

      - Clarification of descriptions:

      We recognize that the previous description in the text regarding "the cells located before the wound" and "the cells at the trailing edge of the wounding" was ambiguous and potentially misleading. We have revised this text to accurately describe the experimental design. Specifically, we compared cells at the leading edge of the wound at different time points (0.5h and 2h post-migration). These corrections are reflected in figure legends (Supplementary Figure 6E and 6F ) and the Results section (page 11,lines 3-8).

      - Improved experimental design:

      To better support our conclusions, we performed live-cell imaging to observe the dynamic changes in the Golgi apparatus during directed migration. As shown in Supplementary Figure 2A, our results confirm that the Golgi apparatus undergoes a transient dispersed state before reorganizing into an intact structure.

      Additionally, we performed fixed-cell staining at different time points to analyze the colocalization of CAMSAP2 with the Golgi apparatus in cells at the leading edge of the wound. The colocalization analysis, presented in Figures 1A-C, further demonstrates the dynamic regulation of CAMSAP2 during Golgi reorientation.

      We hope these updates address the reviewer’s concerns and provide a clearer and more robust foundation for our conclusions. We are grateful for the reviewer’s constructive feedback, which has greatly enhanced the clarity and rigor of our study.

      Minor comments  

      (1) In Fig. 2 and Supplementary Fig. 3, the authors claim that MARK2 is enriched around the Golgi. However, this claim was based on immunofluorescent images of single cells and single-line scans.  

      It is better to present the statistical data for Pearson's coefficient as shown in Figs. 1D and E. To demonstrateMARK2 enrichment around Golgi, but not localization in Golgi, the authors should find a way to quantify the specific enrichment of MARK2 signals in the Golgi region.  

      We thank the reviewer for raising this important point regarding the enrichment of MARK2 around the Golgi apparatus. Upon further consideration, we acknowledge that our current data do not provide sufficient evidence to fully elucidate the mechanism of MARK2 localization to the Golgi.

      To maintain the scientific rigor of our study, we have removed this claim and the corresponding content from the manuscript, including original Figures 2 and Supplementary Figure 3 that specifically discuss MARK2 enrichment. These changes do not affect the primary conclusions of the study, which focus on the role of MARK2-mediated phosphorylation of CAMSAP2.

      We hope this clarification addresses the reviewer’s concerns. In the future, we plan to investigate the precise mechanism of MARK2 localization using additional experimental approaches. We are grateful for the reviewer’s constructive feedback, which has helped us refine the scope and focus of our manuscript.

      (2) In Fig. 3 and Supplementary Fig. 4, the authors report that CAMSAP2 localization on the Golgi is reduced in cells lacking MARK2.  

      Essentially, the present results support this claim. However, the authors should analyze the Golgi localization of CAMASP2 with the same quantification parameter because they used Pearson's coefficient in Fig. 1D, E and Supplementary Fig.4D but Mander's coefficient in Fig. 3C and Fig.4F.  

      We thank the reviewer for their insightful comment regarding the consistency of quantification parameters used in our analysis of CAMSAP2 localization on the Golgi apparatus.

      To address this concern, we have revised Figure 3C to use Pearson’s coefficient for consistency with Figure 1D, 1E (Figure 1B and 1E in the revised manuscript), and Supplementary Figure 4D (Supplementary Figure 3I in the revised manuscript). This ensures uniformity in the quantification parameters across these analyses.

      For Figure 4F, we have retained Mander’s coefficient, as it accounts for variability in expression levels due to overexpression in individual cells. We believe this approach provides a more accurate reflection of CAMSAP2 localization under the experimental conditions shown in Figure 4F.

      We hope these adjustments clarify our analysis and address the reviewer’s concerns. We greatly appreciate the reviewer’s constructive feedback, which has helped improve the consistency and accuracy of our study.

      (3) In Fig.4D-F, the authors claim that S835 phosphorylation of CAMSAP2 is essential for its localization to the Golgi apparatus and for restoring the Golgi dispersion induced by CAMASAP2 depletion.  

      Fig.4E indicates that the S835A mutant of CAMSAP2 significantly restores the compact assembly of the Golgi apparatus, and the differences in the rescue activities of the wild type, S835A, and S835D are rather small. These data contradict the authors' conclusions regarding the pivotal role of MARK2-mediated phosphorylation at the S835 site of CAMSAP2 in maintaining the Golgi architecture (page 9). The authors should remove the phrase "MARK2-mediated" from the sentence unless addressing the aforementioned issues (see 3rd major comment) and describe the role of S835 phosphorylation in more subdued tone.  

      We thank the reviewer for their constructive feedback regarding the conclusions drawn about the role of MARK2-mediated phosphorylation of CAMSAP2 at S835.

      In response, we have revised the relevant sentence to reflect a more nuanced interpretation of the data. Specifically, the original statement:

      “These observations indicate that the phosphorylation of serine 835 in CAMSAP2 is essential for its proper localization to the Golgi apparatus.”

      has been updated to:

      “These observations indicate that MARK2 phosphorylation of serine at position 835 of CAMSAP2 affects the localization of CAMSAP2 on the Golgi and regulates Golgi structure” (page 9, Lines 27-29).

      We hope this modification addresses the reviewer’s concerns. We are grateful for the feedback, which has helped us refine our conclusions and enhance the clarity of our manuscript.

      (4) In Figs. 5I, J and Supplementary Fig.7A-E, the authors claim that the S835 phosphorylationdependent interaction of CAMSAP2 with Uso1 is essential for its localization to the Golgi apparatus.  

      This claim was made based on immunofluorescent images of single cells and single-line scans, and was not sufficiently verified (Supplementary Fig.7B, C). Because this is a crucial claim for the present paper, the authors should present statistical data for Pearson's coefficient, as shown in Fig. 1D and E, to quantitatively estimate the Golgi localization of CAMSAP2.  

      We thank the reviewer for their suggestion to present statistical data using Pearson's coefficient for a more robust quantification of the Golgi localization of CAMSAP2.

      In response, we have revised the statistical analysis for Supplementary Figures 7B-C (Revised Figures 6F and 6G) to use Pearson's coefficient. This change ensures consistency with the quantification methods used in Figures 1D and 1E (Revised Figures 1B and 1E), allowing for a more standardized evaluation of CAMSAP2’s localization to the Golgi apparatus.

      We hope this modification addresses the reviewer’s concerns and strengthens the quantitative support for our claims. We are grateful for the reviewer’s constructive feedback, which has helped improve the rigor of our study.

      (5) The signal intensities of the immunofluorescent data in Fig. 4D, Fig. 5A, Sup-Fig. 3C and E, and Sup-Fig. 7S are very weak for readers to clearly estimate the authors' claims. They should be improved appropriately.  

      We thank the reviewer for highlighting the need to improve the clarity of the immunofluorescent data presented in several figures.

      In response, we have enhanced the signal intensities in Figures 4D, 5A, and Supplementary Figure 7D (Revised Supplementary Figure 6A) to make the signals clearer for readers, while ensuring that the adjustments do not alter the integrity of the original data. Supplementary Figures 3C and 3E was remove from our manuscript.

      Additionally, to improve consistency and readability across the manuscript, we have standardized the quantification methods for similar analyses:

      For CAMSAP2 localization to the Golgi, Pearson's coefficient has been used throughout the manuscript. Figure 3C has been updated to use Pearson's coefficient for consistency.

      For Golgi state analysis in wound-edge cells, we have used the Golgi position relative to the nucleus as a uniform metric. This has been applied to Supplementary Figures 1F and 1G, Figures 2D and 2E, and Figures 5A and 5B.

      We hope these adjustments address the reviewer’s concerns and improve the clarity and consistency of our study. We greatly appreciate the reviewer’s constructive feedback, which has significantly enhanced the quality of our manuscript.

      (6) As indicated above, the authors frequently change the parameters or methods for quantifying the same phenomena (for example, the localization of CAMSAP on the Golgi and Golgi state in wound edge cells) in each figure. This is highly confusing. They should unify them.  

      We thank the reviewer for their valuable feedback regarding the inconsistency in quantification methods across the manuscript.

      To address this concern, we have carefully reviewed the entire manuscript and standardized the methods used for quantifying similar phenomena:

      - CAMSAP2 localization on the Golgi: 

      Pearson's coefficient is now consistently used throughout the manuscript. For example, Figure 3C has been updated to use Pearson's coefficient to align with other figures, such as Figures 1B and 1E.

      - Golgi state in wound-edge cells: 

      The Golgi state is now uniformly measured based on the position of the Golgi relative to the nucleus. This method has been applied to Supplementary Figures 1F and 1G, Figures 2D and 2E, and Figures 5A and 5B.

      We believe these changes significantly improve the clarity and consistency of the manuscript, ensuring that readers can easily interpret the data. We are grateful for the reviewer’s constructive feedback, which has greatly helped us enhance the quality and rigor of our study.

      (7) The legends frequently fail to clearly indicate the number of independent experiments on which each statistical analysis was based.  

      We thank the reviewer for highlighting the need to clearly indicate the number of independent experiments for each statistical analysis.

      In response, we have carefully reviewed the entire manuscript and updated the figure legends to include the number of independent experiments for every statistical analysis. This ensures transparency and allows readers to better evaluate the reliability of the data.

      We hope these updates address the reviewer’s concerns and improve the clarity and rigor of the manuscript. We appreciate the reviewer’s constructive feedback, which has helped us enhance the quality of our work.

      (8) Supplemental Figs. 4E and 4F are not cited in the text.  

      We thank the reviewer for pointing out that Supplemental Figures 4E and 4F were not cited in the text.

      To address this, we have updated the manuscript to cite these figures (Revised Figures 2H and 2I) in the appropriate section (page 8, lines 1-5).

      “the absence of MARK2 can also influence the orientation of the Golgi apparatus during cell wound healing and cause a delay in wound closure (Figure 2 D-I and Figure 3 D).”

      We hope this revision resolves the reviewer’s concern and improves the clarity and completeness of the manuscript. We appreciate the reviewer’s feedback, which has helped us refine our work.

      (9) The data in Fig. 3 analyzed MARK2 knockout cells (not knockdown cells). The caption should be corrected.  

      We thank the reviewer for pointing out the incorrect use of "knockdown" in the caption of Figure 3.

      To address this, we have revised the title of Figure 3 from:

      “MARK2 knockdown reduces CAMSAP2 localization on the Golgi apparatus.”

      to:

      “MARK2 affects CAMSAP2 localization on the Golgi apparatus.”

      This updated caption reflects the inclusion of both MARK2 knockout and knockdown cell lines analyzed in Figure 3.

      We hope this correction resolves the reviewer’s concern and ensures the accuracy of our manuscript. We greatly appreciate the reviewer’s attention to detail, which has helped us improve the clarity and consistency of our work.

      (10) The present caption in Fig. 6 disagrees with the content of the figure.  

      We thank the reviewer for pointing out the inconsistency between the caption and the content of Figure 6.

      To address this issue, we have revised the content of Figure 6 to ensure it aligns accurately with the caption. The updated figure now reflects the description provided in the caption, eliminating any discrepancies and improving clarity for the readers.

      We appreciate the reviewer’s constructive feedback, which has helped us enhance the accuracy and presentation of our manuscript.

      (11) What do "CS" indicate in Fig. 4B and Supplementary Fig. 5D? The style used to indicate point mutants of CAMSAP2 should be unified. 835A or S835A?  

      We thank the reviewer for pointing out the inconsistency in the naming of CAMSAP2 mutants.

      To address this, we have revised all relevant figures and text to use the consistent format "S835A" and "S589A" for CAMSAP2 mutants. Specifically, in Figure 4B and Supplementary Figure 5D (now Supplementary Figure 4C), we have replaced the abbreviation "CS2" with "CAMSAP2" and updated the mutant names from "835A" and "589A" to "S835A" and "S589A," respectively. We hope these updates resolve the reviewer’s concerns and ensure clarity and consistency throughout the manuscript. We are grateful for the reviewer’s attention to detail, which has helped us improve the quality of our work.

      (12) Uso1 is not a Golgi matrix protein.  

      We thank the reviewer for pointing out the incorrect description of Uso1 as a Golgi matrix protein.

      In response, we have revised the manuscript to replace all references to “USO1 as a Golgi matrix protein” with “USO1 as a Golgi-associated protein.” This correction ensures that the terminology used in the manuscript is accurate and consistent with current scientific understanding.

      We appreciate the reviewer’s attention to detail, which has helped us improve the accuracy and quality of our manuscript.

    1. There's a few things going on here. Generally at SGW a gray Olympia SM3 in excellent "looking" condition like this one will go for $120-150. This one is also hiding a script typeface which will usually add another $110-150 of value, which would put it at the $300 mark. I'm sort of surprised that the original winner didn't actually pay for it at this price as that's likely what someone would honestly pay for one like this. (It's also possible that they forgot they won or didn't know and didn't pay for it in time too.)

      On today's listing, it's far, far more likely that someone wants it and either couldn't get it or pay for it now at the price that it was going to go for in a reasonable auction. They used a throw away accout to make an outrageous bid in hopes that in a week it'll be relisted and no one will notice the script typeface and it'll go for well under $200. (It won't.) This happens incredibly frequently for some of the less common typewriters. Usually it's machines with script or uncommon typefaces or uncommon character sets. Recent auctions for a gold plated Olympia SM3 and a Yellow Royal FP with a Gothic typeface come to mind. I've seen this also happen four or five times in a row before someone ultimately pays for a machine at some reasonable price.

      Honestly, SGW should have a policy that the second and third runners up for auctions that don't get paid for by winners should have the right of last refusal on auctions like this to prevent this sort of "gaming" of the system. If you search back in this sub, you'll see this topic coming up every couple of weeks with the same discussions over and over. The common wisdom is that a SGW auction isn't gone until the machine doesn't pop up anymore and actually "sold". And even then, if you wait a week or two, you'll usually see the exact machine pop up less than a month later on eBay being listed by the winner for an exorbitant amount (almost always without having done any additional cleaning or restoration work on it aside from maybe dusting it out.)

      Maybe we should add the tag #SGWgaming to all these conversations to make them easier to find?

      reply to https://old.reddit.com/r/typewriters/comments/1jift5r/listing_on_the_right_was_a_month_ago_listing_on/

    1. McCuskey said that while many fans see the tournament as a fun way to fill out a bracket, the tournament is, in fact, a multi-billion-dollar business, as well as the pinnacle of many student-athletes’ college careers. try { var event = new CustomEvent("nsDfpSlotRendered", { detail: { id: "acm-ad-tag-mr2_ab-mr2_ab" } }); console.log("HTL.nsDfpSlotRendered", event); window.dispatchEvent(event); } catch (err) {}

      Leaving WVU didn't only affect the fans and the players it also affected the entire state of West Virginia's potential economy growth

    1. Reviewer #1 (Public review):

      Summary:

      This study aims to provide imaging methods for users of the field of human layer-fMRI. This is an emerging field with 240 papers published so far. Different than implied in the manuscript, 3T is well represented among those papers. E.g. see the papers below that are not cited in the manuscript. Thus, the claim on the impact of developing 3T methodology for wider dissemination is not justified. Specifically, because some of the previous papers perform whole brain layer-fMRI (also at 3T) in more efficient, and more established procedures.

      The authors implemented a sequence with lots of nice features. Including their own SMS EPI, diffusion bipolar pulses, eye-saturation bands, and they built their own reconstruction around it. This is not trivial. Only a few labs around the world have this level of engineering expertise. I applaud this technical achievement. However, I doubt that any of this is the right tool for layer-fMRI, nor does it represent an advancement for the field. In the thermal noise dominated regime of sub-millimeter fMRI (especially at 3T) it is established to use 3D readouts over 2D (SMS) readouts. While it is not trivial to implement SMS, the vendor implementations (as well as the CMRR and MGH implementations) are most widely applied across the majority of current fMRI studies already. The author's work on this does not serve any previous shortcomings in the field.

      The mechanism to use bi-polar gradients to increase the localization specificity is doubtful to me. In my understanding, killing the intra-vascular BOLD should make it less specific. Also, the empirical data do not suggest a higher localization specificity to me.

      Embedding this work in the literature of previous methods is incomplete. Recent trends of vessel signal manipulation with ABC or VAPER are not mentioned. Comparisons with VASO are outdated and incorrect.

      The reproducibility of the methods and the result is doubtful (see below).

      I don't think that this manuscript is in the top 50% of the 240 layer-fmri papers out there.

      3T layer-fMRI papers that are not cited:

      Taso, M., Munsch, F., Zhao, L., Alsop, D.C., 2021. Regional and depth-dependence of cortical blood-flow assessed with high-resolution Arterial Spin Labeling (ASL). Journal of Cerebral Blood Flow and Metabolism. https://doi.org/10.1177/0271678X20982382

      Wu, P.Y., Chu, Y.H., Lin, J.F.L., Kuo, W.J., Lin, F.H., 2018. Feature-dependent intrinsic functional connectivity across cortical depths in the human auditory cortex. Scientific Reports 8, 1-14. https://doi.org/10.1038/s41598-018-31292-x

      Lifshits, S., Tomer, O., Shamir, I., Barazany, D., Tsarfaty, G., Rosset, S., Assaf, Y., 2018. Resolution considerations in imaging of the cortical layers. NeuroImage 164, 112-120. https://doi.org/10.1016/j.neuroimage.2017.02.086

      Puckett, A.M., Aquino, K.M., Robinson, P.A., Breakspear, M., Schira, M.M., 2016. The spatiotemporal hemodynamic response function for depth-dependent functional imaging of human cortex. NeuroImage 139, 240-248. https://doi.org/10.1016/j.neuroimage.2016.06.019

      Olman, C.A., Inati, S., Heeger, D.J., 2007. The effect of large veins on spatial localization with GE BOLD at 3 T: Displacement, not blurring. NeuroImage 34, 1126-1135. https://doi.org/10.1016/j.neuroimage.2006.08.045

      Ress, D., Glover, G.H., Liu, J., Wandell, B., 2007. Laminar profiles of functional activity in the human brain. NeuroImage 34, 74-84. https://doi.org/10.1016/j.neuroimage.2006.08.020

      Huber, L., Kronbichler, L., Stirnberg, R., Ehses, P., Stocker, T., Fernández-Cabello, S., Poser, B.A., Kronbichler, M., 2023. Evaluating the capabilities and challenges of layer-fMRI VASO at 3T. Aperture Neuro 3. https://doi.org/10.52294/001c.85117

      Scheeringa, R., Bonnefond, M., van Mourik, T., Jensen, O., Norris, D.G., Koopmans, P.J., 2022. Relating neural oscillations to laminar fMRI connectivity in visual cortex. Cerebral Cortex. https://doi.org/10.1093/cercor/bhac154

      Strengths:

      See above. The authors developed their own SMS sequence with many features. This is important to the field. And does not leave sequence development work to view isolated monopoly labs. This work democratises SMS.<br /> The questions addressed here are of high relevance to the field: getting tools with good sensitivity, user-friendly applicability, and locally specific brain activity mapping is an important topic in the field of layer-fMRI.

      Weaknesses:

      (1) I feel the authors need to justify why flow-crushing helps localization specificity. There is an entire family of recent papers that aims to achieve higher localization specificity by doing the exact opposite. Namely, MT or ABC fRMRI aims to increase the localization specificity by highlighting the intravascular BOLD by means of suppressing non-flowing tissue. To name a few:

      Priovoulos, N., de Oliveira, I.A.F., Poser, B.A., Norris, D.G., van der Zwaag, W., 2023. Combining arterial blood contrast with BOLD increases fMRI intracortical contrast. Human Brain Mapping hbm.26227. https://doi.org/10.1002/hbm.26227.

      Pfaffenrot, V., Koopmans, P.J., 2022. Magnetization Transfer weighted laminar fMRI with multi-echo FLASH. NeuroImage 119725. https://doi.org/10.1016/j.neuroimage.2022.119725

      Schulz, J., Fazal, Z., Metere, R., Marques, J.P., Norris, D.G., 2020. Arterial blood contrast ( ABC ) enabled by magnetization transfer ( MT ): a novel MRI technique for enhancing the measurement of brain activation changes. bioRxiv. https://doi.org/10.1101/2020.05.20.106666

      Based on this literature, it seems that the proposed method will make the vein problem worse, not better. The authors could make it clearer how they reason that making GE-BOLD signals more extra-vascular weighted should help to reduce large vein effects.

      The empirical evidence for the claim that flow crushing helps with the localization specificity should be made clearer. The response magnitude with and without flow crushing looks pretty much identical to me (see Fig, 6d).<br /> It's unclear to me what to look for in Fig. 5. I cannot discern any layer patterns in these maps. It's too noisy. The two maps of TE=43ms look like identical copies from each other. Maybe an editorial error?

      The authors discuss bipolar crushing with respect to SE-BOLD where it has been previously applied. For SE-BOLD at UHF, a substantial portion of the vein signal comes from the intravascular compartment. So I agree that for SE-BOLD, it makes sense to crush the intravascular signal. For GE-BOLD however, this reasoning does not hold. For GE-BOLD (even at 3T), most of the vein signal comes from extravascular dephasing around large unspecific veins and the bipolar crushing is not expected to help with this.

      (2) The bipolar crushing is limited to one single direction of flow. This introduces a lot of artificial variance across the cortical folding pattern. This is not mentioned in the manuscript. There is an entire family of papers that perform layer-fmri with black-blood imaging that solves this with a 3D contrast preparation (VAPER) that is applied across a longer time period, thus killing the blood signal while it flows across all directions of the vascular tree. Here, the signal cruising is happening with a 2D readout as a "snap-shot" crushing. This does not allow the blood to flow in multiple directions.<br /> VAPER also accounts for BOLD contaminations of larger draining veins by means of a tag-control sampling. The proposed approach here does not account for this contamination.

      Chai, Y., Li, L., Huber, L., Poser, B.A., Bandettini, P.A., 2020. Integrated VASO and perfusion contrast: A new tool for laminar functional MRI. NeuroImage 207, 116358. https://doi.org/10.1016/j.neuroimage.2019.116358

      Chai, Y., Liu, T.T., Marrett, S., Li, L., Khojandi, A., Handwerker, D.A., Alink, A., Muckli, L., Bandettini, P.A., 2021. Topographical and laminar distribution of audiovisual processing within human planum temporale. Progress in Neurobiology 102121. https://doi.org/10.1016/j.pneurobio.2021.102121

      If I would recommend anyone to perform layer-fMRI with blood crushing, it seems that VAPER is the superior approach. The authors could make it clearer why users might want to use the unidirectional crushing instead.

      (3) The comparison with VASO is misleading.<br /> The authors claim that previous VASO approaches were limited by TRs of 8.2s. The authors might be advised to check the latest literature of the last years.<br /> Koiso et al. has performed whole brain layer-fMRI VASO at 0.8mm at 3.9 seconds (with reliable activation) and 2.7 seconds (with unconvincing activation pattern, though), and 2.3 (without activation).<br /> Also, whole brain layer-fMRI BOLD at 0.5mm and 0.7mm has been previously performed by the Juelich group at TRs of 3.5s (their TR definition is 'fishy' though).

      Koiso, K., Müller, A.K., Akamatsu, K., Dresbach, S., Gulban, O.F., Goebel, R., Miyawaki, Y., Poser, B.A., Huber, L., 2023. Acquisition and processing methods of whole-brain layer-fMRI VASO and BOLD: The Kenshu dataset. Aperture Neuro 34. https://doi.org/10.1101/2022.08.19.504502

      Yun, S.D., Pais‐Roldán, P., Palomero‐Gallagher, N., Shah, N.J., 2022. Mapping of whole‐cerebrum resting‐state networks using ultra‐high resolution acquisition protocols. Human Brain Mapping. https://doi.org/10.1002/hbm.25855

      Pais-Roldan, P., Yun, S.D., Palomero-Gallagher, N., Shah, N.J., 2023. Cortical depth-dependent human fMRI of resting-state networks using EPIK. Front. Neurosci. 17, 1151544. https://doi.org/10.3389/fnins.2023.1151544

      The authors are correct that VASO is not advised as a turn-key method for lower brain areas, incl. Hippocampus and subcortex. However, the authors use this word of caution that is intended for inexperienced "users" as a statement that this cannot be performed. This statement is taken out of context. This statement is not from the academic literature. It's advice for the 40+ user base that want to perform layer-fMRI as a plug-and-play routine tool in neuroscience usage. In fact, sub-millimeter VASO is routinely being performed by MRI-physicists across all brain areas (including deep brain structures, hippocampus etc). E.g. see Koiso et al. and an overview lecture from a layer-fMRI workshop that I had recently attended: https://youtu.be/kzh-nWXd54s?si=hoIJjLLIxFUJ4g20&t=2401

      Thus, the authors could embed this phrasing into the context of their own method that they are proposing in the manuscript. E.g. the authors could state whether they think that their sequence has the potential to be disseminated across sites, considering that it requires slow offline reconstruction in Matlab?<br /> Do the authors think that the results shown in Fig. 6c are suggesting turn-key acquisition of a routine mapping tool? In my humble opinion it looks like random noise, with most of the activation outside the ROI (in white matter).

      (4) The repeatability of the results is questionable.<br /> The authors perform experiments about the robustness of the method (line 620). The corresponding results are not suggesting any robustness to me. In fact the layer profiles in Fig. 4c vs. Fig 4d are completely opposite. Location of peaks turn into locations of dips and vice versa.<br /> The methods are not described in enough detail to reproduce these results.<br /> The authors mention that their image reconstruction is done "using in-house MATLAB code" (line 634). They do not post a link to github, nor do they say if they share this code.

      It is not trivial to get good phase data for fMRI. The authors do not mention how they perform the respective coil-combination.<br /> No data are shared for reproduction of the analysis.

      (5) The application of NODRIC is not validated.<br /> Previous applications of NORDIC at 3T layer-fMRI have resulted in mixed success. When not adjusted for the right SNR regime it can result in artifactual reductions of beta scores, depending on the SNR across layers. The authors could validate their application of NORDIC and confirm that the average layer-profiles are unaffected by the application of NORDIC. Also, the NORDIC version should be explicitly mentioned in the manuscript.

      Akbari, A., Gati, J.S., Zeman, P., Liem, B., Menon, R.S., 2023. Layer Dependence of Monocular and Binocular Responses in Human Ocular Dominance Columns at 7T using VASO and BOLD (preprint). Neuroscience. https://doi.org/10.1101/2023.04.06.535924

      Knudsen, L., Guo, F., Huang, J., Blicher, J.U., Lund, T.E., Zhou, Y., Zhang, P., Yang, Y., 2023. The laminar pattern of proprioceptive activation in human primary motor cortex. bioRxiv. https://doi.org/10.1101/2023.10.29.564658

      Comments on revisions:

      Among all the concerns mentioned above, I think there is only one of the specific issues that was sufficiently addressed.<br /> The authors implemented a combination of three consecutive-dimensional flow crushers. Other concerns were not sufficiently addressed to change my confidence level of the study.<br /> - While the abstract is still focusing on the utility of using 3T, they do not give credit to early 3T layer-fMRI papers leading the way to larger coverage and connectivity applications.<br /> - While the author's choice of using custom SMS 2D readout is justified for them. I do not think that this very method will utilize widespread 3T whole brain connectivity experiments across the global 3T community. This lowers the impact of the paper.<br /> - The images in Fig. 5 are still suspiciously similar. To the level that the noise pattern outside the brain is identical across large parts of the maps with and without PR.<br /> - Maybe it's my ignorance, but I still do not agree why flow crushing focuses the local BOLD responses to small vessels.<br /> - While my feel of a misleading representation of the literature had been accompanied by explicit references, the authors claim that they cannot find them?!? Or claim that they are about something else (which they are not, in my viewpoint).<br /> Data and software are still not shared (not even example data, or nii data).

    2. Author response:

      The following is the authors’ response to the original reviews.

      General responses:

      The authors sincerely thank all the reviewers for their valuable and constructive comments. We also apologize for the long delay in providing this rebuttal due to logistical and funding challenges. In this revision, we modified the bipolar gradients from one single direction to all three directions. Additionally, in response to the concerns regarding data reliability, we conducted a thorough examination of each step in our data processing pipeline. In the original processing workflow, the projection-onto-convex-set (POCS) method was used for partial Fourier reconstruction. Upon examination, we found that applying the POCS method after parallel image reconstruction significantly altered the signal and resulted in considerable loss of functional feature. Futhermore, the original scan protocol employed a TE of 46 ms, which is notably longer than the typical TE of 33 ms. A prolonged TE can increase the ratio of extravascular to intravascular contributions. Importantly, the impact of TE on the efficacy of phase regression remains unclear, introducing potential confounding effects. To address these issues, we revised the protocol by shortening the TE from 46 ms to 39 ms. This adjustment was achieved by modifying the SMS factor to 3 and the in-plane acceleration rate to 3, thereby minimizing the confounding effects associated with an extended TE.

      Following these changes, we recollected task-based fMRI data (N=4) and resting-state fMRI data (N=14) under the updated protocol. Using the revised dataset, we validated layer-specific functional connectivity (FC) through seed-based analyses. These analyses revealed distinct connectivity patterns in the superficial and deep layers of the primary motor cortex (M1), with statistically significant inter-layer differences. Furthermore, additional analyses with a seed in the primary sensory cortex (S1) corroborated the robustness and reliability of the revised methodology. We also changed the ‘directed’ functional connectivity in the title to ‘layer-specific’ functional connectivity, as drawing conclusions about directionality requires auxiliary evidence beyond the scope of this study.

      We provide detailed responses to the reviewers’ comments below.

      Reviewer #1 (Public Review):

      Summary:

      (1)   This study aims to provide imaging methods for users of the field of human layer-fMRI. This is an emerging field with 240 papers published so far. Different than implied in the manuscript, 3T is well represented among those papers. E.g. see the papers below that are not cited in the manuscript. Thus, the claim on the impact of developing 3T methodology for wider dissemination is not justified. Specifically, because some of the previous papers perform whole brain layer-fMRI (also at 3T) in more efficient, and more established procedures.

      3T layer-fMRI papers that are not cited:

      Taso, M., Munsch, F., Zhao, L., Alsop, D.C., 2021. Regional and depth-dependence of cortical blood-flow assessed with high-resolution Arterial Spin Labeling (ASL). Journal of Cerebral Blood Flow and Metabolism. https://doi.org/10.1177/0271678X20982382

      Wu, P.Y., Chu, Y.H., Lin, J.F.L., Kuo, W.J., Lin, F.H., 2018. Feature-dependent intrinsic functional connectivity across cortical depths in the human auditory cortex. Scientific Reports 8, 1-14. https://doi.org/10.1038/s41598-018-31292-x

      Lifshits, S., Tomer, O., Shamir, I., Barazany, D., Tsarfaty, G., Rosset, S., Assaf, Y., 2018. Resolution considerations in imaging of the cortical layers. NeuroImage 164, 112-120. https://doi.org/10.1016/j.neuroimage.2017.02.086

      Puckett, A.M., Aquino, K.M., Robinson, P.A., Breakspear, M., Schira, M.M., 2016. The spatiotemporal hemodynamic response function for depth-dependent functional imaging of human cortex. NeuroImage 139, 240-248. https://doi.org/10.1016/j.neuroimage.2016.06.019

      Olman, C.A., Inati, S., Heeger, D.J., 2007. The effect of large veins on spatial localization with GE BOLD at 3 T: Displacement, not blurring. NeuroImage 34, 1126-1135. https://doi.org/10.1016/j.neuroimage.2006.08.045

      Ress, D., Glover, G.H., Liu, J., Wandell, B., 2007. Laminar profiles of functional activity in the human brain. NeuroImage 34, 74-84. https://doi.org/10.1016/j.neuroimage.2006.08.020

      Huber, L., Kronbichler, L., Stirnberg, R., Ehses, P., Stocker, T., Fernández-Cabello, S., Poser, B.A., Kronbichler, M., 2023. Evaluating the capabilities and challenges of layer-fMRI VASO at 3T. Aperture Neuro 3. https://doi.org/10.52294/001c.85117

      Scheeringa, R., Bonnefond, M., van Mourik, T., Jensen, O., Norris, D.G., Koopmans, P.J., 2022. Relating neural oscillations to laminar fMRI connectivity in visual cortex. Cerebral Cortex. https://doi.org/10.1093/cercor/bhac154

      We thank the reviewer for listing out 8 papers related to 3T layer-fMRI papers. The primary goal of our work is to develop a methodology for brain-wide, layer-dependent resting-state functional connectivity at 3T. Upon review of the cited papers, we found that:

      (1) One study (Lifshits et al.) was not an fMRI study.

      (2) One study (Olman et al.) was conducted at 7T, not 3T.

      (3) Two studies (Taso et al. and Wu et al.) employed relatively large voxel sizes (1.6 × 2.3 × 5 mm³ and 1.5 mm isotropic, respectively), which limits layer specificity.

      (4) Only one of the listed studies (Huber et al., Aperture Neuro 2023) provides coverage of more than half of the brain.

      While each of these studies offers valuable insights, the VASO study by Huber et al. is the most relevant to our work, given its brain-wide coverage. However, the VASO method employs a relatively long TR (14.137 s), which may not be optimal for resting-state functional connectivity analyses.

      To address these limitations, our proposed method achieves submillimeter resolution, layer specificity, brain-wide coverage, and a significantly shorter TR (<5 s) altogether. We believe this advancement provides a meaningful contribution to the field, enabling broader applicability of layer-fMRI at 3T.

      (2) The authors implemented a sequence with lots of nice features. Including their own SMS EPI, diffusion bipolar pulses, eye-saturation bands, and they built their own reconstruction around it. This is not trivial. Only a few labs around the world have this level of engineering expertise. I applaud this technical achievement. However, I doubt that any of this is the right tool for layer-fMRI, nor does it represent an advancement for the field. In the thermal noise dominated regime of sub-millimeter fMRI (especially at 3T), it is established to use 3D readouts over 2D (SMS) readouts. While it is not trivial to implement SMS, the vendor implementations (as well as the CMRR and MGH implementations) are most widely applied across the majority of current fMRI studies already. The author's work on this does not serve any previous shortcomings in the field.

      We would like to thank the reviewer for their comments and the recognition of the technical efforts in implementing our sequence. We would like to address the points raised:

      (1) We completely agree that in-house implementation of existing techniques does not constitute an advancement for the field. We did not claim otherwise in the manuscript. Our focus was on the development of a method for brain-wide, layer-dependent resting-state functional connectivity at 3T, as mentioned in the response above.

      (2) The reviewer stated that "it is established to use 3D readouts over 2D (SMS) readouts". This is a strong claim, and we believe it requires robust evidence to support it. While it is true that 3D readouts can achieve higher tSNR in certain regions, such as the central brain, as shown in the study by Vizioli et al. (ISMRM 2020 abstract; https://cds.ismrm.org/protected/20MProceedings/PDFfiles/3825.html?utm_source=chatgpt.com ), higher tSNR does not necessarily equate to improved detection power in fMRI studies. For instance, Le Ster et al. (PLOS ONE, 2019; https://doi.org/10.1371/journal.pone.0225286 ). demonstrated that while 3D EPI had higher tSNR in the central brain, SMS EPI produced higher t-scores in activation maps.

      (3) When choosing between SMS EPI and 3D EPI, multiple factors should be taken into account, not just tSNR. For example, SMS EPI and 3D EPI differ in their sensitivity to motion and the complexity of motion correction. The choice between them depends on the specific research goals and practical constraints.

      (4) We are open to different readout strategies, provided they can be demonstrated suitable to the research goals. In this study, we opted for 2D SMS primarily due to logistical considerations. This choice does not preclude the potential use of 3D readouts in the future if they are deemed more appropriate for the project objectives.

      The mechanism to use bi-polar gradients to increase the localization specificity is doubtful to me. In my understanding, killing the intra-vascular BOLD should make it less specific. Also, the empirical data do not suggest a higher localization specificity to me.

      We will elaborate the mechanism and reasoning in the later responses.

      Embedding this work in the literature of previous methods is incomplete. Recent trends of vessel signal manipulation with ABC or VAPER are not mentioned. Comparisons with VASO are outdated and incorrect.

      The reproducibility of the methods and the result is doubtful (see below).

      In this revision, we updated the scan protocol and recollected the imaging data. Detailed explanations and revised results are provided in the later responses.

      I don't think that this manuscript is in the top 50% of the 240 layer-fmri papers out there.

      We respect the reviewer’s personal opinion. However, we can only address scientific comments or critiques.

      Strengths:

      See above. The authors developed their own SMS sequence with many features. This is important to the field. And does not leave sequence development work to view isolated monopoly labs. This work democratises SMS.

      The questions addressed here are of high relevance to the field: getting tools with good sensitivity, user-friendly applicability, and locally specific brain activity mapping is an important topic in the field of layer-fMRI.

      Weaknesses:

      (1) I feel the authors need to justify why flow-crushing helps localization specificity. There is an entire family of recent papers that aim to achieve higher localization specificity by doing the exact opposite. Namely, MT or ABC fRMRI aims to increase the localization specificity by highlighting the intravascular BOLD by means of suppressing non-flowing tissue. To name a few:

      Priovoulos, N., de Oliveira, I.A.F., Poser, B.A., Norris, D.G., van der Zwaag, W., 2023. Combining arterial blood contrast with BOLD increases fMRI intracortical contrast. Human Brain Mapping hbm.26227. https://doi.org/10.1002/hbm.26227.

      Pfaffenrot, V., Koopmans, P.J., 2022. Magnetization Transfer weighted laminar fMRI with multi-echo FLASH. NeuroImage 119725. https://doi.org/10.1016/j.neuroimage.2022.119725

      Schulz, J., Fazal, Z., Metere, R., Marques, J.P., Norris, D.G., 2020. Arterial blood contrast ( ABC ) enabled by magnetization transfer ( MT ): a novel MRI technique for enhancing the measurement of brain activation changes. bioRxiv. https://doi.org/10.1101/2020.05.20.106666

      Based on this literature, it seems that the proposed method will make the vein problem worse, not better. The authors could make it clearer how they reason that making GE-BOLD signals more extra-vascular weighted should help to reduce large vein effects.

      The proposed VN fMRI method employs VN gradients to selectively suppress signals from fast-flowing blood in large vessels. Although this approach may initially appear to diverge from the principles of CBV-based techniques (Chai et al., 2020; Huber et al., 2017a; Pfaffenrot and Koopmans, 2022; Priovoulos et al., 2023), which enhance sensitivity to vascular changes in arterioles, capillaries, and venules while attenuating signals from static tissue and large veins, it aligns with the fundamental objective of all layer-specific fMRI methods. Specifically, these approaches aim to maximize spatial specificity by preserving signals proximal to neural activation sites and minimizing contributions from distal sources, irrespective of whether the signals are intra- or extra-vascular in origin. In the context of intravascular signals, CBV-based methods preferentially enhance sensitivity to functional changes in small vessels (proximal components) while demonstrating reduced sensitivity to functional changes in large vessels (distal components). For extravascular signals, functional changes are a mixture of proximal and distal influences. While tissue oxygenation near neural activation sites represents a proximal contribution, extravascular signal contamination from large pial veins reflects distal effects that are spatially remote from the site of neuronal activity. CBV-based techniques mitigate this challenge by unselectively suppressing signals from static tissues, thereby highlighting contributions from small vessels. In contrast, the VN fMRI method employs a targeted suppression strategy, selectively attenuating signals from large vessels (distal components) while preserving those from small vessels (proximal components). Furthermore, the use of a 3T scanner and the inclusion of phase regression in the VN approach mitigates contamination from large pial veins (distal components) while preserving signals reflecting local tissue oxygenation (proximal components). By integrating these mechanisms, VN fMRI improves spatial specificity, minimizing both intravascular and extravascular contributions that are distal to neuronal activation sites. We have incorporated the responses into Discussion section.

      The empirical evidence for the claim that flow crushing helps with the localization specificity should be made clearer. The response magnitude with and without flow crushing looks pretty much identical to me (see Fig, 6d).

      In the new results in Figure 4, the application of VN gradients attenuated the bias towards pial surface. Consistent with the results in Figure 4, Figure 5 also demonstrated the suppression of macrovascular signal by VN gradients.

      It's unclear to me what to look for in Fig. 5. I cannot discern any layer patterns in these maps. It's too noisy. The two maps of TE=43ms look like identical copies from each other. Maybe an editorial error?

      In this revision, the original Figure 5 has been removed. However, we would like to clarify that the two maps with TE = 43 ms in the original Figure 5 were not identical. This can be observed in the difference map provided in the right panel of the figure.

      The authors discuss bipolar crushing with respect to SE-BOLD where it has been previously applied. For SE-BOLD at UHF, a substantial portion of the vein signal comes from the intravascular compartment. So I agree that for SE-BOLD, it makes sense to crush the intravascular signal. For GE-BOLD however, this reasoning does not hold. For GE-BOLD (even at 3T), most of the vein signal comes from extravascular dephasing around large unspecific veins, and the bipolar crushing is not expected to help with this.

      The reviewer’s statement that "most of the vein signal comes from extravascular dephasing around large unspecific veins" may hold true for 7T. However, at 3T, the susceptibility-induced Larmor frequency shift is reduced by 57%, and the extravascular contribution decreases by more than 35%, as shown by Uludağ et al. 2009 ( DOI: 10.1016/j.neuroimage.2009.05.051 ).

      Additionally, according to the biophysical models (Ogawa et al., 1993; doi: 10.1016/S0006-3495(93)81441-3 ), the extravascular contamination from the pial surface is inversely proportional to the square of the distance from vessel. For a vessel diameter of 0.3 mm and an isotropic voxel size of 0.9 mm, the induced frequency shift is reduced by at least 36-fold at the next voxel. Notably, a vessel diameter of 0.3 mm is larger than most pial vessels. Theoretically, the extravascular effect contributes minimally to inter-layer dependency, particularly at 3T compared to 7T due to weaker susceptibility-related effects at lower field strengths. Empirically, as shown in Figure 7c, the results at M1 demonstrated that layer specificity can be achieved statistically with the application of VN gradients. We have incorporated this explanation into the Introduction and Discussion sections of the manuscript.

      (2) The bipolar crushing is limited to one single direction of flow. This introduces a lot of artificial variance across the cortical folding pattern. This is not mentioned in the manuscript. There is an entire family of papers that perform layer-fmri with black-blood imaging that solves this with a 3D contrast preparation (VAPER) that is applied across a longer time period, thus killing the blood signal while it flows across all directions of the vascular tree. Here, the signal cruising is happening with a 2D readout as a "snap-shot" crushing. This does not allow the blood to flow in multiple directions.

      VAPER also accounts for BOLD contaminations of larger draining veins by means of a tag-control sampling. The proposed approach here does not account for this contamination.

      Chai, Y., Li, L., Huber, L., Poser, B.A., Bandettini, P.A., 2020. Integrated VASO and perfusion contrast: A new tool for laminar functional MRI. NeuroImage 207, 116358. https://doi.org/10.1016/j.neuroimage.2019.116358

      Chai, Y., Liu, T.T., Marrett, S., Li, L., Khojandi, A., Handwerker, D.A., Alink, A., Muckli, L., Bandettini, P.A., 2021. Topographical and laminar distribution of audiovisual processing within human planum temporale. Progress in Neurobiology 102121. https://doi.org/10.1016/j.pneurobio.2021.102121

      If I would recommend anyone to perform layer-fMRI with blood crushing, it seems that VAPER is the superior approach. The authors could make it clearer why users might want to use the unidirectional crushing instead.

      We understand the reviewer’s concern regarding the directional limitation of bipolar crushing. As noted in the responses above, we have updated the bipolar gradient to include three orthogonal directions instead of a single direction. Furthermore, flow-related signal suppression does not necessarily require a longer time period. Bipolar diffusion gradients have been effectively used to nullify signals from fast-flowing blood, as demonstrated by Boxerman et al. (1995; DOI: 10.1002/mrm.1910340103). Their study showed that vessels with flow velocities producing phase changes greater than p radians due to bipolar gradients experience significant signal attenuation. The critical velocity for such attenuation can be calculated using the formula: 1/(2gGDd) where g is the gyromagnetic ratio, G is the gradient strength, d is the gradient pulse width and D is the time between the two bipolar gradient pulses. In the framework of Boxerman et al. at 1.5T, the critical velocity for b value of 10 s/mm<sup>2</sup> is ~8 mm/s, resulting in a ~30% reduction in functional signal. In our 3T study, b values of 6, 7, and 8 s/mm<sup>2</sup> correspond to critical velocities of 16.8, 15.2, and 13.9 mm/s, respectively. The flow velocities in capillaries and most venules remain well below these thresholds. Notably, in our VN fMRI sequences, bipolar gradients were applied in all three orthogonal directions, whereas in Boxerman et al.'s study, the gradients were applied only in the z-direction. Given the voxel dimensions of 3 × 3 × 7 mm<sup>3</sup> in the 1.5T study, vessels within a large voxel are likely oriented in multiple directions, meaning that only a subset of fast-flowing signals would be attenuated. Therefore, our approach is expected to induce greater signal reduction, even at the same b values as those used in Boxerman et al.'s study. We have incorporated this text into the Discussion section of the manuscript.

      (3) The comparison with VASO is misleading.

      The authors claim that previous VASO approaches were limited by TRs of 8.2s. The authors might be advised to check the latest literature of the last years.

      Koiso et al. performed whole brain layer-fMRI VASO at 0.8mm at 3.9 seconds (with reliable activation), 2.7 seconds (with unconvincing activation pattern, though), and 2.3 (without activation).

      Also, whole brain layer-fMRI BOLD at 0.5mm and 0.7mm has been previously performed by the Juelich group at TRs of 3.5s (their TR definition is 'fishy' though).

      Koiso, K., Müller, A.K., Akamatsu, K., Dresbach, S., Gulban, O.F., Goebel, R., Miyawaki, Y., Poser, B.A., Huber, L., 2023. Acquisition and processing methods of whole-brain layer-fMRI VASO and BOLD: The Kenshu dataset. Aperture Neuro 34. https://doi.org/10.1101/2022.08.19.504502

      Yun, S.D., Pais‐Roldán, P., Palomero‐Gallagher, N., Shah, N.J., 2022. Mapping of whole‐cerebrum resting‐state networks using ultra‐high resolution acquisition protocols. Human Brain Mapping. https://doi.org/10.1002/hbm.25855

      Pais-Roldan, P., Yun, S.D., Palomero-Gallagher, N., Shah, N.J., 2023. Cortical depth-dependent human fMRI of resting-state networks using EPIK. Front. Neurosci. 17, 1151544. https://doi.org/10.3389/fnins.2023.1151544

      We thank the reviewer for providing these references. While the protocol with a TR of 3.9 seconds in Koiso’s work demonstrated reasonable activation patterns, it was not tested for layer specificity. Given that higher acceleration factors (AF) can cause spatial blurring, a protocol should only be eligible for comparison if layer specificity is demonstrated.

      Secondly, the TRs reported in Koiso’s study pertain only to either the VASO or BOLD acquisition, not the combined CBV-based contrast. To generate CBV-based images, both VASO and BOLD data are required, effectively doubling the TR. For instance, if the protocol with a TR of 3.9 seconds is used, the effective TR becomes approximately 8 seconds. The stable protocol used by Koiso et al. to acquire whole-brain data (94.08 mm along the z-axis) required 5.2 seconds for VASO and 5.1 seconds for BOLD, resulting in an effective TR of 10.3 seconds. The spatial resolution achieved was 0.84 mm isotropic.

      Unfortunately, we could not find the Juelich paper mentioned by the reviewer.

      To have a more comprehensive comparison, we collated relevant literature on brain-wide layer-specific fMRI. We defined brain-wide acquisition as imaging protocols that cover more than half of the human brain, specifically exceeding 55 mm along the superior-inferior axis. We identified five studies and summarized their scan parameters, including effective TR, coverage, and spatial resolution, in Table 1.

      The authors are correct that VASO is not advised as a turn-key method for lower brain areas, incl. Hippocampus and subcortex. However, the authors use this word of caution that is intended for inexperienced "users" as a statement that this cannot be performed. This statement is taken out of context. This statement is not from the academic literature. It's advice for the 40+ user base that wants to perform layer-fMRI as a plug-and-play routine tool in neuroscience usage. In fact, sub-millimeter VASO is routinely being performed by MRI-physicists across all brain areas (including deep brain structures, hippocampus etc). E.g. see Koiso et al. and an overview lecture from a layer-fMRI workshop that I had recently attended: https://youtu.be/kzh-nWXd54s?si=hoIJjLLIxFUJ4g20&t=2401

      In this revision, we decided to focus on cortico-cortical functional connectivity and have removed the LGN-related content. Consequently, the text mentioned by the reviewer was also removed. Nevertheless, we apologize if our original description gave the impression that functional mapping of deep brain regions using VASO is not feasible. The word of caution we used is based on the layer-fMRI blog ( https://layerfmri.com/2021/02/22/vaso_ve/ ) and reflects the challenges associated with this technique, as outlined by experts like Dr. Huber and Dr. Strinberg.

      According to the information provided, including the video, functional mapping of the hippocampus and amygdala using VASO is indeed possible but remains technically challenging. The short arterial arrival times in these deep brain regions can complicate the acquisition, requiring RF inversion pulses to cover a wider area at the base of the brain. For example, as of 2023, four or more research groups were attempting to implement layer-fMRI VASO in the hippocampus. One such study at 3T required multiple inversion times to account for inflow effects, highlighting the technical complexity of these applications. This is the context in which we used the word of caution. We are not sure whether recent advancements like MAGEC VASO have improved its applicability. As of 2024, we have not identified any published VASO studies specifically targeting deep brain structures such as the hippocampus or amygdala. Therefore, it is difficult to conclude that “sub-millimeter VASO is routinely being performed by MRI physicists on deep brain structures such as the hippocampus.”

      Thus, the authors could embed this phrasing into the context of their own method that they are proposing in the manuscript. E.g. the authors could state whether they think that their sequence has the potential to be disseminated across sites, considering that it requires slow offline reconstruction in Matlab?

      We are enthusiastic about sharing our imaging sequence, provided its usefulness is conclusively established. However, it's important to note that without an online reconstruction capability, such as the ICE, the practical utility of the sequence may be limited. Unfortunately, we currently don’t have the manpower to implement the online reconstruction. Nevertheless, we are more than willing to share the offline reconstruction codes upon request.

      Do the authors think that the results shown in Fig. 6c are suggesting turn-key acquisition of a routine mapping tool? In my humble opinion, it looks like random noise, with most of the activation outside the ROI (in white matter).

      As we mentioned in the ‘general response’ in the beginning of the rebuttal, the POCS method for partial Fourier reconstruction caused the loss of functional feature, potentially accounting for the activation in white matter. In this revision, we have modified the pulse sequence, scan protocol and processing pipelines.

      According to the results in Figure 4, stable activation in M1 was observed at the single-subject level across most scan protocols. Yet, the layer-dependent activation profiles in M1 were spatially unstable, irrespective of the application of VN gradients. This spatial instability is not entirely unexpected, as T2*-based contrast is inherently sensitive to various factors that perturb the magnetic field, such as eye movements, respiration, and macrovascular signal fluctuations. Furthermore, ICA-based artifact removal was intentionally omitted in Figure 4 to ensure fair comparisons between protocols, leaving residual artifacts unaddressed. Inconsistency in performing the button-pressing task across sessions may also have contributed to the observed variability. These results suggest that submillimeter-resolution fMRI may not yet be suitable for reliable individual-level layer-dependent functional mapping, unless group-level statistics are incorporated to enhance robustness. We have incorporated this text into the Limitation section of the manuscript.

      (4) The repeatability of the results is questionable.

      The authors perform experiments about the robustness of the method (line 620). The corresponding results are not suggesting any robustness to me. In fact, the layer profiles in Fig. 4c vs. Fig 4d are completely opposite. The location of peaks turns into locations of dips and vice versa.

      The methods are not described in enough detail to reproduce these results.

      The authors mention that their image reconstruction is done "using in-house MATLAB code" (line 634). They do not post a link to github, nor do they say if they share this code.

      We thank the reviewer for the comments regarding reproducibility and data sharing. In response, we have revised the Methods section and elaborated on the technical details to improve clarity and reproducibility.

      Regarding code sharing, we acknowledge that the current in-house MATLAB reconstruction code requires further refinement to improve its readability and usability. Due to limited manpower, we have not yet been able to complete this task. However, we are committed to making the code publicly available and will upload it to GitHub as soon as the necessary resources are available.

      For data sharing, we face logistical challenges due to the large size of the dataset, which spans tens of terabytes. Platforms like OpenNeuro, for example, typically support datasets up to 10TB, making it difficult to share the data in its entirety. Despite this limitation, we are more than willing to share offline reconstruction codes and raw data upon request to facilitate reproducibility.

      Regarding data robustness, we kindly refer the reviewer to our response to the previous comment, where we addressed these concerns in greater detail.

      It is not trivial to get good phase data for fMRI. The authors do not mention how they perform the respective coil-combination.

      No data are shared for reproduction of the analysis.

      Obtaining phase data is relatively straightforward when the images are retrieved directly from raw data. For coil combination, we employed the adaptive coil combination approach described by (Walsh et al.; DOI: 10.1002/(sici)1522-2594(200005)43:5<682::aid-mrm10>3.0.co;2-g ) The MATLAB code for this implementation was developed by Dr. Diego Hernando and is publicly available at https://github.com/welton0411/matlab .

      (5) The application of NODRIC is not validated.

      Previous applications of NORDIC at 3T layer-fMRI have resulted in mixed success. When not adjusted for the right SNR regime it can result in artifactual reductions of beta scores, depending on the SNR across layers. The authors could validate their application of NORDIC and confirm that the average layer-profiles are unaffected by the application of NORDIC. Also, the NORDIC version should be explicitly mentioned in the manuscript.

      Akbari, A., Gati, J.S., Zeman, P., Liem, B., Menon, R.S., 2023. Layer Dependence of Monocular and Binocular Responses in Human Ocular Dominance Columns at 7T using VASO and BOLD (preprint). Neuroscience. https://doi.org/10.1101/2023.04.06.535924

      Knudsen, L., Guo, F., Huang, J., Blicher, J.U., Lund, T.E., Zhou, Y., Zhang, P., Yang, Y., 2023. The laminar pattern of proprioceptive activation in human primary motor cortex. bioRxiv. https://doi.org/10.1101/2023.10.29.564658

      We appreciate the reviewer’s suggestion. To validate the application of NORDIC denoising in our study, we compared the BOLD activation maps before and after denoising in the visual and motor cortices, as well as the depth-dependent activation profiles in M1. These results are presented in Figure 3. The activation patterns in the denoised maps were consistent with those in the non-denoised maps but exhibited higher statistical significance. Notably, BOLD activation within M1 was only observed after NORDIC denoising, underscoring the necessity of this approach. Figure 3c shows the depth-dependent activation profiles in M1, highlighted by the green contours in Figure 3b. Both denoised and non-denoised profiles followed similar trends; however, as expected, the non-denoised profile exhibited larger confidence intervals compared to the NORDIC-denoised profile. These results confirm that NORDIC denoising enhances sensitivity without introducing distortions in the functional signal. The corresponding text has been incorporated into the Results section.

      Regarding the implementation details of NORDIC denoising, the reconstructed images were denoised using a g-factor map (function name: NIFTI_NORDIC). The g-factor map was estimated from the image time series, and the input images were complex-valued. The width of the smoothing filter for the phase was set to 10, while all other hyperparameters were retained at their default values. This information has been integrated into the Methods section for clarity and reproducibility.

      Reviewer #2 (Public Review):

      This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses, and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by parallel-imaging acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper the laminar specificity of gradient-echo BOLD.

      The setup allows for 0.9 mm isotropic acquisitions with large coverage at a reasonable TR (at least for block designs) and the fMRI results presented here were acquired within practical scan-times of 12-18 minutes. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*).

      The well-known double peak feature in M1 during finger tapping was used as a test-bed to evaluate the spatial specificity. They were indeed able to demonstrate two distinct peaks in group-level laminar profiles extracted from M1 during finger tapping, which was largely free from superficial bias. This is rather intriguing as, even at 7T, clear peaks are usually only seen with spatially specific non-BOLD sequences. This is in line with their simple simulations, which nicely illustrated that, in theory, intravascular macrovascular signals should be suppressible with only minimal suppression of microvasculature when small b-values of the VN gradients are employed. However, the authors do not state how ROIs were defined making the validity of this finding unclear; were they defined from independent criteria or were they selected based on the region mostly expressing the double peak, which would clearly be circular? In any case, results are based on a very small sub-region of M1 in a single slice - it would be useful to see the generalizability of superficial-bias-free BOLD responses across a larger portion of M1.

      We appreciate and understand the reviewer’s concerns. Given the small size of the hand knob region within M1 and its intersubject variability in location, defining this region automatically remains challenging. However, we applied specific criteria to minimize bias during the delineation of M1: 1) the hand knob region was required to be anatomically located in the precentral sulcus or gyrus; 2) it needed to exhibit consistent BOLD activation across the majority of testing conditions; and 3) the region was expected to show BOLD activation in the deep cortical layers under the condition of b = 0 and TE = 30 ms. Once the boundaries across cortical depth were defined, the gray matter boundaries of hand knob region were delineated based on the T1-weighted anatomical image and the cortical ribbon mask but excluded the BOLD activation map to minimize potential bias in manual delineation. Based on the new criteria, the resulting depth-dependent profiles, as shown in Figure 4, are no longer superficial-bias-free.

      As repeatedly mentioned by the authors, a laminar fMRI setup must demonstrate adequate functional sensitivity to detect (in this case) BOLD responses. The sensitivity evaluation is unfortunately quite weak. It is mainly based on the argument that significant activation was found in a challenging sub-cortical region (LGN). However, it was a single participant, the activation map was not very convincing, and the demonstration of significant activation after considerable voxel-averaging is inadequate evidence to claim sufficient BOLD sensitivity. How well sensitivity is retained in the presence of VN gradients, high acceleration factors, etc., is therefore unclear. The ability of the setup to obtain meaningful functional connectivity results is reassuring, yet, more elaborate comparison with e.g., the conventional BOLD setup (no VN gradients) is warranted, for example by comparison of tSNR, quantification and comparison of CNR, illustration of unmasked-full-slice activation maps to compare noise-levels, comparison of the across-trial variance in each subject, etc. Furthermore, as NORDIC appears to be a cornerstone to enable submillimeter resolution in this setup at 3T, it is critical to evaluate its impact on the data through comparison with non-denoised data, which is currently lacking.

      We appreciate the reviewer’s comments and acknowledge that the LGN results from a single participant were not sufficiently convincing. In this revision, we have removed the LGN-related results and focused on cortico-cortical FC. To evaluate data quality, we opted to present BOLD activation maps rather than tSNR, as high tSNR does not necessarily translate to high functional significance. In Figure 3, we illustrate the effect of NORDIC denoising, including activation maps and depth-dependent profiles. Figure 4 presents activation maps acquired under different TE and b values, demonstrating that VN gradients effectively reduce the bias toward the pial surface without altering the overall activation patterns. The results in Figure 4 and Figure 5 provide evidence that VN gradients retain sensitivity while reducing superficial bias. The ability of the setup to obtain meaningful FC results was validated through seed-based analyses, identifying distinct connectivity patterns in the superficial and deep layers of the primary motor cortex (M1), with significant inter-layer differences (see Figure 7). Further analyses with a seed in the primary sensory cortex (S1) demonstrated the reliability of the method (see Figure 8). For further details on the results, including the impact of VN gradients and NORDIC denoising, please refer to Figures 3 to 8 in the Results section.

      Additionally, we acknowledge the limitations of our current protocol for submillimeter-resolution fMRI at the individual level. We found that robust layer-dependent functional mapping often requires group-level statistics to enhance reliability. This issue has been discussed in detail in the Limitations section.

      The proposed setup might potentially be valuable to the field, which is continuously searching for techniques to achieve laminar specificity in gradient echo EPI acquisitions. Nonetheless, the above considerations need to be tackled to make a convincing case.

      Reviewer #3 (Public Review):

      Summary:

      The authors are looking for a spatially specific functional brain response to visualise non-invasively with 3T (clinical field strength) MRI. They propose a velocity-nulled weighting to remove the signal from draining veins in a submillimeter multiband acquisition.

      Strengths:

      - This manuscript addresses a real need in the cognitive neuroscience community interested in imaging responses in cortical layers in-vivo in humans.

      - An additional benefit is the proposed implementation at 3T, a widely available field strength.

      Weaknesses:

      - Although the VASO acquisition is discussed in the introduction section, the VN-sequence seems closer to diffusion-weighted functional MRI. The authors should make it more clear to the reader what the differences are, and how results are expected to differ. Generally, it is not so clear why the introduction is so focused on the VASO acquisition (which, curiously, lacks a reference to Lu et al 2013). There are many more alternatives to BOLD-weighted imaging for fMRI. CBF-weighted ASL and GRASE have been around for a while, ABC and double-SE have been proposed more recently.

      The major distinction between diffusion-weighted fMRI (DW-fMRI) and our methodology lies in the b-value employed. DW-fMRI typically measures cellular swelling using b-values greater than 1000 s/mm<sup>2</sup> (e.g., 1800 s/mm(sup>2</sup>). In contrast, our VN-fMRI approach measures hemodynamic responses by employing smaller b-values specifically designed to suppress signals from fast-flowing draining veins rather than detecting microstructural changes.

      Regarding other functional contrasts, we agree that more layer-dependent fMRI approaches should be mentioned. In this revision, we have expanded the Introduction section to include discussions of the double spin-echo approach and CBV-based methods, such as MT-weighted fMRI, VAPER, ABC, and CBF-based method ASL. Additionally, the reference to Lu et al. (2013) has been cited in the revised manuscript. The corresponding text has been incorporated into the Introduction section to provide a more comprehensive overview of alternative functional imaging techniques.

      - The comparison in Figure 2 for different b-values shows % signal changes. However, as the baseline signal changes dramatically with added diffusion weighting, this is rather uninformative. A plot of t-values against cortical depth would be much more insightful.

      - Surprisingly, the %-signal change for a b-value of 0 is not significantly different from 0 in the gray matter. This raises some doubts about the task or ROI definition. A finger-tapping task should reliably engage the primary motor cortex, even at 3T, and even in a single participant.

      - The BOLD weighted images in Figure 3 show a very clear double-peak pattern. This contradicts the results in Figure 2 and is unexpected given the existing literature on BOLD responses as a function of cortical depth.

      - Given that data from Figures 2, 3, and 4 are derived from a single participant each, order and attention affects might have dramatically affected the observed patterns. Especially for Figure 4, neither BOLD nor VN profiles are really different from 0, and without statistical values or inter-subject averaging, these cannot be used to draw conclusions from.

      We appreciate the reviewer’s suggestions. In this revision, we have made significant updates to the participant recruitment, scan protocol, data processing, and M1 delineation. Please refer to the "General Responses" at the beginning of the rebuttal and the first response to Reviewer #2 for more details.

      Previously, the variation in depth-dependent profiles was calculated across upscaled voxels within a specific layer. However, due to the small size of the hand knob region, the number of within-layer voxels was limited, resulting in inaccurate estimations of signal variation. In the revised manuscript, the signal was averaged within each layer before performing the GLM analysis, and signal variation was calculated using the temporal residuals. The technical details of these changes are described in the "Materials and Methods" section. Furthermore, while the initial submission used percentage signal change for the profiles of M1, the dramatic baseline fluctuations observed previously are no longer an issue after the modifications. For this reason, we retained the use of percentage signal change to present the depth-dependent profiles. After these adjustments, the profiles exhibited a bias toward the pial surface, particularly in the absence of VN gradients.

      - In Figure 5, a phase regression is added to the data presented in Figure 4. However, for a phase regression to work, there has to be a (macrovascular) response to start with. As none of the responses in Figure 4 are significant for the single participant dataset, phase regression should probably not have been undertaken. In this case, the functional 'responses' appear to increase with phase regression, which is contra-intuitive and deserves an explanation.

      We agreed with reviewer’s argument. In the revised results, the issues mentioned by the reviewer are largely diminished. The updated analyses demonstrate that phase regression effectively reduces superficial bias, as shown in Figures 4 and 5.

      - Consistency of responses is indeed expected to increase by a removal of the more variable vascular component. However, the microvascular component is always expected to be smaller than the combination of microvascular + macrovascular responses. Note that the use of %signal changes may obscure this effect somewhat because of the modified baseline. Another expected feature of BOLD profiles containing both micro- and microvasculature is the draining towards the cortical surface. In the profiles shown in Figure 7, this is completely absent. In the group data, no significant responses to the task are shown anywhere in the cortical ribbon.

      We agreed with reviewer’s comments. In the revised manuscript, the results have been substantially updated to addressing the concerns raised. The original Figure 7 is no longer relevant and has been removed.

      - Although I'd like to applaud the authors for their ambition with the connectivity analysis, I feel that acquisitions that are so SNR starved as to fail to show a significant response to a motor task should not be used for brain wide directed connectivity analysis.

      We appreciate the reviewer’s comments and share the concern about SNR limitations. In the updated results presented in Figure 5, the activation patterns in the visual cortex were consistent across TEs and b values. At the motor cortex, stable activation in M1 was observed at the single-subject level across most scan protocols. However, the layer-dependent activation profiles in M1 exhibited spatial instability, irrespective of the application of VN gradients. This spatial instability is not entirely unexpected, as T2*-based contrast is inherently sensitive to factors that perturb the magnetic field, such as eye movements, respiration, and macrovascular signal fluctuations. Additionally, ICA-based artifact removal was intentionally omitted in Figure 4 to ensure fair comparisons across protocols, leaving some residual artifacts unaddressed. Variability in task performance during button-pressing sessions may have further contributed to the observed inconsistencies.

      Although these findings suggest that submillimeter-resolution fMRI may not yet be reliable for individual-level layer-dependent functional mapping, the group-level FC analyses can still yield robust results. In Figure 7, group-level statistics revealed distinct functional connectivity (FC) patterns associated with superficial and deep layers in M1. These FC maps exhibited significant differences between layers, demonstrating that VN fMRI enhances inter-layer independence. Additional FC analyses with a seed placed in S1 further validated these findings (see Figure 8).

      The claim of specificity is supported by the observation of the double-peak pattern in the motor cortex, previously shown in multiple non-BOLD studies. However, this same pattern is shown in some of the BOLD weighted data, which seems to suggest that the double-peak pattern is not solely due to the added velocity nulling gradients. In addition, the well-known draining towards the cortical surface is not replicated for the BOLD-weighted data in Figures 3, 4, or 7. This puts some doubt about the data actually having the SNR to draw conclusions about the observed patterns.

      We appreciate the reviewer’s comments. In the updated results, the efficacy of the VN gradients is evident near the pial surface, as shown in Figures 4 and 5. In Figure 4, comparing the second and third columns (b = 0 and b = 6 s/mm<sup>2</sup>, respectively, at TE = 38 ms), the percentage signal change in the superficial layers is generally lower with b = 6 s/mm<sup>2</sup> than with b = 0. This indicates that VN gradient-induced signal suppression is more pronounced in the superficial layers. Additionally, in Figure 5, the VN gradients effectively suppressed macrovascular signals as highlighted by the blue circles. These observations support the role of VN gradients in enhancing specificity by reducing superficial bias and macrovascular contamination. Furthermore, bias towards cortical surface was observed in the updated results in Figure 4.

      Recommendations for the authors:

      Reviewer #2 (Recommendations For The Authors):

      (1) L141: "depth dependent" is slightly misleading here. It could be misunderstood to suggest that the authors are assessing how spatial specificity varies as a function of depth. Rather, they are assessing spatial specificity based on depth-dependent responses (double peak feature). Perhaps "layer-dependent spatial specificity" could be substituted with laminar specificity?

      We thank the reviewer for the suggestion. The term “depth dependent” has been replaced by “layer dependent” in the revised manuscript.

      (2) L146-149: these do not validate spatial specificity.

      The original text is removed.

      (3) L180: Maybe helpful to describe what the b-value is to assist unfamiliar readers.

      We have clarified the b-value as “the strength of the bipolar diffusion gradients” where it is first mentioned in the manuscript.

      (4) Figure 1B: I think it would be appropriate with a sentence of how the authors define micro/macrovasculature. Figure 1B seems to suggest that large ascending veins are considered microvascular which I believe is a bit unconventional. Nevertheless, as long as it is clearly stated, it should be fine.

      In our context, macrovasculature refers to vessels that are distal to neural activation sites and contribute to extravascular contamination. These vessels are typically larger in size (e.g., > 0.1 mm in diameter) and exhibit faster flow rates (e.g., > 10 mm/s).

      (5) I think the authors could be more upfront with the point about non-suppressed extravascular effects from macrovasculature, which was briefly mentioned in the discussion. It could already be highlighted in the introduction or theory section.

      We thank the reviewer’s suggestions. We have expanded the discussion of extravascular effects from macrovasculature in both the Introduction (5th paragraph) and Discussion (3rd paragraph) sections.

      (6) The phase regression figure feels a bit misplaced to me. If the authors agree: rather than showing the TE-dependency of the effect of phase regression, it may be more relevant for the present study to compare the conventional setup with phase regression, with the VN setup without phase regression. I.e., to show how the proposed setup compares to existing 3T laminar fMRI studies.

      In this revision, both the TE-dependent and VN-dependent effects of phase regression were investigated. The results in Figure 4 and Figure 5 demonstrated that phase regression effectively suppresses macrovascular contributions primarily near the gray matter/CSF boundary, irrespective of TE or the presence of VN gradients.

      (7) L520: It might be beneficial to also cite the large body of other laminar studies showing the double peak feature to underscore that it is highly robust, which increases its relevance as a test-bed to assess spatial specificity.

      We agreed. More literatures have been cited (Chai et al., 2020; Huber et al., 2017a; Knudsen et al., 2023; Priovoulos et al., 2023).

      (8) L557: The argument that only one participant was assessed to reduce inter-subject variability is hard to buy. If significant variability exists across subjects, this would be highly relevant to the authors and something they would want to capture.

      We thank the reviewer for the suggestions. In this revision, we have increased the number of participants to 4 for protocol development and 14 for resting-state functional connectivity analysis, allowing us to better assess and account for inter-subject variability.

      (9) L637: add download link and version number.

      The download link has been added as requested. The version number is not applicable.

      (10) L638: How was the phase data coil-combined?

      The reconstructed multi-channel data, which were of complex values, were combined using the adaptive combination method (Walsh et al.; DOI: 10.1002/(sici)1522-2594(200005)43:5<682::aid-mrm10>3.0.co;2-g). The MATLAB code for this implementation was developed by Dr. Diego Hernando and is publicly available at https://github.com/welton0411/matlab . The phase data were then extracted using the MATLAB function ‘angle’.

      (11) L639: Why was the smoothing filter parameter changed (other parameters were default)?

      The smoothing filter parameter was set based on the suggestion provided in the help comments of the NIFTI_NORDIC function:

      function  NIFTI_NORDIC(fn_magn_in,fn_phase_in,fn_out,ARG)

      % fMRI

      %

      %  ARG.phase_filter_width=10;

      In other words, we simply followed the recommendation outlined in the NIFTI_NORDIC function’s documentation.

      (12) I assume the phase data was motion corrected after transforming to real and imaginary components and using parameters estimated from magnitude data? Maybe add a few sentences about this.

      Prior to phase regression, the time series of real and imaginary components were subjected to motion correction, followed by phase unwrapping. The phase regression was incorporated early in the data processing pipeline to minimize the discrepancy in data processing between magnitude and phase images (Stanley et al., 2021).

      (13) Was phase regression applied with e.g., a deming model, which accounts for noise on both the x and y variable? In my experience, this makes a huge difference compared with regular OLS.

      We appreciate the reviewer’s insightful comment. We are aware that the noise present in both magnitude and phase data therefore linear Deming regression would be a good fit to phase regression (Stanley et al., 2021). To perform Deming regression, however, the ratio of magnitude error variance to phase error variance must be predefined. In our initial tests, we found that the regression results were sensitive to this ratio. To avoid potential confounding, we opted to use OLS regression for the current analysis. However, we agreed Deming model could enhance the efficacy of phase regression if the ratio could be determined objectively and properly.

      (14) Figure 2: What is error bar reflecting? I don't think the across-voxel error, as also used in Figure 4, is super meaningful as it assumes the same response of all voxels within a layer (might be alright for such a small ROI). Would it be better to e.g. estimate single-trial response magnitude (percent signal change) and assess variability across? Also, it is not obvious to me why b=30 was chosen. The authors argue that larger values may kill signal, but based on this Figure in isolation, b=48 did not have smaller response magnitudes (larger if anything).

      We agreed with the reviewer’s opinion on the across-voxel error. In the revised manuscript, the signal was averaged within each layer before performing the GLM analysis, and signal variation was calculated using the temporal residuals. The technical details of these changes are described in the "Materials and Methods" section.

      Additionally, the bipolar diffusion gradients were modified from a single direction to three orthogonal directions. As a result, the questions and results related to b=30 or b=48 are no longer applicable.

      (15) Figure 5: would be informative to quantify the effect of phase regression over a large ROI and evaluate reduction in macrovascular influence from superficial bias in laminar profiles.

      We appreciate the reviewer’s suggestion. In the revised manuscript, the reduction in macrovascular influence from superficial bias across a large ROI is displayed in Figure 5. Additionally, the impact on laminar profiles is demonstrated in Figure 4.

      (16) L406-408: What kind of robustness?

      We acknowledge that describing the protocol as “robust” was an overstatement. The updated results indicate that the current protocol for submillimeter fMRI may not yet be suitable for reliable individual-level layer-dependent functional mapping. However, group-level functional connectivity (FC) analyses demonstrated clear layer-specific distinctions with VN fMRI, which were not evident in conventional fMRI. These findings highlight the enhanced layer specificity achievable with VN fMRI.

      (17) Figure 8: I think C) needs pointers to superficial, middle, and deep layers? Why is it not in the same format as in Figure 9C? The discussion of the FC results could benefit from more references supporting that these observations are in line with the literature.

      In the revised results, the layer pooling shown in Figure 9c has been removed, making the question regarding format alignment no longer applicable. Additionally, references supporting the FC results have been added to the revised Discussion section (7th paragraph).

      (18) L456-457: But correlation coefficients may also be biased by different CNR across layers.

      That is correct. In the updated FC results in Figure 7 to 9, we used group-level statistics rather than correlation coefficients.

      Reviewer #3 (Recommendations For The Authors):

      The results in Figure 2-6 should be repeated over, or averaged over, a (small) group of participants. N=6 is usual in this field. I would seriously reconsider the multiband acceleration - the acquisition seemingly cannot support the SNR hit.

      A few more specific points are given below:

      (1) Abstract: The sentence about LGN in the abstract came for me out of the blue - why would LGN be important here, it's not even a motor network node? Perhaps the aims of the study should be made more clear - if it's about networks as suggested earlier then a network analysis result would be expected too. Expanding the directed FC findings would improve the logical flow of the abstract. Given the many concerns, removing the connectivity analysis altogether would also be an option.

      We thank the reviewer for the suggestions. The LGN-related results indeed diluted the focus of this study and have been completely removed in this revision.

      (2) Line 105: in addition to the VASO method, ..

      The corresponding text has been revised, and as a result, the reviewer’s suggestion is no longer applicable.

      (3) If out of the set MB 4 / 5 / 6 MB4 was best, why did the authors not continue with a comparison including MB3 and MB2? It seems to me unlikely that the MB4 acquisition is actually optimal.

      Results: We appreciate the reviewer’s suggestions. In this revision, we decreased the MB factor to 3, as it allowed us to increase the in-plane acceleration rate to 3, thereby shortening the TE. The resulting sensitivity for both individual and group-level results is detailed in earlier responses, such as the response to Q16 for Reviewer #2.

      (4) The formatting of the references is occasionally flawed, including first names and/or initials. Please consider using a reliable reference manager.

      We used Zotero as our reference manager in this revision to ensure consistency and accuracy. The references have been formatted according to the APA style.

      (5) In the caption of Figure 5, corrected and uncorrected p values are identical. What multiple comparisons correction was made here? A multiple comparisions over voxels (as is standard) would usually lead to a cut-off ~z=3.2. That would remove most of the 'responses' shown in figure 5.

      We appreciate the reviewer’s comment. The original results presented in Figure 5 have been removed in the revised manuscript, making this comment no longer applicable.

    1. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      Comments on revisions:

      The authors have fully addressed the reviewers' comments and questions.

    1. Here are 6 trims of the 2025 Mazda CX-90, what you get with each one, and the corresponding price tag

      Here are the six Mazda CX-90 trim levels for 2025, including what you get with each one and the corresponding price tag

    1. 2025 Mazda CX-30 S: The CX-30 S is the base model and, as a result, is the most affordable. It receives a full LED lighting setup, 16-inch alloy wheels, push-button start, and remote keyless entry. With its vast array of features and technology, the CX-30 S trim comes with a price tag of $26,415. 2025 Mazda CX-30 Select Sport: The Select Sport trim upgrades its base-level predecessor's limited features with a more polished entry system, a larger wheel setup of 18 inches, and turn signals integrated within its heated side mirrors. Additionally, rain-sensing wipers come as standard equipment combined with a leather-wrapped steering wheel, rear privacy glass, gear selector, and more. It has a price of $28,070. 2025 Mazda CX-30 Preferred: The Preferred trim includes a power moonroof, functional outside mirrors, as well as heated front seats coupled with the driver’s 8-way power (with lumbar and memory). As a result of these upgrades, the Preferred trim comes with a price of $30,360. 2025 Mazda CX-30 Carbon Edition: Moving up the 2025 Mazda CX-30 trim lineup, we find the Carbon Edition. This model offers the exclusive gray coloration with bold, black mirrors and wheels. Also, red leather enhances the cabin with HD radio (with 2 additional speakers), wireless smartphone charging, and more. These upgrades increase the MSRP for the Carbon Edition to $31,360. 2025 Mazda CX-30 Carbon Turbo: The Carbon Turbo trim is available exclusively in gold paint. However, that’s just the beginning of its differentiation. It also separates itself with beautiful terracotta leatherette-trimmed seats, a more pronounced 10.25-inch infotainment touchscreen, and a bold grille that matches its door mirrors. As a result, these upgrades push the Carbon Turbo’s MSRP to $34,360. 2025 Mazda CX-30 Premium: As we climb higher up the CX-30 hierarchy, we land on the Premium trim. True to form, this model lives up to its namesake by boasting signature LED headlights and a power liftgate. Also, navigation is standard, and the trim is equipped with a head-up display that uses traffic sign recognition. Moreover, a 12-speaker Bose sound system brings your satellite radio to life to create a well-connected and entertaining driving experience. The 2025 CX-30 Premium trim costs $33,560. 2025 Mazda CX-30 Premium Plus: The 2025 CX-30's top-of-the-line trim is the Premium Plus model. It boasts all the upscale features and specifications in addition to a 360-degree camera system, reverse emergency braking assistance connectivity, auto-dimming rearview mirror, and more. With all that it has to offer, the Premium Plus trim is priced at $38,370.

      For each list item, take the vehicle model name (e.g. "2025 Mazda CX-30 S" and make it an H3, then put the associated paragraph content below it.

      Headings and paragraph content shouldn't be formatted as a list and colons can be removed from the headings

    2. 2025 Mazda CX-30 Trim Levels The 2025 Mazda CX-30 has 7 trim levels, each with a different set of features and attributes. Let’s explore each of these models in detail to determine which is the best for you.  2025 Mazda CX-30 S: The CX-30 S is the base model and, as a result, is the most affordable. It receives a full LED lighting setup, 16-inch alloy wheels, push-button start, and remote keyless entry. With its vast array of features and technology, the CX-30 S trim comes with a price tag of $26,415. 2025 Mazda CX-30 Select Sport: The Select Sport trim upgrades its base-level predecessor's limited features with a more polished entry system, a larger wheel setup of 18 inches, and turn signals integrated within its heated side mirrors. Additionally, rain-sensing wipers come as standard equipment combined with a leather-wrapped steering wheel, rear privacy glass, gear selector, and more. It has a price of $28,070. 2025 Mazda CX-30 Preferred: The Preferred trim includes a power moonroof, functional outside mirrors, as well as heated front seats coupled with the driver’s 8-way power (with lumbar and memory). As a result of these upgrades, the Preferred trim comes with a price of $30,360. 2025 Mazda CX-30 Carbon Edition: Moving up the 2025 Mazda CX-30 trim lineup, we find the Carbon Edition. This model offers the exclusive gray coloration with bold, black mirrors and wheels. Also, red leather enhances the cabin with HD radio (with 2 additional speakers), wireless smartphone charging, and more. These upgrades increase the MSRP for the Carbon Edition to $31,360. 2025 Mazda CX-30 Carbon Turbo: The Carbon Turbo trim is available exclusively in gold paint. However, that’s just the beginning of its differentiation. It also separates itself with beautiful terracotta leatherette-trimmed seats, a more pronounced 10.25-inch infotainment touchscreen, and a bold grille that matches its door mirrors. As a result, these upgrades push the Carbon Turbo’s MSRP to $34,360. 2025 Mazda CX-30 Premium: As we climb higher up the CX-30 hierarchy, we land on the Premium trim. True to form, this model lives up to its namesake by boasting signature LED headlights and a power liftgate. Also, navigation is standard, and the trim is equipped with a head-up display that uses traffic sign recognition. Moreover, a 12-speaker Bose sound system brings your satellite radio to life to create a well-connected and entertaining driving experience. The 2025 CX-30 Premium trim costs $33,560. 2025 Mazda CX-30 Premium Plus: The 2025 CX-30's top-of-the-line trim is the Premium Plus model. It boasts all the upscale features and specifications in addition to a 360-degree camera system, reverse emergency braking assistance connectivity, auto-dimming rearview mirror, and more. With all that it has to offer, the Premium Plus trim is priced at $38,370.

      Move this section below the sentence ending with "and boasts a selection of both non-turbo as well as turbocharged gas engine options."

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1:

      Major Comments:

      1. The data in the paper strongly suggests that the new copper shuttles are selective for copper and have faster binding kinetics (Fig 1) than the previous one. However, the data regarding the copper shuttling from the copper(Aβ) peptides is not very convincing. It appears to be due to the Cu effect alone (Fig.3), as the reduction in viability with Cu(II)+ AscH- is almost the same as the Cu(II)(Aβ)+AscH-. To convincingly show that the peptide shuttle can strip copper from (Aβ) peptides, the authors need to show that the copper is bound to the (Aβ) peptide before it is used in the experiment. Rightfully so, the effect of the toxicity of Cu(II)+ AscH- is similar to that of Cu(II)(Aβ16)+AscH-. This is due to the fact that Aβ16 is not toxic to the cells, so therefore there is no compounded effect of Cu and Aβ16 as seen for Cu(II)(Aβ40). As for the toxicity of Cu(II)+ AscH-, it is be similar to Cu(II)(Aβ)+AscH- because Cu(II) will be bound to a weaker ligand in the medium and such loosely bound Cu is also able to produce ROS with AscH- with similar rates as Cu-Ab.

      Data from our lab and others have shown that in HEPES solution at pH 7.4, Aβ forms a complex with Cu. The present work is also in line with Cu-binding to Ab, as in Figure 1C (GSH), the rate of Cu withdrawal by the shuttle can only be explained by Cu bound to Ab, as Cu in the buffer binds to the shuttle much faster. Also, the AscH- consumption rate measured in Fig S5D-E are congruent of Cu bound to Ab, unbound Cu has a much faster rate of AscH- consumption (Santoro et al. 2018, doi.org/10.1039/C8CC06040A).

      The concentrations of Aβ and Cu used in our experimental condition were determined with a UV-Vis spectrophotometer.

      Minor comments:

      1. The paper does not cite Figure 1A and some supplementary figures, especially Supp. Fig. 1-2. All the figures and supplementary figures should be cited. This has been rectified for all the concerned figures.

      The data presentation in Figures 3B and S8 is confusing."-" signs indicate no addition or the blank box means no addition. Also, the AKH-αR5W4 has no "-" sign in the first bar. For clarity, please indicate the -, +, or no sign means in the figure legends. Also, what does "Batch A" refer to in Figure 3B?

      The figures have been modified as suggested by the reviewer.

      Page 7, correct (Error! Referencesource not found.Figure 1C).

      This has been rectified.

      The Giantin staining in Figure 2B is making it hard to visualize ATP7A trafficking. If the Giantin image overlay is removed, it may be easier to see the movement of ATP7A from the perinuclear region to the vesicles.

      The images have been modified to better appreciate the ATP7A change in distribution upon the increase in intracellular Cu level. We have reduced the number of conditions for which images are provided and provided individual staining for clarity. Zoomed images are also provided. The remainder of the conditions are in Figure S7B

      In the introduction, the authors mention, "These molecules have, however, a major pitfall as is seen for Elesclemol, a candidate for Menkes disease treatments 32. The authors cite reference " Tsvetkov, P. et al. Copper induces cell death by targeting lipoylated TCA cycle proteins." The paper showing elesclomol as a candidate for Menkes disease treatments is Guthrie L et al., Elesclomol alleviates Menkes pathology and mortality by escorting Cu to cuproenzymes in mice. Science. 2020.

      We thank the reviewer for pointing this out, which was apparently not clearly explained. Our intention here was to show that a major pitfall of shuttles like Elesclomol, as seen in the study by Tsvetkov, P. et al. Science (2022), is cuprotoxicity. The sentence has been clarified and the work of Guthrie L et al is cited for Elesclomol as a candidate for Menkes disease.

      Reviewer #2 :

      Major issues:

      1. This reviewer is not convinced that the authors' experimental system is well suited for studies of glia activation and protective effects. With the exception of a couple of panels it is very hard to see differences. The authors should significantly improve the quality of images in Figure 5 to make this set of data convincing. We thank the reviewer for his/her detailed evaluation and for bringing to light the quality of the image in Figure 5. We have therefore improved the quality of the images by improving the signal to noise ratio to better show the differences between conditions.

      Similarly, the quality of giantin staining is low and needs to be improved and more experimental details are needed (see details below).

      As stated in our answer to reviewer 1, the images have been modified to better appreciate ATP7A redistribution upon increase of intracellular Cu levels. We have reduced the number of conditions for which images are provided and provided individual staining for clarity. Zoomed images are also provided. The remainder of the conditions are in Figure S7B.

      Given that shuttles are found within vesicles, the authors should discuss the mechanism through which Cu is released into the cytosol to trigger ATP7B trafficking.

      The mechanism of Cu escape from endosomes remains poorly understood. However, supported by our recent observations that Cu quickly (within 10 min) dissociates from the Cu-shuttle AKH-αR5W4NBD in endosomes (Okafor et al., 2024, /doi.org/10.3389/fmolb.2024.1355963), we discuss the potential involvement CTR1/2 and DMT1 (page 16).

      There are numerous small writing issues that make paper difficult to read. The authors are encouraged to carefully edit their manuscript.

      We thank the reviewer for pointing this out and several errors have been corrected whereas various sentences have been clarified.

      Minor issues

      * „A solution of monomerized Aβ complex in 10% DMEM (diluted with DMEM salt solution) was prepared in microcentrifuge tubes" - here and further the description of media composition is confusing What is the rest 90%?

      This has been rectified. The composition of the salt solution that makes up the 90% has been provided (page 4).

      * „Afterwards, AscH- was added to the tubes and vortexed, the mixture was then added to PC12 cells" - concentration of ascorbate is mentioned only once (later in the figure legend) where it can be barely found, also without explaining the choice of concentration. Additionally, ascorbate's product code is not listed. Please, correct.

      These points have been rectified.

      * Description of the cell (PC12 line) handling conditions is absent (growth medium, passage number used etc) and should be included.

      This information is now provided.

      * ATP7A delocalization assay. Details for the secondary antibodies are absent (full name (e.g. AlexaFluor 488), manufacturer, code) and should be added.

      Missing information has been added.

      * page 6: „Next, we investigated the capacity of the shuttles to withdraw Cu(II) from cell culture media, DMEM 10% and DMEM/F12 1:1 (D/F)." Here and further explanation is needed why the mixture of DMEM/F12 is needed (F12 is also not listed in the materials list).

      DMEM/F12 is a media that is commercially available used for some cell types, and it has been added to the materials list (page 4).

      * Page 7. Legend to the figure 1B: „Conditions: Cu(II)=AKH-αR5W4NBD=DapHH-αR5W4NBD=HDapH-αR5W4NBD= 5 μM, DMEM 10%, D/F 100%, 25{degree sign}C, n=3." - „DMEM/F12" ratio equals to „100%" is confusing, please clarify

      This has been clarified.

      * Page 8-9. Legend to the Figure 2A. „Similar observations were obtained with 5 different cell cultures." Same remark goes to the legend to supplementary figure 7 ("Similar observations were obtained with at least 3 different cell cultures"). Do the authors mean independent experiments or different cell lines? Please clarify. If different cell lines, consider including these data into the supplement.

      Indeed we meant independent experimentations. This has been clarified.

      * Page 8-9, figure 2B. Giantin is a cis-golgi marker, which should localize perinuclearly. In the cells shown the signal is diffuse and appears non-specific. Please improve the quality.

      We have reduced the number of conditions for which images are provides and are providing individual staining for clarity. Zoomed images are also provided allowing visualization of the typical cis-Golgi distribution of Giantin.

      * Page 8-9, figure 2B. ATP7A is shown in green. The authors did not specify the secondary antibody has been used for it. If the secondary antibody used for labeling of ATP7A has green fluorescence then how does one distinguish between the transporter signal and signal of the green fluorescent shuttle? Please provide more details.

      We thank the reviewer for pointing this point as we missed to mention this technical issue in the original manuscript. The Cu-shuttles labeled with NBD indeed emit in the green signal, but they are not fixable under our conditions and are washed out during ICC procedure. Accordingly, they do generate any background signal and do not interfere with the ICC as shown by the controls and test conditions (Figure S7B and Figure 2B). This is now mentioned (page 11).

      * Page 9 and Figure 2B. Why did authors use Cu(II)EDTA for the experiment? What was the concentration? Please, add this information as well as Cu(II)GTSM treatment conditions to the experiment description in materials and methods.

      EDTA is a strong chelator of Cu(II), however due to its negative charge it cannot penetrate the plasma membrane thus importing Cu. It is therefore used as a negative control, to eliminate the speculation of Cu non-specifically crossing the plasma membrane or through a channel.

      * Figure 2 and supplementary figure 7. It would be beneficial to have higher magnification images. Please, add them, if possible.

      These higher magnification images have been provided.

      * Page 11. „In conclusion, the novel Cu(II)-selective peptide shuttles .... capable of instantly preventing ... toxicity on PC12 cells, whereas ... instantly rescue Cu(II)Aβ1-42 toxicity". Authors should be more careful with terminology. According to the materials and methods, the survival assay was carried out after 24h of cells' treatment with the reagents. Effect visible after 24h and „instant rescue" is not the same, Please clarify or modify the wording

      In principle, the peptides cannot reverse the production of ROS, however they prevent ROS production. Therefore, for the peptides to have an effect, they have to instantly halt ROS production. This is justified by the novel shuttles being more effective than AKH-αR5W4NBD in preventing toxicity, given we modified just the Cu binding sequence. We have however restricted the use of the term instantly to ROS production.

      * Page 13, figure 5, panels C and D. In both quantitations Cu(II) was used as one of the control conditions. Why in panel D the percentage of activated microglial cells (second graphs from right) is several fold higher (appr. 150% vs >500%)?

      This variability was observed throughout our set of experiments and could be linked to the quality of the hippocampal slices used. Slight variations in the age of the animals or in the traces of metals in the mediums are likely explanations. However, the different groups that are compared represent experiments performed simultaneously.

      * Supplementary Figure S3B. The lowest solid line does not correspond to any color in the legend (please, check and correct). However, by the method of exclusion, one may conclude that it refers to Cu(II)+HDapH-shuttle. What could be a potential explanation for stronger quenching of this shuttle by binding Cu(II) directly from the spiked media comparing to when it is pre-complexed with copper (also supported by the panel D)?

      The stronger quenching of this shuttle by binding Cu(II) directly from the spiked media comparing to when it is pre-complexed with copper is not significant.

      * In discussion the authors mention that the designed shuttles are prone to degradation in 48 hours. In the viability assays, they treat cells for 24 hours, in the fluorescent and confocal microscopy experiments for one hour or less. What is the lifetime of these shuttle peptides in the cells?

      The lifetime of the shuttle peptide in the cells is currently unknown. However, after 24h incubation of PC12 cells with the AKH-αR5W4NBD, DapHH-αR5W4NBD and HDapH-αR5W4NBD, the Cu shuttles lose their punctate distribution and appear diffuse inside the cells. We have recently shown that AKH-αR5W4NBD cycles through different endosomal compartments and eventually reaches the lysosomes where it could be degraded (Okafor et al., 2024, /doi.org/10.3389/fmolb.2024.1355963). Therefore, the diffuse distribution of the fluorescence signal could suggest degradation of the Cu-shuttles.

      * From the microscopy observations, the mechanism of entry of apo-shuttles (with no Cu(II) in the complex) and in complex with Cu(II) looks quite different. Namely, in figure S7 the fluorescent signal is very strong in the plasma membrane with significantly less vesicular pattern when compared to figure 2A. It is especially apparent for DapHH shuttle at 15 minutes of incubation. Can authors hypothesize/discuss the reason for these differences?

      The difference of the shuttle’s signal in the presence or absence of Cu binding, is due to fluorescence quenching by Cu bound and was at the heart of the design of these shuttles. Hence a strong signal at the plasma membrane is seen in the absence of Cu as these CPP-based shuttles interact strongly with the plasma membrane. However in presence of Cu, they become less visible due to quenching by Cu. Interestingly however, is that when Cu dissociates from the shuttle inside the cells (likely in acid endosomes), this quenching is suppressed and the fluorescence reappears. This is now better explained (page 10).

      * Please, show the figures in the supplementary file in the same order as you refer to them.

      This has been rectified.

      * Introduction. Description of the shuttle peptides: „(3) a cell penetrating peptide (CPP), αR5W4, with sequence RRWWRRRWWR, for cell entry35" - one R is the middle is extra.

      This has been rectified.

      *Kd units are missing (pages 2, 3 and 15) and should be added.

      This has been added.

      * Figure 1A is either not referred at all or mislabeled.

      * Page 7, Figure 1B: x axis on the second panel (+Mn+) misses a label.

      * Page 8. „Upon addition of DapHH-αR5W4NBD or HDapH-αR5W4NBD, an immediate slow-down in ROS production was observed (Figure 1D and S1E), ..." - mislabeled supplementary figure, please, correct.

      * Page 11. „...but not in the presence of AKH-αR5W4NBD which required pre-incubation to prevent toxicity (Figure 3AFigure)." Please, correct the reference to the figure.

      * Page 11. „This is in line with the faster retrieval ... previously demonstrated in vitro (Figure 1)" - please, specify the panel.

      * Supplementary materials and methods, subsection „Retrieval of Cu by peptide shuttles from Aβ", page 2: „The same was done for 10 μM Cu(II)...to give the estimated 100% saturated emission level." - check the spelling of the shuttle species.

      * Supplementary Figure S4. By the behavior of AKH-shuttle in the presence of copper and other metals, it looks that panels are shuffled, i.e. panel C looks corresponding to the panel B with DMEM/F12 conditions, whish is also supported by the values in the Table S1. Please, check and correct, if needed.

      * Supplementary figure S9, panel A. Apparently, mislabeled images with Abeta1-42 and Cu(II)Abeta1-42. Please, correct.

      We apologize for the different issues in referencing figures. This has been rectified.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Minor Concerns

      I think that authors can add some concepts of general interest on AD, as follows

      evidence showed that AD top-line disease-modifying drugs employing monoclonal antibodies (donanemab, lecanemab, and aducanumab) that tag Aβ, based on the 'Amyloid cascade hypothesis', are able to rid the brain of Aβ plaques, but the drug benefits consist in a reduction of 35% of cognitive decline. The remaining disease burden (more than 65%) has no disease-modifying therapeutic options, at the moment. Furthermore, monoclonal antibodies against Aβ have strong side- events (ARIA). On this basis, it could be suggested that removing Aβ plaque might not be sufficient to slow the 100% percentage of clinical decline in AD. This is why the Cu(II) shuttle invention presented by the candidate may represent a valid and concrete means to fight AD, since also meta-analyses demonstrate that Cu and more specifically non-Cp Cu is increased in AD (PMID: 34219710). The authors can add some of these clinical considerations in the Discussion.

      There is only a very brief description of the scenario of evidence of the involvement of copper in Alzheimer's, especially from a clinical point of view, I mean the scenario resulting from clinical studies carried out on AD patients. This would have highlighted the unmet medical need to which these new compounds (the Cu shuttles) can provide an answer. At least for a subpopulation of Alzheimer's patients, and we know that there are different subtypes of Alzheimer's disease (for example 10.1016/j.neurobiolaging.2004.04.001, but authors can find others), these Cu(II) selective shuttles could provide beneficial effects. Literature reports about a percentage of AD patients with increased levels of Cu (some papers on this topic e can be easily retrieved,), who may primarily benefit from these compounds. These can be easily identified as it is also characterized by a different biochemical, cognitive, and genetic profile. The current study is timely since AD patients with high Cu can be easily identified since they are characterized by a different biochemical, cognitive, and genetic profile as per recent findings (PMID: 37047347). This information can improve the quality of the manuscript by providing information about the unmet clinical need that this study can answer

      We thank the reviewer for his very positive evaluation and for his suggestion that gives more perspective to our work. Accordingly, we have added these parts to the introduction and discussion sections.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary: The paper addresses the design and synthesis of novel copper (Cu)-selective peptide transporters to prevent Cu(Aβ)-induced toxicity and microglial activation in organotypic hippocampal slices.This is a very interesting study. I would define the study as pioneering and I hope that it is a seminal study, as it could be a study that opens the doors to future studies in the sector but above all applications in the clinical field. The methods are very complex and demonstrate an excellent knowledge of the biochemistry of beta-amyloid and copper. Methods are also clear and provide information for reproducibility

      Minor Concerns

      I think that authors can add some concepts of general interest on AD, as follows evidence showed that AD top-line disease-modifying drugs employing monoclonal antibodies (donanemab, lecanemab, and aducanumab) that tag Aβ, based on the 'Amyloid cascade hypothesis', are able to rid the brain of Aβ plaques, but the drug benefits consist in a reduction of 35% of cognitive decline. The remaining disease burden (more than 65%) has no disease-modifying therapeutic options, at the moment. Furthermore, monoclonal antibodies against Aβ have strong side- events (ARIA). On this basis, it could be suggested that removing Aβ plaque might not be sufficient to slow the 100% percentage of clinical decline in AD. This is why the Cu(II) shuttle invention presented by the candidate may represent a valid and concrete means to fight AD, since also meta-analyses demonstrate that Cu and more specifically non-Cp Cu is increased in AD (PMID: 34219710). The authors can add some of these clinical considerations in the Discussion

      there is only a very brief description of the scenario of evidence of the involvement of copper in Alzheimer's, especially from a clinical point of view, I mean the scenario resulting from clinical studies carried out on AD patients. This would have highlighted the unmet medical need to which these new compounds (the Cu shuttles) can provide an answer. At least for a subpopulation of Alzheimer's patients, and we know that there are different subtypes of Alzheimer's disease (for example 10.1016/j.neurobiolaging.2004.04.001, but authors can find others), these Cu(II) selective shuttles could provide beneficial effects. Literature reports about a percentage of AD patients with increased levels of Cu (some papers on this topic e can be easily retrieved,), who may primarily benefit from these compounds. These can be easily identified as it is also characterized by a different biochemical, cognitive, and genetic profile. The current study is timely since AD patients with high Cu can be easily identified since they are characterized by a different biochemical, cognitive, and genetic profile as per recent findings (PMID: 37047347). This information can improve the quality of the manuscript by providing information about the unmet clinical need that this study can answer

      Significance

      The significance of the study relies on that the Cu(II) selective shuttles can import Cu into cells and also release Cu once inside the cells, which was shown to be bioavailable, as revealed by the delocalization of ATP7A from the TGN to the sub-plasmalemma zone in PC12 cells. The novelty is well expressed by the implementation of Cu(II) selective shuttles that can release Cu inside the cells. Thus, they can restore Cu physiological levels in conditions of brain Cu deficiency that typify the neuronal cells in AD. Furthermore, this Cu trafficking can be finely tuned, thus preventing potential adverse drug reactions when transferred into human clinical phase I and II studies. This application may represent a step forward concerning previous copper attenuating compounds/Cu(II) ionophores such as Clioquinol and GTSM which mediated non-physiological Cu import into the cells that have likely contributed to neurotoxicity processes in previous unsuccessful phase II clinical trials.

      Furthermore, the originality of the current study relies on the fact that these shuttles can be tracked in real-time, once in the cell, since they employ a fluorophore moiety sensitive to Cu binding. Furthermore, DapHH-αR5W4NBD and HDapH-αR5W4NBD, can import bioavailable Cu(II) and can prevent ROS production by Cu(II)Aβ instantly, due to the much faster Cu-binding. Importantly, DapHH-αR5W4NBD and HDapH-αR5W4NBD shuttles have been also capable of preventing OHSC slices from Cu-induced neurotoxicity, microglial proliferation, and activation. Another important feature of the Cu shuttles is that they can be designed to control their site of cell delivery. In fact, previous ionophores had the tendency to accumulate in the mitochondria, and, in doing so, excess Cu in the mitochondria might have competed with other transitional metals (mainly Fe) and triggered mitochondrial dysfunction as well as cuproptosis. These are the main strengths of the study.

      The audience of this article is currently that of expert biochemists, but by adding aspects regarding the unmet clinical need relating to the large population of AD patients with high copper in the introduction and discussion, the article can capture the attention of clinicians.

      I am a neuroscientist working on biochemical pathways and metals in Alzheimer's disease.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      *Reviewer #1 (Evidence, reproducibility and clarity (Required)): *

      • The authors investigate in this study the function of LIN-42 for the process of precise molting timing in C. elegans. To achieve this, they compare LIN-42 with its mammalian ortholog, Period. They found that similar to Period, LIN-42 interacted with the kinase KIN-20, a mammalian Casein kinase 1 (CK1) ortholog. Hence, two different proteins involved in rhythmic processes, LIN-42 and Period function in a conserved manner. *
      • First, they used mutants with specific deletions to untangle various phenotypes during C. elegans development. From this analysis they identify a specific region, corresponding to a CK1-binding region in mammals, to be mainly involved in the rhythmic molting phenotype. Next, they identify KIN-20, the CK1 ortholog as interaction partner of LIN-42. They even were able to demonstrate an interaction of CK1 with the region of LIN-42. Using CK1, they identified potential phosphorylation sites within LIN-42 and compared those with immunoprecipitated protein in vivo. There was a substantial overlap. While the C-terminal tail of LIN-42 was heavily phosphorylated, deletion of the C-terminal part resulted only in a minor phenotype for rhythmic molting. Last but not least, they demonstrated that point mutations that inactivate the catalytic function of KIN-20 produced a rhythmic molting phenotype. The interaction of LIN-42 with KIN-20 affected the localization of the kinase, similar to what was found to Period and CK1. *
      • Overall, the experiments are well done, well controlled and well described even for non-specialists. I guess it was not easy to kind of sort out the many overlapping phenotypes. It was certainly helpful just to focus on the clear rhythmic molting phenotype. *

      • I have no major or minor comments. *

      • Reviewer #1 (Significance (Required)): *

      • The manuscript is well written and can be followed by non-specialists of the field. The experiments are well performed. Even if some experiments did not yield the expected phenotype, e.g. deletion of the C-terminal tail of LIN-42 had only a minor phenotype inspire of heavy phosphorylation, these experiments are anyhow included and explained. *

      • Overall, the study is interesting for people in the C. elegans field and by similarity mammalian chronobiology. I would expect that most of the progress based on this study will be on the further elucidation of the molting phenotype and how the other phenotypes related to this. Then this could emerge as a blueprint for molting phenomena in other species as well. *
      • I am a mammalian chronobiologist working on Period proteins. *

      We thank the reviewer for their positive evaluation of our work.

      *Reviewer #2 (Evidence, reproducibility and clarity (Required)): *

      • This study represents pioneering work on LIN-42, the C. elegans ortholog of PER, uncovering its role in molting rhythms and heterochronic timing. A key strength of this work lies in its integrative approach, combining genetic and developmental analyses in C. elegans with biochemical characterization of LIN-42 protein. *

      • At the organismal level, the authors take advantage of the power of C. elegans as a model system, employing precise genetic manipulations and high-resolution developmental assays to dissect the contributions of LIN-42 and its interaction partner KIN-20, the C. elegans ortholog of CK1, to molting rhythms. Their findings provide in vivo evidence that binding of LIN-42 with KIN-20 promotes the nuclear accumulation of KIN-20 and is crucial for molting rhythms, while its PAS domain appears dispensable for this function. This detailed phenotypic analysis of multiple LIN-42 and KIN-20 mutants represents a significant contribution to our understanding of the developmental clock. *

      • At the biochemical level, the study provides a detailed analysis of the mechanism underlying LIN-42's interaction with CK1, demonstrating that LIN-42 contains a functionally conserved CK1-binding domain (CK1BD). Through their in vitro kinase assays and structural insights, the authors identified distinct roles for CK1BD-A and CK1BD-B: the former in kinase inhibition and the latter in stable CK1 binding and phosphorylation. Importantly, their data align well with previous findings on PER-CK1 regulation in mammalian and Drosophila systems, reinforcing the evolutionary conservation of key clock components. *

      • Overall, this work stands out for its deep and important insights into how CK1-mediated regulation extends beyond the circadian clock to regulate the developmental clock. The combination of genetic approaches with biochemical analyses makes this an outstanding contribution to both chronobiology and nematode developmental biology. *

      We thank the reviewer for the strong endorsement for publication of our work

      *Major comment 1: * * In Figure 2D, I could not find a crucial control if the authors claim that KIN-20 binds to LIN-42. For example, a single mutant of LIN-42-3xFLAG could be used as a control for the double mutant. *

      We will do an appropriate control experiment.

      *Major comment 2: * * The sizes of the KIN20 bands were very diverged (~40 kDa and ~60 kDa), but the authors provide no explanation for this. *

      The worm produces several KIN-20 isoforms. We will state this in the revised manuscript.

      *Major comment 3: * * Regarding the MS study, the raw data are available, but the detailed supplemental Excel files would be more informative for readers. For example, are other interactors such as REV-ERB/NHR-85 detected in Figure 2A? Regarding Figure 4F, the list of phosphorylation sites and MS scores is also informative. *

      We apologize for our omission in stating clearly in the figure legend that the significantly enriched proteins were labeled with a red dot. These were only LIN-42 itself and KIN-20. NHR-85 was not enriched. We will state this explicitly in a revised version and provide all relevant information.

      *Major comment 4: * * It is an important finding that the PAS domain of LIN-42 is not essential for the molting rhythms. Is the PAS domain also dispensable for binding with KIN-20? *

      Although we have currently no reason to assume that the PAS domain would be required for KIN-20 binding, we will perform an in vitro experiment to test for binding.

      *Major comment 5 (Optional): * * In this study, the authors carefully performed in vitro kinase assays, and I strongly suggest that they investigate whether the CKI-mediated phosphorylation of LIN-42 is temperature-compensated and whether the CKI-BD-AB regions affect it. *

      Although this is an interesting question, addressing it appears outside the scope of the manuscript and a revision; please see section 4 below.

      *Major comment 6 (Optional): * * In Figure 6, the authors argue that the CKI-BD of LIN-42 is important for CK1 nuclear translocation. It would be better to show the effect of the nuclear accumulation of CKI on nuclear proteins, like the mammalian CKI-PER2-CLOCK story. Does CKI localization affect phosphorylation status of other clock-related proteins including REV-ERB/NHR-85? * * Phospho-proteome analysis would identify nuclear substrates of CK1. In addition, is phosphorylation of LIN-42 dispensable for the CK1 nuclear translocation? *

      This is another interesting question yet currently nothing is known about other CK1/KIN-20 targets, and we have no evidence for NHR-85 being one. Please see our detailed comments in the section 4 below.

      To address whether LIN-42 phosphorylation affects CK1/KIN-20 nuclear accumulation, we will seek to examine KIN-20 localization in LIN-42∆Tail animals.

      *Major comment 7 (Optional): * * LIN-42 rhythmic expression could drive rhythmic nuclear accumulation of KIN-20. It would be better to examine this possibility using kin-20::GFP in lin-42 mutants. *

      We agree that the mutant analysis is important for this and Fig. 6C shows reduced KIN-20 nuclear accumulation in LIN-42∆CK1BD.

      Minor 1: * * I could not find the full gel images of the Western blot analyses as supplemental materials.

      This data will be added.

      Minor 2: * * The authors discussed a conserved module in two different clocks. A statement regarding a recently published paper (Hiroki and Yoshitane, Commun Biol, 2024) would be informative for readers.

      We will add such a statement.

      ***Referee cross-commenting** *

      • I basically agree with reviewer 1 and hope that this paper will be published soon as it is very valuable for our field. I have constructively pointed out some parts that could be improved, but depending on the editor's judgement, I believe that even if not all of these are revised, it will be sufficient for publication. *

      • Reviewer #2 (Significance (Required)): *

      • This work stands out for its deep and important insights into how CK1-mediated regulation extends beyond the circadian clock to regulate the developmental clock. The combination of genetic approaches with biochemical analyses makes this an outstanding contribution to both chronobiology and nematode developmental biology. *

      • I strongly suggest editors to accept this study with minor modifications according to the following comments.*

      We thank the reviewer for their strong support and the clear indication of required vs. optional revisions.

      *Reviewer #3 (Evidence, reproducibility and clarity (Required)): *

      • In their manuscript "A conserved chronobiological complex times C. elegans development", Spangler, Braun, Ashley et al. investigate the mechanisms through which the PERIOD orthologue, lin-42, regulates rhythmic molting in C. elegans. Through precise genetic manipulations, the authors identify a particular region of lin-42, the 'CK1BD', which regulates molting timing, with less effect on other lin-42 phenotypes (e.g. heterochrony). They show that LIN-42 and the casein kinase 1 (CK1) homologue KIN-20 interact in vivo, and identify phosphorylation sites of LIN-42. Using biochemical assays, they find that the CK1BD of LIN-42 is sufficient for interaction with the human homologue of KIN-20, CK1, in vitro. The LIN-42 CK1BD is also required for the proper nuclear accumulation of KIN-20 in vivo. Furthermore, a point mutation that should disrupt the catalytic activity of KIN-20 also shows an irregular molting phenotype, similar to the lin-42 CK1BD mutant. The manuscript is very well-written and the data and methods are well-presented and detailed. Overall this work makes a convincing case that the C. elegans lin-42:Kin-20 and mammalian period:Ck1 interactions have functionally conserved roles in the oscillatory developmental programs of each organism (molting timing and circadian rhythms, respectively), with a few caveats below that can be addressed.*

      We thank the reviewer for their positive evaluation of our work.

      *Major comments: *

        1. The authors have shown that LIN-42 is phosphorylated in vivo, but the dependence of this phosphorylation on KIN-20 is not fully addressed. In the discussion (lines 417-420), the authors mention that the unhealthy phenotype of the kin-20 mutant animals prevented them from assessing LIN-42 phosphorylation in this genetic background. To bolster their model and to circumvent this issue, it should be feasible to generate a kin-20 degron allele and to perform the LIN-42 phospho-proteomics upon inducible degradation. Alternatively, perhaps a phos-tag western blot for LIN-42 could be used to compare the kin-20 wild-type to kin-20 mutants.*

      We agree, and acknowledged in the discussion, that phoshorylation of LIN-42 by KIN-20 in vivo has not been demonstrated by us. However, as discussed in the section 4 below, we find that this costly, challenging and time-consuming experiment is not warranted by the expected gain.

      For technical reasons, the in vitro biochemistry was done using human CK1 protein. There are a few places (e.g. results, line 248 and discussion line 437), where the language, in my opinion, is extrapolating the CK1 results too strongly to KIN-20. The authors mention that feedback inhibition is a known property of human CK1. It is indeed quite striking that the LIN-42 CK1BD region interacts with and is phosphorylated by the human counterpart of KIN-20, and that feedback inhibition is also seen! However, the language about KIN-20 itself should be softened, since there does not appear to be clear evidence that KIN-20 exhibits the same properties as human CK1 (unless perhaps human CK1 can functionally replace KIN-20 in worms, or the proteins were extremely similar?)

      We will follow the reviewer’s advice and carefully examine the text for instances where we extrapolated too much and tone these down. (We note that this does not apply to the example of line 248 where we wrote “Collectively, our data establish that the LIN-42

      CK1BD is functionally conserved and mediates stable binding to the CK1 kinase domain.”, i.e., there was no mentioning of KIN-20.)

      The role of the three LIN-42 isoforms should be further clarified. Minimally, it should be explained why the alleles where both b and c isoforms should be flag-tagged seem to only produce detectable b isoform (e.g. Fig. 2C).

      We will clarify that the individual roles of the isoforms are largely unknown and that we can only speculate that the c-isoform may exhibit either generally low expression or expression in only few cells or tissues.

      4. Related to points 2 and 3 above, the authors have shown that the CKIBD mediates association with human CK1 in vitro, and is required for nuclear accumulation of KIN-20 in vivo, but not that the complex formation between LIN-42 and KIN-20 depends on the CK1BD. Given the reciprocal co-IP findings, it should be feasible to create tagged versions of lin-42(deltaCK1BD) and to determine the effect on LIN-42-KIN-20 complex formation. While there is already a b-isoform tag, an a-isoform tag would also help to address whether both the b and a isoforms interact with KIN-20 in a CK1BD-dependent manner in vivo. These strains would also allow the authors to determine how the CK1BD deletion affects overall levels/stability/rhythmic accumulation of LIN-42(a or b), which would potentially serve to strengthen their conclusions about the role of the lin-42 CK1BD.

      We will attempt to generate a FLAG-tagged LIN-42∆CK1BD to perform IP and check for binding of KIN-20.

      As detailed in section 4, we cannot tag LIN-42a individually due to the structure of the genomic locus, and its level appear very low to begin with.

      In the molting timing assay, there is an unexpected result where the delta-C-terminal-tail lin-42 allele resembles the n1089 (N-terminal deletion) (line 315). Could the authors more clearly explain this finding?

      As we point out in the manuscript, n1089 is a partial deletion with a breakpoint in a noncoding (intronic) region of lin-42. Accordingly, it is currently unknown, what mature transcripts and proteins are made in the mutant animals. This prevents us from making educated guesses as to why there is a phenotypic resemblance between these and lin-42∆tail mutant animals. We will clarify in the manuscript that this is an interesting, but currently unexplained observation.

      *Minor comments: *

        1. The correspondence between the LIN-42 "SYQ" and "LT" motifs and the motifs referred to as "A" and "B" should be clarified, and consistent names/labels used. Are these interchangeable names? If it is necessary to use both names, the differences between SYQ/LT and A/B should be made more clear.*

      We agree that the situation is not completely satisfactory but feel that we need to use both names since they have both been used in the literature. We will work to revise the text to reflect more clearly the correspondence.

      For data presented as "% of animals", please indicate the number of animals scored (e.g. egl, alae assays - ~ how many animals per replicate (dot)?).

      We will provide these numbers.

      Line 145-148 - Mentioning the relevant phenotype(s) of the lin-42 null allele from the cited paper would provide a good point of comparison here.

      We will mention the previously described phenotypes.

      Line 201 - the phrase "This is also true for the proteins:" is unclear, as the previous sentence states that both lin-42 and kin-20 mRNAs oscillate, while the next sentence says that only LIN-42 protein oscillates.

      We apologize for the confusion and will correct the text.

      Line 231 - please explain the significance of the 'lower response signal' in the BLI assay for the CKIBD(no tail).

      We will clarify that the lower response signal observed for the CK1BD compared to the CK1BD+Tail (residues 402-589; same construct used in Fig. 3B) reflects its smaller molecular weight, which reduces the overall mass contribution to the BLI sensor.

      Fig. 2 - C/D - the genotype lane labels should I think indicate an N-terminal rather

      We will fix this mistake.

      7. Fig. 6, line 367 - lin-42 is variably described as promoting increased KIN-20 'nuclear accumulation' or 'localization'. I think that 'accumulation' is more accurate, as it doesn't imply a specific mechanism for the difference (transport vs stabilization, etc.)

      We will revise the manuscript accordingly.

      *8. Fig 6B - an overlay of the panels or another way of quantifying the colocalization would make this result more clear. *

      We will supply the requested overlay.

      *Reviewer #3 (Significance (Required)): *

      • This work presents a major mechanistic and conceptual advance in our understanding of the role of lin-42/Period, a conserved key regulator of C. elegans development. Previously, it was not clear if the heterochronic and circadian functions of lin-42 were genetically separable, nor was it known how LIN-42 physically interacted with the CK1 homologue. This work addresses these questions using precise genome engineering and detailed phenotypic and biochemical approaches. The work also reveals the conservation of bi-directional/reciprocal regulation between lin-42 and kin-20. The main limitations of the study, which can potentially be addressed as outlined in the 'major points' above, are that evidence should be provided that lin-42 phosphorylation depends on kin-20 in vivo, and that the CK1BD mediates the interaction in vivo (since the in vitro work is with human CK1). As the authors indicate, this is the first 'conserved clock module' of this type, and this work will therefore be of significant interest to both the C. elegans developmental biology and the more general biological timing fields. *

      • Field of expertise of the reviewer- C. elegans genetics and development.*

      Description of the studies that the authors prefer not to carry out

      *Major comment 5 (Optional): * * In this study, the authors carefully performed in vitro kinase assays, and I strongly suggest that they investigate whether the CKI-mediated phosphorylation of LIN-42 is temperature-compensated and whether the CKI-BD-AB regions affect it. *

      Temperature compensation is of course one of the most striking features of circadian clocks, and CK1-mediated phosphorylation of PER appears a critical component. We agree that it would be interesting to examine whether or not this feature exists in an animal whose development is not or only partially temperature-compensated. However, these studies are not straightforward – we would first have to set up an assay and demonstrate temperature compensation for the mammalian PER – CK1 pair as a positive control. We were not able to purify KIN-20 so could only test whether the LIN-42 substrate promoted temperature compensation. Moreover, either result for LIN-42 – CK1 would immediately raise new questions that would deserve extensive follow-up: if there is temperature compensation, why is worm development not compensated? If there is none, where/how do the interactions between CK1 and LIN-42 differ from those between CK1 and PER? Hence, we propose that these studies are outside the scope of the current study.

      *Major comment 6 (Optional): * * In Figure 6, the authors argue that the CKI-BD of LIN-42 is important for CK1 nuclear translocation. It would be better to show the effect of the nuclear accumulation of CKI on nuclear proteins, like the mammalian CKI-PER2-CLOCK story. Does CKI localization affect phosphorylation status of other clock-related proteins including REV-ERB/NHR-85? * * Phospho-proteome analysis would identify nuclear substrates of CK1. In addition, is phosphorylation of LIN-42 dispensable for the CK1 nuclear translocation? *

      We agree that it will be important to identify relevant targets of KIN-20 in future work. Unfortunately, at this point, none are known, and we especially do not have any knowledge of the phosphorylation status of NHR-85. Indeed, in unrelated (and unpublished) work we have done a phosphoproteomics time course of wild-type animals. We have not detected any NHR-85-derived phosphopeptides in our analysis. Thus, this would establish a completely new line of research, incompatible with the timelines of a revision.

      @Ref. 3:

      1. *The authors have shown that LIN-42 is phosphorylated in vivo, but the dependence of this phosphorylation on KIN-20 is not fully addressed. In the discussion (lines 417-420), the authors mention that the unhealthy phenotype of the kin-20 mutant animals prevented them from assessing LIN-42 phosphorylation in this genetic background. To bolster their model and to circumvent this issue, it should be feasible to generate a kin-20 degron allele and to perform the LIN-42 phospho-proteomics upon inducible degradation. Alternatively, perhaps a phos-tag western blot for LIN-42 could be used to compare the kin-20 wild-type to kin-20 mutants. * We agree, and acknowledged in the discussion, that phoshorylation of LIN-42 by KIN-20 in vivo has not been demonstrated by us. However, since our data from the LIN-42∆Tail mutant also suggest that LIN-42 phosphorylation be functionally largely dispensable for KIN-20’s function in rhythmic molting, we consider further elucidation of this point a lower priority, especially considering the challenges involved. As we have seen for our unpublished work on wild-type animals, a phosphoproteomics experiments would be costly and time-consuming, with a non-trivial analysis (due to the underlying dynamics of protein level changes). A phos-tag gel would be subject to multiple confounders given the abundance of the phosphosites that we detected on immunoprecipitated LIN-42 – unlikely to stem only from KIN-20 activity – and an increase in total LIN-42 levels that we observe upon KIN-20 depletion, and thus appears unsuited to providing a meaningful answer.

      *Related to points 2 and 3 above, the authors have shown that the CKIBD mediates association with human CK1 in vitro, and is required for nuclear accumulation of KIN-20 in vivo, but not that the complex formation between LIN-42 and KIN-20 depends on the CK1BD. Given the reciprocal co-IP findings, it should be feasible to create tagged versions of lin-42(deltaCK1BD) and to determine the effect on LIN-42-KIN-20 complex formation. While there is already a b-isoform tag, an a-isoform tag would also help to address whether both the b and a isoforms interact with KIN-20 in a CK1BD-dependent manner in vivo. These strains would also allow the authors to determine how the CK1BD deletion affects overall levels/stability/rhythmic accumulation of LIN-42(a or b), which would potentially serve to strengthen their conclusions about the role of the lin-42 CK1BD. *

      As detailed in section 2, we will address the point concerning LIN-42∆CK1BD. However, due to the overlapping exons, we are unable to tag the a-isoform independently of the b-isoform. Moreover, in a western blot of a line where both a- and b-isoforms are tagged, we have observed only little or no LIN-42a signal, suggesting that, like the c-isoform, its expression may be more limited, making biochemical characterization difficult. Hence, these experiments are not feasible.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In their manuscript "A conserved chronobiological complex times C. elegans development", Spangler, Braun, Ashley et al. investigate the mechanisms through which the PERIOD orthologue, lin-42, regulates rhythmic molting in C. elegans. Through precise genetic manipulations, the authors identify a particular region of lin-42, the 'CK1BD', which regulates molting timing, with less effect on other lin-42 phenotypes (e.g. heterochrony). They show that LIN-42 and the casein kinase 1 (CK1) homologue KIN-20 interact in vivo, and identify phosphorylation sites of LIN-42. Using biochemical assays, they find that the CK1BD of LIN-42 is sufficient for interaction with the human homologue of KIN-20, CK1, in vitro. The LIN-42 CK1BD is also required for the proper nuclear accumulation of KIN-20 in vivo. Furthermore, a point mutation that should disrupt the catalytic activity of KIN-20 also shows an irregular molting phenotype, similar to the lin-42 CK1BD mutant. The manuscript is very well-written and the data and methods are well-presented and detailed. Overall this work makes a convincing case that the C. elegans lin-42:Kin-20 and mammalian period:Ck1 interactions have functionally conserved roles in the oscillatory developmental programs of each organism (molting timing and circadian rhythms, respectively), with a few caveats below that can be addressed.

      Major comments:

      1. The authors have shown that LIN-42 is phosphorylated in vivo, but the dependence of this phosphorylation on KIN-20 is not fully addressed. In the discussion (lines 417-420), the authors mention that the unhealthy phenotype of the kin-20 mutant animals prevented them from assessing LIN-42 phosphorylation in this genetic background. To bolster their model and to circumvent this issue, it should be feasible to generate a kin-20 degron allele and to perform the LIN-42 phospho-proteomics upon inducible degradation. Alternatively, perhaps a phos-tag western blot for LIN-42 could be used to compare the kin-20 wild-type to kin-20 mutants.
      2. For technical reasons, the in vitro biochemistry was done using human CK1 protein. There are a few places (e.g. results, line 248 and discussion line 437), where the language, in my opinion, is extrapolating the CK1 results too strongly to KIN-20. The authors mention that feedback inhibition is a known property of human CK1. It is indeed quite striking that the LIN-42 CK1BD region interacts with and is phosphorylated by the human counterpart of KIN-20, and that feedback inhibition is also seen! However, the language about KIN-20 itself should be softened, since there does not appear to be clear evidence that KIN-20 exhibits the same properties as human CK1 (unless perhaps human CK1 can functionally replace KIN-20 in worms, or the proteins were extremely similar?)
      3. The role of the three LIN-42 isoforms should be further clarified. Minimally, it should be explained why the alleles where both b and c isoforms should be flag-tagged seem to only produce detectable b isoform (e.g. Fig. 2C).
      4. Related to points 2 and 3 above, the authors have shown that the CKIBD mediates association with human CK1 in vitro, and is required for nuclear accumulation of KIN-20 in vivo, but not that the complex formation between LIN-42 and KIN-20 depends on the CK1BD. Given the reciprocal co-IP findings, it should be feasible to create tagged versions of lin-42(deltaCK1BD) and to determine the effect on LIN-42-KIN-20 complex formation. While there is already a b-isoform tag, an a-isoform tag would also help to address whether both the b and a isoforms interact with KIN-20 in a CK1BD-dependent manner in vivo. These strains would also allow the authors to determine how the CK1BD deletion affects overall levels/stability/rhythmic accumulation of LIN-42(a or b), which would potentially serve to strengthen their conclusions about the role of the lin-42 CK1BD.
      5. In the molting timing assay, there is an unexpected result where the delta-C-terminal-tail lin-42 allele resembles the n1089 (N-terminal deletion) (line 315). Could the authors more clearly explain this finding?

      Minor comments:

      1. The correspondence between the LIN-42 "SYQ" and "LT" motifs and the motifs referred to as "A" and "B" should be clarified, and consistent names/labels used. Are these interchangeable names? If it is necessary to use both names, the differences between SYQ/LT and A/B should be made more clear.
      2. For data presented as "% of animals", please indicate the number of animals scored (e.g. egl, alae assays - ~ how many animals per replicate (dot)?).
      3. Line 145-148 - Mentioning the relevant phenotype(s) of the lin-42 null allele from the cited paper would provide a good point of comparison here.
      4. Line 201 - the phrase "This is also true for the proteins:" is unclear, as the previous sentence states that both lin-42 and kin-20 mRNAs oscillate, while the next sentence says that only LIN-42 protein oscillates.
      5. Line 231 - please explain the significance of the 'lower response signal' in the BLI assay for the CKIBD(no tail).
      6. Fig. 2 - C/D - the genotype lane labels should I think indicate an N-terminal rather than C-terminal LIN-42 tag.
      7. Fig. 6, line 367 - lin-42 is variably described as promoting increased KIN-20 'nuclear accumulation' or 'localization'. I think that 'accumulation' is more accurate, as it doesn't imply a specific mechanism for the difference (transport vs stabilization, etc.)
      8. Fig 6B - an overlay of the panels or another way of quantifying the colocalization would make this result more clear.

      Significance

      This work presents a major mechanistic and conceptual advance in our understanding of the role of lin-42/Period, a conserved key regulator of C. elegans development. Previously, it was not clear if the heterochronic and circadian functions of lin-42 were genetically separable, nor was it known how LIN-42 physically interacted with the CK1 homologue. This work addresses these questions using precise genome engineering and detailed phenotypic and biochemical approaches. The work also reveals the conservation of bi-directional/reciprocal regulation between lin-42 and kin-20. The main limitations of the study, which can potentially be addressed as outlined in the 'major points' above, are that evidence should be provided that lin-42 phosphorylation depends on kin-20 in vivo, and that the CK1BD mediates the interaction in vivo (since the in vitro work is with human CK1). As the authors indicate, this is the first 'conserved clock module' of this type, and this work will therefore be of significant interest to both the C. elegans developmental biology and the more general biological timing fields.

      Field of expertise of the reviewer- C. elegans genetics and development.

    1. Twitter publishing tools can now add a description to any tweet their users publish, not as a part of the 140 character message, but as a small machine-readable metadata field that travels along with the content.

      This feels a lot like the tags in an annotation. We've thought about structured tags, and possibly the ability for different users or groups to publish different schemas for those structures. A tag or possibly a group layer could inherit one or more schemas by referencing them.

    1. Docker setup Installation Install Docker on your system Install the required packages: Copied pip install 'smolagents[docker]' Setting up the docker sandbox Create a Dockerfile for your agent environment: Copied FROM python:3.10-bullseye # Install build dependencies RUN apt-get update && \ apt-get install -y --no-install-recommends \ build-essential \ python3-dev && \ pip install --no-cache-dir --upgrade pip && \ pip install --no-cache-dir smolagents && \ apt-get clean && \ rm -rf /var/lib/apt/lists/* # Set working directory WORKDIR /app # Run with limited privileges USER nobody # Default command CMD ["python", "-c", "print('Container ready')"] Create a sandbox manager to run code: Copied import docker import os from typing import Optional class DockerSandbox: def __init__(self): self.client = docker.from_env() self.container = None def create_container(self): try: image, build_logs = self.client.images.build( path=".", tag="agent-sandbox", rm=True, forcerm=True, buildargs={}, # decode=True ) except docker.errors.BuildError as e: print("Build error logs:") for log in e.build_log: if 'stream' in log: print(log['stream'].strip()) raise # Create container with security constraints and proper logging self.container = self.client.containers.run( "agent-sandbox", command="tail -f /dev/null", # Keep container running detach=True, tty=True, mem_limit="512m", cpu_quota=50000, pids_limit=100, security_opt=["no-new-privileges"], cap_drop=["ALL"], environment={ "HF_TOKEN": os.getenv("HF_TOKEN") }, ) def run_code(self, code: str) -> Optional[str]: if not self.container: self.create_container() # Execute code in container exec_result = self.container.exec_run( cmd=["python", "-c", code], user="nobody" ) # Collect all output return exec_result.output.decode() if exec_result.output else None def cleanup(self): if self.container: try: self.container.stop() except docker.errors.NotFound: # Container already removed, this is expected pass except Exception as e: print(f"Error during cleanup: {e}") finally: self.container = None # Clear the reference # Example usage: sandbox = DockerSandbox() try: # Define your agent code agent_code = """ import os from smolagents import CodeAgent, HfApiModel # Initialize the agent agent = CodeAgent( model=HfApiModel(token=os.getenv("HF_TOKEN"), provider="together"), tools=[] ) # Run the agent response = agent.run("What's the 20th Fibonacci number?") print(response) """ # Run the code in the sandbox output = sandbox.run_code(agent_code) print(output) finally: sandbox.cleanup()

      docker e2b sandbox

    1. Author response:

      The following is the authors’ response to the previous reviews.

      Public Reviews:

      Reviewer #1 (Public review):

      Comment of Review of Revised Version:

      Although the authors have partly corrected the manuscript by removing the mislabeling in their Co-IP experiments, my primary concern on the actual functional connotations and direct interaction between PA28y and C1QBP still remains unaddressed. As already mentioned in my previous review, since the core idea of the work is PA28y's direct interaction with C1QBP, stabilizing it, the same should be demonstrated in a more convincing manner.

      My other observation on the detection of C1QBP as a doublet has been addressed by usage of anti-C1QBP Monoclonal antibody against the polyclonal one used before. C1QBP doublets have not been observed in the present case.

      The authors have also worked on the presentation of the background by suitably modifying the statements and incorporating appropriate citations.

      However, the authors are requested to follow the recommendations provided to them by the reviewers to address the major concerns.

      Thank you very much for your comments. We appreciate your concerns regarding the need for more direct evidence to support the stabilizing interaction between PA28γ and C1QBP. In response to your feedback, we have taken additional steps to provide more convincing evidence of this interaction.

      To complement our existing pull-down and Co-IP experiments, we utilized AlphaFold 3 to predict the three-dimensional structure of the PA28γ-C1QBP complex. The predicted model reveals specific residues and interfaces that are likely involved in the direct interaction between PA28γ and C1QBP. Our analysis indicates that this interaction may depend on amino acids 1-167 and 1-213 of C1QBP (Revised Appendix Figure 1E-H). Furthermore, aspartate (ASP), as the 177th amino acids of PA28γ, was predicted to interact with the 76th amino acid threonine (THR) and the 78th amino acid glycine (GLY) of C1QBP (Revised Appendix Figure 1I). This structural insight was further validated by our immunoprecipitation experiments (Revised Figure 1J). These findings provide a molecular basis for the observed stabilizing effect and suggest potential mechanisms by which PA28γ influences C1QBP stability. Specifically, the identified interaction sites offer clues into how PA28γ may stabilize C1QBP at the molecular level.

      Furthermore, we performed proximity ligation assays (PLA) to detect in situ interactions between PA28γ and C1QBP at the single-cell level. PLA results clearly demonstrate the presence of PA28γ-C1QBP complexes within cells, providing direct evidence of their physical interaction (Revised Figure 1D). This approach overcomes some of the limitations associated with traditional IP experiments and confirms the direct nature of the interaction.

      In summary, the integration of AlphaFold 3 predictions, PLA data, and our previous Pull-down and Co-IP experiments provides robust and direct evidence for a stable interaction between PA28γ and C1QBP. We believe that these additional findings significantly reinforce our conclusions and effectively address the concerns raised by the reviewers. Once again, thank you for your valuable feedback, which has been instrumental in refining and enhancing our study.

      Reviewer #2 (Public review):

      Comment of Review of Revised Version:

      Weaknesses:

      Many data sets are shown in figures that cannot be understood without more descriptions either in the text or the legend, e.g., Fig. 1A. Similarly, many abbreviations are not defined.

      The revision addressed these issues.

      Some of the pull-down and coimmunoprecipitation data do not support the conclusion about the PA28g-C1QBP interaction. For example, in Appendix Fig. 1B the Flag-C1QBP was detected in the Myc beads pull-down when the protein was expressed in the 293T cells without the Myc-PA28g, suggesting that the pull-down was not due to the interaction of the C1QBP and PA28g proteins. In Appendix Fig. 1C, assume the SFB stands for a biotin tag, then the SFB-PA28g should be detected in the cells expressing this protein after pull-down by streptavidin; however, it was not. The Western blot data in Fig. 1E and many other figures must be quantified before any conclusions about the levels of proteins can be drawn.

      The revision addressed these problems.

      The immunoprecipitation method is flawed as it is described. The antigen (PA28g or C1QBP) should bind to the respective antibody that in turn should binds to Protein G beads. The resulting immunocomplex should end up in the pellet fraction after centrifugation, and analyzed further by Western blot for coprecipitates. However, the method in the Appendix states that the supernatant was used for the Western blot.

      The revision corrected this method.

      To conclude that PA28g stabilizes C1QBP through their physical interaction in the cells, one must show whether a protease inhibitor can substitute PA28q and prevent C1QBP degradation, and also show whether a mutation that disrupt the PA28g-C1QBP interaction can reduce the stability of C1QBP. In Fig. 1F, all cells expressed Myc-PA28g. Therefore, the conclusion that PA28g prevented C1QBP degradation cannot be reached. Instead, since more Myc-PA28g was detected in the cells expressing Flag-C1QBP compared to the cells not expressing this protein, a conclusion would be that the C1QBP stabilized the PA28g. Fig. 1G is a quantification of a Western blot data that should be shown.

      The binding site for PA28g in C1QBP was mapped to the N-terminal 167 residues using truncated proteins. One caveat would be that some truncated proteins did not fold correctly in the absence of the sequence that was removed. Thus, the C-terminal region of the C1QBP with residues 168-283 may still bind to the PA29g in the context of full-length protein. In Fig. 1I, more Flag-C1QBP 1-167 was pull-down by Myc-PA28g than the full-length protein or the Flag-C1QBP 1-213. Why?

      The interaction site in PA28g for C1QBP was not mapped, which prevents further analysis of the interaction. Also, if the interaction domain can be determined, structural modeling of the complex would be feasible using AlphaFold2 or other programs. Then, it is possible to test point mutations that may disrupt the interaction and if so, the functional effect.

      The revision added AlphaFold models for the protein interaction. However, the models were not analyzed and potential mutations that would disrupt the interact were not predicted, made and tested. The revision did not addressed the request for the protease inhibitor.

      Thank you for your insightful comments regarding the binding site of PA28γ in C1QBP. We appreciate your concern about the potential misfolding of truncated proteins and the possible interaction between the C-terminal region (residues 168-283) of C1QBP and PA28γ in the context of full-length protein.

      To address these concerns, we have conducted additional analyses and experiments to provide a more comprehensive understanding of the interaction between PA28γ and C1QBP. Using AlphaFold 3, we predicted the three-dimensional structure of the PA28γ-C1QBP complex. The model reveals specific residues and interfaces that are likely involved in the direct interaction between PA28γ and C1QBP. Notably, our structural analysis indicates that the interaction may primarily depend on amino acids 1-167 and 1-213 of C1QBP (Revised Appendix Figure 1E-H). Furthermore, aspartate (ASP), as the 177th amino acids of PA28γ, was predicted to interact with the 76th amino acid threonine (THR) and the 78th amino acid glycine (GLY) of C1QBP (Revised Appendix Figure 1I). This prediction supports the idea that the N-terminal region of C1QBP is crucial for its interaction with PA28γ. Regarding the observation in old Figure 1I (Revised Figure 1J), where more Flag-C1QBP 1-167 was pulled down by Myc-PA28γ compared to the full-length protein or Flag-C1QBP 1-213, we believe this can be explained by several factors:

      A. The truncation of C1QBP to residues 1-167 may expose key interaction sites that are partially obscured in the full-length protein. This enhanced accessibility could lead to stronger binding affinity and higher pull-down efficiency.

      B. While it is possible that some truncated proteins do not fold correctly, our data suggest that the N-terminal fragment (1-167) retains sufficient structural integrity to interact effectively with PA28γ. The increased pull-down of this fragment suggests that it captures the essential elements required for binding.

      C. The C-terminal region (168-283) might exert steric hindrance or allosteric effects on the N-terminal binding site in the context of the full-length protein. This interference could reduce the overall binding efficiency, leading to less pull-down of full-length C1QBP compared to the truncated version.

      Compared with the control group, the presence of Myc-PA28γ significantly increased the expression level of Flag-C1QBP (r Revised Figure 1G). Gray value analysis showed that in cells transfected with Myc-PA28γ, the decay rate of Flag-C1QBP was significantly slower than that of the control group (Revised Figure 1H), suggesting that PA28γ can delay the protein degradation of C1QBP and stabilize its protein level. This indicates that an increase in the level of PA28γ protein can significantly enhance the expression level of C1QBP protein, while PA28γ can slow down the degradation rate of C1QBP and improve its stability. In addition, our western blot analysis also proved that PA28γ could still prevent the degradation of C1QBP under the action of proteasome inhibitor MG-132 (Revised Appendix Figure 1D). Moreover, PA28γ could not stabilize the mutation of C-terminus of C1QBP (amino acids 94-282), which was not the interaction domain of PA28γ-C1QBP (Revised Figure 1K).

    1. Author response:

      The following is the authors’ response to the original reviews.

      Reviewer #1 (Public review):

      Summary:

      This manuscript presents evidence of ’vocal style’ in sperm whale vocal clans. Vocal style was defined as specific patterns in the way that rhythmic codas were produced, providing a fine-scale means of comparing coda variations. Vocal style effectively distinguished clans similar to the way in which vocal repertoires are typically employed. For non-identity codas, vocal style was found to be more similar among clans with more geographic overlap. This suggests the presence of social transmission across sympatric clans while maintaining clan vocal identity.

      Strengths:

      This is a well-executed study that contributes exciting new insights into cultural vocal learning in sperm whales. The methodology is sound and appropriate for the research question, building on previous work and ground-truthing much of their theories. The use of the Dominica dataset to validate their method lends strength to the concept of vocal style and its application more broadly to the Pacific dataset. The results are framed well in the context of previous works and clearly explain what novel insights the results provide to the current understanding of sperm whale vocal clans. The discussion does an overall great job of outlining why horizontal social learning is the best explanation for the results found.

      Weaknesses:

      The primary issues with the manuscript are in the technical nature of the writing and a lack of clarity at times with certain terminology. For example, several tree figures are presented and ’distance’ between trees is key to the results, yet ’distance’ is not clearly defined in a way for someone unfamiliar with Markov chains to understand. However, these are issues that can easily be dealt with through minor revisions with a view towards making the manuscript more accessible to a general audience.

      I also feel that the discussion could focus a bit more on the broader implications - specifically what the developed methods and results might imply about cultural transmission in other species. This is specifically mentioned in the abstract but not really delved into in detail during the discussion.

      We are grateful for the Reviewer’s recognition of the study’s contributions to understanding cultural vocal learning in sperm whales. In response to the concerns regarding clarity and accessibility, we have revised the manuscript to improve the definition of key concepts, such as the notion of “distance” between subcoda trees. This adjustment ensures clarity for readers unfamiliar with the technical details of Markov chains. Additionally, we have expanded the discussion to highlight broader implications of our findings, particularly their relevance to understanding cultural transmission in other species, as suggested.

      Reviewer #2 (Public review):

      Summary:

      The current article presents a new type of analytical approach to the sequential organisation of whale coda units.

      Strengths:

      The detailed description of the internal temporal structure of whale codas is something that has been thus far lacking.

      Weaknesses:

      It is unclear how the insight gained from these analyses differs or adds to the voluminous available literature on how codas varies between whale groups and populations. It provides new details, but what new aspects have been learned, or what features of variation seem to be only revealed by this new approach? The theoretical basis and concepts of the paper are problematical and indeed, hamper potentially the insights into whale communication that the methods could offer. Some aspects of the results are also overstated.

      We appreciate the Reviewer’s acknowledgment of the novelty in describing the internal temporal structure of whale codas. Regarding the concern about the unique contributions of this approach, we have further emphasized in the revised manuscript how our methodology reveals previously uncharacterized dimensions of coda structure. Specifically, our work highlights how non-identity codas, which have received limited attention, play a significant role in inter-clan acoustic interactions. By leveraging Variable Length Markov Chains, we provide a nuanced understanding of coda subunits that complements existing studies and demonstrates the value of this analytical approach.

      Reviewer #3 (Public review):

      Summary:

      The study presented by Leitao et al., represents an important advancement in comprehending the social learning processes of sperm whales across various communicative and socio-cultural contexts. The authors introduce the concept of ”vocal style” as an addition to the previously established notion of ”vocal repertoire,” thereby enhancing our understanding of sperm whale vocal identity.

      Strengths:

      A key finding of this research is the correlation between the similarity of clan vocal styles for non-ID codas and spatial overlap (while no change occurs for ID codas), suggesting that social learning plays a crucial role in shaping symbolic cultural boundaries among sperm whale populations. This work holds great appeal for researchers interested in animal cultures and communication. It is poised to attract a broad audience, including scholars studying animal communication and social learning processes across diverse species, particularly cetaceans.

      Weaknesses:

      In terms of terminology, while the authors use the term ”saying” to describe whale vocalizations, it may be more conservative to employ terms like ”vocalize” or ”whale speech” throughout the manuscript. This approach aligns with the distinction between human speech and other forms of animal communication, as outlined in prior research (Hockett, 1960; Cheney & Seyfarth, 1998; Hauser et al., 2002; Pinker & Jackendoff, 2005; Tomasello, 2010).

      We thank the Reviewer for recognizing the importance of our findings and their appeal to broader audiences interested in animal cultures and communication. In response to the suggestion regarding terminology, we have adopted a more conservative language to align with distinctions between human and non-human communication systems. For example, terms like “vocalize” and “vocal repertoire” are used in place of anthropomorphic terms such as “saying”. This ensures consistency with established conventions while maintaining clarity for a broad readership.

      Reviewer #1 (Recommendations):

      Comment 1

      Lines 11-13: As mentioned above, the implications for comparing communication systems and cultural transmission in other species isn’t really discussed much and I think it’s a really interesting component of the study’s broader implications.

      Thank you for the comment.

      Action - We added a few more sentences to the discussion regarding this.

      Comment 2

      Figure 1: More information on the figure of these trees would help. What do the connecting lines represent? What do the plain black dots and the black dot with the white dot represent? Especially since the ”distance between trees” is a key result, it’s important that someone unfamiliar with Markov chains can understand the basics of how this is calculated and what it represents. It is explained in the methods, but a brief explanation here would make the results and the figure a lot clearer since the methods are the last section of the manuscript.

      These were omitted as we believed that attempting to introduce the mathematical structure and the methodology to compare two instances, in a figure caption, would have caused more ambiguity than necessary.

      Action - Added an informal introduction to these concepts on the figure caption. Also added a pointer to the Supplementary Materials.

      Comment 3

      Table 1: A definition of dICIs should be included here.

      Added the definition of discrete ICI to the table.

      Comment 4

      Figure 2: The placement of the figures is a bit confusing because they are quite far from the text that references them.

      We thank the reviewer for pointing this out, we tried to edit the manuscript to improve this issue, but this part of the editing is more within the journal’s powers than our own.

      Action - Moved images closes to the corresponding text in manuscript.

      Comment 5

      Line 117: Probabilistic distance needs to be briefly explained earlier when you first mention distance (see Lines 11-13 comments).

      Action - Clarifications added in the caption of figure 1. as per comment on Lines 11-13

      Comment 6

      Figure 4: Is order considered in these pairwise comparisons? It looks like there are two dots for each pairwise comparison. Additionally, why is the overlap different in these two comparisons? For example, short:four-plus has an overlap of 0.6, while four-plus:short has an overlap of 0.95.

      The x-axis of the plots in Figure 4 is geographical clan overlap. This is calculated as per (Hersh et al., 2022) and is described in our Methods (see “Measuring clan overlap” section). Given two clans—for example, the Four-Plus and the Short clan—spatial overlap is calculated twice: as the proportion of the Four-Plus clan’s repertoires that were recorded within 1,000 km of at least one of the Short clan’s repertoires, and as the proportion of the Short clan’s repertoires that were recorded within 1,000 km of at least one of the Four-Plus clan’s repertoires.

      Order is important in these pairwise comparisons and generates an asymmetric matrix because the clans have different spatial extents. A clan found in only one small region might overlap completely with a clan that spans the Pacific Ocean, while the opposite is not true. For example, the Short clan spans the Pacific Ocean while the Four-Plus clan has been documented over a smaller area (but that smaller area overlaps extensively with the Short clan range). That is why the value is smaller (0.6) when considering how much of the Short clan’s range is shared with the Four-Plus clan, and larger ( 0.95) when considering how much of the Four-Plus clan’s range is shared with the Short clan.

      Action - We have now added a reference to that section of the Methods in our Figure 4 caption and include the clan spatial overlap matrix as a supplemental table (Table S5).

      Comment 7

      Figure 4: I think the reference should be Hersh et al. [11].

      Thank you for catching this.

      Action - Reference corrected

      Comment 8

      Line 227: What aspect of your analysis looked at how often codas were produced? You mention coda frequency, but it is unclear how this was incorporated into your analysis. If this is included in the methods, the language is a bit too technical to easily parse it out.

      Indeed here we are referencing the results of the paper mentioned in the previous line. We do not look at coda production frequency.

      Action - Added citation to paper that actually performs this analysis.

      Comment 9

      Lines 253-255: I think you could dig into this a little more, as ”there is currently no evidence” is not the most convincing argument that something is not a driver. Perhaps expanding on the latter sentence that clans are recognizable across oceans basins would be helpful. Does this suggest that clans with similar geographic overlap experience diverse environmental conditions across ocean basins? If so, this might better strengthen your argument against environmental drivers.

      Thank you for pointing this out. We feel that the next sentence highlights that clans are recognizable across environmental variation from one side to the other of the ocean basin, which supports the inductive reasoning that codas do not vary systematically with environment. However, we have edited these sentences for clarity.

      Comment 10

      Lines 311-314: It would also be interesting to look at vocal style across non-ID coda types. Are some more similar to each other across clans than others? Perhaps vocal style can further distinguish types of non-ID codas.

      In supplementary Materials 3.4.2 and 3.5 we highlight our results when the codas are separated by coda type summarized in Table S4. We do compare the vocal style across non-ID coda types across clans and within the same clan. The results however are aggregated to highlight the differences in style between the clans and a a coda type-only comparison is not shown.

      Comment 11

      Lines 390-392: I’m assuming this is why pairwise comparisons were directional (i.e., there was both an A:B and a B:A comparison)? Can you speak to why A:B and B:A comparisons can have such different overlap values?

      Given two clans—for example, the Four-Plus and the Short clan—spatial overlap is calculated twice: as the proportion of the Four-Plus clan’s repertoires that were recorded within 1,000 km of at least one of the Short clan’s repertoires, and as the proportion of the Short clan’s repertoires that were recorded within 1,000 km of at least one of the Four-Plus clan’s repertoires.

      Order is important in these pairwise comparisons and generates an asymmetric matrix because the clans have different spatial extents. A clan found in only one small region might overlap completely with a clan that spans the Pacific Ocean, while the opposite is not true. For example, the Short clan spans the Pacific Ocean while the Four-Plus clan has been documented over a smaller area (but that smaller area overlaps extensively with the Short clan range). That is why the value is smaller (0.6) when considering how much of the Short clan’s range is shared with the Four-Plus clan, and larger (0.95) when considering how much of the Four-Plus clan’s range is shared with the Short clan.

      Action - We now include the clan spatial overlap matrix as a supplemental table (Table S5).

      Comment 13

      Line 56: Can you briefly explain what memory means in the context of Markov chains?

      We provide an explanation of the meaning of memory in the Methods section on ”Variable length Markov Chains”. Briefly, the memory in this case means how many states in the past of the Markov chain’s current state are required to predict the next transition of the chain itself. Standard Markov chains “look” back only one time step, while k-th order Markov chains look back k steps. In our case, there was no reason to assume that the memory required to predict different sequences of states (interclick intervals) should be the same across all sequences, and thus we adopted the formalism of variable length Markov chains, that allow for different levels of memory across the system.

      Comment 14

      Supplementary Figure S3: Like in the main manuscript, briefly explain or remind us what the blank nodes and the yellow nodes are.

      Action - Clarified that the orange node represents the root of the tree in the figures.

      Comment 15

      Supplementary Figure S7: Put the letters before the dataset name.

      Action - Done.

      Comment 16

      Supplementary Figure S10: Unclear what ’inner vs outer’ means.

      One specifies comparisons across clans (outer) and the other within the same clan (inner)

      Action - Added clarification on the caption of Figure S10

      Comment 17

      Supplementary Figure S14: Include a-c labels in the figure itself.

      Action - Labels added to figure

      Comment 18

      Supplementary Figure S14: The information about the nodes is what needs to be included earlier and in the main body when discussing the trees.

      Action - Added the explanation earlier in the text and in the main body

      Reviewer #2 (Recommendations):

      Comment 19

      Line 22: ”Symbolic” and ”Arbitrary” are not synonyms. Please see the comment above.

      We agree. Here, we make the point that the evolution of symbolic markers of group identity can be explained from what are initially arbitrary, and meaningless, signals (see [L1, L2]). Our point being that any vocalization, any coda, could have become selected for as an identity coda, and to become symbolic, and evolve to play a key role in cultural group formation and in-group favoritism because they enable a community of individuals to solve the problem of with whom to collaborate. The specific coda itself does not affect collaborative pay offs, but group specific differences in behavior can, as such the coda is arguably symbolic; as it is observable and recognizable, and can serve as a means for social assortment even when the behavioural differences are not. This can explain the means by which the social segregation which is observed among behaviorally distinct clans of sperm whales. However, in this manuscript, we do not extend this discussion of existing literature and have attempted to concisely describe this in a couple of lines, which clearly do a disservice to the large body of literature on the evolution of symbolic markers and human ethnic groups. We have added some citations to this section so that the reader may follow up should they disagree with out brief introductory statements.

      Action - Added citations and pointers to the literature.

      Comment 20

      Line 24: The authors’ terminology around ”markers”, ”arbitrary”, ”symbolic” is unnecessarily confusing and mystifying, giving the impression these terms are interchangeable. They are not. These terms are an integral and long-established part of key definitions in signal theory. Term use should be followed accordingly. The observation that whale vocal signals vary per population does not necessarily mean that they function as a social tag. The word ”dog” varies per population but its use relates to an animal, not the population that utters the word. ”Dog” is not ”symbolic” of England, English-speaking populations or the English language. Furthermore, the function of whale vocal signals is extremely challenging to determine. In the best conditions, researchers can pin the signal’s context, this is distinct from signal’s function and further even for the signal’s meaning. How exactly the authors determine that whale vocal signals are arbitrary is, thus, perplexing given that this would require a detailed description and understanding of who is producing the song, when, towards whom, and how the receivers react, none of which the authors have and without which no claim on the signals’ function can be made. This terminological laxness and the sensu latu in extremis to various terms in an unjustified, unnecessary and unhelpful.

      We use these terms as established in Hersh et al 2022 and the works leading up to it over the last 20 years in the study of sperm whales. These are often derived from definitions by Boyd and Richerson’s work on culture in humans and animals along with evolution of symbolic markers both in theory and in humans. We agree with the reviewer that these are difficult to establish in non-humans, whales or otherwise, but feel strongly that the accumulating evidence provides strong support for the function of these signals as symbolic markers of cultural groups, and that they likely evolved from initially arbitrary calls which were a part of the vocal repertoire (similar to the process and selective environment in Efferson et al. [L1] and McElreath et al. [L2]). We feel that we do not use these terms interchangeably here, and have inherited their use from definitions from anthropology. The work presented here uses terminology built across two decades of work in cetacean, and sperm whale, culture. And do not feel that these terms should be omitted here.

      Comment 21

      Lines 21-27: Overly broad and hazy paragraph.

      We hope the replies above and our changes satisfy this comment and clarify the text.

      Comment 22

      Figure 1 legend: What are ”memory structures”? Unjustified descriptor.

      The phrase was chosen to make draw some intuition on the variation of context length in variable length markov models.

      Action - Re-worded from memory structures to statistical properties

      Comment 23

      Line 30: Omit ”finite”.

      Action - Omitted.

      Comment 24

      Line 31: Please define and distinguish ”rhythm” and ”tempo”. Also see comment above, rhythm and tempo definitions require the use of IOIs.

      We disagree with the reviewer’s claims here. In our research specifically, and for sperm whale research generally, coda inter-click intervals (ICIs) are calculated as the time between the start of the first click and the start of the subsequent click. This makes ICIs identical to inter-onset intervals (IOIs) under all definitions we are aware of. For example, Burchardt and Knornschild [L3] define IOIs as such: “In a sequence of acoustic signals, the time span between the start of an element and the next element, comprising the element duration and the following gap duration”. We now include a sentence making this point.

      Regardless, we disagree on a more fundamental level with the statement that unless researchers quantify inter-onset intervals (IOIs), they cannot make any claims about rhythm. There are many studies that investigate rhythmic aspects of human and animal vocalizations without using IOIs [L4–L7]. If the duration of sound elements of interest is relatively constant (as is the case for sperm whale clicks), then rhythm analyses can still be meaningfully conducted on inter-call intervals (the silent intervals between calls).

      For sperm whales, coda rhythm is defined by the relative ICIs standardized by their total duration. These can be clustered into discrete, defined rhythm types based on characteristic ICI patterns. Coda tempo is relative to the total duration of the coda itself. This can also be clustered into discrete tempo types across all coda durations as well (see [L8]).

      Action - We added a sentence specifying that in this case we can use both ICIs and IOIs because of the standardized length of a single click.

      Comment 25

      Line 36: Are there non-vocalized codas to require the disambiguation here?

      No, we have omitted for clarity.

      Comment 26

      Line 44: ”Higher” than which other social group class?

      Sperm whales live in a multi-level social organization. Clans are a “higher” level of social organization than the social “units” which we define in line 40. Clans are made up of all units which share similar production repertoire of codas.

      Action - We have added ’above social units’ on line 44 to make this clear.

      Comment 27

      Line 47: The use of “symbolic” continues to be enigmatic, even if authors are taking in this classification from other researchers. In signal theory (semiotics), not all biomarkers are necessarily symbols. I advise the authors to avoid the use of the term colloquially and instead adopt the definition used in the research field within which the study falls in.

      There is ample examples of the use of ”symbolic” when referring to markers of in-group membership both in human and non-human cultures.Our choice to use the term “symbolic” is based on a previous study [L9] that found quantitative evidence that sperm whale identity codas function as symbolic markers of cultural identity, at least for Pacific Ocean clans. The full reasoning behind why the authors used the term “symbolic markers” is given in that paper, but briefly, they found evidence that identity coda usage becomes more distinct as clan overlap increases, while non-identity coda usage does not change. This matches theoretical and empirical work on human symbolic markers[L1, L2, L10, L11].

      Action - We retain the use of the term here, as defined in the works cited, and based on its prior usage in the study of both human and non-human cultures.

      Comment 28

      Line 50: This statement is not technically accurate. The use of a signal as a marker by individuals can only be determined by how individuals ”interpret” and react to that signal - e.g., via playback experiments - it cannot be determined by how different populations use and produce the signals.

      We respectfully disagree. While we agree that the optimal situation would be that of playback, the contextual use can provide insight into the functional use of signals; as can expected patterns of use and variation, as was tested in the papers we cite. However, this argument is not the scope nor the synthesis of this paper. These statements are supported by existing published works, as cited, and we encourage the reviewer to take exception with those papers.

      Comment 29

      Line 69: ”Meaningful speech characteristics”??? These terms do not logically or technically follow the previous statement. Why not stay faithful to the results and state that the method used seems to be valid and reliable because it confirms former studies and methods?

      Action - Reworded to better underline the method’s results with previous studies

      Comment 30

      Lines 72-74: This statement doesn’t seem to accurately capture/explain/resume the difference between ID and non-ID codas.

      We are not sure what the reviewer is referring to in this case. The sentence in this case was meant to explain the different relations that ID/non-ID codas have with clan sympatry.

      Comment 31

      Line 75: The information provided in the few previous sentences does not allow the reader to understand why these results support the notion that cultural transmission and social learning occurs between clans.

      We conclude out introduction with a brief summary of our overall findings, which we then use the rest of the manuscript to support these statements.

      Comment 32

      Table 1: So far, the authors refer to their analyses as capturing the ”rhythm” of whale clicks. Consequently, it is not readily clear at this point why the authors rely on ”ICIs” (inter click intervals) instead of the ”universal” measure used across taxa to capture the rhythm of signal sequences - IOIs (inter onset intervals). If ICIs are the same measure as IOIs, why not use the common term, instead of creating a new term name? Alternatively, if ICIs are not equivalent to IOIs, then arguably the analyses do not capture the ”rhythm” of whale clicks, as claimed by the authors. Any rhythmic claim will need to be based on IOI measures. In animal behaviour, stereotyped is primarily used to describe pathological, dysfunctional behaviour. I suggest the use of other adjective, such as ”regular”, ”repetitive”, ”recurring”, ”predictable”. Another deviation from typical terminology: ”usage frequency” -¿ ”production rate”. Why is a clan a ”higher-order” level of social organization? This requires explanation, at least a mention, of what are the ”lower-order” levels. To the non-expert reader, there is a logical circularity/gap here: Clans are said to produce clan-specific codas, and then, it is said that codas are used to delineate clans. Either one deduces, or one infers, but not both. This raises the question, are clans confirmed by any other means than codas?

      We are not creating a “new term name”: inter-click interval (ICI) is the standard terminology used in odontocete (toothed whale) research. We take the reviewer’s point that some readers will not be coming to our paper with that background, however, and now explicitly point out that ICI is synonymous with IOI for sperm whales. Please see our response to your earlier comment for more on this point.

      Comment 33

      Line 92: Unclear term, ”sub-sequence”. Fig. 1B doesn’t seem to readily help disambiguate the meaning of the term.

      In fact reference to Fig. 1B is misplaced as it does not refer to the text. A sub-sequence is simply a contiguous subset of a coda, a subset of it.

      Action - Removed ambiguous reference to Fig. 1B

      Comment 34

      Line 94: How does the use of ”sequence” compare here with ”sub-sequence” above?

      In fact its the same situation although the previous comment highlighted a source of ambiguity.

      Action - Reworded the sentence to be less confusing.

      Comment 35

      Line 95: Signal sequences don’t ”contain” memory, they require memory for processing.

      Action - Rephrased from “sequences contain memory” to “states depend on previous sequences of varying length”.

      Comment 36

      Lines 95-97: The analogy with human language seems forced, combinatorics in any given species are expected to entail different transitions between unit/unit-sequences.

      Thank you for the comment. Indeed, the purpose of the analogy is to illustrate how variable length Markov Chains work (which have been shown to be good at discerning even accents of the same language). We used human language as an analogy to provide the readers’ with a more intuitive understanding of the results.

      Action - Revised paragraph to read: “Despite we do not have direct evidence of unitary blocks in sperm whale communication, on can imagine this effect similarly to what happens with words (e.g., a word beginning with “re” can continue in more ways than one starting with “zy”).”

      Comment 37

      Line 97: Unclear which possibility is this.

      Action - Made the wording clearer.

      Comment 38

      Line 99: Invocation of memory, although common in the use of Markov chains, in inadequate here given that the research did not study how individuals perceived or processed click sequences, only how individual produced click sequences. If the authors are referring to the cognitive load imposed by producing clicks sequences, terms such as ”sequence planning” will be more accurate.

      Here, we use the term “fixed-memory” in relation to the definition of a variable length Markov model. We feel that, in this section of the manuscript, the context is clear that it is a mathematical definition and in no way invokes the biological idea of memory or cognition. It is rather standard to use memory to describe the order of Markov chains. Swapping words in the definition of mathematical objects when the context is clear seems to cause unnecessary ambiguity.

      Action - We clarified this in the manuscript (see comments above).

      Reviewer #3 (Recommendations):

      Comment 39

      Line 16: Add ”broadly defined” as there are many other more restricted definitions (see for example Tomasello 1999; 2009). Tomasello M (1999) The cultural origins of human cognition. Harvard University Press, Cambridge Tomasello M (2009) The question of chimpanzee culture, plus postscript (chimpanzee culture 2009). In: Laland KN, Galef BG (eds) The question of animal culture. Harvard University Press, Cambridge, pp 198-221.

      Thanks for the clarification.

      Action - We added the term “broadly” and added the last reference.

      Comment 40

      Line 22: Is all stable social learned behavior that becomes idiosyncratic and ”distinguishable” considered symbolic markers? If not, consider adding ”potentially.”

      No, but the evolution of cultural groups with differing behavior can reorganize the selective environment in such a way that it can favour an in-group bias that was not initially advantageous to individuals and lead to a preference towards others who share an overt symbolic marker that initially had no meaning and a random frequency in both populations. That is to say, even randomly assigned trivial groups can evolve arbitrary symbolic markers through in-group favouritism once behavioural differences exist even in the absence of any history of rivalry, conflict, or competition between groups. See for example [L1, L2].

      Comment 41

      Table 1: Identity codas are defined as a ”Subset of coda types most frequently used by a sperm whale clan; canonically used to define vocal clans.” Therefore, I infer that an identity coda is not exclusively used by a specific clan and may be utilized by other clans, albeit less frequently. If this is the case, what criteria determine the frequency of usage for a coda to be categorized as an identity or non-identity coda? Does the criteria used to differentiate between ID and non-ID codas reflect the observed differences in micro changes between the two and within clans?

      The methods for this categorization are defined, discussed, and justified in previous work in [L9, L12]. We feel its outside the scope of this paper to review these details here in this manuscript. However, the differences between vocal styles discussed here and the frequency production repertoires which allow for the definition of identity codas are on different scales. The differences between identity and non-identity codas are not the observed differences in vocal style reported here.

      Comment 42

      Table 1: The definition of vocal style states that it ”Encodes the rhythmic variations within codas.” However, if rhythm changes, does the type of coda change as well? Typically, in musical terms, the component that maintains the structure of a rhythm is ”tempo,” not ”rhythm.” How much microvariation is acceptable to maintain the same rhythm, and when do these variations constitute a new rhythm?

      Thank you for raising this important point about the relationship between rhythmic variations and coda categorization. In our definition, ”vocal style” refers to subtle, micro-level variations in the rhythmic structure of codas that do not alter their overarching categorical identity. These microvariations are akin to ”tempo” changes in musical terms, which can modify the expression of a rhythm without fundamentally altering its structure.

      The threshold at which microvariations constitute a new rhythm, and thus a new coda type, remains an open question and is a limitation of current analytical approaches. In our study, we used established classification methods to group codas into types, treating variations within these groups as part of the same rhythm. Future work could refine these thresholds to better distinguish between meaningful rhythmic variation and the emergence of new coda types.

      Comment 43

      Table 1: Change ”say” to ”vocalize” (similarly as used in line 273 for humpback whales ”vocalizations”).

      Thanks.

      Action - Done.

      Comment 44

      Lines 33-35 and Figure 1-C: Can a lay listener discern the microvariations within each coda type by ear? Consider including sound samples of individual rhythmic microvariations for the same coda type pattern (e.g., Four plus, Palindrome, Plus One, Regular) to provide readers/listeners with an impression of their detectability. If authors considered too much or redundant Supplemental material at least give a sound sample for each the 4 subcodas modeled structures examples of 4R2 coda variations depicted in Figure 1-C so the reader can have an acoustic impression of them.

      We do not think that human listeners would be able to all of the variation detected here. However, this does not mean that it is not important variation for the whales. Human observers being able to classify call variation aurally shouldn’t be seen as a bar representing important biological variation for non-human species, given that their hearing and vocal production systems have evolved independently. Importantly, ’Four Plus’,’Palindrome’, etc are names of Clans; sympatric, but socially segregated, communities of whale families, which share a distinct vocal dialect of coda types. These clans each have have distinguishable coda dialects made up of dozens of coda types (and delineated based on identity codas), these are not names/categorical coda types themselves.

      Action - We now provide audio samples of all coda types listed in Figure 1B in the paper’s Github repository.

      Comment 45

      Line 69: As stated above, it may be confusing to refer to it as ”speech.” I suggest adding something like: ”Our method does capture one essential characteristic of human speech: phonology.” Reply 45.—Thank you for drawing our attention to this.

      Action - We removed the word “speech” from the manuscript, using “communication” and/or “vocalization” depending on the context.

      Comment 46

      Line 111-112: Consider adding a sound sample of the variation of the 4R2 coda type that can be vocalized as BCC but also as CBB as supplementary data.

      What the reviewer has correctly observed is that the traditional categorical coda type ’names’ do not capture the variation within a type by rhythm nor by tempo.

      Action - We have added samples of all coda types listed in Figure 1B in the paper’s Github repo.

      Comment 47

      Figure 3: Include a sound sample for each of the 7 coda types in Figure 1B (”specific vocal repertoires”) to illustrate the set of coda types used and their associated usage frequencies, or at least for each of the 7 coda types in Figure 3 and tables S1 and S2.

      Sperm whales in the Eastern Caribbean produce dozens of rhythm types across at least five categorical tempo types [L8, L13]. The coda types represented in Figure 1B do not demonstrate all the variability inherent in the sperm whales’ vocal dialect. Importantly, Figure 3, as well as table S1 and S2, refer to clan-level dialects not specific individual coda types.

      Action - We added sound samples for each coda rhythm type listed in Figure 1B to the Github repository.

      Comment 48

      Lines 184-190: It is unclear what human analogy term is used for ID codas. This needs clarification.

      We are not making an analogy in humans for the role of ID vs non-ID codas, but only providing the example of accents as changes in vocalization (style) without a change in the actual words used (repertoire).

      Action - We tried to make it clearer in the manuscript.

      Comment 49

      Line 190: Change ”whale speech” to ”whale vocalizations.”

      Thanks.

      Action - Done.

      Comment 50

      Figure 4: Correct citation number Hersh ”10” to Hersh ”11.”

      Thanks.

      Action - Fixed the reference.

      Comment 51

      Lines 224-232: Clarify whether the reference to how spatial overlap affects the frequency of ID codas refers to shared ID codas between clans or the production frequency of each coda within the total repertoire of codas.

      The similarity between ID coda repertoires we are referring to there is based on the ID codas of both clans.

      More details on the comparison can be found in [L9].

      Action - We added a sentence explaining the comparison is made using the joint set of ID codas.

      Comment 52

      Lines 240-241: What are non-ID codas vocal cues for?

      Non-ID codas likely serve as flexible, context-dependent signals that facilitate group coordination, convey environmental or social context, and promote social learning, especially in mixed-clan or overlapping habitats. Their variability suggests multifunctional roles shaped by ecological and social pressures.

      Comment 53

      Lines 267-268: It’s unclear whether non-ID coda vocal styles are genetically inherited or not, as argued in lines 257-258.

      We did not intend to argue that non-ID coda vocal styles are genetically inherited. Instead, we aimed to present a hypothetical consideration: if non-ID coda vocal styles were genetically inherited, one would expect a direct correlation between vocal style similarity and genetic relatedness. This hypothetical framework was introduced to strengthen our argument that the observed patterns are unlikely to be explained by genetic inheritance, as such correlations have not been observed. While we acknowledge that we lack definitive proof to rule out genetic influences entirely, the evidence available strongly suggests that social learning, rather than genetic transmission, is the more plausible mechanism.

      Action - Clarified in manuscript.

      Comment 54

      Line 277: Can males mate with females from different clans?

      Yes, genetic evidence shows that males may even switch ocean basins.

      Action - We have clarified that we mean the female members of units from different clans have only rarely been observed to interact at sea between clans.

      Comment 55

      Lines 287-292: Consider discussing the difference between controlled/voluntary and automatic/involuntary imitation and their implications for cultural selection and social learning (see Heyes 2011; 2012). Heyes, C. (2011). Automatic imitation. Psychological bulletin, 137(3), 463. Heyes, C. (2012). What’s social about social learning?. Journal of comparative psychology, 126(2), 193.

      Thank you for your insightful comment regarding this. The distinction between controlled/voluntary and automatic/involuntary imitation, as highlighted by Heyes [L14, L15], provides a potentially valuable framework for interpreting social learning mechanisms in sperm whales. Automatic imitation refers to reflexive, often unconscious mimicry driven by perceptual or motor coupling, while controlled imitation involves deliberate and goal-directed efforts to replicate behaviors. Both forms likely play complementary roles in the cultural transmission observed in sperm whales.

      This dual-process perspective highlights the potential for cultural selection to act at different levels. Automatic imitation may drive convergence in shared environments, promoting acoustic homogeneity and facilitating inter-clan communication. In contrast, controlled imitation ensures the preservation of clan-specific vocal traditions, maintaining cultural diversity. This interplay between automatic and controlled processes could reflect a balancing act between cultural assimilation and differentiation, underscoring the adaptive value of these mechanisms in dynamic social and ecological contexts.

      Action - We have incorporated a short discussion of this distinction and its implications for our findings in the Discussion. Additionally, we have cited [L14, L15] to provide theoretical grounding for this interpretation.

      Comment 56

      Methods: Consider integrating the paragraph from lines 319-321 into lines 28-35 and eliminate redundant information.

      Thanks.

      Action - We implemented the suggestion, removing the first paragraph of the Dataset description and integrating the information when we introduce the concepts of codas and clicks.

      [L1] C. Efferson, R. Lalive, and E. Fehr, Science 321, 1844 (2008).

      [L2] R. McElreath, R. Boyd, and P. Richerson, Curr. Anthropol. 44, 122 (2003).

      [L3] L. S. Burchardt and M. Knornschild, PLoS Computational Biology 16, e1007755 (2020).

      [L4] A. Ravignani and K. de Reus, Evolutionary Bioinformatics 15, 1176934318823558 (2019).

      [L5] C. T. Kello, S. D. Bella, B. Med´ e, and R. Balasubramaniam, Journal of the Royal Society Interface 14, 20170231 (2017).

      [L6] D. Gerhard, Canadian Acoustics 31, 22 (2003).

      [L7] N. Mathevon, C. Casey, C. Reichmuth, and I. Charrier, Current Biology 27, 2352 (2017).

      [L8] P. Sharma, S. Gero, R. Payne, D. F. Gruber, D. Rus, A. Torralba, and J. Andreas, Nature Communications 15, 3617 (2024).

      [L9] T. A. Hersh, S. Gero, L. Rendell, M. Cantor, L. Weilgart, M. Amano, S. M. Dawson, E. Slooten, C. M. Johnson, I. Kerr, et al., Proc. Natl. Acad. Sci. 119, e2201692119 (2022).

      [L10] R. Boyd and P. J. Richerson, Cult Anthropol 2, 65 (1987). [L11] E. Cohen, Curr. Anthropol. 53, 588 (2012).

      [L12] T. A. Hersh, S. Gero, L. Rendell, and H. Whitehead, Methods Ecol. Evol. 12, 1668 (2021), ISSN 2041-210X, 2041-210X.

      [L13] S. Gero, A. Bøttcher, H. Whitehead, and P. T. Madsen, R. Soc. Open Sci. 3, 160061 (2016).

      [L14] C. Heyes, Psychological Bulletin 137, 463 (2011).

      [L15] C. Heyes, Journal of Comparative Psychology 126, 193 (2012).

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 Evidence, reproducibility and clarity Summary: Bhatt et al. seek to define factors that influence H3.3 incorporation in the embryo. They test various hypotheses, pinpointing the nuclear/cytoplasmic ratio and Chk1, which affects cell cycle state, as influencers. The authors use a variety of clever Drosophila genetic manipulations in this comprehensive study. The data are presented well and conclusions reasonably drawn and not overblown. I have only minor comments to improve readability and clarity. I suggest two OPTIONAL experiments below. We thank the reviewer for their positive and helpful comments. Major comments: We found this manuscript well written and experimentally thorough, and the data are meticulously presented. We have one modification that we feel is essential to reader understanding and one experimental concern: The authors provide the photobleaching details in the methodology, but given how integral this measurement is to the conclusions of the paper, we feel that this should be addressed in clear prose in the body of the text. The authors explain briefly how nuclear export is assayed, but not import (line 99). Would help tremendously to clarify the methods here. This is especially important as import is again measured in Fig 4. This should also be clarified (also in the main body and not solely in the methods). We have added the following sentences to the main body of the text to clarify how photobleaching and import were assayed. “We note that these differences are not due to photobleaching as our measurements on imaged and unimaged embryos indicate that photobleaching is negligible under our experimental conditions (see methods, Figure S1G-H)” lines 98-101 and “Since nuclear export is effectively zero, we attribute the increase in total H3.3 over time solely to import and therefore the slope of total H3.3 over time corresponds to the import rate.” lines 111-113 Revision Plan In addition we have clarified how import was calculated to figure legends in Figure 5D (formerly 4D) and S1F which now read: “Initial slopes of nuclear import curves (change in total nuclear intensity over time for the first 5 timepoints) …” We also added the following explanation of how nuclear import rates were calculated to the methods section: “Import rates were calculated by using a linear regression for the total nuclear intensity over time for the first 5 timepoints in the nuclear import curves.” lines 471-473, methods If the embryos appeared "reasonably healthy" (line 113) after slbp RNAi, how do the authors know that the RNAi was effective, especially in THESE embryos, given siblings had clear and drastic phenotype? This is especially critical given that the authors find no effect on H3.3 incorporation after slbp RNAi (and presumably H3 reduction), but this result would also be observed if the slbp RNAi was just not effective in these embryos. We apologize for the confusion caused by our word choice. The “healthy” slbp-RNAi embryos had measurable phenotypes consistent with histone depletion that we have reported previously (Chari et al, 2019) including cell cycle elongation and early cell cycle arrest (Figure S4D). However, they did not have the catastrophic mitosis observed in more severely affected embryos. We agree with the reviewer that a concern of this experiment is that the less severely affected embryos likely have more remaining RD histones including H3. To address this we also tested H3.3 incorporation in the embryos that fail to progress to later cell cycles in the cycles that we could measure. Even in these more severely affected embryos we were not able to detect a change in H3.3 incorporation relative to controls (lines 240-243 and Fig S4B). Unfortunately, it is impossible to conduct the ideal experiment, which would be a complete removal of H3 since this is incompatible with oogenesis and embryo survival. To address this confusion we have added supplemental videos of control, moderately affected and severely affected SLBP-RNAi embryos as movies 3-5 and modified the text to read: “All embryos that survive through at least NC12, had elongated cell cycles in NC12 and 60% arrested in NC13 as reported previously indicating the effectiveness of the knockdown (Figure S4C, Movie 3-5)39. In these embryos, H3.3 incorporation is largely unaffected by the reduction in RD H3 (Figure 6B).” lines 236-240 Finally, to characterize the range of SLBP knockdown in the RNAi embryos we propose to do single embryo RT-qPCRs for SLBP mRNA for multiple individual embryos. This will provide a measure of the range knockdown that we observed in our H3.3 movies. Minor comments: Introduction: Revision Plan Consider using "replication dependent" (RD) rather than "replication coupled." Both are used in the field, but RD parallels RI ("replication independent"). We thank the reviewer for this suggestion. We have made the text edits to change "replication coupled" (RC) to "replication dependent" (RD) throughout the manuscript. Would help for clarity if the authors noted that H3 is equivalent to H3.2 in Drosophila. Also it is relevant that there are two H3.3 loci as the authors knock mutations into the H3.3A locus, but leave the H3.3B locus intact. The authors should clarify that there are two H3.3 genes in the Drosophila genome. We have changed the text as follows to increase clarity as suggested: “Similarly, we have previously shown that RD H3.2 (hereafter referred to as H3) is replaced by RI H3.3 during these same cycles, though the cause remains unclear29” lines 52-54 “There are ~100 copies of H3 in the Drosophila genome, but only 2 of H3.3 (H3.3A and H3.3B)26. To determine which factor controls nuclear availability and chromatin incorporation, we genetically engineered flies to express Dendra2-tagged H3/H3.3 chimeras at the endogenous H3.3A locus, keeping the H3.3B locus intact.” lines 127-131 Please add information and citation (line 58): H3.3 is required to complete development when H3.2 copy number is reduced (PMID: 37279945, McPherson et al. 2023) We have added the suggested information. The text now reads “Nonetheless, H3.3 is required to complete development when H3.2 copy number is reduced54.” lines 61-62 Results: Embryo genotype is unclear (line 147): Hira[ssm] haploid embryos inherit the Hira mutation maternally? Are Hira homozygous mothers crossed to homozygous fathers to generate these embryos, or are mothers heterozygous? This detail should be in the main text for clarity. The Hira mutants are maternal effect. We crossed homozygous Hirassm females to their hemizygous Hirassm or FM7C brothers. However, the genotype of the male is irrelevant since the Hira phenotype prevents sperm pronuclear fusion and therefore there is no paternal contribution to the embryonic genotype. We have clarified this point in the text: “We generated embryos lacking functional maternal Hira using Hirassm-185b (hereafter Hirassm) homozygous mothers which have a point mutation in the Hira locus57.” lines 160-162 Revision Plan Line 161: Shkl affects nuclear density, but it also appears from Fig 3 to affect nuclear size? The authors do not address this, but it should at least be mentioned. We thank the reviewer for the astute observation. More dense regions of the Shkl embryos do in fact have smaller nuclei. We believe that this is a direct result of the increased N/C ratio since nuclear size also falls during normal development as the N/C ratio increases. We have added a new figure 1 in which we more carefully describe the events of early embryogenesis in flies including a quantification of nuclear size and number in the pre-ZGA cell cycles (Figure 1C). We also note the correlation of nuclear size with nuclear density in the text: “During the pre-ZGA cycles (NC10-13), the maximum volume that each nucleus attains decreases in response to the doubling number of nuclei with each division (Figure 1C).” lines 86-87 “To test this, we employed mutants in the gene Shackleton (shkl) whose embryos have non-uniform nuclear densities and therefore a gradient of nuclear sizes across the anterior/posterior axis (Figure 3A-B, Movie 1-2)58.” lines 180-183 The authors often describe nuclear H3/H3.3 as chromatin incorporated, but these image-based methods do not distinguish between chromatin-incorporated and nuclear protein. To distinguish between chromatin incorporated and nuclear free histone we have exploited the fact that histones that are not incorporated into DNA freely diffuse away from the chromatin mass during mitosis while those that are bound into nucleosomes remain on chromatin during this time. In our previous study we showed that H3-Dendra2 that is photoconverted during mitosis remains stably associated with the mitotic chromatin through multiple cell cycles (Shindo and Amodeo, 2019) strengthening our use of this metric. To help clarify this point as well as other methodological details we have added a new Figure 1B which documents the time points at which we make various measurements within the lifecycle of the nucleus. We also edited the text to read: “We have previously shown that with each NC, the pool of free H3 in the nucleus is depleted and its levels on chromatin during mitosis decrease (Figure 1D, S1C-D)29. In contrast, H3.3 mitotic chromatin levels increase during the same cycles (Figure 1D, S1C-D)29.” lines 89-92 I very much appreciate how the authors laid out their model in Fig 3 and then used the same figure to explain which part of the model they are testing in Figs 4 and 5. This is not a critique- we can complement too! Thank you! Revision Plan OPTIONAL experimental suggestion: The experiments in Figure 4 and 5 are clever. One would expect that H3 levels might exhaust faster in embryos lacking all H3.2 histone genes (Gunesdogan, 2010, PMID: 20814422), allowing a comparison testing the H3 availability > H3.3 incorporation portion of the hypothesis without manipulating the N/C ratio. This might also result in a more consistent system than slbp RNAi (below). We thank the reviewer for the experimental suggestion. We also considered this experimental manipulation to decrease RD histone H3.2. We chose not to do this experiment because in the Gunesdogan paper they show that the zygotic HisC nulls have normal development until after NC14 (unlike the maternal SLBP-RNAi that we used) suggesting that maternal H3.2 supplies do not become limiting until after the stages under consideration in our paper. Maternal HisC-nulls are, of course, impossible to generate since histones are essential. O'Haren 2024 (PMID: 39661467) did not find increased Pol II at the HLB after zelda RNAi (line 227). Might also want to mention here that zelda RNAi does not result in changes to H3 at the mRNA level (O'Haren 2024), as that would confound the model. We thank the reviewer for the suggestion. We have removed the discussion of Pol II localization and replaced it with the information about histone mRNA : “zelda controls the transcription of the majority of Pol II genes during ZGA but disruption of zelda does not change RD histone mRNA levels67–70”. lines 249-251 Discussion: Should discuss results in context of McPherson et al. 2023 (PMID: 37279945), who showed that decreasing H3.2 gene numbers does not increase H3.3 production at the mRNA or protein levels. We expanded our discussion to include the following: “Given the fact that H3.3 pool size does not respond to H3 copy number in other Drosophila tissues,54 our results suggest that H3.3 incorporation dynamics are likely independent of H3 availability.” lines 278-280 The Shackleton mutation is a clever way to alter N/C ratio, but the authors should point out that it is difficult (impossible?) to directly and cleanly manipulate the N/C ratio. For example, Shkl mutants seem to also have various nuclear sizes. As discussed above, we think that nuclear size is a direct response to the N/C ratio. We have added the following sentence to the discussion as well as a citation to a paper which discusses how the N/C ratio might contribute to nuclear import in early embryos to the discussion: “This may be due to N/C ratio-dependent changes in nuclear import dynamics which may also contribute to the observed changes in nuclear size across the shkl embryo75.” lines 307-309 Revision Plan How is H3.3 expression controlled? Is it possible that H3.3 biosynthesis is affected in Chk1 mutants? To address this question we propose to perform RT-qPCR for H3.3A and H3.3B as well as Hira in the Chk1 mutant. Unfortunately, we do not have antibodies that reliably distinguish between H3 and H3.3 in our hands (despite literature reports), but we will also perform a pan-H3 immunostaining in the Chk1 embryos to measure how the total H3-type histone pool changes as a result of the loss of Chk1. Figures: While I appreciate the statistical summaries in tables, it is still helpful to display standard significance on the figures themselves. We have added statistical comparisons in Figure 3 (formerly Figure 2). We do not feel that it is appropriate to directly compare the intensities of the H3-Dendra2 construct expressed from the pseudo-endogenous locus to the H3.3 and chimeric proteins expressed from the H3.3A locus as they were imaged using different settings. Although we plot H3 on the same graph as the other proteins to allow for ease of comparison of their trends over time it is not appropriate to directly compare their normalized intensities which including statistical tests would encourage. We have added a note to the legend of Figure 1 explaining this which reads: “Note that statistical comparisons between the two Dendra2 constructs have not been done as they were expressed from different loci and imaged under different experimental settings.” Fig 1: A: Is it possible to label panels with the nuclear cycle? We have done this. B: Statistics required - caption suggests statistics are in Table S2, but why not put on graph? Please see the explanation above for why we do not feel that it is appropriate to perform this comparison. C/D: Would be helpful if authors could plot H3/H3.3 on same graph because what we really need to compare is NC13 between H3/H3.3 (and statistics between these curves) Please see the explanation above for why we do not feel that it is appropriate to perform this comparison. These curves can be directly compared within a construct and we can evaluate their trends over time, but the normalized values should not be directly compared in the way that would be encouraged by plotting the data as suggested. E: The comparison in the text is between H3.3 and H3, but only H3.3 data is shown. I realize that it is published prior, but the comparison in figure would be helpful. We have added the previously published values to the text. Revision Plan “These changes in nuclear import and incorporation result in a less complete loss of the free nuclear H3.3 pool (~70% free in NC11 to ~30% in NC13) than previously seen for H3 (~55% free in NC11 to ~20% in NC13)” lines 116-119 Fig 2: A: A very helpful figure. Slightly unclear that the H3 that is not Dendra tagged is at the H3.3 locus. Also unclear that the H3.3A-Dendra2 line exists and used as control, as is not shown in figure. Should show H3 and H3.3 controls (Figure S2) We have edited the figure to add Dendra2 to all of the constructs and made clear the location of each construct including adding the landing site for H3-Dendra2. We have also cited Figure S1 in the legend which contains a more detailed diagram of the integration strategy. F/H- As the comparison is between H3 and ASVM, it would help to combine these data onto the same graph. As the color is currently used unnecessarily to represent nuclear cycle, the authors could use their purple/pink color coding to represent H3/ASVM. We have combined these data onto a single graph as requested and changed the colors appropriately. We have not added statistical comparisons to this graph as we again believe that they would be inappropriate. In the legend of Fig 2 the authors write "in the absence of Hira." Technically, there is only a point mutation in Hira. It is not absent. Good catch! We have changed this to “in Hirassm mutants”. Fig 3: G: Please show WT for comparison. Can use data in Fig 3A. We have added the color-coded number of neighbor embryo representations for WT and Shkl embryos underneath the example embryo images in 4A-B (formerly 3A-B,G). Model in H is very helpful (complement)! Thank you. Fig 4: B/C/F/G: The authors use a point size scale to represent the number of nuclei, but the graphs are so overlaid that it is not particularly useful. Is there a better way to display this dimension? We chose to represent the data in this way so that the visual impact of each line is representative of the amount of data (number of nuclei in each bin) that underlies it. This helps to prevent sparsely populated outlier bins at the edges of the distribution from dominating the interpretation of the data. If the reviewer has a suggestion for a better way to visualize this information we would welcome their suggestion, but we cannot think of a better way at this time. D/E/H/I: What does "min volume" mean on the X axis? Since the uneven N/C ratio in the shkl embryos results in a wavy cell cycle pattern there is no single time point where we can calculate the number of neighbors for the whole embryo (since Revision Plan not all nuclei are in the same cell cycle at a given point). Therefore, we had to choose a criterion for when we would calculate the number of neighbors for each nucleus. We chose nuclear size as a proxy for nuclear age since nuclear size increases throughout interphase (see new figure 1B). So, the minimum volume is the newly formed nucleus in a given cell cycle. We also tested other timepoints for the number of neighbors (maximum nuclear volume, just before nuclear envelope breakdown and midway between these two points) and found similar results. We chose to use minimum volume in this paper because this is the time point when the nucleus is growing most quickly and nuclear import is at its highest. We have added the following explanation to the methods: “For shkl embryos, as the nuclear cycles are asynchronous, nuclear divisions start at different timepoints within the same cell cycle and the nuclear density changes as the neighboring nuclei divide. Therefore, the total intensity traces were aligned to match their minimum volumes (as shown in Figure 1B) to T0.” lines 485-488, methods And the following detail to the figure legend: “...plotted by the number of nuclear neighbors at their minimum nuclear volume…” Figure 5 legend We also added a depiction of the lifecycle of the nucleus in which we marked the minimum volume as the new Figure 1B. Fig 5: F: OPTIONAL Experimental request: Here I would like to see H3 as a control. This is a very good suggestion, and we are currently imaging H3-Dendra2 in the Chk1 background. However, our preliminary results suggest that there may be some synthetic early lethality between the tagged H3-Dendra2 and Chk1 since these embryos are much less healthy than H3.3-Dendra2 Chk1 embryos or Chk1 with other reporters. In addition, we have observed a much higher level of background fluorescence in this cross than in the H3-Dendra2 control. We are uncertain if we will be able to obtain usable data from this experiment, but will continue to try to find conditions that allow us to analyze this data. As an orthogonal approach to answer the question, we will perform immunostaining with a pan-H3 antibody in Chk1 mutant embryos to measure total H3 levels under these conditions. Since the majority of H3-type histone is H3.2 and we know how H3.3 changes, this staining will give us insight into the dynamics of H3 in Chk1 mutant embryos. Significance General assessment: Many long-standing mysteries surround zygotic genome activation, and here the authors tackle one: what are the signals to remodel the zygotic chromatin around ZGA? This is a tricky question to answer, as basically all manipulations done to the embryo Revision Plan have widespread effects on gene expression in general, confounding any conclusions. The authors use clever novel techniques to address the question. Using photoconvertible H3 and H3.3, they can compare the nuclear dynamics of these proteins after embryo manipulation. Their model is thorough and they address most aspects of it. The hurdle this study struggles to overcome is the same that all ZGA studies have, which is that manipulation of the embryo causes cascading disasters (for example, one cannot manipulate the nuclear:cytoplasmic ratio without also altering cell cycle timing), so it's challenging to attribute molecular phenotypes to a single cause. This doesn't diminish the utility of the study. Advance: The conceptual advance of this study is that it implicates the nuclear:cytoplasmic ratio and Chk1 in H3.3 incorporation. The authors suggest these factors influence cell cycle closing, which then affects H3.3 incorporation, although directly testing the granularity of this model is beyond the scope of the study. The authors also provide technical advancement in their use of measuring histone dynamics and using changes in the dynamics upon treatment as a useful readout. I envision this strategy (and the dendra transgenes) to be broadly useful in the cell cycle and developmental fields. Audience: The basic research presented in this study will likely attract colleagues from the cell cycle and embryogenesis fields. It has broader implications beyond Drosophila and even zygotic genome activation. This reviewer's expertise: Chromatin, Drosophila, Gene Regulation Reviewer #2 (Evidence, reproducibility and clarity (Required)): This manuscript investigates the regulation of H3.3 incorporation during zygotic genome activation (ZGA) in Drosophila, proposing that the nuclear-to-cytoplasmic (N/C) ratio plays a central role in this process. While the study is conceptually interesting, several concerns arise regarding the lack of proper control experiments and the clarity of the writing. The manuscript is difficult to follow due to vague descriptions, insufficient distinctions between established knowledge and novel findings, and a lack of rigorous statistical analyses. These issues need to be addressed before the study can be considered for publication. We thank the reviewers for their careful reading of this manuscript. We have sought to clarify the concerns regarding clarity through numerous text edits detailed below. We did include ANOVA analysis for all of the relevant statistical comparisons in the supplemental table. However, to increase clarity we have also added some statistical comparisons in the main figures. We note that we do not feel that it is appropriate to directly compare the intensities of the H3-Dendra2 construct expressed from the pseudo-endogenous locus to the H3.3 and chimeric proteins expressed from the H3.3A locus as they were imaged using different settings. Although we plot H3 on the same graph as the other proteins to allow for ease of comparison of their trends over time it is not appropriate to directly compare their normalized intensities which including statistical tests would encourage. We have added a note to the legend of the new Figure 1 Revision Plan explaining this which reads: “Note that statistical comparisons between the two Dendra2 constructs have not been done as they were expressed from different loci and imaged under different experimental settings.” Major Concerns The manuscript would benefit from a clearer introduction that explicitly distinguishes between previously known mechanisms of histone regulation during ZGA and the novel contributions of this study. Currently, the introduction lacks sufficient background on early embryonic chromatin regulation, making it difficult for readers unfamiliar with the field to grasp the significance of the findings. The authors should also be more precise when discussing the timing of ZGA. While they state that ZGA occurs after 13 nuclear divisions, it is well established that a minor wave of ZGA begins at nuclear cycle 7-8, whereas the major wave occurs after cycle 13. Clarifying this distinction will improve the manuscript's accessibility to a broader audience. We have added a new figure 1 to make the timing and nuclear behaviors of the embryo during ZGA in Drosophila more clear. We have also added information about how the chromatin changes during Drosophila ZGA in the following sentence: “ In Drosophila, these changes include refinement of nucleosomal positioning, partitioning of euchromatin and heterochromatin and formation of topologically associated domains20–22,24.” lines 39-41 We have clarified the major and minor waves of ZGA in the introduction and results by adding the following sentences to the introduction and results respectively: “In most organisms ZGA happens in multiple waves but the chromatin undergoes extensive remodeling to facilitate bulk transcription during the major wave of ZGA (hereafter referred to as ZGA)18–20,22–25..” lines 36-39 “In Drosophila, ZGA occurs in 2 waves. The minor wave starts as early as the 7th cycle, while major ZGA occurs after 13 rapid syncytial nuclear cycles (NCs) and is accompanied by cell cycle slowing and cellularization (Figure 1A-B).” lines 83-85 We hope that these changes help to reduce confusion and make the paper more accessible. However, we are happy to add additional information if the reviewer can provide specific points which require further attention. One of the primary weaknesses of this study is the lack of adequate control experiments. In Figure 1, the authors suggest that the levels of H3 and H3.3 are influenced by the N/C ratio, but Revision Plan it is unclear whether transcription itself plays a role in these dynamics. To properly test this, RNA-seq or Western blot analyses should be performed at nuclear cycles 10 and 13-14 to compare the levels of newly transcribed H3 or H3.3 against maternally supplied histones. Without such data, the authors cannot rule out transcriptional regulation as a contributing factor. In the pre-ZGA cell cycles the vast majority of protein including histones is maternally loaded. Gunesdogan et al. (2010) showed that the zygotic RD histone cluster nulls survive past NC14 (well past ZGA) with no discernible defects indicating that maternal RD histone supplies are sufficient for normal development during the cell cycles under consideration. Therefore, new transcription of replication coupled histones is not needed for apparently normal development during this period. Moreover, we have done the western blot analysis using a Pan-H3 antibody as suggested by the reviewer in our previously published paper (Shindo and Amodeo, 2019 supplemental figure S3A-B) and found that total H3-type histone proteins only increase moderately during this period of development, nowhere near the rate of the nuclear doublings. We have added the following sentence to clarify this point. “These divisions are driven by maternally provided components and the total amount of H3 type histones do not keep up with the pace of new DNA produced29.” lines 88-89 We have also previously done RNA-seq on wild-type embryos (and those with altered maternal histone levels) (Chari et al 2019). In this RNA-seq (like most RNA-seq in flies) we used poly-A selection and therefore cannot detect the RD histone mRNAs (which have a stem-loop instead of a poly-A tail). We have plotted the mRNA concentrations for both H3.3 variants from that dataset below for the reviewers reference (we have not included this in the revised manuscript). The total H3.3 mRNA levels are nearly constant from egg laying (NC0- these are from unfertilized embryos) until after ZGA (NC14). These data combined with the westerns discussed above give us confidence that what we are observing is the partitioning of large pools of maternally provided histones with only a relatively small contribution of new histone synthesis. Revision Plan In Figure 2, the manuscript introduces chimeric embryos expressing modified histone variants, but their developmental viability is not addressed. It is essential to determine whether these embryos survive and whether they exhibit any phenotypic consequences such as altered hatching rates, defects in nuclear division, or developmental arrest. Tagging histones is often deleterious to organismal health. In Drosophila there are two H3.3 loci (H3.3A and H3.3B). In all of our chimera experiments we have left the H3.3B and one copy of the H3.3A locus unperturbed to provide a supply of untagged H3.3. This allows us to study H3.3 and chimera dynamics without compromising organism health. All of our chimeras are viable and fertile with no obvious morphological defects. We have added the following sentences to the text to clarify this point: “There are ~100 copies of H3 in the Drosophila genome, but only 2 of H3.3 (H3.3A and H3.3B)26. To determine which factor controls nuclear availability and chromatin incorporation, we genetically engineered flies to express Dendra2-tagged H3/H3.3 chimeras at the endogenous H3.3A locus, keeping the H3.3B locus intact….These chimeras were all viable and fertile. ” lines 127-131, 136 In addition we propose performing hatch rate assays for embryos from the chimeric embryos of S31A, SVM and ASVM to assess if there is any decrease in fecundity due to the presence of the chimeras. Moreover, given that H3.3 is associated with actively transcribed genes, an RNA-seq analysis of chimeric embryos should be included to assess transcriptional changes linked to H3.3 incorporation. This is an excellent suggestion and will definitely be a future project for the lab. However, to do this experiment correctly we will need to generate untagged chimeric lines that will (hopefully) allow for the full replacement of H3.3 with the chimeric histones instead of a single copy among 4. This is beyond the scope of this paper. Figures 3 and 4 raise additional concerns about whether histone cluster transcription is altered in shkl mutant embryos. The authors propose that the shkl mutation affects the N/C ratio, yet it remains unclear whether this leads to changes in the transcription of histone clusters. Furthermore, since HIRA is a key chaperone for H3.3, it would be important to assess whether its levels or function are compromised in shkl mutants. To address these gaps, RT-qPCR or RNA-seq should be performed to quantify histone cluster transcription, and Western blot analysis should be used to determine if HIRA protein levels are affected. The changes in the N/C ratio that are observed in the shkl mutant are within SINGLE embryo (differences in nuclear spacing). In these experiments we are comparing nuclei within a common cytoplasm that have different local nuclear densities (N/C ratios). Therefore, if Shkl Revision Plan were somehow affecting the transcription of histones or their chaperones we would expect all of the nuclei within the same mutant embryo to be equally affected since they are genetically identical and share a common cytoplasm. We do not directly compare the behavior of shkl embryos to wildtype except to demonstrate that there is no positional effect on the import of H3 and H3.3 across the length of the embryo in wildtype. To clarify our experimental system for these experiments we have added additional panels to Figure 4A and B that depict the number of neighbors for both control and Shkl embryos. Nonetheless, to address the reviewer’s concern that shkl may change the amount of H3 present in the embryo, we propose to conduct a western blot comparison of wildtype and shkl embryos using a pan-H3 antibody. There are no tools (antibodies or fluorescently tagged proteins) to assess HIRA protein levels in Drosophila. We therefore propose to perform RT-qPCR for HIRA in wildtype and shkl embryos. A similar issue arises in Figure 5, where the authors claim that H3.3 incorporation is dependent on cell cycle state but do not sufficiently test whether this is linked to changes in HIRA levels. Given the importance of HIRA in H3.3 deposition, its levels should be examined in Slbp, Zelda, and Chk1 RNAi embryos to verify whether changes in H3.3 incorporation correlate with HIRA function. Without this, it is difficult to conclude that the observed effects are strictly due to cell cycle regulation rather than histone chaperone dynamics. Since H3.3 incorporation is unaffected in the Slbp and Zelda-RNAi lines there is no reason to suspect a change in HIRA function. There are no available tools (antibodies or fluorescently tagged proteins) to directly measure HIRA protein in Drosophila. To test if changes in HIRA loading might contribute to the decreased H3.3 incorporation in the Chk1 mutant we propose to perform RT-qPCR for HIRA in wildtype and Chk1 embryos. Several figures require additional statistical analyses to support the claims made. In Figure 1B, statistical testing should be included to validate the reported differences. Figure 1C-D states that "H3.3 accumulation reduces more slowly than H3," yet there is no quantitative comparison to substantiate this claim. Similarly, Figure 1E presents the conclusion that "These changes in nuclear import and incorporation result in a less dramatic loss of the free nuclear H3.3 pool than previously seen for H3," despite the fact that H3 data are not included in this figure. The conclusions drawn from these data need to be supported with appropriate statistical comparisons and more precise descriptions of what is being measured. For Figure 1B (now 2B) we do not feel that it is appropriate to directly compare the intensities of the H3-Dendra2 construct expressed from the pseudo-endogenous locus to the H3.3 and chimeric proteins expressed from the H3.3A locus as they were imaged using different settings and therefore we do not feel that direct statistical tests are appropriate. Rather, we plot the two histones on the same graph normalized to their own NC10 values so that the trend in their decrease over time may be compared. The statistical tests for H3.3 compared to the chimeras which were originally in the supplemental table have been added to Figure 3 (formerly figure 2). Revision Plan It is important to note that in this directly comparable situation the ASVM mutant (whose trends closely mirror H3) is highly statistically distinct from H3.3. We have added a note to the legend of the new Figure 1 explaining this which reads: “Note that statistical comparisons between the two Dendra2 constructs have not been done as they were expressed from different loci and imaged under different experimental settings.” For Figure 1C-D (now 2C-D) we have removed this claim from the text. We were referring to the plateau in nuclear import for H3 that is less dramatic in H3.3, but this is more carefully discussed in the next paragraph and its addition at that point generated confusion. The text now reads: “To further assess how nuclear uptake dynamics changed during these cycles, we tracked total nuclear H3 and H3.3 in each cycle (Figure 2C-D). Since nuclear export is effectively zero, we attribute the increase in total H3.3 over time solely to import and therefore the slope of total H3.3 over time corresponds to the import rate. Though the change in initial import rates between NC10 and NC13 are similar between the two histones (Figure S1F), we observed a notable difference in their behavior in NC13. H3 nuclear accumulation plateaus ~5 minutes into NC13, whereas H3.3 nuclear accumulation merely slows (Figure 2C-D).” lines 109-116 For Figure 1E (now 2E), to address the difference between H3 and H3.3 free pools we have added the previously published values to the text and changed the phrasing from “less dramatic” to “less complete”. The sentence now reads: “These changes in nuclear import and incorporation result in a less complete loss of the free nuclear H3.3 pool (~70% free in NC11 to ~30% in NC13) than previously seen for H3 (~55% free in NC11 to ~20% in NC13)” lines 116-119 Figure 2 presents additional concerns regarding data interpretation. The comparisons between H3.3 and H3.3S31A to H3 and H3.3SVM/ASVM lack statistical analysis, making it difficult to determine the significance of the observed differences. As discussed above, it is not appropriate to directly compare H3 to H3.3 and the chimeras at the H3.3A locus since they are expressed from different promoters and imaged with different settings. The ANOVA comparisons between all of the constructs in the H3.3A locus can be found in the supplemental table. We have also added the statistical significance between each chimera and H3.3 within a cell cycle to the figure. Including the full set of comparisons for all genotypes and timepoints makes the figure nearly impossible to interpret, but they remain available in the supplemental table. Revision Plan The disappearance of H3.3 from mitotic chromosomes in Figure 2E is also not explained. If this phenomenon is functionally relevant, the authors should provide a mechanistic interpretation, or at the very least, discuss potential explanations in the text. In Figures 2F-H, the reasoning behind comparing the nuclear intensity of H3.3 to H3 in Hira mutants is unclear. To properly assess the role of HIRA in H3.3 chromatin accumulation, a more appropriate comparison would be between wild-type H3.3 and H3.3 levels in Hira knockdown embryos. As explained in the text and depicted in Figure 3D (formerly 2D), the HIRAssm mutant is a point mutation that prevents observable H3.3 chromatin incorporation, but not nuclear import. This is what is depicted in Figure 3E (formerly 2E). The loss of H3.3 from mitotic chromatin is due to the inability to incorporate H3.3 into chromatin as expected for a HIRA mutant. We have edited the figure 3 legend to make this more clear. It now reads: “Hirassm mutation nearly abolishes the observable H3.3 on mitotic chromatin (E).” In Figure 3F (formerly 2F-H) we ask what happens to H3 chromatin incorporation when there is almost no incorporation of H3.3 due to the HIRA mutation. In this mutant there is so little H3.3 incorporation that we cannot quantify H3.3 levels on mitotic chromatin (see the new Figure 1B for the stage where chromatin levels are quantified). This experiment was done to test if H3.3ASVM (expressed at the H3.3A locus) is incorporated into chromatin in embryos lacking the function of H3.3’s canonical chaperone. We have edited the text to make this more clear: “Since the chromatin incorporation of the H3/H3.3 chimeras appears to depend on their chaperone binding sites, we asked if impairing the canonical H3.3 chaperone, Hira, would affect the incorporation of H3.3ASVMexpressed from the H3.3A locus.”lines 158-160 A broader concern is that the authors only test HIRA as a histone chaperone but do not consider alternative chaperones that could influence H3.3 deposition. Since multiple chaperone systems regulate histone incorporation, it would strengthen the conclusions if additional chaperones were tested. Since HIRAssm reduced H3.3-Dendra2 incorporation to nearly undetectable levels (Figure 3E) we believe that it is the primary H3.3 incorporation pathway during this period of development. Therefore, we believe that removing HIRA function is a sufficient test of the dependance of H3.3ASVM on the major H3.3 chaperone at this time. Although it would be interesting to fully map how all H3 and H3.3 chimera constructs respond to all histone chaperone pathways, we believe that this is beyond the scope of this manuscript. Additionally, the manuscript does not include any validation of the RNAi knockdown efficiencies used throughout the study. This raises concerns about whether the observed phenotypes are truly due to target gene depletion or off-target effects. RT-qPCR or Western blot analyses should be performed to confirm knockdown efficiency. Revision Plan Both the Zelda and slbp-RNAi lines used for knockdowns have been used and validated in the early fly embryo in previously published works ((Yamada et al., 2019), (Duan et al., 2021), (O’Haren et al., 2025), (Chari et al, 2019)) and the phenotypes that we observe in our embryos are consistent with the published data including altered cell cycle durations (Figure S4C) and lack of cellularization/gastrulation. We note that the zelda RNAi phenotypes are also highly consistent with the effects of Zelda germline clones. To validate that slbp-RNAi knocks down histones we included a western blot for Pan-H3 in slbp-RNAi embryos that demonstrates a large effect on total H3 levels (Figure S4A). To further demonstrate the phenotypic effects of the slbp-RNAi we have added supplemental movies (Videos 4 and 5). To fully characterize the RNAi efficiency under our conditions we propose to perform RT-qPCR for slbp in slbp-RNAi and Zelda in Zelda-RNAi compared to control (w) RNAi embryos. Finally, the section discussing "H3.3 incorporation depends on cell cycle state, but not cell cycle duration" is unclear. The term "cell cycle state" is vague and should be explicitly defined. Does this refer to a specific phase of the cell cycle, changes in chromatin accessibility, or another regulatory mechanism? The term cell cycle state is deliberately vague. We know that Chk1 regulates many aspects of cell cycle progression and cannot determine from our data which aspect(s) of cell cycle regulation by Chk1 are important for H3.3 incorporation. Our data indicate that it is not simply interphase duration as we originally hypothesized. We have expanded our discussion section to underscore some aspects of Chk1 regulation that we speculate may be responsible for the change in H3.3 behavior. “Chk1 mutants decrease H3.3 incorporation even before the cell cycle is significantly slowed. Cell cycle slowing has been previously reported to regulate the incorporation of other histone variants in Drosophila15. However, our results indicate that cell cycle state and not duration per se, regulates H3.3 incorporation. In most cell types, the primary role of Chk1 is to stall the cell cycle to protect chromatin in response to DNA damage. Therefore, Chk1 activity directly or indirectly affects the chromatin state in a variety of ways. We speculate that Chk1’s role in regulating origin firing may be particularly important in this context73,74. Late replicating regions and heterochromatin first emerge during ZGA, and Chk1 mutants proceed into mitosis before the chromatin is fully replicated22,23,25,71. Since H3.3 is often associated with heterochromatin, the decreased H3.3 incorporation in Chk1 mutants may be an indirect result of increased origin firing and decreased heterochromatin formation73,74.” lines 287-298 Reviewer #2 (Significance (Required)): This manuscript investigates the regulation of H3.3 incorporation during zygotic genome Revision Plan activation (ZGA) in Drosophila, proposing that the nuclear-to-cytoplasmic (N/C) ratio plays a central role in this process. While the study is conceptually interesting, several concerns arise regarding the lack of proper control experiments and the clarity of the writing. The manuscript is difficult to follow due to vague descriptions, insufficient distinctions between established knowledge and novel findings, and a lack of rigorous statistical analyses. These issues need to be addressed before the study can be considered for publication. Reviewer #3 (Evidence, reproducibility and clarity (Required)): Summary: Based on previous findings of the changing ratios of histone H3 to its variant H3.3, the authors test how H3.3 incorporation into chromatin is regulated for ZGA. They demonstrate here that H3 nuclear availability drops and replacement by H3.3 relies on chaperone binding, though not on its typical chaperone Hira. Furthermore, they show that nuclear-cytoplasmic (N/C) ratios can influence this histone exchange likely by influencing cell cycle state. We thank the reviewer for their thoughtful comments. We note that our data ARE consistent with H3.3 incorporation depending on Hira through its chaperone binding site. Major comments: 1. The claims are largely supported by the data but I think a couple more experiments could help bolster the claims about cell cycle and chk1 regulation. a. Creating a phosphomimetic of the chk1 phosphorylation site on H3.3 to see if it can overcome the defects seen in chk1 mutants b. Assessing heterochromatin of embryos without chk1 (or ASVM mutants) for example, by looking at H3K9me3 levels The first experiments could take several months if the flies haven't already been generated by the authors but the second should be quicker. a. This is an excellent experimental suggestion which is bolstered by the fact that in frogs H3.3 S31A cannot rescue H3.3 morpholino during gastrulation, but H3.3S31D can (Sitbon et al, 2020). However, to correctly conduct this experiment would require generating and validating multiple additional endogenous H3.3 replacement lines, likely without a fluorescent tag as they can interfere with histone rescue constructs in most species. As the reviewer notes, this would take several months of work (we have not generated the critical flies yet) and may not yield a satisfying answer since there are reports that H3.3 may be dispensable in flies aside from as a source of H3-type histone outside of S-phase (Hödl and Bassler, 2012). While we hope to continue experiments along these lines in the future we feel that this is beyond the scope of the current manuscript. Revision Plan b. To address this we propose to stain for H3K9me3 in wildtype and Chk1-/- embryos. Since the ASVM line is not a full replacement of all H3.3 we think that staining for H3K9me3 in this line is unlikely to yield a detectable difference. 2. It would also be interesting to see what the health of the flies with some mutations in this paper are beyond the embryo stage if they are viable (e.g., development to adulthood, fertility etc.) a. the SVM, ASVM mutations b. the hira + ASVM mutations The authors might already have this data but if not they have the flies and it shouldn't take long to get these data. a. To address this concern we propose to conduct hatch rate assays for embryos from the Dendra tagged H3.3, S31A, SVM, ASVM flies. However, we do note that in our experiments only one copy of the H3.3A locus was mutated and tagged with Dendra2 leaving one copy of H3.3A and both copies of H3.3B untouched to ensure normal development as tagging all copies of histone genes can lead to lethality. b. All Hira mutants develop as haploids due to the inability to decondense the sperm chromatin (which is dependent on Hira). This leads to one extra division to restore the N/C ratio prior to cell cycle slowing and ZGA. These embryos go on to gastralate and die late in development after cuticle formation (presumably due to their decreased ploidy) (Loppin et al., 2000). The addition of ASVM into the Hira background does not appear to rescue the ploidy defect as these embryos also undergo the extra division (Figure 3H). We are therefore confident that these embryos will not hatch. We have added the information about the development of Hira mutant to the text as follow: “These embryos develop as haploids and undergo one additional syncytial division before ZGA (NC14). Hirassmembryos develop otherwise phenotypically normally through organogenesis and cuticle formation, but die before hatching57.” lines 164-167 3. In the discussion section, can the authors speculate on how they think H3.3 ASVM is getting incorporated if not through Hira. Are there other known H3 variant chaperones, or can the core histone chaperone substitute? We have expanded our discussion to include the the following: “In the case of the chimeric histone proteins the incorporation behavior was dependent on the chaperone binding site. For example, H3.3ASVM import and incorporation was similar to H3 in control embryos and H3.3ASVM was still incorporated in Hirassm mutants. This is consistent with the chaperone binding site determining the chromatin incorporation pathway and suggests that H3.3ASVM likely interacts with H3 chaperones such as Caf1.” lines 280-285 Revision Plan Minor comments: While the paper is well written, I found the figures very confusing and difficult to interpret. Comments here are meant to make it easier to interpret. 1. Fig 1 and most of the paper would benefit from a schematic of early embryo transitions labelled with time and stages of cell cycle to make interpreting data easier This is an excellent suggestion! We have added a new figure (Figure 1) to explain both the biological system and the way that we measured many properties in this paper. 2. Fig 1- same green color is used for nuclear cycle 12 and for H3.3 making it confusing when reading graphs. Please check other figures where there is a similar use of color for two different things We have changed the colors so that they are more distinct. 3. Fig 1C,D might benefit more from being split up into 3 graphs by cell cycle with H3 and H3.3 plotted on the same graphs rather than the way it is now We do not feel that it is appropriate to directly compare the intensities of the H3-Dendra2 construct expressed from the pseudo-endogenous locus to the H3.3 and chimeric proteins expressed from the H3.3A locus as they were imaged using different settings. These curves can be directly compared within a construct and we can evaluate their trends over time, but the normalized values should not be directly compared in the way that would be encouraged by plotting the data as suggested. 4. Line 130-133: can they also comment on the different between SVM and ASVM. It seems like SVM might be even worse than ASVM (Fig 2C). Is this related to chk1 phosphorylation? We think that this is a property of the mixed chimeras since S31A is also imported less efficiently than H3.3 (though we cannot be sure without further experiments). We have added this explanation to the text: “We speculate that chimeric histone proteins (H3.3S31A and H3.3SVM) are not as efficiently handled by the chaperone machinery as species that are normally found in the organism including H3.3ASVM which is protein-identical to H3.” lines 150-152 5. Fig 2F-G: It is very difficult to compare between histones when they are on different graphs, please consider putting H3, H3.3 and H3.3ASVM in a hirassm background on the same graph. We have done this in the new Figure 3F. Revision Plan 6. Fig 3- move G to become A and then have A and B. We have restructured this figure to include the nuclear density map of control in response to a comment from Reviewer 1. Although not exactly what the reviewer has envisioned, we hope that this adds clarity to the figure. 7. The initial slope graphs in 4D, E, H and I are not easy to understand and would benefit from an explanation in the legend. We have edited the legend of Figure 5D (formerly 4D) and S1F which now read: “Initial slopes of nuclear import curves (change in total nuclear intensity over time for the first 5 timepoints) …” In addition we have updated the methods to include: “Import rates were calculated by using a linear regression for the total nuclear intensity over time for the first 5 timepoints in the nuclear import curves.” lines 471-473, methods Reviewer #3 (Significance (Required)): This paper addresses an important and understudied question- how do histones and their variants mediate chromatin regulation in the early embryo before zygotic genome activation? The authors follow up on some previous findings and provide new insights using clever genetics and cell biology in Drosophila melanogaster. However, the authors do not directly look at chromatin structural changes using existing genomic tools. This may be beyond the scope of this work but would make for a nice addition to strengthen their claims if they can implement these chromatin accessibility techniques in the early embryo. Histones affect a majority of biological processes and understanding their role in the early embryo is key to understanding development. I believe this study applies to a broad audience interested in basic science. However, I do think the authors might benefit from a more broad discussion of their results to attract a broad readership.

    1. Nevertheless, migrating from JUnit 4 to 5 requires effort. All annotations, like @Test, now reside in the package org.junit.jupiter.api , and some annotations were renamed or dropped and have to be replaced. A short overview of the differences between both framework versions is the following: Assertions reside in org.junit.jupiter.api.Assertions Assumptions reside in org.junit.jupiter.api.Assumptions @Before and @After no longer exist; use @BeforeEach and @AfterEach instead. @BeforeClass and @AfterClass no longer exist; use @BeforeAll and @AfterAll instead. @Ignore no longer exists, use @Disabled or one of the other built-in execution conditions instead @Category no longer exists, use @Tag instead @Rule and @ClassRule no longer exist; superseded by @ExtendWith and @RegisterExtension @RunWith no longer exists, superseded by the extension model using @ExtendWith

      JUnit 4 到 5 的主要变化

    1. file is named, for the convenience of its human users, and is referred to by its name. A name is usually a string of characters, such as example.c. Some systems differentiate between uppercase and lowercase characters in names, whereas other systems do not. When a file is named, it becomes independent of the process, the user, and even the system that created it. For instance, one user might create the file example.c, and another user might edit that file by specifying its name. The file's owner might write the file to a USB drive, send it as an e-mail attachment, or copy it across a network, and it could still be called example.c on the destination system. Unless there is a sharing and synchonization method, that second copy is now independent of the first and can be changed separately. A file's attributes vary from one operating system to another but typically consist of these: Name. The symbolic file name is the only information kept in human-readable form. Identifier. This unique tag, usually a number, identifies the file within the file system; it is the non-human-readable name for the file. Type. This information is needed for systems that support different types of files. Location. This information is a pointer to a device and to the location of the file on that device. Size. The current size of the file (in bytes, words, or blocks) and possibly the maximum allowed size are included in this attribute. Protection. Access-control information determines who can do reading, writing, executing, and so on. Timestamps and user identification. This information may be kept for creation, last modification, and last use. These data can be useful for protection, security, and usage monitoring.

      A file has a name for easy identification and can be accessed or moved while keeping the same name. Copies of a file are separate unless they are synchronized. File attributes include its name, a unique system identifier, its type, size, and access permissions. It also has timestamps that record when it was created, modified, or used.

    2. A file is named, for the convenience of its human users, and is referred to by its name. A name is usually a string of characters, such as example.c. Some systems differentiate between uppercase and lowercase characters in names, whereas other systems do not. When a file is named, it becomes independent of the process, the user, and even the system that created it. For instance, one user might create the file example.c, and another user might edit that file by specifying its name. The file's owner might write the file to a USB drive, send it as an e-mail attachment, or copy it across a network, and it could still be called example.c on the destination system. Unless there is a sharing and synchonization method, that second copy is now independent of the first and can be changed separately. A file's attributes vary from one operating system to another but typically consist of these: Name. The symbolic file name is the only information kept in human-readable form. Identifier. This unique tag, usually a number, identifies the file within the file system; it is the non-human-readable name for the file. Type. This information is needed for systems that support different types of files. Location. This information is a pointer to a device and to the location of the file on that device. Size. The current size of the file (in bytes, words, or blocks) and possibly the maximum allowed size are included in this attribute. Protection. Access-control information determines who can do reading, writing, executing, and so on. Timestamps and user identification. This information may be kept for creation, last modification, and last use. These data can be useful for protection, security, and usage monitoring. Some newer file systems also support extended file attributes, including character encoding of the file and security features such as a file checksum. Figure 13.1 illustrates a file info window on macOS that displays a file's attributes.

      File attributes vary across operating systems, but they generally include name, identifier, type, location, size, protection, timestamps, and access permissions. These attributes help manage and secure files effectively. However, the concept of extended attributes, such as file checksums and character encoding, raises questions. How do extended attributes improve security, and how are they implemented differently across file systems? Understanding these attributes is crucial for file management, particularly in environments that require strict access control and data integrity measures. I would like to explore how modern file systems, such as NTFS and ext4, utilize extended attributes to enhance security and organization.

    1. AI-powered suggestions

      Imagine 3d Reading.... something well beyond writing suggestions.

      1.) Source material. eg. NY Times. 2.) Social layer e.g. I tag you on a sentence talking about their Grammarly/Coda article and rumors about Notion 3.) Engaging AI to test facts, offer alternative povs, summaries, etc.

      Now Grammarly has read, write and collab + AI. * Suggestions * Collaboration & Mentions * AI in the browser for all

  2. Feb 2025
    1. Now a major bank has put a price tag on how much the economy has lost as a result of discrimination against African Americans: $16 trillion.

      Thesis the united states has lost a lot of money due to racism and discrimination.

    1. Tag the other devs to be Reviewers (at least 1 reviewer is required for approval, for larger Issues request that multiple reviewers need to approve it)

      What is the process for determining who will review (if only 1 reviewer is needed)?

    1. Author response:

      The following is the authors’ response to the original reviews.

      Reviewer #1 (Public review):

      Fuchs describes a novel method of enzymatic protein-protein conjugation using the enzyme Connectase. The author is able to make this process irreversible by screening different Connectase recognition sites to find an alternative sequence that is also accepted by the enzyme. They are then able to selectively render the byproduct of the reaction inactive, preventing the reverse reaction, and add the desired conjugate with the alternative recognition sequence to achieve near-complete conversion. I agree with the authors that this novel enzymatic protein fusion method has several applications in the field of bioconjugation, ranging from biophysical assay conduction to therapeutic development. Previously the author has published on the discovery of the Connectase enzymes and has shown its utility in tagging proteins and detecting them by in-gel fluorescence. They now extend their work to include the application of Connectase in creating protein-protein fusions, antibody-protein conjugates, and cyclic/polymerized proteins. As mentioned by the author, enzymatic protein conjugation methods can provide several benefits over other non-specific and click chemistry labeling methods. Connectase specifically can provide some benefits over the more widely used Sortase, depending on the nature of the species that is desired to be conjugated. However, due to a similar lengthy sequence between conjugation partners, the method described in this paper does not provide clear benefits over the existing SpyTag-SpyCatcher conjugation system.  Additionally, specific disadvantages of the method described are not thoroughly investigated, such as difficulty in purifying and separating the desired product from the multiple proteins used. Overall, this method provides a novel, reproducible way to enzymatically create protein-protein conjugates.

      The manuscript is well-written and will be of interest to those who are specifically working on chemical protein modifications and bioconjugation.

      I'd like to comment on two points.

      (1) The benefits over the SpyTag-SpyCatcher system. Here, the conjugation partners are fused via the 12.3 kDa SpyCatcher protein, which is considerably larger than the Connectase fusion sequence (19 aa). This is mentioned in the introduction (p. 1 ln 24-26). Furthermore, SpyTag-SpyCatcher fusions are truly irreversible, while Connectase/BcPAP fusions may be reversed (p. 8, ln 265-273). For example, target proteins (e.g., AGAFDADPLVVEI-Protein) may be covalently fused to functionalized magnetic beads (e.g., Bead-ELASKDPGAFDADPLVVEI) in order to perform a pulldown assay. After the assay, the target protein and any bound interactors could be released from the beads by the addition of a Connectase / peptide (AGAFDAPLVVEI) mixture.

      In a related technology, the SpyTag-SpyCatcher system was split into three components, SpyLigase, SpyTag and KTag  (Fierer et al., PNAS 2014). The resulting method introduces a sequence between the fusion partners (SpyTag (13aa) + KTag (10aa)), which is similar in length to the Connectase fusion sequence (p. 8, ln 297 - 298). Compared to the original method, however, this approach seems to require longer incubation times, while yielding less fusion product (Fierer et al., Figure 2).

      (2) Purification of the fusion product. The method is actually advantageous in this respect, as described in the discussion (p. 8, ln 258-264). Examples are now provided in Figure 6.

      Reviewer #2 (Public review):

      Summary:

      Unlike previous traditional protein fusion protocols, the author claims their proposed new method is fast, simple, specific, reversible, and results in a complete 1:1 fusion. A multi-disciplinary approach from cloning and purification, biochemical analyses, and proteomic mass spec confirmation revealed fusion products were achieved.

      Strengths:

      The author provides convincing evidence that an alternative to traditional protein fusion synthesis is more efficient with 100% yields using connectase. The author optimized the protocol's efficiency with assays replacing a single amino acid and identification of a proline aminopeptidase, Bacilius coagulans (BcPAP), as a usable enzyme to use in the fusion reaction. Multiple examples including Ubiquitin, GST, and antibody fusion/conjugations reveal how this method can be applied to a diverse range of biological processes.

      Weaknesses:

      Though the ~100% ligation efficiency is an advancement, the long recognition linker may be the biggest drawback. For large native proteins that are challenging/cannot be synthesized and require multiple connectase ligation reactions to yield a complete continuous product, the multiple interruptions with long linkers will likely interfere with protein folding, resulting in non-native protein structures. This method will be a good alternative to traditional approaches as the author mentioned but limited to generating epitope/peptide/protein tagged proteins, and not for synthetic protein biology aimed at examining native/endogenous protein function in vitro.

      The assessment is fair, and I have no further comments to add.

      Reviewer #1 (Recommendations for the authors):

      Major/Experimental Suggestions:

      (1) Throughout the paper only one reaction shown via gels had 100% conversion to desired product (Figure 3C). It is misleading to title a paper with absolutes such as "100% product yield", when the majority of reactions show >95% product yield, without any purification. Please change the title of the manuscript to something along the lines of "Novel Irreversible Enzymatic Protein Fusions with Near-Complete Product Yield".

      The conjugation reaction is thermodynamically favored. It is driven by the hydrolysis of a peptide bond (P|GADFDADPLVVEI), which typically releases 8 - 16 kJ/mol energy. This should result in a >99.99% complete reaction (DG° = -RT ln (Product/Educt)). In line with this, 99% - 100% of the less abundant educts (LysS, Figure 3A; MBP, Figure 3B; Ub-Strep, Figure 3C) are converted in the time courses (Figure 3D-F show different reaction conditions, which slow down conjugate formation). 100% conversion are also shown in Figure 5, Figure 6, and Figure S4. Likewise, 99.6% relative fusion product signal intensity in an LCMS analysis (Figure S2) after 4h reaction time (0.13% and 0.25% educts). In this experiment, the proline had been removed from 99.8% of the peptide byproducts (P|GADFDADPLVVEI). It is clear that this reaction is still ongoing and that >99.99% of the prolines will be removed from the peptides in time. These findings suggest that the conjugation reaction gradually slows down the less educt is available, but eventually reaches completion.

      For some experiments, lower product yields (e.g. 97% in Figure 3B) are reported in the paper. These were calculated with Yield = 100% x Product / (Educt1 + Educt 2 + Product). With this formula, 100% conjugation can only be achieved with exactly equimolar educt quantities, because both educt 1 and educt 2 need to be converted entirely. If one educt 1 is available in excess, for example because of protein concentration measurement inaccuracies or pipetting errors, some of it will be left without fusion partner. In case of Figure 3B, 3% more GST seemed to have been in the mixture. These are methodological inaccuracies.

      (2) Please provide at least one example of a purified desired product, and mention the difficulties involved as a disadvantage to this particular method. Separating BcPAP, Connectase, and the desired protein-protein conjugate may prove to be quite difficult, especially when Connectase cleaves off affinity tags.

      Examples are now provided in Figure 6. As described in the discussion (p. 8, ln 258-264), the simple product purification is one of the advantages of the method.

      (3) For the antibody conjugate, please provide an example of conjugating an edduct that would prove to be more useful in the context of antibodies. For example, as you mention in the introduction, conjugation of fluorophores, immobilization tags such as biotin, and small molecule linker/drugs are useful bioconjugates to antibodies.

      Antibody-biotinylation is now shown in Figure S6; Antibody-fluorophore conjugates are part of Figures S5 and S7.

      (4) Please assess the stability of these protein-protein conjugates under various conditions (temperature, pH, time) to ensure that the ligation via Connectase is stable over a broad array of conditions. In particular, a relevant antibody-conjugate stability assay should be done over the period of 1-week in both buffer and plasma to show applicability for potential therapeutics.

      The stability of an antibody-biotin conjugate in blood plasma over 7 days at different temperatures is now shown in Figure S7.

      Generally, Connectase introduces a regular peptide bond (Asp-Ala) with a high chemical and physical stability (e.g. 10 min incubation at 95°C in SDS-PAGE loading buffer; H2O-formic acid / acetonitrile gradients for LC-MS). The sequence may be susceptible to proteases, although this is not the case in HEK293 cells (antibody expression), E. coli, or blood plasma (Figure S7).

      (5) Please conduct functional assays with the antibody-protein/peptide conjugates to show that the antibody retains binding capabilities to the HER-2 antigen and the modification was site-selective, not interfering with the binding paratope or binding ability of the antibody in any way. This can be done through bio-layer interferometry, surface plasmon resonance, ELISA, etc.

      We plan the immobilization of the HER2 antibody on microplates and its use in an ELISA. However, this experiment requires significant testing and optimizations. It will be part of a future paper on the use of Connectase for protein immobilization.

      For now, the mass spectrometry data provide clear evidence of a single site-selective conjugation, as the C-terminal ELASKDPGAFDADPLVVEI-Strep sequence is replaced by ELASKDAGAFDADPLVVEI(-Ub). Given that the conjugation sites at the C-termini are far from the antigen binding sites, and have already been used in a number of other approaches (e.g., SpyTag, SnapTag, Sortase), it appears unlikely that these conjugations interfere with antigen binding.

      (6) Please include gels of all proteins used in ligation reactions after purification steps in the SI to show that each species was pure.

      The pure proteins are now shown in Figure S9.

      (7) Please provide the figures (not just tables) of LC/MS deconvoluted mass spectra graphs for all conjugates, either in the main text or the SI.

      Please specify which spectra you are missing. I believe all relevant spectra are shown in Figures 4, 5, and S3. The primary data can be found in Dataset S2.

      (8) Please provide more information in the methods section on exactly how the densitometry quantification of gel bands was performed with ImageJ.

      Details on the quantification with Image Studio Lite 5.2 were added in the method section (p. 17, ln 461-463).

      Minor Suggestions:

      (1) Page 1, line 19: can include one sentence on what assays these particular bioconjugations are usefule for (e.g. internalization cell studies, binding assays, etc.)

      I prefer not to provide additional details here to keep the text concise and focused.

      (2) Page 1, line 22: "three to ten equivalents" instead of 3x-10x.

      Done.

      (3) Page 1, line 23: While NHS labeling is widely considered non-specific, maleimide conjugation to free cysteines is generally considered specific for engineered free cysteine residues, since native proteins often do not have free cysteine residues available for conjugation. If you are referring to the potential of maleimides to label lysines as well, that should be specifically stated.

      I modified the sentence, now stating that these methods are "can be" unspecific.

      As pointed out, it is possible to achieve specificity by eliminating all other free cysteines and/or engineering a cysteine in an appropriate position. In many other cases, however (e.g., natural antibodies), several cysteines are available, or the sample contains other proteins/peptides. I did not want to go into more detail here and refer to the cited review.

      (4) Page 1, line 31: "and an oligoglycine G(1-5)-B"

      Done.

      (5) Page 1, line 34: It is not clear where in the source these specific Km values are coming from, considering these are variable based on specific conditions/substrates and tend to be reaction-specific.

      I cited another review, which lists the same values, along with a few other measurements (Jacobitz et al., Adv Protein Chem Struct Biol 2017, Table 2). It is clear that each of these measurements differs somewhat, but they are generally comparable (K<sub>M</sub>(LPETG) = 5500 - 8760 µM; K<sub>M</sub>(GGGGG) = 140 - 196 µM). I chose the cited study (Frankel et al., Biochemistry 2005), because it also investigated hydrolysis rates. In this study, the measurements are derived from the plots in Figure 2.

      (6) Page 1, line 47: the comparison to western blots feels a little like apples to oranges, even though this comparison was made in previous literature. Engineering an expressed protein to have this tag and then using the tag to detect and quantify it, feels more akin to a tagging/pull down assay than a western blot in which unmodified proteins are easily detected.

      It is akin to a frequently used type of western blots with tag-specific antiboies, e.g. Anti-His<sub>6</sub>, -Streptavidin, -His<sub>6</sub>, -HA ,-cMyc, -Flag. I modified the sentence to clarify this.

      (7) Page 2, line 51: "Connectase cleaves between the first D and P amino acids in the recognition sequence, resulting in an N-terminal A-ELASKD-Connectase intermediate and a C-terminal PGAFDADPLVVEI peptide."

      I prefer the current sentence, because we assume that a bond between the aspartate and Connectase is formed before PGAFDADPLVVEI is cleaved off.

      (8) Page 3, line 94: "Exact determination is not possible due to reversibility of the reaction", the way it is stated now sounds like it is a flaw in the methods. Also, update Figure 2 to read "Estimated relative ligation rate".

      Done.

      (9) Page 3, lines 101-107: This is worded in a confusing way. It can either be X<sub>1</sub> or X<sub>2</sub> that is inactivated depending on if the altered amino acid is on the original protein sequence or on the desired edduct to conjugate. You first give examples of how to render other amino acids inactive, but then ultimately state that proline made inactive, so separate the two distinct possibilities a bit more clearly.

      The reaction requires the inactivation of X<sub>1</sub>, without affecting X<sub>2</sub> (ln 100 - 102). This is true, no matter whether it is X<sub>1</sub> = A, C, S, or P that is inactivated. I added a sentence to clarify this (ln 102 – 103).

      (10) Page 4, line 118: Give a one-sentence justification for why these proteins were chosen to work with (easy to express, stable, etc).

      Done.

      (11) Page 5, line 167: "payload molecules".

      Done.

      (12) Page 5, lines 170-173: Word this more clearly- "full conversion with many of these methods is difficult on antibodies due to each heavy and light chain being modified separately, resulting in only a total yield of 66% DAR4 even when 90% of each chain is conjugated."

      I rephrased the section.

      (13) Page 8, line 290: Discuss other disadvantages of this method including difficulties purifying and in incorporating such a long sequence into proteins of interest.

      Product purification is shown in the new Figure 6. As stated above, I consider the simple purification process an advantage of the method.  The genetic incorporation of the sequence into proteins is a routine process and should not make any difficulties. The disadvantages of long linker sequences between fusion partners are now discussed (p.8 – 9, ln 300-302).

      (14) Page 10, line 341: 'The experiment is described and discussed in detail in a previously published paper.31"

      Done.

      Reviewer #2 (Recommendations for the authors):

      Minor Points:

      (1) It's unclear how the author derived 100% ligation rate with X = Proline in Figure 2 when there is still residual unligated UB-Strep at 96h. Please provide an expanded explanation for those not familiar with the protocol. Is the assumption made that there will be no UB-Strep if the assay was carried out beyond 96h?

      I clarified the figure legend. The assay shows the formation of an equilibrium between educts and products. Therefore, only ~50% Ub-Strep is used with X = Proline (see p. 2, ln 79 - 81). The "relative ligation rate" refers to the relative speed with which this equilibrium is established. The highest rate is seen with X = Proline, and it is set to 100%. The other rates are given relative to the product formation with X = Proline.

      (2) Though the qualitative depiction of the data in Figure 3 is appreciated, an accompanying graphical representation of the data in the same figure will greatly enhance reception and better comprehension of several of the author's conclusions.

      Graphs are now shown in Figure S1.

      (3) Figure 3 panel E is misaligned. Please align it with panel B above it.

      Done, thank you.

      (4) The author refers to 'The resulting circular assemblies (37% UB2...)' in the text but identifies it as UB-C2 in Figure 5B. Is this a mistake or does UB2 refer to another assembly not mentioned in the Figures? Please check for inconsistencies.

      All circular assemblies are now labeled Ub-C <sub>1-6</sub>.

      (5) Finishing with a graphical schematic that depicts the entire protocol in a simple image would be much appreciated and well-received by readers. Including the scheme with A and B proteins, the recognition linkers, the addition of connectase and BcPAP, etc. to the final resulting protein with connected linker.

      A graphical summary of the reaction is now included in Figure 6.

    1. Author response:

      The following is the authors’ response to the original reviews.

      eLife Assessment

      (1) This is a valuable manuscript that successfully integrates several data sets to determine genomic interactions with nuclear bodies.

      In this paper we both challenge and/or revise multiple long-standing “textbook” models of nuclear genome organization while also revealing new features of nuclear genome organization. Therefore, we argue that the contributions of this paper extend well beyond “valuable”. Specifically, these contributions include:

      a. We challenge a several decades focus on the correlation of gene positioning relative to the nuclear lamina. Instead, through comparison of cell lines, we show a strong correlation of di4erences in gene activity with di4erences in relative distance to nuclear speckles in contrast to a very weak correlation with di4erences in relative distance to the nuclear lamina. This inference of little correlation of gene expression with nuclear lamina association was supported by direct experimental manipulation of genome positioning relative to the nuclear lamina. Despite pronounced changes in relative distances to the nuclear lamina there was little change relative to nuclear speckles and little change in gene expression.

      b. We similarly challenge the long-standing proposed functional correlation between the radial positioning of genes and gene expression. Here, and in a now published companion paper (doi.org/10.1038/s42003-024-06838-7), we demonstrate how nuclear speckle positioning relative to nucleoli and the nuclear lamina varies among cell types, as does the inverse relationship between genome positioning relative to nuclear speckles and the nuclear lamina. Again, this is consistent with the primary correlation of gene activity being the positioning of genes relative to nuclear speckles and also explains previous observations showing a strong relationship between radial position and gene expression only in some cell types.

      c. We identified a new partially repressed, middle to late DNA replicating type of chromosome domain- “p-w-v fILADs”- by their weak interaction with the nuclear lamina, which, based on our LMNA/LBR KO experimental results, compete with LADs for nuclear lamina association. Moreover, we show that when fLADs convert to iLADs, most conversions are to this p-w-v fiLAD state, although ~ one third are to a normal, active, early replicating iLAD state. Thus, fLADs can convert between repressed, partially repressed, and active states, challenging the prevailing assumption of the division of the genome into two states – active, early replicating A compartment/iLAD regions versus inactive, late replicating, B compartment/LAD regions.

      d. We identified nuclear speckle associated domains as DNA replication initiation zones, with the domains showing strongest nuclear speckle attachment initiating DNA replication earliest in S-phase.

      e. We describe for the first time an overall polarization of nuclear genome organization in adherent cells with the most active, earliest replicating genomic regions located towards the equatorial plane and less expressed genomic regions towards the nuclear top or bottom surfaces. This includes polarization of some LAD regions to the nuclear lamina at the equatorial plane and other LAD regions to the top or bottom nuclear surfaces.

      We have now rewritten the text to make the significance of these new findings clearer.

      (2) Strength of evidence: The evidence supporting the central claims is varied in its strength ranging from solid to incomplete. Orthogonal evidence validating the novel methodologies with alternative approaches would better support the central claims.

      We argue that our work exploited methods, data, and analyses equal to or more rigorous than the current state-of-the-art. This indeed includes orthogonal evidence using alternative methods which both supported our novel methodologies as well as demonstrating their robustness relative to more conventional approaches. This explains how we were able to challenge/revise long-standing models and discover new features of nuclear genome organization. More specifically:

      a. Unlike most previous analyses, we have integrated both genomic and imaging approaches to examine the nuclear genome organization relative to not one, but several di4erent nuclear locales and we have done this across several cell types. To our knowledge, this is the first such integrated approach and has been key to our success in appreciating new features of nuclear genome organization.

      b. The 16-fraction DNA replication Repli-seq data we developed and applied to this project represents the highest temporal mapping of DNA replication timing to date.

      c. The TSA-seq approach that we used remains the most accurate sequence-based method for estimating microscopic distance of chromosome regions to di4erent nuclear locales. As implemented, this method is unusually robust and direct as it exploits the exponential micron-scale gradient established by the di4usion of the free-radicals generated by peroxidase labeling to measure relative distances of chromosome regions to labeled nuclear locales. We had previously demonstrated that TSA-seq was able to estimate the average distances of genomic regions to nuclear speckles with an accuracy of ~50 nm, as validated by light microscopy. The TSA-seq 2.0 protocol we developed and applied to this project maintained the original resolution of TSA-seq to estimate to an accuracy of ~50 nm the average distances of genomic regions from nuclear speckles, as validated by light microscopy, while achieving more than a 10-fold reduction in the required number of cells.

      We have rewritten the text to address the reviewer concerns that led them to their initial characterization of the TSA-seq as novel and not yet validated.

      First, we have added a discussion of how the use of nuclear speckle TSA-seq as a “cytological ruler” was based on an extensive initial characterization of TSA-seq as described in previous published literature. In that previous literature we showed how the conventional molecular proximity method, ChIP-seq, instead showed local accumulation of the same marker proteins over short DNA regions unrelated to speckle distances. Second, we reference our companion paper, now published, and describe how the extension of TSA-seq to measure relative distances to nucleoli was further validated and shown to be robust by comparison to NAD-seq and extensive multiplexed immuno-FISH data. We further discuss how in the same companion paper we show how nucleolar DamID instead was inconsistent with both the NAD-seq and multiplexed immuno-FISH data as well as the nucleolar TSA-seq.

      Third, we have added scatterplots showing exactly how highly the estimated microscopic distances to all three nuclear locales, measured in IMR90 fibroblasts, correlate with the TSA-seq measurements in HFF fibroblasts. This addresses the concern that we were not using the exact same fibroblast cell line for the TSA-seq versus microscopic measurements. The strong correlation already observed would only be expected to become even stronger with use of the exact same fibroblast cell lines for both measurements.

      Fourth, we have addressed the reviewer concern that the nuclear lamin TSA-seq was not properly validated because it did not match nuclear lamin Dam-ID. We have now added to the text a more complete explanation of how microscopic proximity assays such as TSA-seq measure something di4erent from molecular proximity assays such as DamID or NAD-seq. We have added further explanation of how TSA-seq complements molecular proximity assays such as DamID and NAD-seq, allowing us to extract further information than either measurement alone. We also briefly discuss why TSA-seq succeeds for certain nuclear locales using multiple independent markers whereas molecular proximity assays may fail against the same nuclear locales using the same markers. This includes brief discussion from our own experience attempting unsuccessfully to use DamID against nucleoli and nuclear speckles.

      Reviewer #1 (Public Review):

      (1) The weakness of this study lies in the fact that many of the genomic datasets originated from novel methods that were not validated with orthogonal approaches, such as DNAFISH. Therefore, the detailed correlations described in this work are based on methodologies whose efficacy is not clearly established. Specifically, the authors utilized two modified protocols of TSA-seq for the detection of NADs (MKI67IP TSA-seq) and LADs (LMNB1-TSA-seq).

      We disagree with the statement that the TSA-seq approach and data has not been validated by orthogonal approaches. We have now addressed this point in the revised manuscript text:

      a) We added text to describe how previously FISH was used to validate speckle TSA-seq by demonstrating a residual of ~50 nm between the TSA-seq predicted distance to speckles and the distance measured by light microscopy using FISH:

      "In contrast, TSA-seq measures relative distances to targets on a microscopic scale corresponding to 100s of nm to ~ 1 micron based on the measured diffusion radius of tyramide-biotin free-radicals (Chen et al., 2018). Exploiting the measured exponential decay of the tyramide-biotin free-radical concentration, we showed how the mean distance of chromosomes to nuclear speckles could be estimated from the TSA-seq data to an accuracy of ~50 nm, as validated by FISH (Chen et al., 2018)."

      b) We note that we also previously have validated lamina (Chen et al, JCB 2018) and nucleolar (Kumar et al, 2024) TSA-seq and further validated speckle TSA-seq (Zhang et al, Genome Research 2021) by traditional immuno-FISH and/or immunostaining. The overall high correlation between lamina TSA-seq and the orthogonal lamina DamID method was also extensively discussed in the first TSA-seq paper (Chen et al, JCB 2018). Included in this discussion was description of how the di4erences between lamina TSA-seq and DamID were expected, given that DamID produces a signal more proportional to contact frequency, and independent of distance from the nuclear lamina, whereas TSA-seq produces a signal that is a function of microscopic distance from the lamina, as validated by traditional FISH.

      c) We added text to describe how the nucleolar TSA-seq previously was validated by two orthogonal methods- NAD-seq and multiplexed DNA immuno-FISH:

      "We successfully developed nucleolar TSA-seq, which we extensively validated using comparisons with two different orthogonal genome-wide approaches (Kumar et al., 2024)- NAD-seq, based on the biochemical isolation of nucleoli, and previously published direct microscopic measurements using highly multiplexed immuno-FISH (Su et al., 2020)."

      d) We have now added panels A&B to Fig. 7 and a new Supplementary Fig. 7 demonstrating further validation of TSA-seq based on showing the high correlation between the microscopically measured distances of many hundreds of genomic sites across the genome from di4erent nuclear locales and TSA-seq scores. As discussed in response #2 below, we have used comparison of distances measured in IMR90 fibroblasts with TSA-seq scores measured in HFF fibroblasts. We would argue therefore that these correlations are a lower estimate and therefore the correlation between microscopic distances and TSAseq scores would likely have been still higher if we had performed both assays in the exact same cell line.

      (2) Although these methods have been described in a bioRxiv manuscript by Kumar et al., they have not yet been published. Moreover, and surprisingly, Kumar et al., work is not cited in the current manuscript, despite its use of all TSA-seq data for NADs and LADs across the four cell lines.

      The Kumar et al, Communications Biology, 2024 paper is now published and is cited properly in our revision. We apologize for this oversight and confusion our initial omission of this citation may have created. We had been writing this manuscript and the Kumar et al manuscript in parallel and had intended to co-submit. We planned to cross-reference the two at the time we co-submitted, adding the Kumar et al reference to the first version of this manuscript once we obtained a doi from bioRxiv. But we then submitted the Kumar et al manuscript several months earlier, but meanwhile forgot that we had not added the reference to our first manuscript version.

      (3) Moreover, Kumar et al. did not provide any DNA-FISH validation for their methods.

      As we described in our response to Reviewer 1's comment #1, we had previously provided traditional FISH validation of lamina TSA-seq in our first TSA- seq paper as well as validation by comparison with lamina DamID (Chen et al, 2018).

      We also described how the nucleolar TSA-seq was extensively cross-validated in the Kumar et al, 2024 paper by both NAD-seq and the highly multiplexed immuno-FISH data from Su et al, 2020).

      We note additionally that in the Kumar et al, 2024 paper the nucleolar TSA-seq was additionally validated by correlating the predicted variations in centromeric association with nucleoli across the four cell lines predicted by nucleolar TSA-seq with the variations observed by traditional immunofluorescence microscopy.

      (4) Therefore, the interesting correlations described in this work are not based on robust technologies.

      This comment was made in reference to the Kumar et al paper not having been published, and, as noted in responses to points #2 and #3, the paper is now published.

      But we wanted to specifically note, however, that our experience is that TSA-seq has proven remarkably robust in comparison to molecular proximity assays. We've described in our responses to the previous points how TSA-seq has been cross-validated by both microscopy and by comparison with lamina DamID and nucleolar NAD-seq. We note also that in every application of TSA-seq to date, all antibodies that produced good immunostaining showed good TSA-seq results. Moreover, we obtained nearly identical results in every case in which we performed TSA-seq with different antibodies against the same target. Thus anti-SON and antiSC35 staining produced very similar speckle TSA-seq data (Chen et al, 2018), anti-lamin A and anti-lamin B staining produced very similar lamina TSA-seq data (Chen et al, 2018), antinucleolin and anti-POL1RE staining produced very similar DFC/FC nucleolar TSA-seq data (Kumar et al, 2024), and anti-MKI67IP and anti-DDX18 staining produced very similar GC nucleolar TSA-seq data (Kumar et al, 2024).

      This independence of results with TSA-seq to the particular antibody chosen to label a target differs from experience with methods such as ChIP, DamID, and Cut and Run/Tag in which results can differ or be skewed based on variable distance and therefore reactivity of target proteins from the DNA or due to other factors such as non-specific binding during pulldown (ChIP) or differential extraction by salt washes (Cut and Tag).

      Our experience in every case to date is that antibodies that produce similar immunofluorescence staining produce similar TSA-seq results. We attribute this robustness to the fact that TSA-seq is based only on the original immunostaining specificity provided by the primary and secondary antibodies plus the diffusion properties of the tyramide-free radical.

      We've now added the following text to our revised manuscript:

      "As previously demonstrated for both SON and lamin TSA-seq (Chen et al., 2018), nucleolar TSA-seq was also robust in the sense that multiple target proteins showing similar nucleolar staining showed similar TSA-seq results (Kumar et al., 2024); this robustness is intrinsic to TSA-seq being a microscopic rather than molecular proximity assay, and therefore not sensitive to the exact molecular binding partners and molecular distance of the target proteins to the DNA."

      (5) An attempt to validate the data was made for SON-TSA-seq of human foreskin fibroblasts (HFF) using multiplexed FISH data from IMR90 fibroblasts (from the lung) by the Zhuang lab (Su et al., 2020). However, the comparability of these datasets is questionable. It might have been more reasonable for the authors to conduct their analyses in IMR90 cells, thereby allowing them to utilize MERFISH data for validating the TSA-seq method and also for mapping NADs and LADs.

      We disagree with the reviewer's overall assessment that that the use of the IMR90 data to further validate the TSA-seq is questionable because the TSA-seq data from HFF fibroblasts is not necessarily comparable with multiplexed immuno-FISH microscopic distances measured in IMR90 fibroblasts.

      In response we have now added panels to Fig. 7 and Supplementary Fig. 7, showing:

      a) There is very little di4erence in correlation between speckle TSA-seq and measured distances from speckles in IMR90 cells whether we use IMR90 or HFF cells SON TSA-seq data (R<sup>2</sup> = 0.81 versus 0.76) (new Fig. 7A).

      b) There is also a high correlation between lamina (R<sup>2</sup> = 0.62) and nucleolar (R<sup>2</sup> = 0.73) HFF TSA-seq and measured distances in IMR90 cells. Thus, we conclude that this high correlation shows that the multiplexed data from ~1000 genomic locations does validate the TSA-seq. These correlations should be considered lower bounds on what we would have measured using IMR90 TSA-seq data. Thus, the true correlation between distances of loci from nuclear locales and TSA-seq would be expected to be either comparable or even stronger than what we are seeing with the IMR90 versus HFF fibroblast comparisons.

      c) This correlation is cell-type specific (Fig. 7B, new SFig. 7). Thus, even for speckle TSAseq, highly conserved between cell types, the highest correlation of IMR90 distances with speckle TSA-seq is with IMR90 and HFF fibroblast data. For lamina and nucleolar TSA-seq, which show much lower conservation between cell types, the correlation of IMR90 distances is high for HFF data but much lower for data from the other cell types. This further justifies the use of IMR90 fibroblast distance measurements as a proxy for HFF fibroblast measurements.

      Thus, we have added the following text to the revised manuscript:

      "We reasoned that the nuclear genome organization in the two human fibroblast cell lines would be sufficiently similar to justify using IMR90 multiplexed FISH data [43] as a proxy for our analysis of HFF TSA-seq data. Indeed, the high inverse correlation (R= -0.86) of distances to speckles measured by MERFISH in IMR90 cells with HFF SON TSA-seq scores is nearly identical to the inverse correlation (R= -0.89) measured instead using IMR90 SON TSA-seq scores (Fig. 7A). Similarly, distances to the nuclear lamina and nucleoli show high inverse correlations with lamina and nucleolar TSA-seq, respectively (Fig. 7A). These correlations were cell type specific, particularly for the lamina and nucleolar distance correlations, as these correlations were reduced if we used TSA-seq data from other cell types (SFig. 7A). Therefore, the high correlation between IMR90 microscopic distances and HFF TSA-seq scores can be considered a lower bound on the likely true correlation, justifying the use of IMR90 as a proxy for HFF for testing our predictions."

      Reviewer #2 (Public Review):

      Weaknesses:

      (1) The experiments are largely descriptive, and it is difficult to draw many cause-andeffect relationships...The study would benefit from a clear and specific hypothesis.

      This study was hypothesis-generating rather than hypothesis-testing in its goal. Our research was funded through the NIH 4D-Nucleome Consortium, which had as its initial goal the development, benchmarking, and validation of new genomic technologies. Our Center focused on the mapping of the genome relative to different nuclear locales and the correlation of this intranuclear positioning of the genome with functions- specifically gene expression and DNA replication timing. By its very nature, this project took a discovery-driven versus hypothesis-driven scientific approach. Our question fundamentally was whether we could gain new insights into nuclear genome organization through the integration of genomic and microscopic measurements of chromosome positioning relative to multiple different nuclear compartments/bodies and their correlation with functional assays such as RNA-seq and Repliseq.

      Indeed, this study resulted in multiple new insights into nuclear genome organization as summarized in our last main figure. We believe our work and conclusions will be of general interest to scientists working in the fields of 3D genome organization and nuclear cell biology. We anticipate that each of these new insights will prompt future hypothesis-driven science focused on specific questions and the testing of cause-and-effect relationships.

      However, we do want to point out that our comparison of wild-type K562 cells with the LMNA/LBR double knockout was designed to test the long-standing model that nuclear lamina association of genomic loci contributes to gene silencing. This experiment was motivated by our surprising result that gene expression differences between cell lines correlated strongly with differences in positioning relative to nuclear speckles rather than the nuclear lamina. Despite documenting in these double knockout cells a decreased nuclear lamina association of most LADs, and an increased nuclear lamina association of the “p-w-v” fiLADs identified in this manuscript, we saw no significant change in gene expression in any of these regions as compared to wild-type K562 cells. Meanwhile, distances to nuclear speckles as measured by TSA-seq remained nearly constant.

      We would argue that this represents a specific example in which new insights generated by our genomics comparison of cell lines led to a clear and specific hypothesis and the experimental testing of this hypothesis.

      (2) Similarly, the paper would be very much strengthened if the authors provided additional summary statements and interpretation of their results (especially for those not as familiar with 3D genome organization).

      We appreciate this feedback and agree with the reviewer that this would be useful, especially for those not familiar with previous work in the field of 3D genome organization. In an earlier draft, we had included additional summary and interpretation statements in both the Introduction and Results sections. At the start of each Results section, we had also previously included brief discussion of what was known before and the context for the subsequent analysis contained in that section. However, we had thought we might be submitting to a journal with specific word limits and had significantly cut out that text.

      We have now restored this text and, in certain cases, added additional explanations and context.

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      Figures 1C and D. Please add the units at the values of each y-axis.

      We have done that.

      The representation of Figure 2C lacks clarity and is diJicult to understand. The x-axis labeling regarding the gene fraction number needs clarification.

      We've modified the text to the Fig. 2C legend: "Fraction of genes showing significant di=erence in relative positioning to nuclear speckles (gene fraction, x-axis) versus log2 (HFF FKPM / H1 FKPM) (y-axis);"

      "We next used live-cell imaging to corroborate that chromosome regions close to nuclear speckles, primarily Type I peaks, would show the earliest DNA replication timing." This sentence requires modification as Supplementary Figure 3F does not demonstrate that Type I peaks exhibit the earliest DNA replication timing; it only indicates that the first PCNA foci in S-phase are in proximity to nuclear speckles.

      We've modified the text to: "We next used live-cell imaging to show that chromosome regions close to nuclear speckles show the earliest DNA replication timing; this is consistent with the earliest firing DNA replication IZs, as determined by Repli-seq, aligning with Type 1 peaks that are closely associated with nuclear speckles."

      In Figure 5, the authors employed LaminB1-DamID to quantify LADs in LBR-KO and LMNA/LBR-DKO K562 cells. These are interesting results. However, for these experiments, it is crucial to assess LMNB1 signal at the nuclear periphery via immunofluorescence (IF) to confirm the absence of changes, ensuring that the DamID signal solely reflects contacts with the nuclear lamina. Furthermore, in this instance, their findings should be validated through DNA-FISH.

      Immunostaining of LMNB1 was performed and showed a normal staining pattern as a ring adjacent to the nuclear periphery. Images of this staining were included in the metadata tied to the sequencing data sets deposited on the 4D Nucleome Data portal. We thank the reviewer for bringing up this point, and have added a sentence mentioning this result in the Results Section:

      "Immunostaining against LMNB1 revealed the normal ring of staining around the nuclear periphery seen in wt cells (images deposited as metadata in the deposited sequencing data sets)."

      Because both TSA-seq and DamID have been extensively validated by FISH, as detailed in our previous responses to the public reviewer comments, we feel it is unnecessary to validate these findings by FISH.

      p-w-v-fiLADs should be labelled in Figure 5B.

      We've added labeling as suggested.

      "The consistent trend of slightly later DNA replication timing for regions (primarily p-w-v fiLADs) moving closer to the lamina" is not visible in the representation of the data of Figure 5G.

      We did not make a change as we believed this trend was apparent in the Figure.

      To reduce the descriptive nature of the data, it would be pertinent to conduct H3K9me3 and H3K27me3 ChIP-seq analyses in both the parental and DKO mutant cells. This would elucidate whether p-w-v-fiLADs and NADs anchoring to the nuclear lamina undergo changes in their histone modification profile.

      We believe further analysis of the reasons underlying these shifts in positioning, including such ChIP-seq or equivalent analysis, is of interest but beyond the scope of this publication. We see such measurements as the beginning of a new story but insuJicient alone to determine mechanism. Therefore we believe such experiments should be part of that future study.

      The description of Figure 7 lacks clarity. Additionally, it appears that TSA-seq for NADs and LADs may not be universally applicable across all cell types, particularly in flat cells, whereas DamID scores demonstrate less variation across cell lines, as also stated by the authors.

      TSA-seq is a complement to rather than a replacement for either DamID or NAD-seq. TSAseq reports on microscopic distances whereas both DamID and NAD-seq instead are more proportional to contact frequency with the nuclear lamina or nucleoli, respectively, and insensitive to distances of loci away from the lamina or nucleoli. Thus, TSA-seq provides additional information based on the intrinsic diJerences in what TSA-seq measures relative to molecular proximity methods such as DamID or NAD-seq. The entire point is that the convolution of the exponential point-spread-function of the TSA-seq with the shape of the nuclear periphery allows us to distinguish genomic regions in the equatorial plane versus the top and bottom of the nuclei. The TSA-seq is therefore highly "applicable" when properly interpreted in discerning new features of genome organization. As we stated in the revised manuscript, the lamina DamID and TSA-seq are complementary and provide more information together then either method along. The same is true for the NAD-seq and nucleolar TSA-seq comparison, as described in more detail in the Kumar, et al, 2024 paper.

      Introduction:

      The list of methodologies for mapping genomic contacts with nucleoli (NADs) should also include recent technologies, such as Nucleolar-DamID (Bersaglieri et al., PMID: 35304483), which has been validated through DNA-FISH.

      We did not include nucleolar DamID in the mention in the Introduction of methods for identifying diJerential lamina versus nucleolar interactions of heterochromatin- either from our own collaborative group or from the cited reference- because we did not have confidence in the accuracy of this method in identifying NADs. In the case of the published nucleolar DamID from our collaborative group, published in Wang et al, 2021, we later discovered that despite apparent agreement of the nucleolar DamID with a small number of published FISH localization the overall correlation of the nucleolar DamID with nucleolar localization was poor. As described in detail in the Kumar et al, 2024 publication, this poor correlation of the nucleolar DamID was established using three orthogonal methods- nucleolar TSA-seq, NAD-seq, and multiplexed immuno-FISH measurements from ~1000 genomic locations. Instead, we found that this nucleolar DamID showed high correlation with lamina DamID. We note that many strong NADs are also LADs, which we think is why validation with only several FISH probes is inadequate to demonstrate overall validation of the approach.

      We could not compare our nucleolar-DamID data in human cells with the alternative nucleolar-DamID results cited by the reviewer which were performed in mouse cells. We note that in this paper the nucleolar DamID FISH validation only included several putative NAD chromosome regions and, I believe, one LAD region. However, our initial comparison of the nucleolar DamID cited by the reviewer with unpublished TSA-seq data from mouse ESCs produced by the Belmont laboratory and with NAD-seq data from the Kaufman laboratory shows a similar lack of correlation of the nucleolar DamID signal with nucleolar TSA-seq and NAD-seq, as well as multiplexed immuno-FISH data from the Long Cai laboratory, as we saw in our analysis of own nucleolar DamID data in human cells.

      We have added explanation concerning the lack of correlation of our nucleolar DamID with orthogonal measurements of nucleolar proximity in the added text (below) to our revised manuscript:

      "Nucleolar DamID instead showed broad positive peaks over large chromatin domains, largely overlapping with LADs mapped by LMNB1 DamID (Wang et al., 2021). However, this nucleolar DamID signal, while strongly correlated with lamin DamID, showed poor correlation with either NAD-seq or nucleolar distances mapped by multiplexed immunoFISH (Kumar et al., 2024). We suspect the problem is that with molecular proximity assays the output signals are disproportionally dominated by the small fraction of target proteins juxtaposed in su=icient proximity to the DNA to produce a signal rather than the amount of protein concentrated in the target nuclear body. "

      Our mention of nucleolar TSA-seq was in the context of why we focused on nucleolar TSAseq and excluded our own nucleolar DamID. We chose not to discuss the second nucleolar DamID method cited above 1) because it was not appropriate to our discussion of our own experimental approach and 2) also because we cannot yet make a definitive statement of its accuracy for nucleolar mapping.

      Reviewer #2 (Recommendations For The Authors):

      (1) The authors start the manuscript by describing the 'radial genome organization' model and contrast it with the 'binary model' of genome organization. It would be helpful for the authors to contextualize their results a bit more with regard to these two diJerent models in the discussion.

      We have added several sentences in the first paragraph of the Discussion to accomplish this contextualization. The new paragraph reads:

      "Here we integrated imaging with both spatial (DamID, TSA-seq) and functional (Repli-seq, RNA-seq) genomic readouts across four human cell lines. Overall, our results significantly extend previous nuclear genome organization models, while also demonstrating a cell-type dependent complexity of nuclear genome organization. Briefly, in contrast to the previous radial model of genome organization, we reveal a primary correlation of gene expression with relative distances to nuclear speckles rather than radial position. Additionally, beyond a correlation of nuclear genome organization with radial position, in cells with flat nuclei we show a pronounced correlation of nuclear genome organization with distance from the equatorial plane. In contrast to previous binary models of genome organization, we describe how both iLAD / A compartment and LAD / B compartment contain within them smaller chromosome regions with distinct biochemical and/or functional properties that segregate di=erentially with respect to relative distances to nuclear locales and geometry."

      (2) Data should be provided demonstrating KO of LBR and LMNA - immunoblotting for both proteins would be one approach. In addition, it would be helpful to provide additional nuclear morphology measurements of the DKO cells (volume, surface area, volume of speckles/nucleoli, number of speckles/nucleoli).

      We've added additional description describing the generation and validation of the KO lines:

      "To create LMNA and LBR knockout (KO) lines and the LMNA/LBR double knockout (DKO) line, we started with a parental "wt" K562 cell line, clone #17, expressing an inducible form of Cas9 (Brinkman et al., 2018). The single KO and DKO were generated by CRISPR-mediated frameshift mutation according to the procedure described previously (Schep et al., 2021). The "wt" K562 clone #17 was used for comparison with the KO clones.

      The LBR KO clone, K562 LBR-KO #19, was generated, using the LBR2 oligonucleotide GCCGATGGTGAAGTGGTAAG to produce the gRNA, and validated previously, using TIDE (Brinkman et al., 2014) to check for frameshifts in all alleles as described elsewhere (Schep et al., 2021). The LMNA/LBR DKO, K562 LBR-LMNA DKO #14, was made similarly, starting with the LBR KO line and using the combination of two oligonucleotides to produce gRNAs:

      LMNA-KO1: ACTGAGAGCAGTGCTCAGTG, LMNA-KO2: TCTCAGTGAGAAGCGCACGC.

      Additionally, the LMNA KO line, K562 LMNA-KO #14, was made the same way but starting with the "wt" K562 cell line. Validation was as described above; additionally, for the new LMNA KO and LMNA/LBR DKO lines, immunostaining showed the absence of anti-LMNA antibody signal under confocal imaging conditions used to visualize the wt LMNA staining while the RNA-seq from these clones revealed an ~20-fold reduction in LMNA RNA reads relative to the wt K562 clone."

      As suggested, we also added morphological data for the DKO line in a modified SFig.5.

      (3) The rationale for using LMNB1 TSA-seq and LMNB1 DAMID is not immediately clear. The LMNB1 TSA-seq is more variable across cell types and replicates than the DAMID. Could the authors please compare the datasets a bit more to understand the diJerences? For example, the authors demonstrate that "40-70% of the genome shows statistically significant diJerences in Lamina TSA-seq over regions 100 kb or larger, with most of these regions showing little or no diJerences in speckle TSA-seq scores." If the LMNB1 DAMID data is used for this analysis or Figure 2D, is the same conclusion reached? Also, in Figure 6, the authors conclude that C1 and C3 LAD regions are enriched for constitutive LADs, while C2 and C4 LAD regions are fLADs. This is a bit surprising because the authors and others have previously shown that constitutive LADs have higher LMNB1 contact frequency than facultative LADs (Kind, et al Cell 2015, Figure 3C).

      Indeed, in the first TSA-seq paper (Chen et al, 2018) we did observe that cLADs had the highest LMNB TSA-seq scores; this was for K562 cells with round nuclei in which there is therefore no diJerence in lamina TSA-seq scores produced by nuclear shape over the entire nucleus.

      However, there are diJerences between TSA-seq and DamID in terms of what they measure and we refer the reviewer to the first TSA-seq paper (Chen et al, 2018) that explains in greater depth these diJerences. This first paper explains how DamID is indeed related to contact frequency but how the TSA-seq instead estimates mean distances from the target, in this case the nuclear lamina. This is because the diJusion of tyramide free radicals from the site of their constant HRP production produces an exponential decay gradient of tyramide free radical concentration at steady state.

      We have summarized these diJerences in in text we have added to introduce both DamID and TSA-seq in the second Results section:

      "DamID is a well-established molecular proximity assay; DamID applied to the nuclear lamina divides the genome into lamina-associated domains (LADs) versus nonassociated “inter-LADs” or “iLADs” (Guelen et al., 2008; van Steensel and Belmont, 2017). In contrast, TSA-seq measures relative distances to targets on a microscopic scale corresponding to 100s of nm to ~ 1 micron based on the measured diJusion radius of tyramide-biotin free-radicals (Chen et al., 2018)... While LMNB1 DamID segments LADs most accurately, lamin TSA-seq provides distance information not provided by DamID- for example, variations in relative distances to the nuclear lamina of diJerent iLADs and iLAD regions. These diJerences between the LMNB1 DamID and LMNB TSA-seq signals are also crucial to a computational approach, SPIN, that segments the genome into multiple states based on their varying nuclear localization, including biochemically and functionally distinct lamina-associated versus near-lamina states (Consortium et al., 2024; Wang et al., 2021).

      Thus, lamin DamID and TSA-seq complement each other, providing more information together than either one separately."

      We note that these diJerences in lamina DamID and TSA-seq are crucial to being able to gain additional information by comparing variations in the lamina TSA-seq for LADs in Figs. 6&7. See our response to point (4) below, for further explanation.

      (4) In 7B/C, the authors show that the highest LMNB1 regions in HFF are equator of IMR90s. However, in Figure 7G, their cLAD score indicates that constitutive LADs are not at the equator. This is a bit surprising given the point above and raises the possibility that SON signals (as opposed to LMNB1 signals) might be more responsible for correlation to localization relative to the equator. Hence, it might be helpful if the authors repeat the analyses in Figures 7B/C in regions with diJering LMNB1 signals but similar SON signals (and vice versa).

      Again, this is based on the apparent assumption by the reviewer that DamID and TSA-seq work the same way and measure the same thing. But as explained above in the previous point, this is not true.

      In our first TSA-seq paper (Chen et al, 2018) we showed how we could use the exponential decay point-spread-function produced by TSA, measured directly by light microscopy, to convert sequencing reads from the TSA-seq into a predicted mean distance from nuclear speckles, approximated as point sources. These mean distances predicted from the SON TSA-seq data agreed with measured FISH distances to nuclear speckles to within ~50 nm for a set of DNA probes from diJerent chromosome regions. Moreover, varying TSA staining conditions changed the decay constants of this exponential decay, thus producing diJerences in the SON TSA-seq signals. By using these diJerent exponential decay functions to convert the TSA-seq scores from these independent data sets to estimated distances from nuclear speckles, we again observed a distance residual of ~50 nm; in this case though this distance residual of ~50 nm represented the mean residual observed genome-wide. This gives us great confidence that the TSA-seq is working as we have modeled it.

      As we mentioned in our response to point 3 above, we did see the highest LMNB TSA-seq signal for cLADs in K562 cells with round nuclei (Chen et al, 2018).

      But as we now show in our simulation performed in this paper for Fig. 7, the observed tyramide free radical exponential decay gradient convolved with the flat nuclear lamina shape produces a higher equatorial LMNB1 TSA-seq signal for LADs at the equatorial plane. We confirmed that LADs with this higher TSA-seq signal were enriched at the equatorial plane by mining the multiplexed IMR90 imaging data. Similar mining of the multiplexed FISH IMR90 data showed localization of cLADs away from the equatorial plane.

      We are not clear about the rationale for what the reviewer is suggesting about SON signals "being more responsible for correlation to localization to the equator". We have provided an explanation for the higher lamina TSA-seq scores for LADs near the equator based on the measured spreading of the tyramide free radicals convolved with the eJect of the nuclear shape. This makes a prediction that the observed variation in lamina TSA-seq scores for LADs with similar DamID scores is related to their positioning relative to the equatorial plane as we then validated through our mining of the IMR90 multiplexed FISH data.

      (5) FISH of individual LADs, v-fiLADs, and p-w-v-fiLADs relative to the lamina and speckle would be helpful to understand their relative positioning in control and LBR/LMNA double KO cells. This would significantly bolster the claim that "histone mark enrichments..more precisely revealed the diJerential spatial distribution of LAD regions...".

      Adequately testing these predictions made from the lamina/SON TSA-seq scatterplots by direct FISH measurements would require measurements from large numbers of diJerent chromosome regions through a highly multiplexed immuno-FISH approach. We are not equipped currently in any of our laboratories to do such measurements and we leave this therefore for future studies.

      Rather our statement is based on our use of TSA-seq analyzed through these 2D scatterplots and should be valid to the degree that our TSA-seq measurements do indeed correlate with microscopy derived distances.

      However, we do now include demonstration of a high correlation of speckle, lamina, and nucleolar TSA-seq with highly multiplexed immuno-FISH measurement of distances to these locales in a revised Fig. 7. The high correlation shown between the TSA-seq scores and measured distances does therefore add additional support to our claim that the reviewer is discussing, even without our own multiplexed FISH validation.

      (6) "In contrast, genes within genomic regions which in pair-wise comparisons of cell lines show a statistically significant diJerence in lamina TSA-seq show no obvious trend in their expression diJerences (Figure 2C).". This appears to be an overstatement based on the left panel of 2D.

      We do not follow the reviewer's point. In Fig. 2C we show little bias in the diJerences in gene expression between the two cell types for regions that showed diJerences in lamina TSA-seq. The reviewer is suggesting something otherwise based on their impression, not explicitly stated, of the left panel of Fig. 2D. But we see similar shades of blue extending vertically at low SON values and similar shades of red extending vertically at high SON values, suggesting a correlation of gene expression only with the SON TSA-seq score but not with the LMNB1 TSA-seq score displayed on the y-axis. This is also consistent with the very small and/or insignificant correlation coeJicients measured in our linear model relating diJerences in LMNB1 TSA-seq to diJerences in expression but the large correlation coeJicient observed for SON TSA-seq (Fig. 2E). Thus, we see Fig. 2C-E as self-consistent.

      (7) In the section on "Polarity of Nuclear Genome Organization" - "....Using the IMR90 multiplexed FISH data set [43]...." - The references are not numbered.

      We thank the reviewer for this correction.

      (8) I believe there is an error in the Figure 7B legend. The descriptions of Cluster 1 and 2 do not match those indicated in the figure.

      We again thank the reviewer for this correction.

    1. Training Hub

      Just a general comment about navigation in the training hub: I appreciate that the layout and navigation may not be a priority at this stage, as content is still under development. However, there are some issues with the UI/UX throughout - I will add a tag "#navigation" so that all my comments on navigation throughout the courses can be collated seperately to my content comments.

      Navigation on this particular page is good though - highly intuitive and clearly labelled.

    1. reply to u/Sept-27 at https://old.reddit.com/r/Zettelkasten/comments/1itbduv/how_to_begin_storytelling_with_smart_notes/

      Ahrens' book will likely leave you with more questions than answers and really has nothing directly to say on the practice of fictional storytelling. Doto's book does a better job of filling in these pieces but approaches writing in general rather than specifically fiction.

      For fiction writers, I often recommend they don't practice putting Luhmann-artig numbers on their cards, but organize them in a more impromptu manner and allow them to shift more as you write. This allows things to shift more easily during the process and provides for a bit more creativity.

      Some resources and examples for fiction with a ZK:<br /> - Vladimir Nabokov - David Lynch - take particular note of his method taught by Frank Daniel at AFI - Dustin Lance Black - Card index for fiction writing - The Zettelkasten Method for Fiction Writing

      Take the inspiration these suggest, but don't go down the rabbit hole too deeply. You're going to want to evolve something that works best for you and your modes of writing, so trying to imitate someone else's system too closely will be the kiss of death.

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript describes the role of PRDM16 in modulating BMP response during choroid plexus (ChP) development. The authors combine PRDM16 knockout mice and cultured PRDM16 KO primary neural stem cells (NSCs) to determine the interactions between BMP signaling and PRDM16 in ChP differentiation.

      They show PRDM16 KO affects ChP development in vivo and BMP4 response in vitro. They determine genes regulated by BMP and PRDM16 by ChIP-seq or CUT&TAG for PRDM16, pSMAD1/5/8, and SMAD4. They then measure gene activity in primary NSCs through H3K4me3 and find more genes are co-repressed than co-activated by BMP signaling and PRDM16. They focus on the 31 genes found to be co-repressed by BMP and PRDM16. Wnt7b is in this set and the authors then provide evidence that PRDM16 and BMP signaling together repress Wnt activity in the developing choroid plexus.

      Strengths:

      Understanding context-dependent responses to cell signals during development is an important problem. The authors use a powerful combination of in vivo and in vitro systems to dissect how PRDM16 may modulate BMP response in early brain development.

      Main weaknesses of the experimental setup:

      (1) Because the authors state that primary NSCs cultured in vitro lose endogenous Prdm16 expression, they drive expression by a constitutive promoter. However, this means the expression levels are very different from endogenous levels (as explicitly shown in Supplementary Figure 2B) and the effect of many transcription factors is strongly dose-dependent, likely creating differences between the PRDM16-dependent transcriptional response in the in vitro system and in vivo.

      (2) It seems that the authors compare Prdm16_KO cells to Prdm16 WT cells overexpressing flag_Prdm16. Aside from the possible expression of endogenous Prdm16, other cell differences may have arisen between these cell lines. A properly controlled experiment would compare Prdm16_KO ctrl (possibly infected with a control vector without Prdm16) to Prdm16_KO_E (i.e. the Prdm16_KO cells with and without Prdm16 overexpression.)

      Other experimental weaknesses that make the evidence less convincing:

      (1) The authors show in Figure 2E that Ttr is not upregulated by BMP4 in PRDM16_KO NSCs. Does this appear inconsistent with the presence of Ttr expression in the PRDM16_KO brain in Figure1C?

      (2) Figure 3: The authors use H3K4me3 to measure gene activity. This is however, very indirect, with bulk RNA-seq providing the most direct readout and polymerase binding (ChIP-seq) another more direct readout. Transcription can be regulated without expected changes in histone methylation, see e.g. papers from Josh Brickman. They verify their H3K4me3 predictions with qPCR for a select number of genes, all related to the kinetochore, but it is not clear why these genes were picked, and one could worry whether these are representative.

      (3) Line 256: The overlap of 31 genes between 184 BMP-repressed genes and 240 PRDM16-repressed genes seems quite small.

      (4) The Wnt7b H3K4me3 track in Fig. 3G is not discussed in the text but it shows H3K4me3 high in _KO and low in _E regardless of BMP4. This seems to contradict the heatmap of H3K4me3 in Figure 3E which shows H3K4me3 high in _E no BMP4 and low in _E BMP4 while omitting _KO no BMP4. Meanwhile CDKN1A, the other gene shown in 3G, is missing from 3E.

      (5) The authors use PRDM16 CUT&TAG on dissected dorsal midline tissues to determine if their 31 identified PRDM16-BMP4 co-repressed genes are regulated directly by PRDM16 in vivo. By manual inspection, they find that "most" of these show a PRDM16 peak. How many is most? If using the same parameters for determining peaks, how many genes in an appropriately chosen negative control set of genes would show peaks? Can the authors rigorously establish the statistical significance of this observation? And why wasn't the same experiment performed on the NSCs in which the other experiments are done so one can directly compare the results? Instead, as far as I could tell, there is only ChIP-qPCR for two genes in NSCs in Supplementary Figure 4D.

      (6) In comparing RNA in situ between WT and PRDM16 KO in Figure 7, the authors state they use the Wnt2b signal to identify the border between CH and neocortex. However, the Wnt2b signal is shown in grey and it is impossible for this reviewer to see clear Wnt2b expression or where the boundaries are in Figure 7A. The authors also do not show where they placed the boundaries in their analysis. Furthermore, Figure 7B only shows insets for one of the regions being compared making it difficult to see differences from the other region. Finally, the authors do not show an example of their spot segmentation to judge whether their spot counting is reliable. Overall, this makes it difficult to judge whether the quantification in Figure 7C can be trusted.

      (7) The correlation between mKi67 and Axin2 in Figure 7 is interesting but does not convincingly show that Wnt downstream of PRDM16 and BMP is responsible for the increased proliferation in PRDM16 mutants.

      Weaknesses of the presentation:

      Overall, the manuscript is not easy to read. This can cause confusion.

    2. Reviewer #2 (Public review):

      Summary:

      This article investigates the role of PRDM16 in regulating cell proliferation and differentiation during choroid plexus (ChP) development in mice. The study finds that PRDM16 acts as a corepressor in the BMP signaling pathway, which is crucial for ChP formation.

      The key findings of the study are:<br /> (1) PRDM16 promotes cell cycle exit in neural epithelial cells at the ChP primordium.<br /> (2) PRDM16 and BMP signaling work together to induce neural stem cell (NSC) quiescence in vitro.<br /> (3) BMP signaling and PRDM16 cooperatively repress proliferation genes.<br /> (4) PRDM16 assists genomic binding of SMAD4 and pSMAD1/5/8.<br /> (5) Genes co-regulated by SMADs and PRDM16 in NSCs are repressed in the developing ChP.<br /> (6) PRDM16 represses Wnt7b and Wnt activity in the developing ChP.<br /> (7) Levels of Wnt activity correlate with cell proliferation in the developing ChP and CH.

      In summary, this study identifies PRDM16 as a key regulator of the balance between BMP and Wnt signaling during ChP development. PRDM16 facilitates the repressive function of BMP signaling on cell proliferation while simultaneously suppressing Wnt signaling. This interplay between signaling pathways and PRDM16 is essential for the proper specification and differentiation of ChP epithelial cells. This study provides new insights into the molecular mechanisms governing ChP development and may have implications for understanding the pathogenesis of ChP tumors and other related diseases.

      Strengths:

      (1) Combining in vitro and in vivo experiments to provide a comprehensive understanding of PRDM16 function in ChP development.

      (2) Uses of a variety of techniques, including immunostaining, RNA in situ hybridization, RT-qPCR, CUT&Tag, ChIP-seq, and SCRINSHOT.

      (3) Identifying a novel role for PRDM16 in regulating the balance between BMP and Wnt signaling.

      (4) Providing a mechanistic explanation for how PRDM16 enhances the repressive function of BMP signaling. The identification of SMAD palindromic motifs as preferred binding sites for the SMAD/PRDM16 complex suggests a specific mechanism for PRDM16-mediated gene repression.

      (5) Highlighting the potential clinical relevance of PRDM16 in the context of ChP tumors and other related diseases. By demonstrating the crucial role of PRDM16 in controlling ChP development, the study suggests that dysregulation of PRDM16 may contribute to the pathogenesis of these conditions.

      Weaknesses:

      (1) Limited investigation of the mechanism controlling PRDM16 protein stability and nuclear localization in vivo. The study observed that PRDM16 protein became nearly undetectable in NSCs cultured in vitro, despite high mRNA levels. While the authors speculate that post-translational modifications might regulate PRDM16 in NSCs similar to brown adipocytes, further investigation is needed to confirm this and understand the precise mechanism controlling PRDM16 protein levels in vivo.

      (2) Reliance on overexpression of PRDM16 in NSC cultures. To study PRDM16 function in vitro, the authors used a lentiviral construct to constitutively express PRDM16 in NSCs. While this approach allowed them to overcome the issue of low PRDM16 protein levels in vitro, it is important to consider that overexpressing PRDM16 may not fully recapitulate its physiological role in regulating gene expression and cell behavior.

      (3) Lack of direct evidence for AP1 as the co-factor responsible for SMAD relocation in the absence of PRDM16. While the study identified the AP1 motif as enriched in SMAD binding sites in Prdm16 knockout cells, they only provided ChIP-qPCR validation for c-FOS binding at two specific loci (Wnt7b and Id3). Further investigation is needed to confirm the direct interaction between AP1 and SMAD proteins in the absence of PRDM16 and to rule out other potential co-factors.

    3. Author response:

      Public Reviews:

      Reviewer #1 (Public review):

      Summary:

      This manuscript describes the role of PRDM16 in modulating BMP response during choroid plexus (ChP) development. The authors combine PRDM16 knockout mice and cultured PRDM16 KO primary neural stem cells (NSCs) to determine the interactions between BMP signaling and PRDM16 in ChP differentiation.

      They show PRDM16 KO affects ChP development in vivo and BMP4 response in vitro. They determine genes regulated by BMP and PRDM16 by ChIP-seq or CUT&TAG for PRDM16, pSMAD1/5/8, and SMAD4. They then measure gene activity in primary NSCs through H3K4me3 and find more genes are co-repressed than co-activated by BMP signaling and PRDM16. They focus on the 31 genes found to be co-repressed by BMP and PRDM16. Wnt7b is in this set and the authors then provide evidence that PRDM16 and BMP signaling together repress Wnt activity in the developing choroid plexus.

      Strengths:

      Understanding context-dependent responses to cell signals during development is an important problem. The authors use a powerful combination of in vivo and in vitro systems to dissect how PRDM16 may modulate BMP response in early brain development.

      Main weaknesses of the experimental setup:

      (1) Because the authors state that primary NSCs cultured in vitro lose endogenous Prdm16 expression, they drive expression by a constitutive promoter. However, this means the expression levels are very different from endogenous levels (as explicitly shown in Supplementary Figure 2B) and the effect of many transcription factors is strongly dose-dependent, likely creating differences between the PRDM16-dependent transcriptional response in the in vitro system and in vivo.<br />

      We acknowledge that our in vitro experiments may not ideally replicate the in vivo situation, a common limitation of such experiments, our primary aim was to explore the molecular relationship between PRDM16 and BMP signaling in gene regulation. Such molecular investigations are challenging to conduct using in vivo tissues. In vitro NSCs treated with BMP4 has been used a model to investigate NSC proliferation and quiescence, drawing on previous studies (e.g., Helena Mira, 2010; Marlen Knobloch, 2017). Crucially, to ensure the relevance of our in vitro findings to the in vivo context, we confirmed that cultured cells could indeed be induced into quiescence by BMP4, and this induction necessitated the presence of PRDM16. Furthermore, upon identifying target genes co-regulated by PRDM16 and SMADs, we validated PRDM16's regulatory role on a subset of these genes in the developing Choroid Plexus (ChP) (Fig. 7 and Suppl.Fig7-8). Only by combining evidence from both in vitro and in vivo experiments could we confidently conclude that PRDM16 serves as an essential co-factor for BMP signaling in restricting NSC proliferation.

      (2) It seems that the authors compare Prdm16_KO cells to Prdm16 WT cells overexpressing flag_Prdm16. Aside from the possible expression of endogenous Prdm16, other cell differences may have arisen between these cell lines. A properly controlled experiment would compare Prdm16_KO ctrl (possibly infected with a control vector without Prdm16) to Prdm16_KO_E (i.e. the Prdm16_KO cells with and without Prdm16 overexpression.)

      We agree that Prdm16 KO cells carrying the Prdm16-expressing vector would be a good comparison with those with KO_vector. However, despite more than 10 attempts with various optimization conditions, we were unable to establish a viable cell line after infecting Prdm16 KO cells with the Prdm16-expressing vector. The overall survival rate for primary NSCs after viral infection is low, and we observed that KO cells were particularly sensitive to infection treatment when the viral vector was large (the Prdm16 ORF is more than 3kb).

      As an alternative oo assess vector effects, we instead included two other control cell lines, wt and KO cells infected with the 3xNLS_Flag-tag viral vector, and presented the results in supplementary Fig 2.  When we compared the responses of the four lines — wt, KO, wt infected with the Flag vector, KO infected with the Flag vector — to the addition and removal of BMP4, we confirmed that the viral infection itself has no significant impacts on the responses of these cells to these treatments regarding changes in cell proliferation and Ttr induction.

      Given that wt cells and the KO cells, with or without viral backbone infection behave quite similarly in terms of cell proliferation, we speculate that even if we were successful in obtaining a cell line with Prdm16-expressing vector in the KO cells, it may not exhibit substantial differences compared to wt cells infected with Prdm16-expressing vector.

      Other experimental weaknesses that make the evidence less convincing:

      (1) The authors show in Figure 2E that Ttr is not upregulated by BMP4 in PRDM16_KO NSCs. Does this appear inconsistent with the presence of Ttr expression in the PRDM16_KO brain in Figure1C?<br />

      The reviwer’s point is that there was no significant increase in Ttr expression in Prdm16_KO cells after BMP4 treatment (Fig. 2E), but there remained residule Ttr mRNA signals in the Prdm16 mutant ChP (Fig. 1C). We think the difference lies in the measuable level of Ttr expression between that induced by BMP4 in NSC culture and that in the ChP. This is based on our immunostaining expreriment in which we tried to detect Ttr using a Ttr antibody. This antibody could not detect the Ttr protein in BMP4-treated Prdm16_expressing NSCs but clearly showed Ttr signal in the wt ChP. This means that although Ttr expression can be significantly increased by BMP4 in vitro to a level measurable by RT-qPCR, its absolute quantity even in the Prdm16_expressing condition is much lower compared to that in vivo. Our results in Fig 1C and Fig 2E, as well as Fig 7B, all consistently showed that Prdm16 depletion significantly reduced Ttr expression in in vitro and in vivo.

      (2) Figure 3: The authors use H3K4me3 to measure gene activity. This is however, very indirect, with bulk RNA-seq providing the most direct readout and polymerase binding (ChIP-seq) another more direct readout. Transcription can be regulated without expected changes in histone methylation, see e.g. papers from Josh Brickman. They verify their H3K4me3 predictions with qPCR for a select number of genes, all related to the kinetochore, but it is not clear why these genes were picked, and one could worry whether these are representative.

      H3K4me3 has widely been used as an indicator of active transcription and is a mark for cell identity genes. And it has been demonstrated that H3K4me3 has a direct function in regulating transciption at the step of RNApolII pausing release. As stated in the text, there are advantages and disadvantages of using H3K4me3 compared to using RNA-seq. RNA-seq profiles all gene products, which are affected by transcription and RNA stability and turnover. In contrast, H3K4me3 levels at gene promoter reflects transcriptional activity. In our case, we aimed to identify differential gene expression between proliferation and quiescence states. The transition between these two states is fast and dynamic. RNA-seq may not be able to identify functionally relevant genes but more likely produces false positive and negative results. Therefore, we chose H3K4me3 profiling.

      We agree that transcription may change without histone methylation changes. This may cause an under-estimation of the number of changed genes between the conditions. 

      We validated 7 out of 31 genes (Wnt7b, Id3, Mybl2, Spc24, Spc25, Ndc80 and Nuf2). We chose these genes based on two critira: 1) their function is implicated in cell proliferation and cell-cycle regulation based on gene ontology analysis; 2) their gene products are detectable in the developing ChP based on the scRNA-seq data. Three of these genes (Wnt7b, Id3, Mybl2) are not related to the kinetochore. We now clarify this description in the revised text.

      (3) Line 256: The overlap of 31 genes between 184 BMP-repressed genes and 240 PRDM16-repressed genes seems quite small.

      This indicates that in addition to co-repressing cell-cycle genes, BMP and PRDM16 have independent fucntions. For example, it was reported that BMP regulates neuronal and astrocyte differentiation (Katada, S. 2021), while our previous work demonstrated that Prdm16 controls temporal identity of NSCs (He, L. 2021).

      (4) The Wnt7b H3K4me3 track in Fig. 3G is not discussed in the text but it shows H3K4me3 high in _KO and low in _E regardless of BMP4. This seems to contradict the heatmap of H3K4me3 in Figure 3E which shows H3K4me3 high in _E no BMP4 and low in _E BMP4 while omitting _KO no BMP4. Meanwhile CDKN1A, the other gene shown in 3G, is missing from 3E.

      The track in Fig 3G shows the absolute signal of H3K4me3 after mapping the sequencing reads to the genome and normaliz them to library size. Compare the signal in Prdm16_E with BMP4 and that in Prdm16_E without BMP4, the one with BMP4 has a lower peak. The same trend can be seen for the pair of Prdm16_KO cells with or without BMP4.  The heatmap in Fig. 3E shows the relative level of H3K4me3 in three conditions. The Prdm16_E cells with BMP4 has the lowest level, while the other two conditions (Prdm16_KO with BMP4 and Prdm16_E without BMP4) display a higher level. These two graphs show a consistent trend of H3K4me3 changes at the Wnt7b promoter across these conditions.

      (5) The authors use PRDM16 CUT&TAG on dissected dorsal midline tissues to determine if their 31 identified PRDM16-BMP4 co-repressed genes are regulated directly by PRDM16 in vivo. By manual inspection, they find that "most" of these show a PRDM16 peak. How many is most? If using the same parameters for determining peaks, how many genes in an appropriately chosen negative control set of genes would show peaks? Can the authors rigorously establish the statistical significance of this observation? And why wasn't the same experiment performed on the NSCs in which the other experiments are done so one can directly compare the results? Instead, as far as I could tell, there is only ChIP-qPCR for two genes in NSCs in Supplementary Figure 4D.

      In our text, we indicated the genes containing PRDM16 binding peaks in the figures and described them as “Text in black in Fig. 6A and Supplementary Fig. 5A”. We will add the precise number “25 of these genes” in the main text to clarify it. To define a negative control set of genes, we will use BMP-only repressed 184-31 =153 genes (excluding PRDM16-BMP4 co-repressed), and of these 153 genes, we will determine how many have PRDM16 peaks in the E12.5 ChP data, say X. Then we will use binomial test to calculate p-value binom_test(25, 31, X/153, alternative=“greater).

      We are confused with the second part of the comment “And why wasn't the same experiment performed on the NSCs in which the other experiments are done so one can directly compare the results? Instead, as far as I could tell, there is only ChIP-qPCR for two genes in NSCs in Supplementary Figure 4D.” If the reviewer meant why we didn’t sequence the material from sequential-ChIP or validate more taget genes, the reason is the limitation of the material. Sequential ChIP requires a large quantity of the antibodies, and yields little material barely sufficient for a few qPCR after the second round of IP. This yielded amount was far below the minimum required for library construction. The PRDM16 antibody was a gift, and the quantity we have was very limited. We made a lot of efforts to optimize all available commercial antibodies in ChIP and Cut&Tag, but none of them worked.

      (6) In comparing RNA in situ between WT and PRDM16 KO in Figure 7, the authors state they use the Wnt2b signal to identify the border between CH and neocortex. However, the Wnt2b signal is shown in grey and it is impossible for this reviewer to see clear Wnt2b expression or where the boundaries are in Figure 7A. The authors also do not show where they placed the boundaries in their analysis. Furthermore, Figure 7B only shows insets for one of the regions being compared making it difficult to see differences from the other region. Finally, the authors do not show an example of their spot segmentation to judge whether their spot counting is reliable. Overall, this makes it difficult to judge whether the quantification in Figure 7C can be trusted.

      To address these questions, in the revised manuscript we will include an individal channel of Wnt2b and mark the boundaries. We will also provide full-view images and examples of spot segmentation in supplementary figures as space limitation in the main figures.

      (7) The correlation between mKi67 and Axin2 in Figure 7 is interesting but does not convincingly show that Wnt downstream of PRDM16 and BMP is responsible for the increased proliferation in PRDM16 mutants.

      We agree that this result (the correlation between mKi67 and Axin2) alone only suggests that Wnt signaling is related to the proliferation defect in the Prdm16 mutant, and does not necessarily mean that Wnt is downstream of PRDM16 and BMP. Our concolusion is backed up by two additional lines of evidences:  the Cut&Tag data in which PRDM16 binds to regulatory regions of Wnt7b and Wnt3a; BMP and PRDM16 co-repress Wnt7b in vitro.

      An ideal result is that down-regulating Wnt signaling in Prdm16 mutant can rescue Prdm16 mutant phenotype. Such an experiment is technically challenging. Wnt plays diverse and essential roles in NSC regulation, and one would need to use a celltype-and stage-specific tool to down-regulate Wnt in the background of Prdm16 mutation. Moreover, Wnt genes are not the only targets regulated by PRDM16 in these cells, and downregulating Wnt may not be sufficient to rescue the phenotype. 

      Weaknesses of the presentation:

      Overall, the manuscript is not easy to read. This can cause confusion.

      We will revise the text to improve the clarity.

      Reviewer #2 (Public review):

      Summary:

      This article investigates the role of PRDM16 in regulating cell proliferation and differentiation during choroid plexus (ChP) development in mice. The study finds that PRDM16 acts as a corepressor in the BMP signaling pathway, which is crucial for ChP formation.

      The key findings of the study are:

      (1) PRDM16 promotes cell cycle exit in neural epithelial cells at the ChP primordium.

      (2) PRDM16 and BMP signaling work together to induce neural stem cell (NSC) quiescence in vitro.

      (3) BMP signaling and PRDM16 cooperatively repress proliferation genes.

      (4) PRDM16 assists genomic binding of SMAD4 and pSMAD1/5/8.

      (5) Genes co-regulated by SMADs and PRDM16 in NSCs are repressed in the developing ChP.

      (6) PRDM16 represses Wnt7b and Wnt activity in the developing ChP.

      (7) Levels of Wnt activity correlate with cell proliferation in the developing ChP and CH.

      In summary, this study identifies PRDM16 as a key regulator of the balance between BMP and Wnt signaling during ChP development. PRDM16 facilitates the repressive function of BMP signaling on cell proliferation while simultaneously suppressing Wnt signaling. This interplay between signaling pathways and PRDM16 is essential for the proper specification and differentiation of ChP epithelial cells. This study provides new insights into the molecular mechanisms governing ChP development and may have implications for understanding the pathogenesis of ChP tumors and other related diseases.

      Strengths:

      (1) Combining in vitro and in vivo experiments to provide a comprehensive understanding of PRDM16 function in ChP development.

      (2) Uses of a variety of techniques, including immunostaining, RNA in situ hybridization, RT-qPCR, CUT&Tag, ChIP-seq, and SCRINSHOT.

      (3) Identifying a novel role for PRDM16 in regulating the balance between BMP and Wnt signaling.

      (4) Providing a mechanistic explanation for how PRDM16 enhances the repressive function of BMP signaling. The identification of SMAD palindromic motifs as preferred binding sites for the SMAD/PRDM16 complex suggests a specific mechanism for PRDM16-mediated gene repression.

      (5) Highlighting the potential clinical relevance of PRDM16 in the context of ChP tumors and other related diseases. By demonstrating the crucial role of PRDM16 in controlling ChP development, the study suggests that dysregulation of PRDM16 may contribute to the pathogenesis of these conditions.

      Weaknesses:

      (1) Limited investigation of the mechanism controlling PRDM16 protein stability and nuclear localization in vivo. The study observed that PRDM16 protein became nearly undetectable in NSCs cultured in vitro, despite high mRNA levels. While the authors speculate that post-translational modifications might regulate PRDM16 in NSCs similar to brown adipocytes, further investigation is needed to confirm this and understand the precise mechanism controlling PRDM16 protein levels in vivo.

      While mechansims controlling PRDM16 protein stability and nuclear localization in the developing brain are interesting, the scope of this paper is revealing the function of PRDM16 in the choroid plexus and its interaction with BMP signaling. We will be happy to pursuit this direction in our next study.

      (2) Reliance on overexpression of PRDM16 in NSC cultures. To study PRDM16 function in vitro, the authors used a lentiviral construct to constitutively express PRDM16 in NSCs. While this approach allowed them to overcome the issue of low PRDM16 protein levels in vitro, it is important to consider that overexpressing PRDM16 may not fully recapitulate its physiological role in regulating gene expression and cell behavior.

      As stated above, we acknowledge that findings from cultured NSCs may not directly apply to ChP cells in vivo. We are cautious with our statements. The cell culture work was aimed to identify potential mechanisms by which PRDM16 and SMADs interact to regulate gene expression and target genes co-regulated by these factors. We expect that not all targets from cell culture are regulated by PRDM16 and SMADs in the ChP, so we validated expression changes of several target genes in the developing ChP and now included the new data in Fig. 7 and Supplementary Fig. 7. Out of the 31 genes identified from cultured cells, four cell cycle regulators including Wnt7b, Id3, Spc24/25/nuf2 and Mybl2, showed de-repression in Prdm16 mutant ChP. These genes can be relevant downstream genes in the ChP, and other target genes may be cortical NSC-specific or less dependent on Prdm16 in vivo.

      (3) Lack of direct evidence for AP1 as the co-factor responsible for SMAD relocation in the absence of PRDM16. While the study identified the AP1 motif as enriched in SMAD binding sites in Prdm16 knockout cells, they only provided ChIP-qPCR validation for c-FOS binding at two specific loci (Wnt7b and Id3). Further investigation is needed to confirm the direct interaction between AP1 and SMAD proteins in the absence of PRDM16 and to rule out other potential co-factors.

      We agree that the finding of the AP1 motif enriched at the PRDM16 and SMAD co-binding regions in Prdm16 KO cells can only indirectly suggest AP1 as a co-factor for SMAD relocation. That’s why we used ChIP-qPCR to examine the presence of C-fos at these sites. Although we only validated two targets, the result confirms that C-fos binds to the sites only in the Prdm16 KO cells but not Prdm16_expressing cells, suggesting AP1 is a co-factor.  We results cannot rule out the presence of other co-factors.

      Reviewer #3 (Public review):

      Summary:

      Bone morphogenetic protein (BMP) signaling instructs multiple processes during development including cell proliferation and differentiation. The authors set out to understand the role of PRDM16 in these various functions of BMP signaling. They find that PRDM16 and BMP co-operate to repress stem cell proliferation by regulating the genomic distribution of BMP pathway transcription factors. They additionally show that PRDM16 impacts choroid plexus epithelial cell specification. The authors provide evidence for a regulatory circuit (constituting of BMP, PRDM16, and Wnt) that influences stem cell proliferation/differentiation.

      Strengths:

      I find the topics studied by the authors in this study of general interest to the field, the experiments well-controlled and the analysis in the paper sound.

      Weaknesses:

      I have no major scientific concerns. I have some minor recommendations that will help improve the paper (regarding the discussion).

      We will revise the discussion according the suggestions.

    1. "Wer sind meine Freunde?"<br /> ist halt doch eine illegale Frage...

      https://github.com/milahu/alchi

      Von den 5 Zeitungsartikeln<br /> zu diesem lächerlichen "Anti-Terror Einsatz"<br /> ist der hier der Beste.

      "ein Gewaltpotenzial sei nie von ihm ausgegangen"<br /> richtig.<br /> aber meine schwarze jacke ist jetzt eine waffe?

      "dingfest gemacht" klingt so schön.<br /> das letzte mal<br /> wo sich irgendwer von mir "bedroht gefühlt" hat,<br /> bin ich für 6 monate im psychiatrie-knast wasserburg verschwunden (sechs monate!!),<br /> dafür zahlt die krankenversicherung 500 euro pro tag,<br /> und davon soll ich dann auch noch 10% bezahlen.<br /> meinen laptop haben die ärzte mir weggenommen,<br /> weil das ist "schlecht für meine Gesundheit"<br /> genauso wie meine Omega 3 Kapseln,<br /> Multivitamin Tabletten, CBD Öl, ...<br /> nicht dass die arme Pharmaindustrie pleite geht.

      wenn ich in 6 monaten wieder frei bin,<br /> dann werde ich genau da weiter machen,<br /> wo ich aufgehört habe:<br /> 300 bücher pro monat drucken,<br /> und überall verschenken,<br /> bis ich endlich weiß,<br /> ob meine hypothese wahr oder falsch ist.

      Viel Spaß beim zensieren von meinem Kommentar,<br /> ich hab genug andere Publisher:<br /> darktea.onion<br /> righttoprivacy.onion<br /> hypothes.is<br /> ...<br /> aber es liest eeh keiner,<br /> die leute ersticken im spam.

    1. Author response:

      The following is the authors’ response to the current reviews.

      We thank Reviewers for highlighting the strengths of our work along with suggestions for future directions.

      We agree with the Reviewers that RPS26 depletion may impact not only RAN translation initiation and codon selection (as showed in the experiments in Figure 4G), but also other mechanisms, such as speed of PIC scanning, as we stated in the discussion. Although, we did provide the data showing that mRNA of exogenous FMR1-GFP does not change upon RPS26 depletion (Figure 3B&C), hence observed effect most likely stems from translation regulation. In addition, an experiment with ASO-ACG treatment (Figure 4G) suggests that near cognate start codon selection or speed of PIC scanning may be a part of the regulation of RAN translation sensitive to RPS26 depletion. In addition, our latest unpublished results (Niewiadomska D. et al., in revision), indicate that FMRpolyG in fusion with GFP is fairly stable, in particular, while derived from long repeats (>90xCGG), suggesting that the protein stability is not at play in RPS26-dependent regulation.

      We would like to stress that in order to avoid bias in result interpretation and to mimic the natural situation, the majority of experiments concerning levels of FMRpolyG were performed in cell models with stable expression of ACG-initiated FMRpolyG. Currently, we do not possess a cell model with stable expression of AUG-initiated FMRpolyG, and the experiments based on transient transfection system would not necessarily be comparable to the results obtained in stable expression system. However, we believe that the experiment presented in Figure 2B serves as a good control for overall translation level upon RPS26 depletion indicating that RPS26 insufficiency does not affect global translation and the observed regulation is specific to some mRNAs including the one encoding FMRpolyG frame. We also show that the level of ca. 80% of identified canonical proteins, including FMRP, did not change upon RPS26 silencing (SILAC-MS, Figure 4A). Indeed, we did not explore the ribosome composition upon RPS26 and TSR2 depletion, although, most likely the pool of functional ribosomes in the cell is sufficient enough to support the basal translation level (SUnSET assays, Figure 2B & 5C). However, we cannot exclude possibility that for some mRNAs, including one encoding for FMRpolyG, the observed effect can be partially caused by lowering the number of fully active ribosomes, especially in experiments with transient transfection experiments where transgene expression is hundreds times higher than for average native mRNA.

      Finally, we agree with the Reviewer that in vitro translation assay would provide the evidence of direct effect of RPS26 on FMRpolyG level, however, we did not manage to overcome technical difficulties in obtaining cellular lysate devoid of RPS26 from vendor companies.


      The following is the authors’ response to the original reviews.

      General Comments

      We thank Reviewers for the critical comments and experimental suggestions. We considered most of the advices in the revised version of the manuscript, which allowed for a more balanced interpretation of the results presented, and further supported major statement of the manuscript that insufficiency of the RPS26 and RPS25 plays a role in modulating the efficiency of noncanonical RAN translation from FMR1 mRNA, which results in the production of toxic polyglycine protein (FMRpolyG). Firstly, performing new experiments, we showed that silencing of the RPS26 and its chaperone protein TSR2, which regulates loading/exchange of RPS26 in maturing small ribosome subunit, did not elicit global translation inhibition. Secondly, we demonstrated that in contrary to RPS26 and RPS25 depletion, silencing the RPS6 protein, a core component of 40S subunit, did not affect FMRpolyG production, further supporting the specific effect of RPS26 and RPS25 on RAN translation regulation of mutant FMR1 mRNA. We also observed that depletion of RPS26, RPS25 and RPS6 had significant negative effect on cells proliferation which is in line with previously published results indicating that insufficiencies of ribosomal proteins negatively affect cell growth. Moreover, we showed that FMRpolyG production is significantly affected by RPS26 depletion while initiated at ACG, but not other near cognate start codons. Importantly, translation of FMRP initiated at canonical AUG codon of the same mRNA upstream the CGGexp was not affected by RPS26 silencing, similarly to vast majority of the human proteome. This implies that RAN translation of FMR1 mRNA mediated by RPS26 insufficiency is likely to be dependent on start codon selection/fidelity. In essence, we provide a series of evidences indicating that cellular amount of 40S ribosomal proteins RPS26 and RPS25 is important factor of CGGrelated RAN translation regulation. Finally, we also decided to tone down our claims. Now, we state that the RPS26/25/TSR2 insufficiency or depletion, affects RAN translation, rather than composition of 40S ribosomal subunit per se influences RAN translation. We have addressed all specific concerns below and made changes to the new version of manuscript.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      In this manuscript, Tutak et al use a combination of pulldowns, analyzed by mass spectrometry, reporter assays, and fluorescence experiments to decipher the mechanism of protein translation in fragile X-related diseases. The topic is interesting and important.

      Although a role for Rps26-deficient ribosomes in toxic protein translation is plausible based on already available data, the authors' data are not carefully controlled and thus do not support the conclusions of the paper.

      We sincerely appreciate your rigorous, insightful, and constructive feedback throughout the revision process. We believe your guidance has been instrumental in significantly enhancing the quality of our research. Below, we have addressed your comments pointby-point.

      Strengths:

      The topic is interesting and important.

      Weaknesses:

      In particular, there is very little data to support the notion that Rps26-deficient ribosomes are even produced under the circumstances. And no data that indicate that they are involved in the RAN translation. Essential controls (for ribosome numbers) are lacking, no information is presented on the viability of the cells (Rps26 is an essential protein), and the differences in protein levels could well arise from block in protein synthesis, and cell division coupled to differential stability of the proteins.

      We agree that data presented in the first version of the manuscript did not directly address the following processes: ribosome content, global translation rate and cell viability upon RPS26 depletion. Therefore we addressed some of the issues in the revised version of the manuscript. In particular, we showed that RPS26 and TSR2 knock down did not inhibit global translation (new Figure 2B & 4C), hence we concluded that the changes of FMRpolyG level did not arise from general translational shut down. On the other hand, RPS26, RPS25 and RPS6 depletion negatively affected cells proliferation (new Figure 2A,5D,6C), which is in line with a number of previously published researches (e.g. Cheng et al, 2019; Havkin-Solomon et al, 2023). However, the rate of proliferation abnormalities is limited. We agree that observed effects on RAN translation from mutant FMR1 mRNA may stem from the combination of altered protein synthesis, conditions of the cells but also cis-acting factors of mRNA sequence/structure. In new experiments we showed that single nucleotide substitution of ACG by other near cognate start codons change sensitivity of RAN translation to insufficiency of RPS26 (new Figure 4F). Also the inhibitory effect of antisense oligonucleotide binding to the region of 5’UTR containing ACG initiation codon (ASO_ACG) is different in cells differing in amount of RPS26 (new Figure 4G).

      We also agree that our data only partially supports the role of RPS26-defficient ribosomes in RAN translation. Therefore, we have toned down our claims. Now, we state that the RPS26/25/TSR2 insufficiency or depletion affects RAN translation. We also changed the title of the manuscript to: “Insufficiency of 40S ribosomal proteins, RPS26 and RPS25, negatively affects biosynthesis of polyglycine-containing proteins in fragile-X associated conditions” (Previously it was: “Ribosomal composition affects the noncanonical translation and toxicity of polyglycine-containing proteins in fragile X-associated conditions”.

      Specific points:

      (1) Analysis of the mass spec data in Supplemental Table S3 indicates that for many of the proteins that are differentially enriched in one sample, a single peptide is identified. So the difference is between 1 peptide and 0. I don't understand how one can do a statistical analysis on that, or how it would give out anything of significance. I certainly do not think it is significant. This is exacerbated by the fact that the contaminants in the assay (keratins) are many, many-fold more abundant, and so are proteins that are known to be mitochondrial or nuclear, and therefore likely not actual targets (e.g. MCCC1, PC, NPM1; this includes many proteins "of significance" in Table S1, including Rrp1B, NAF1, Top1, TCEPB, DHX16, etc...).

      The data in Table S6/Figure 3A suffer from the same problem.

      I am not convinced that the mass spec data is reliable.

      We thank Reviewer for the comment concerning MS data; however, we believe that it may stem from misunderstanding of the data presented in Table S3 and S6. Both tables represent the output from MaxQuant analysis (so-called ProteinGroup) of MS .raw files, without any filtering. As stated in the Material&Methods, we applied default parameters suggested by MaxQuant developers to analyze MS data, these include identification of proteins based on at least 1 unique peptide, and thus some of the proteins with only 1 unique peptide are shown in Tables S1 and S3. Reviewer is also right that in this output table common contaminants, such as keratins are included. However, these identifications are denoted as “CON_”, and are further filtered out during statistical analysis in Perseus software. During the statistical analysis we first filtered out irrelevant protein groups identifications, such as contaminants, or only identified by site modifications.

      We have changed the names of Supplementary Table files, giving more detailed description. We hope this will help to avoid misunderstanding for broader public. Secondly, when comparing the data presented in Table S3 and volcano plot presented in Figure 1B, one can notice that indeed the majority of identified proteins are not statistically significant (grey points), thus not selected for further stratification. Lack of significance of these proteins may be partially due to poor MS identification, however, they are not included in the following parts of the manuscript. Further, we selected only eight proteins (out of over 150) for stratification by orthogonal techniques, thus we argue that this step validates the biological relevance of chosen candidate RAN-translation modifiers. One should also keep in mind that pull down samples analyzed by MS often yield lower intensity and identification rates, when comparing to whole cell analysis, as a result of lower protein input or stringent washes used during sample preparation.

      Regarding the data presented in Table S6 (SILAC data), we argue that these data are of very good quality. More than 2,000 proteins were identified in a 125min gradient, with over 80% of proteins that were identified with at least 2 unique peptides. Each of three biological replicates was analyzed three times (technical replicates), giving total of 9 high resolution MS runs. Together, we strongly believe that this data is of high confidence.

      (2) The mass-spec data however claims to identify Rps26 as a factor binding the toxic RNA specifically. The rest of the paper seeks to develop a story of how Rps26-deficient ribosomes play a role in the translation of this RNA. I do not consider that this makes sense.

      Indeed, we identified RPS26 as a protein that co-precipitated with FMR1 containing expanded CGG repeats (Supplementary Figure 1G) and found that depletion of RPS26 hindered RAN translation of FMRpolyG, suggesting that RPS26 positively affects RAN translation. However, we did not state that RPS26 directly interacts with toxic RNA. In order to confirm the specificity of RAN translation regulation by RPS26 insufficiency, we tested whether depletion of other 40S ribosomal protein, RPS6, affects FMRpolyG synthesis. Our experiments showed that there was no any significant effect on RAN translation efficiency post RPS6 silencing (new Figure 5C). Importantly, we showed that RPS26 depletion did not inhibit global translation (new Figure 2B). In addition, mutagenesis of near-cognate start codon (new Figure 4F) and ASO_ACG treatment (new Figure 4G) provided the evidences that modulation of FMRpolyG biosynthesis by RPS26 level may depend on start codon selection. In essence, our data suggest that RPS26 depletion specifically affects synthesis of FMRpolyG, but not FMRP derived from the same FMR1 mRNA with CGGexp. However, we do not claim that the observed effect is the consequence of a direct interaction between RPS26 and 5’UTR of FMR1 mRNA. Downregulation of FMRpolyG biosynthesis could be an outcome of the alteration of ribosomal assembly, decrease of efficiency and fidelity of PIC scanning/initiation or impeded elongation or a combination of all these processes. In the manuscript we presented the results of experiments which tested many of these possibilities.

      (3) Rps26 is an essential gene, I am sure the same is true for DHX15. What happens to cell viability? Protein synthesis? The yeast experiments were carefully carried out under experiments where Rps26 was reduced, not fully depleted to give small growth defects.

      We agree with the Reviewer that RPS26 and DHX15 are essential proteins, similarly to all RNA binding proteins, and caution should be taken during experimental design. To address this, we titrated different concentrations of siRPS26, and found that administration of 5 nM siRPS26, which just partially silenced RPS26, decreased FMRpolyG by around 50% (new Figure 1D). This impact was even greater with 15 nM siRPS26, as we observed around 80% decrease of FMRpolyG.

      Havkin-Solomon et al. (2023), showed that proliferation rate is decreased in cells with mutated C-terminus of RPS26, which is required for contacting mRNA. In accordance with this study, we showed that cells with knocked down RPS26 proliferate less efficiently (new Figure 2A), but depletion of RPS26 did not impact the global translation (new Figure 2B). In addition, our SILAC-MS data indicates that ~80% of proteins with determined expression level were not affected by RPS26 insufficiency, and ~20% of the proteins turned out to be sensitive to RPS26 decrease. Although, these data do not take into account the protein stability.

      (4) Knockdown efficiency for all tested genes must be shown to evaluate knockdown efficiency.

      The current version of the manuscript contains representative western blots with validation of knock-down efficiency (for example in Figure 3B, C, E, Figure 6A) and we included knock-down validations where applicable (Figures 1D, 2B, 4G and 5C).

      (5) The data in Figure 1E have just one mock control, but two cell types (control si and Rps26 depletion).

      Mock control corresponds to the cells treated with lipofectamine reagent and was included in the study to determine the “background” signal from cells treated with delivery agent and reagents used to measure the apoptosis process. These cells were neither expressing FMRpolyG, nor siRNAs. Luminescence signals were normalized to the values obtained from mock control. We added more details describing this assay in the Figure 1 legend.

      (6) The authors' data indicate that the effects are not specific to Rps26 but indeed also observed upon Rps25 knockdown. This suggests strongly that the effects are from reduced ribosome content or blocked protein synthesis. Additional controls should deplete a core RP to ascertain this conclusion.

      We agree that observed effects may stem from reduced ribosome content, however, we argue that this is the only possibility and explanation. Previously, it was shown that RPS25 regulates G4C2-related RAN translation, but knock out of RPS25 does not affect global translation (Yamada S, 2019, Nat. Neuroscience). Similarly, we showed that KD of RPS26 or TSR2 did not reduce significantly global translation rate (SUnSET assay; new Figure 2B and 5C, respectively).

      Moreover, in a new version of manuscript we included a control experiment, where we silenced core ribosomal protein (RPS6) and found that RPS6 depletion did not affect RAN translation from mutant FMR1 mRNA (new Figure 5C), thus strengthening our conclusion about specific RAN translation regulation by the level of RPS26 and RPS25.

      Finally, our observation aligns well with current knowledge about how deficiency of different ribosomal proteins alters translation of some classes of mRNAs (Luan Y, 2022, Nucleic Acids Res; Cheng Z, 2019, Mol Cell). It was shown that depletion of RPS26 affects translation rate of different mRNAs compared to depletion of other proteins of small ribosomal subunit.

      (7) Supplemental Figure S3 demonstrates that the depletion of S26 does not affect the selection of the start codon context. Any other claim must be deleted. All the 5'-UTR logos are essentially identical, indicating that "picking" happens by abundance (background).

      Supplementary Figure 3D represents results indicating that the mutation in -4 position (from G to A) did not affect the RAN translation regardless of RPS26 presence or depletion. However, this result does not imply that RPS26 does not affect the selection of start codon of sequence- or RNA structure-context. We verified this particular -4 position, as it was suggested previously as important RPS26-sensitive site in yeasts (Ferretti M, 2017, Nat Struct Mol Biol). We agree with Reviewer that all 5’UTR logos presented in our paper did not show statistical significance for neither tested position for human mRNAs. On the contrary, we observed that regulation sensitive to RPS26 level depends on the selection of start codon of RAN translation, in particular ACG initiation (new Figure 4F&G). RPS26 depletion affected ACG-initiated but not GTG- or CTG-initiated RAN translation.

      In the previous version of the manuscript, we wrote that we did not identify any specific motifs or enrichment within analyzed transcripts in comparison to the background. On the other hand, we found that the GC-content among analyzed transcripts is higher within 5’UTRs and in close proximity to ATG in coding sequences (Figure 4D), what suggests the importance of RNA stable structures in this region. In addition, we showed that mRNAs encoding proteins responding to RPS26 depletion have shorter than average 5’UTRs (new Figure 4E).

      (8) Mechanism is lacking entirely. There are many ways in which ribosomes could have mRNA-specific effects. The authors tried to find an effect from the Kozak sequence, unsuccessfully (however, they also did not do the experiment correctly, as they failed to recognize that the Kozak sequence differs between yeast, where it is A-rich, and mammalian cells, where it is GGCGCC). Collisions could be another mechanism.

      Indeed, collisions as well as other mechanisms such as skewed start codon fidelity may have an effect on efficiency of FMRpolyG biosynthesis. In the current version of the manuscript, we show that RPS26 amount-sensitive regulation seems to be start codonselection dependent (new Figure 4F&G).

      Reviewer #2 (Public Review):

      Summary:

      Translation of CGG repeats leads to the accumulation of poly G, which is associated with neurological disorders. This is a valuable paper in which the authors sought out proteins that modulate RAN translation. They determined which proteins in Hela cells bound to CGG repeats and affected levels of polyG encoded in the 5'UTR of the FMR1 mRNA. They then showed that siRNA depletion of ribosomal protein RPS26 results in less production of FMR1polyG than in control. There are data supporting the claim that RPS26 depletion modulates RAN translation in this RNA, although for some results, the Western results are not strong. The data to support increased aggregation by polyG expression upon S26 KD are incomplete.

      We thank the Reviewer for critical comments and suggestions. We sincerely appreciate your rigorous, insightful, and constructive feedback throughout the revision process.

      Below each specific point, we addressed the mentioned issues.

      Strengths:

      The authors have proteomics data that show the enrichment of a set of proteins on FMR1 RNA but not a related RNA.

      We thank Reviewer for appreciation of provided MS-screening results, which identified proteins enriched on FMR1 RNA with expanded CGG repeats.

      Weaknesses:

      - It is insinuated that RPS26 binds the RNA to enhance CGG-containing protein expression. However, RPS26 reduction was also shown previously to affect ribosome levels, and reduced ribosome levels can result in ribosomes translating very different RNA pools.

      In previous version of the manuscript we did not state that RPS26 binds directly to RNA with expanded CGG repeats and we did not show the experiment indicating direct interaction between studied RNA and RPS26. What we showed is that RPS26 was enriched on FMR1 RNA MS samples, however, we did not verify whether it is direct or indirect interaction. We also tried to test hypothesis that lack of RPS26 in PIC complex may affect efficiency of RAN translation initiation via specific, previously described in yeast Kozak context (Ferretti M, 2017, Nat Struct Mol Biol). As we described this hypothesis was negatively validated. However, we showed that other features of 5’UTR sequences (e.g. higher GC-content or shorter leader sequence) are potentially important for translation efficiency in cells with depleted RPS26.

      Indeed, RPS26 is involved in 40S maturation steps (Plassart L, 2021, eLife) and its insufficiency or mutations or blocking its inclusion to 40S ribosome may result in incomplete 40S maturation, which subsequently might negatively affect translation per se. However, we did not observe global translation inhibition after RPS26 depletion or depletion of TSR2, the chaperon involved in incorporation/exchange RPS26 to small ribosomal subunit (new Figure 2B and 5C). In addition, our SILAC-MS data indicates that majority of studied proteins (including FMRP, the main product of FMR1 gene) were not affected by RPS26 depletion which can be carefully extrapolated to global translation. In revised manuscript we also showed that relatively low silencing of RPS26 also decreased FMRpolyG production in model cells (new Figure 1D).

      We agree that reduced ribosome levels can result in different efficiency of translation of different RNA pools. We enhance this statement in revised manuscript. However, we also showed that the same mRNA containing different near cognate start codons (single/two nucleotide substitution) specific to RAN translation, or targeting this codon with antisense oligonucleotides resulted in altered sensitivity of FMR1 mRNA translation to RPS26 depletion (new Figure 4F).

      - A significant claim is that RPS26 KD alleviates the effects of FMRpolyG expression, but those data aren't presented well.

      We thank the Reviewer for this comment. In the new version of the manuscript, we have added new microscopic images and improved the explanation of Figure 1E. We have also completed the interpretation of Figure 1F in the main text, figure image as well as figure legend, and we hope that these changes will ameliorate understanding of our data.

      Recommendations For The Authors:

      - A significant claim is that RPS26 KD alleviates the effects of FMR polyG expression, but those data aren't presented well:

      Figure 1D (supporting data in S2) and 2D - the authors need to show representative images of a control that has aggregation and indicate aggregates being counted on an image. The legend states that there are no aggregates, but the quantification of aggregates/nucleus is ~1, suggesting there are at least 1 per cell. It is preferred to show at least a representative of what is quantified in the main figure instead of a bar graph.

      The representative images of control and siRPS26-treated cells are now shown in revised version of Figure 1E. Additionally, we completed the Figure legend concerning this part, as well as extended description of the experiment in Materials&Methods section.

      Figure 1E - it is unclear what luminescence signal is being measured. Is this a dye for an apoptotic marker? More information is needed in the legend.

      This information was added to the legend of modified Figure 1F (previously 1E) as suggested.

      - Some of the Western blots are not very convincing. Better evidence for the changes in bar graphs would improve how convincing the data are:

      Fig 2B. The western for FMR95G in the first model is not very convincing. The difference by eye for the second siRNA seems to give a larger effect than the first for 95G construct but they appear almost the same on the graph. More supporting information for the quantification is needed.

      We provided better explanation for WB quantification in M&M section in the manuscript. Alos, we provided additional blot demonstrating independent biological replicate of the mentioned experiment in supplementary materials (Supplementary Figure S2E).

      Figure 4A, the blots for RPS26 and FMR95G are not convincing. They are quite smeary compared to all of the others shown for these proteins in other figures. Could a different replicate be shown?

      We provided additional blot demonstrating the effect on transiently expressed FMRpolyG affected by depletion of TSR2 in COS7 cell line (Supplementary Figure S4A).

      Figure 5A and 5B blots are not ideal. Could a different replicate be shown? Or show multiple replicates in the supplemental figure?

      We provided additional blots from the same experiment, although data is not statistically significant, most likely due to low quality of normalization factor, which is Vinculin (Supplementary Figure S5A). Nevertheless, the level of FMRpolyG is decreased by ~70% after RPS25 silencing in SH-SY5Y cells.

      Figure 2C. Please use the same y axes for all four Westerns in B and C. One would like to compare 95 and 15 repeats, but it is difficult when the y axes are different.

      Thank you for this comment. The y axis was adjusted as suggested by the Reviewer.

      Figure 3D-The text suggests a significant difference between positive and negative responders that is not clear in the figure.

      In the main body of the manuscript we state that: “We did not observe any significant differences in the frequency of individual nucleotide positions in the 20-nucleotide vicinity of the start codon relative to the expected distribution in the BG”, which is in line with the graph showed in Figure 4D (previously 3D).

      Reviewer #3 (Public Review):

      Tutak et al provide interesting data showing that RPS26 and relevant proteins such as TSR2 and RPS25 affect RAN translation from CGG repeat RNA in fragile X-associated conditions. They identified RPS26 as a potential regulator of RAN translation by RNAtagging system and mass spectrometry-based screening for proteins binding to CGG repeat RNA and confirmed its regulatory effects on RAN translation by siRNA-based knockdown experiments in multiple cellular disease models and patient-derived fibroblasts. Quantitative mass spectrometry analysis found that the expressions of some ribosomal proteins are sensitive to RPS26 depletion while approximately 80% of proteins including FMRP were not influenced. Since the roles of ribosomal proteins in RAN translation regulation have not been fully examined, this study provides novel insights into this research field. However, some data presented in this manuscript are limited and preliminary, and their conclusions are not fully supported.

      (1) While the authors emphasized the importance of ribosomal composition for RAN translation regulation in the title and the article body, the association between RAN translation and ribosomal composition is apparently not evaluated in this work. They found that specific ribosomal proteins (RPS26 and RPS25) can have regulatory effects on RAN translation (Figures 1C, 2B, 2C, 2E, 4A, 5A, and 5B), and that the expression levels of some ribosomal proteins can be changed by RPS26 knockdown (Figure 3B, however, the change of the ribosome compositions involved in the actual translation has not been elucidated). Therefore, their conclusive statement, that is, "ribosome composition affects RAN translation" is not fully supported by the presented data and is misleading.

      We thank the Reviewer for critical comments and suggestions. We agree that the initial title and some statements in the text were misleading and the presented data did not fully support the aforementioned statement regarding ribosomal composition affecting FMRpolyG synthesis. Therefore, in the revised version of the manuscript we included a control experiment indicating that depletion of another core 40S ribosomal protein (RPS6) did not impact the FMRpolyG synthesis (new Figure 5C), which supports our hypothesis that RPS26 and RPS25 are specific CGG-related RAN translation modifiers. To precisely deliver a main message of our work, we changed the title that will indicate the specific effect of RPS26 and RPS25 insufficiency on RAN translation of FMRpolyG. Proposed title: “Insufficiency of 40S ribosomal proteins, RPS26 and RPS25 negatively affects biosynthesis of polyglycine-containing proteins in fragile-X associated conditions”. We also changed all statements regarding “ribosomal composition” in main text of the new version of manuscript.

      (2) The study provides insufficient data on the mechanisms of how RPS26 regulates RAN translation. Although authors speculate that RPS26 may affect initiation codon fidelity and regulate RAN translation in a CGG repeat sequence-independent manner (Page 9 and Page 11), what they really have shown is just identification of this protein by the screening for proteins binding to CGG repeat RNA (Figure 1A, 1B), and effects of this protein on CGG repeat-RAN translation. It is essential to clarify whether the regulatory effect of RPS26 on RAN translation is dependent on CGG repeat sequence or near-cognate initiation codons like ACG and GUG in the 5' upstream sequence of the repeat. It would be better to validate the effects of RPS26 on translation from control constructs, such as one composed of the 5' upstream sequence of FMR1 with no CGG repeat, and one with an ATG substitution in the 5' upstream sequence of FMR1 instead of near-cognate initiation codons.

      We agree that the data presented in the manuscript implies that insufficiency of RPS26 plays a pivotal role in the regulation of CGG-related RAN translation and in the revised version of the manuscript we included a series of experiments indicating that ACG codon selection seems to be an important part of RPS26 level-dependent regulation of polyglycine production (new Figure 4F&G; see point 3 below for more details). Importantly, in the luciferase assay showed on Figure 4F we used the AUG-initiated firefly luciferase reporter as normalization control.

      Moreover, to verify if FMRpolyG response to RPS26 deficiency depends on the type of reporter used, we repeated many experiments using FMRpolyG fused with different tags. The luciferase-based assays were in line with experiments conducted on constructs with GFP tag (new Figure 1D), thus strengthening our previous data. Moreover, in the series of experiments, we show that FMRP synthesis which is initiated from ATG codon located in FMR1 exon 1, was not affected by RPS26 depletion (Figure 3E & 4C), even though its translation occurs on the same mRNA as FMRpolyG. This indicates a specific RPS26 regulation of polyglycine frame initiated from ACG near cognate codon.

      (3) The regulatory effects of RPS26 and other molecules on RAN translation have all been investigated as effects on the expression levels of FMRpolyG-GFP proteins in cellular models expressing CGG repeat sequences Figures 1C, 2B, 2C, 2E, 4A, 5A, and 5B). In these cellular experiments, there are multiple confounding factors affecting the expression levels of FMRpolyG-GFP proteins other than RAN translation, including template RNA expression, template RNA distribution, and FMRpolyG-GFP protein degradation. Although authors evaluated the effect on the expression levels of template CGG repeat RNA, it would be better to confirm the effect of these regulators on RAN translation by other experiments such as in vitro translation assay that can directly evaluate RAN translation.

      We agree that there are multiple factors affecting final levels of FMRpolyG-GFP proteins including aforementioned processes. We evaluated the level of FMR1 mRNA, which turned out not to be decreased upon RPS26 depletion (Figure 3B&C), therefore, we assumed that what we observed, was the regulation on translation level, especially that RPS26 is a ribosomal protein contacting mRNA in E-site. We believe that direct assays such as in vitro translation may be beneficial, however, depletion of RPS26 from cellular lysate provided by the vendor seems technically challenging, if not completely impossible. Instead, we focused on sequence/structure specific regulation of RAN translation with the emphasis on start-codon initiation selection. It resulted in generating the valuable results pointing out the RPS26 role in start codon fidelity (Figure 4F&G). These new results showed that translation from mRNAs differing just in single or two nucleotide substitution in near cognate start codon (ACG to GUG or ACG to CUG), although results in exactly the same protein, is differently sensitive to RPS26 silencing (new Figure 4F). Similar differences were observed for translation efficiency from the same mRNA targeted or not with antisense oligonucleotide complementary to the region of RAN translation initiation codon (new Figure 4G). These results also suggest that stability of FMRpolyG is not affected in cells with decreased level of RPS26.

      (4) While the authors state that RPS26 modulated the FMRpolyG-mediated toxicity, they presented limited data on apoptotic markers, not cellular viability (Figure 1E), not fully supporting this conclusion. Since previous work showed that FMRpolyG protein reduces cellular viability (Hoem G, 2019,Front Genet), additional evaluations for cellular viability would strengthen this conclusion.

      We thank the Reviewer for this suggestion. We addressed the apoptotic process in order to determine the effect of RPS26 depletion on RAN translation related toxicity (Figure 1F). In revised version of the manuscript, we also added the evaluation on how cells proliferation was affected by RPS26, RPS25, RPS6 and TSR2 depletion. Our data indicate that TSR2 silencing slightly impacted the cellular fitness (new Figure 5D), whereas insufficiencies of RPS26, RPS25 and RPS6 had a much stronger negative effect on proliferation (new Figure 2A, 5D, 6C), which is in line with previous data (Cheng Z 2019, Mol Cell; Luan Y, 2022, Nucleic Acids Res). The difference in proliferation rate after treatment with siRPS26 makes proper interpretation of cellular viability assessment very difficult.

      Recommendations For The Authors:

      (1) It would be nice to validate the effects of overexpression of RPS26 and other regulators on RAN translation, not limited to knockdown experiments, to support the conclusion.

      We did not performed such experiments because we believed that RPS26 overexpression may have no or marginal effect on translation or RAN translation. It is likely impossible to efficiently incorporate overexpressed RPS26 into 40S subunits, because the concentration of all ribosomal proteins in the cells is very high.

      (2) It would be better to explain how authors selected 8 proteins for siRNA-based validation (Figure 1C, 1D, S1D) from 32 proteins enriched in CGG repeat RNA in the first screening.

      We selected those candidates based on their functions connected to translation, structured RNA unwinding or mRNA processing. For example, we tested few RNA helicases because of their known function in RAN translation regulation described by other researchers. This explanation was added to the revised version of the manuscript.

      (3) Original image data showing nuclear FMRpolyG-GFP aggregates should be presented in Figure 1D.

      The representative images of control and siRPS26-treated cells are now shown in modified version of Figure 1E and described with more details in the legend.

      (4) Image data in Figure 2A and 2D have poor signal/noise ratio and the resolution should be improved. In addition, aggregates should be clearly indicated in Figure 2D in an appropriate manner.

      The stable S-FMR95xG cellular model is characterized by very low expression of RANtranslated FMR95xG, therefore, it is challenging to obtain microscopic images of better quality with higher GFP signal. In the L-99xCGG model expression of transgene is higher. Therefore, we provided new image in the new version of Figure 3D (former 2D). Moreover, we showed aggregates on the image obtained using confocal microscopy (new Supplementary Figure 2D).

      (5) The detailed information on patient-derived fibroblast (age and sex of the patient, the number of CGG repeats, etc.) in Figure 2F needed to be presented.

      This information was added to the figure legend (Figure 3F; previously 2F) and in the Material and Methods section as suggested.

      (6) It would be better to normalize RNA expression levels of FMR1 and FMR1-GFP by the housekeeping gene in Figure S2C, like other RT-qPCR experimental data such as Figure 2B.

      Normalization of FMR1-GFP to GAPDH is now shown in modified version of Figure S2C (right graph) as requested by the Reviewer.

      (7) It would be better to add information on molecular weight on all Western blotting data.

      (8) Marks corresponding to molecular weight ladder were added to all images.

      Full blots, including protein ladders were deposited in Zenodo repository, under doi: 10.5281/zenodo.13860370

      References

      Cheng Z, Mugler CF, Keskin A, Hodapp S, Chan LYL, Weis K, Mertins P, Regev A, Jovanovic M & Brar GA (2019) Small and Large Ribosomal Subunit Deficiencies Lead to Distinct Gene Expression Signatures that Reflect Cellular Growth Rate. Mol Cell 73: 36-47.e10

      Havkin-Solomon T, Fraticelli D, Bahat A, Hayat D, Reuven N, Shaul Y & Dikstein R (2023) Translation regulation of specific mRNAs by RPS26 C-terminal RNA-binding tail integrates energy metabolism and AMPK-mTOR signaling. Nucleic Acids Res 51: 4415–4428

      Hoem,G., Larsen,K.B., Øvervatn,A., Brech,A., Lamark,T., Sjøttem,E. and Johansen,T. (2019) The FMRpolyGlycine protein mediates aggregate formation and toxicity independent of the CGG mRNA hairpin in a cellular model for FXTAS. Front. Genet., 10, 1–18.

      Luan Y, Tang N, Yang J, Liu S, Cheng C, Wang Y, Chen C, Guo YN, Wang H, Zhao W, et al (2022) Deficiency of ribosomal proteins reshapes the transcriptional and translational landscape in human cells. Nucleic Acids Res 50: 6601–6617

      Plassart L, Shayan R, Montellese C, Rinaldi D, Larburu N, Pichereaux C, Froment C, Lebaron S, O’donohue MF, Kutay U, et al (2021) The final step of 40s ribosomal subunit maturation is controlled by a dual key lock. Elife 10

    1. Author response:

      The following is the authors’ response to the original reviews.

      Reviewer #1 (Public Review):

      Summary:

      his study shows a new mechanism of GS regulation in the archaean Methanosarcina mazei and clarifies the direct activation of GS activity by 2-oxoglutarate, thus featuring another way in which 2-oxoglutarate acts as a central status reporter of C/N sensing.

      Mass photometry and single particle cryoEM structure analysis convincingly show the direct regulation of GS activity by 2-OG promoted formation of the dodecameric structure of GS. The previously recognized small proteins GlnK1 and Sp26 seem to play a subordinate role in GS regulation, which is in good agreement with previous data. Although these data are quite clear now, there remains one major open question: how does 2-OG further increase GS activity once the full dodecameric state is achieved (at 5 mM)? This point needs to be reconsidered.

      Weaknesses:

      It is not entirely clear, how very high 2-OG concentrations activate GS beyond dodecamer formation.

      The data presented in this work are in stark contrast to the previously reported structure of M. mazei GS by the Schumacher lab. This is very confusing for the scientific community and requires clarification. The discussion should consider possible reasons for the contradictory results.

      Importantly, it is puzzling how Schumacher could achieve an apo-structire of dodecameric GS? If 2-OG is necessary for dodecameric formation, this should be discussed. If GlnK1 doesn't form a complex with the dodecameric GS, how could such a complex be resolved there?

      In addition, the text is in principle clear but could be improved by professional editing. Most obviously there is insufficient comma placement.

      We thank Reviewer #1 for the professional evaluation and raising important points. We will address those comments in the updated manuscript and especially improve the discussion in respect to the two points of concern.

      (1) How can GlnA1 activity further be stimulated with further increasing 2-OG after the dodecamer is already fully assembled at 5 mM 2-OG.

      We assume a two-step requirement for 2-OG, the dodecameric assembly and the priming of the active sites. The assembly step is based on cooperative effects of 2-OG and does not require the presence of 2-OG in all 2-OG-binding pockets: 2-OG-binding to one binding pocket also causes a domino effect of conformational changes in the adjacent 2-OG-unbound subunit, as also described for Methanothermococcus thermolithotrophicus GS in Müller et al. 2023. Due to the introduction of these conformational changes, the dodecameric form becomes more favourable even without all 2-OG binding sites being occupied. With higher 2-OG concentrations present (> 5mM), the activity increased further until finally all 2-OG-binding pockets were occupied, resulting in the priming of all active sites (all subunits) and thereby reaching the maximal activity.

      (2) The contradictory results with previously published data on the structure of M. mazei by Schumacher et al. 2023.

      We certainly agree that it is confusing that Schumacher et al. 2023 obtained a dodecameric structure without the addition of 2-OG, which we claim to be essential for the dodecameric form. 2-OG is a cellular metabolite that is naturally present in E. coli, the heterologous expression host both groups used. Since our main question focused on analysing the 2-OG effect on GS, we have performed thorough dialysis of the purified protein to remove all 2-OG before performing MP experiments. In the absence of 2-OG we never observed significant enzyme activity and always detected a fast disassembly after incubation on ice. We thus assume that a dodecamer without 2-OG in Schumacher et al. 2023 is an inactive oligomer of a once 2-OG-bound form, stabilized e.g. by the presence of 5 mM MgCl2.

      The GlnA1-GlnK1-structure (crystallography) by Schumacher et al. 2023 is in stark contrast to our findings that GlnK1 and GlnA1 do not interact as shown by mass photometry with purified proteins. A possible reason for this discrepancy might be that at the high protein concentrations used in the crystallization assay, complexes are formed based on hydrophobic or ionic protein interactions, which would not form under physiological concentrations.

      Reviewer #2 (Public Review):

      Summary:

      Herdering et al. introduced research on an archaeal glutamine synthetase (GS) from Methanosarcina mazei, which exhibits sensitivity to the environmental presence of 2-oxoglutarate (2-OG). While previous studies have indicated 2-OG's ability to enhance GS activity, the precise underlying mechanism remains unclear. Initially, the authors utilized biophysical characterization, primarily employing a nanomolar-scale detection method called mass photometry, to explore the molecular assembly of Methanosarcina mazei GS (M. mazei GS) in the absence or presence of 2-OG. Similar to other GS enzymes, the target M. mazei GS forms a stable dodecamer, with two hexameric rings stacked in tail-to-tail interactions. Despite approximately 40% of M. mazei GS existing as monomeric or dimeric entities in the detectable solution, the majority spontaneously assemble into a dodecameric state. Upon mixing 2-OG with M. mazei GS, the population of the dodecameric form increases proportionally with the concentration of 2-OG, indicating that 2-OG either promotes or stabilizes the assembly process. The cryo-electron microscopy (cryo-EM) structure reveals that 2-OG is positioned near the interface of two hexameric rings. At a resolution of 2.39 Å, the cryo-EM map vividly illustrates 2-OG forming hydrogen bonds with two individual GS subunits as well as with solvent water molecules. Moreover, local side-chain reorientation and conformational changes of loops in response to 2-OG further delineate the 2-OG-stabilized assembly of M. mazei GS.

      Strengths & Weaknesses:

      The investigation studies the impact of 2-oxoglutarate (2-OG) on the assembly of Methanosarcina mazei glutamine synthetase (M mazei GS). Utilizing cutting-edge mass photometry, the authors scrutinized the population dynamics of GS assembly in response to varying concentrations of 2-OG. Notably, the findings demonstrate a promising and straightforward correlation, revealing that dodecamer formation can be stimulated by 2-OG concentrations of up to 10 mM, although GS assembly never reaches 100% dodecamerization in this study. Furthermore, catalytic activities showed a remarkable enhancement, escalating from 0.0 U/mg to 7.8 U/mg with increasing concentrations of 2-OG, peaking at 12.5 mM. However, an intriguing gap arises between the incomplete dodecameric formation observed at 10 mM 2-OG, as revealed by mass photometry, and the continued increase in activity from 5 mM to 10 mM 2-OG for M mazei GS. This prompts questions regarding the inability of M mazei GS to achieve complete dodecamer formation and the underlying factors that further enhance GS activity within this concentration range of 2-OG.

      Moreover, the cryo-electron microscopy (cryo-EM) analysis provides additional support for the biophysical and biochemical characterization, elucidating the precise localization of 2-OG at the interface of two GS subunits within two hexameric rings. The observed correlation between GS assembly facilitated by 2-OG and its catalytic activity is substantiated by structural reorientations at the GS-GS interface, confirming the previously reported phenomenon of "funnel activation" in GS. However, the authors did not present the cryo-EM structure of M. mazei GS in complex with ATP and glutamate in the presence of 2-OG, which could have shed light on the differences in glutamine biosynthesis between previously reported GS enzymes and the 2-OG-bound M. mazei GS.

      Furthermore, besides revealing the cryo-EM structure of 2-OG-bound GS, the study also observed the filamentous form of GS, suggesting that filament formation may be a universal stacking mechanism across archaeal and bacterial species. However, efforts to enhance resolution to investigate whether the stacked polymer is induced by 2-OG or other factors such as ions or metabolites were not undertaken by the authors, leaving room for further exploration into the mechanisms underlying filament formation in GS.

      We thank Reviewer #2 for the detailed assessment and valuable input. We will address those comments in the updated manuscript and clarify the message.

      (1) The discrepancy of the dodecamer formation (max. at 5 mM 2-OG) and the enzyme activity (max. at 12.5 mM 2-OG). We assume that there are two effects caused by 2-OG: 1. cooperativity of binding (less 2-OG needed to facilitate dodecamer formation) and 2. priming of each active site. See also Reviewer #1 R.1). We assume this is the reason why the activity of dodecameric GlnA1 can be further enhanced by increased 2-OG concentration until all catalytic sites are primed.

      (2) The lack of the structure of a 2-OG and ATP-bound GlnA1. Although we strongly agree that this would be a highly interesting structure, it seems out of the scope of a typical revision to request new cryo-EM structures. We evaluate the findings of our present study concerning the 2-OG effects as important insights into the strongly discussed field of glutamine synthetase regulation, even without the requested additional structures.

      (3) The observed GlnA1-filaments are an interesting finding. We certainly agree with the referee on that point, that the stacked polymers are potentially induced by 2-OG or ions. However, it is out of the main focus of this manuscript to further explore those filaments. Nevertheless, this observation could serve as an interesting starting point for future experiments.

      Reviewer #3 (Public Review):

      Summary:

      The current manuscript investigates the effect of 2-oxoglutarate and the Glk1 protein as modulators of the enzymatic reactivity of glutamine synthetase. To do this, the authors rely on mass photometry, specific activity measurements, and single-particle cryo-EM data.

      From the results obtained, the authors convey that glutamine synthetase from Methanosarcina mazei exists in a non-active monomeric/dimeric form under low concentrations of 2-oxoglutarate, and its oligomerization into a dodecameric complex is triggered by higher concentration of 2-oxoglutarate, also resulting in the enhancement of the enzyme activity.

      Strengths:

      Glutamine synthetase is a crucial enzyme in all domains of life. The dodecameric fold of GS is recurrent amongst prokaryotic and archaea organisms, while the enzyme activity can be regulated in distinct ways. This is a very interesting work combining protein biochemistry with structural biology.

      The role of 2-OG is here highlighted as a crucial effector for enzyme oligomerization and full reactivity.

      Weaknesses:

      Various opportunities to enhance the current state-of-the-art were missed. In particular, omissions of the ligand-bound state of GnK1 leave unexplained the lack of its interaction with GS (in contradiction with previous results from the authors). A finer dissection of the effect and role of 2-oxoglurate are missing and important questions remain unanswered (e.g. are dimers relevant during early stages of the interaction or why previous GS dodecameric structures do not show 2-oxoglutarate).

      We thank Reviewer #3 for the expert evaluation and inspiring criticism.

      (1) Encouragement to examine ligand-bound states of GlnK1. We agree and plan to perform the suggested experiments exploring the conditions under which GlnA1 and GlnK1 might interact. We will perform the MP experiments in the presence of ATP. In GlnA1 activity test assays when evaluating the presence/effects of GlnK1 on GlnA1 activity, however, ATP was always present in high concentrations and still we did not observe a significant effect of GlnK1 on the GlnA1 activity.

      (2) The exact role of 2-OG could have been dissected much better. We agree on that point and will improve the clarity of the manuscript. See also Reviewer #1 R.1.

      (3) The lack of studies on dimers. This is actually an interesting point, which we did not consider during writing the manuscript. Now, re-analysing all our MP data in this respect, GlnA1 is likely a dimer as smallest species. Consequently, we will add more supplementary data which supports this observation and change the text accordingly.

      (4) Previous studies and structures did not show the 2-OG. We assume that for other structures, no additional 2-OG was added, and the groups did not specifically analyse for this metabolite either. All methanoarchaea perform methanogenesis and contain the oxidative part of the TCA cycle exclusively for the generation of glutamate (anabolism) but not a closed TCA cycle enabling them to use internal 2-OG concentration as internal signal for nitrogen availability. In the case of bacterial GS from organisms with a closed TCA cycle used for energy metabolism (oxidation of acetyl CoA) like e.g. E. coli, the formation of an active dodecameric GS form underlies another mechanism independent of 2-OG. In case of the recent M. mazei GS structures published by Schumacher et al. 2023, the dodecameric structure is probably a result from the heterologous expression and purification from E. coli. (See also Reviewer #1 R.2). One example of methanoarchaeal glutamine synthetases that do in fact contain the 2-OG in the structure, is Müller et al. 2023.

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      Specific issues:

      L 141: 2-OG levels increase due to slowing GOGAT reaction (due to Gln limitation as a consequence of N-starvation).... (2-OG also increases in bacteria that lack GDH...)

      As the GS-GOGAT cycle is the major route of ammonium assimilation, consumption of 2-OG by GDH is probably only relevant under high ammonium concentrations.

      In Methanoarchaea, GS is strictly regulated and expression strongly repressed under nitrogen sufficiency - thus glutamate for anabolism is mainly generated by GDH under N sufficiency consuming 2-OG delivered by the oxidative part of the TCA cycle (Methanogenesis is the energy metabolism in methanoarchaea, a closed TCA cycle is not present) thus 2-OG is increasing under nitrogen limitation, when no NH3 is available for GDH.

      L148: it is not clear what is meant by: "and due to the indirect GS activity assay"

      We apologize for not being clear here. The GS activity assay used is the classical assay by Sahpiro & Stadtman 1970 and is a coupled optical test assay (coupling the ATP consumption of the GS activity to the oxidation of NADH by lactate dehydrogenase). Based on the coupled test assay the measurements of low activities show a high deviation. We now added this information in the revised MS respectively.

      L: 177: arguing about 2-OG affinities: more precisely, the 0.75 mM 2-OG is the EC50 concentration of 2-OG for triggering dodecameric formation; it might not directly reflect the total 2-OG affinity, since the affinity may be modulated by (anti)cooperative effects, or by additional sites... as there may be different 2-OG binding sites involved... (same in line 201)

      Thank you for the valuable input. We changed KD to EC50 within the entire manuscript. Concerning possible additional 2-OG binding sites: we did not see any other 2-OG in the cryo-EM structure aside from the described one and we therefore assume that the one described in the manuscript is the main and only one. Considering the high amounts of 2-OG (12.5 mM) used in the structure, it is quite unlikely that additional 2-OG sites exist since they would have unphysiologically low affinities.

      In this respect, instead of the rather poor assay shown in Figure 1D, a more detailed determination of catalytic activation by different 2-OG concentrations should be done (similar to 1A)... This would allow a direct comparison between dodecamerization and enzymatic activation.

      We agree and performed the respective experiments, which are now presented in revised Fig. 1D

      Discussion: the role of 2-OG as a direct activator, comparison with other prokaryotic GS: in other cases, 2-OG affects GS indirectly by being sensed by PII proteins or other 2-OG sensing mechanisms (like 2OG-NtcA-mediated repression of IF factors in cyanobacteria)

      We agree and have added that information in the discussion as suggested.

      290. Unclear: As a second step of activation, the allosteric binding of 2-OG causes a series of conformational.... where is this site located? According to the catalytic effects (compare 1A and 1D) this site should have a lower affinity …

      Thank you very much for pointing this out. Binding of 2-OG only occurs in one specific allosteric binding-site. Binding however, has two effects on the GlnA1: dodecamer assembly and priming of the active site (with two specific EC50, which are now shown in Fig. 1A and D).

      See also public comment #1 (1).

      Reviewer #2 (Recommendations For The Authors):

      The primary concern for me is that mass photometry might lead to incorrect conclusions. The differences in the forms of GS seen in SEC and MP suggest that GS can indeed form a stable dodecamer when the concentration of GS is high enough, as shown in Figure S1B. I strongly suggest using an additional biophysical method to explore the connection between GS and 2-OG in terms of both assembly and activity, to truly understand 2-OG's role in the process of assembly and catalysis.

      We apologize if we did not present this clear enough, however the MP analysis of GlnA1 in the absence of 2-OG showed always (monomers/) dimers, dodecamers were only present in the presence of 2-OG. The SEC analysis in Fig. S1B has been performed in the presence of 12.5 mM 2-OG, we realized this information is missing in the figure legend - we now added this in the revised version. The 2-OG is in addition visible in the Cryo EM structure. Thus, we do not agree to perform additional biophysical methods.

      As for the other experimental findings, they appear satisfactory to me, and I have no reservations regarding the cryoEM data.

      (1) Mass photometry is a fancy technique that uses only a tiny amount of protein to study how they come together. However, the concentration of the protein used in the experiment might be lower than what's needed for them to stick together properly. So, the authors saw a lot of single proteins or pairs instead of bigger groups. They showed in Figure S1B that the M. mazei GS came out earlier than a 440-kDa reference protein, indicating it's actually a dodecamer. But when they looked at the dodecamer fraction using mass photometry, they found smaller bits, suggesting the GS was breaking apart because the concentration used was too low. To fix this, they could try using a technique called analytic ultracentrifuge (AUC) with different amounts of 2-OG to see if they can spot single proteins or pairs when they use a bit more GS. They could also try another technique called SEC-MALS to do similar tests. If they do this, they could replace Figure 1A with new data showing fully formed GS dodecamers when they use the right amount of 2-OG.

      Thank you for this input. In MP we looked at dodecamer formation after removing the 2-OG entirely and re-adding it in the respective concentration. We think that GlnA1 is much more unstable in its monomeric/dimeric fraction and that the complete and harsh removal of 2-OG results in some dysfunctional protein which does not recover the dodecameric conformation after dialysis and re-addition of 2-OG. Looking at the dodecamer-peak right after SEC however, we exclusively see dodecamers, which is now included as an additional supplementary figure (suppl. Fig. 1C). Consequently, we did not perform additional experiments.

      (2) Building on the last point, the estimated binding strength (Kd) between 2-OG and GS might be lower than it really is, because the GS often breaks apart from its dodecameric form in this experiment, even though 2-OG helps keep the pairs together, as seen with cryoEM. What if they used 5-10 times more GS in the mass photometry experiment? Would the estimated bond strength stay the same? Could they use AUC or other techniques like ITC to find out the real, not just estimated, strength of the bond?

      We agree that the term KD is not suitable. We have changed the term KD to EC50 as suggested by reviewer #1, which describes the effective concentration required for 50 % dodecamer assembly. Furthermore, we disagree that the dodecamer breaks apart when the concentrations are as low as in MP experiments. The actual reason for the breaking is rather the harsh dialysis to remove all 2-OG before MP experiments. Right after SEC, the we exclusively see dodecamer in MP (suppl. Fig. S1C). See also #2 (1).

      (3) The fact that the GS hardly works without 2-OG is interesting. I tried to understand the experiment setup, but it wasn't clear as the protocol mentioned in the author's 2021 FEBS paper referred to an old paper from 1970. The "coupled optical test assay" they talked about wasn't explained well. I found other papers that used phosphometry assays to see how much ATP was used up. I suggest the authors give a better, more detailed explanation of their experiments in the methods section. Also, it's unclear why the GS activity keeps going up from 5 to 12.5 mM 2-OG, even though they said it's saturated. They suggested there might be another change happening from 5 to 12.5 mM 2-OG. If that's the case, they should try to get a cryo-EM picture of the GS with lots of 2-OG, both with and without ATP/glutamate (or the Met-Sox-P-ADP inhibitor), to see what's happening at a structural level during this change caused by 2-OG.

      We agree with the reviewer that the GS assay was not explained in detail (since published and known for several years). However, we now added the more detailed description of the assay in the revised MS, which also measures the ATP used up by GS, but couples the generation of ADP to an optical test assay producing pyruvate from PEP with the generated ADP catalysed by pyruvate kinase present in the assay. This generated pyruvate is finally reduced to lactate by the present lactate dehydrogenase consuming NADH, the reduction of which is monitored at 340 nm.

      The still increasing activity of GS after dodecamer formation (max. at 5 mM 2-OG) and the continuously increasing enzyme activity (max. at 12.5 mM 2-OG): See also public reviews, we assume that there are two effects caused by 2-OG: 1. cooperativity of binding (less 2-OG needed to facilitate dodecamer formation) and 2. priming of each active site.

      The suggested additional experiments with and without ATP/Glutamate: Although we strongly agree that this would be a highly interesting structure, it seems out of the scope of a typical revision to request new cryo-EM structures. We evaluate the findings of our present study concerning the 2-OG effects as important insights into the strongly discussed field of glutamine synthetase regulation, even without the requested additional structures.

      (4) Please remake Figure S2, the panels are too small to read the words. At least I have difficulty doing so.

      We assume the reviewer is pointing to Suppl. Fig S3, we now changed this figure accordingly.

      Line 153, the reference Schumacher et al. 23, should be 2023?

      Yes, thank you. We corrected that.

      Line 497. I believe it's UCSF ChimeraX, not Chimera.

      We apologize and corrected accordingly.

      Reviewer #3 (Recommendations For The Authors):

      Recent studies on the Methanothermococcus thermolithotrophicus glutamine synthetase, published by Müller et al., 2024, have identified the binding site for 2-oxoglutarate as well as the conformational changes that were induced in the protein by its presence. In the present study, the authors confirm these observations and additionally establish a link between the presence of 2-oxoglutarate and the dodecameric fold and full activation of GS.

      Curiously, here, the authors could not confirm their own findings that the dodecameric GS can directly interact with the PII-like GlnK1 protein and the small peptide sP26. However, the lack of mention of the GlnK-bound state in these studies is very alarming since it certainly is highly relevant here.

      We agree with the reviewer that we have not observed the interaction with GlnK1 and sP26 in the recent study. Consequently, we speculate that yet unknown cellular factor(s) might be required for an interaction of GlnA1 with GlnK1 and sP26, which were not present in the in vitro experiments using purified proteins, however they were present in the previous pull-down approaches (Ehlers et al. 2005, Gutt et al. 2021). Another reason might be that post-translational modifications occur in M. mazei, which might be important for the interaction, which are also not present in purified proteins expressed in E. coli.

      The manuscript interest could have been substantially increased if the authors had done finer biochemical and enzymatic analyses on the oligomerization process of GS, used GlnK1 bound to known effectors in their assays and would have done some more efforts to extrapolate their findings (even if a small niche) of related glutamine synthetases.

      We thank the reviewer for their valuable encouragement to explore ligand-bound-states of GlnK1. However, in this manuscript we mainly focused on 2-OG as activator of GlnA1 and decided to dedicate future experiments to the exploration of conditions that possibly favor GlnK1-binding.

      In principle, we have explored the ATP bound GlnK1 effects on GlnA1 activity in the activity assays (Fig. 2E) since ATP (3.6 mM) is present. GlnK1 however showed no effects on GlnA1 activity.

      In general, the manuscript is poorly written, with grammatically incorrect sentences that at times, which stands in the way of passing on the message of the manuscript.

      Particular points:

      (1) It is mentioned that 2-OG induces the active oligomeric (dodecamer, 12-mer) state of GlnA1 without detectable intermediates. However, only 62 % of the starting inactive enzyme yields active 12-mers. Note that this is contradicted in line 212.

      Thanks for pointing out this discrepancy. After removing all 2-OG as we did before MP-experiments, GlnA1 doesn’t reach full dodecamers anymore when 2-OG is re-added. This is not because the 2-OG amount is not enough to trigger full assembly, but because the protein is much more unstable in the absence of 2-OG, so we predict that some GlnA1 breaks during dialysis. See also answer reviewer #2 (1) and supplementary figure S1C.

      Is there any protein precipitation upon the addition of 2-OG? Is all protein being detected in the assay, meaning, is monomer/dimer + dodecamer yields close to 100% of the total enzyme in the assay?

      There is no protein precipitation upon the addition of 2-OG, indeed, GlnA1 is much more stable in the presence of 2-OG. In the mass photometry experiments, all particles are measured, precipitated protein would be visible as big entities in the MP.

      Please add to Figure 1 the amount of monomer/dimer during titration. Some debate why there is no full conversion should be tentatively provided.

      We agree with the reviewer and included the amount of monomer/dimer in the figure, as well as some discussion on why it is not fully converted again. GlnA1 is unstable without 2-OG and it was dialysed against buffer without 2-OG before MP measurements. This sample mistreatment resulted in no full re-assembly after re-adding 2-OG (although full dodecamers before dialysis (suppl. Fig. S1C).

      (2) Figure 1B reflects an exemplary result. Here, the addition of 0.1 mM 2-OG seems to promote monomer to dimer transition. Why was this not studied in further detail? It seems highly relevant to know from which species the dodecamer is assembled.

      We thank the reviewer for their comment. However, we would like to point out that, although not shown in the figure, GlnA1 is always mainly present as dimers as the smallest entity. As suggested earlier, we have added the amount of monomers/dimers to Figure 1A, which shows low monomer-counts at all 2-OG concentrations (Fig.1A). Although not depicted in the graph starting at 0.01 mM OG, we also see mainly dimers at 0 mM 2-OG.

      How does the y-axis compare to the number and percentage of counts assigned to the peaks? In line 713, it is written that the percentage of dodecamer considers the total number of counts, and this was plotted against the 2-OG concentration.

      We thank the reviewer for addressing this unclarity. Line 713 corresponds to Figure 1A, where we indeed plotted the percentage of dodecamer against the 2-OG-concentration. Thereby, the percentage of dodecamer corresponds to the percentage calculated from the Gaussian Fit of the MP-dodecamer-peak. In Figure 1 B, however, the y-axis displays the relative amount of counts per mass, multiple similar masses then add up to the percentage of the respective peak (Gaussian Fit above similar masses).

      (3) Lines 714 and 721 (and elsewhere): Why only partial data is used for statistical purposes?

      We in general only show one exemplary biological replicate, since the quality of the respective GlnA1 purification sometimes varied (maximum activity ranging from 5 - 10 U/mg). Therefore, we only compared activities within the same protein purification. For the EC50 calculations of all measurements, we refer to the supplement.

      (4) Lines 192-193: It is claimed that GlnK1 was previously shown to both regulate the activity of GlnA1 and form a complex with GlnA1. Please mention the ratio between GlnK1 and GlnA1 in this complex.

      We now included the requested information (GlnA1:GlnK1 1:1, (Ehlers et al. 2005); His6-GlnA1 (0.95 μM), His6-GlnK1 (0.65 μM); 2:1,4, Gutt et al. 2021).

      It is also known that PII proteins such as GlnK1 can bind ADP, ATP, and 2-OG. Interestingly, however, for various described PII proteins, 2-OG can only bind after the binding of ATP.

      So, the crucial question here is what is the binding state of GlnK1? 

      Were these assays performed in the absence of ATP? This is key to fully understand and connect the results to the previous observations. For example, if the GlnK1 used was bound to ADP but not to ATP, then the added 2-OG might indeed only be able to affect GlnA1 (leading to its activation/oligomerization). If this were true and according to the data reported, ADP would prevent GlnK1 from interacting with any oligomeric form of GlnA1. However, if GlnK1 bound to ATP is the form that interacts with GlnA1 (potentially validating previous results?) then, 2-OG would first bind to GlnK1 (assuming a higher affinity of 2-OG to GlnK1), eventually causing its release from GlnA1 followed by binding and activation of GlnA1.

      These experiments need to be done as they are essential to further understand the process. Given the ability of the authors to produce the protein and run such assays, it is unclear why they were not done here. As written in line 203, in this case, "under the conditions tested" is not a good enough statement, considering what is known in the field and how many more conclusions could easily be taken from such a setup.

      Thanks for the encouragement to investigate the ligand-bound states of GlnK1. We agree and plan to perform the suggested mass photometry experiments exploring the conditions under which GlnA1 and GlnK1 might interact in future work. In GlnA1 activity test assays, when evaluating the presence/effects of GlnK1 on GlnA1 activity, however, ATP was always present in high concentrations and still we did not observe a significant effect of GlnK1 on the GlnA1 activity.

      (5) Figure 2D legend claims that the graphic shows the percentage of dodecameric GlnA1 as a function of the concentration of 2-OG. This is not what the figure shows; Figure 2D shows the dodecamer/dimer (although legend claims monomer was used, in line 732) ratio as a function of 2-OG (stated in line 736!). If this is true, a ratio of 1 means 50 % of dodecamers and dimers co-exist. This appears to be the case when GlnK1 was added, while in the absence of GlnK1 higher ratios are shown for higher 2-OG concentration implying that about 3 times more dodecamers were formed than dimers. However, wouldn´t a 50 % ratio be physiologically significant?

      We apologize for the partially incorrect and also misleading figure legend and corrected it. Indeed, the ratio of dodecamers and dimers is shown. Furthermore, we did not use monomeric GlnA1 (the smallest entity is mainly a dimer, see Fig 1A), however, the molarity was calculated based on the monomer-mass. Concerning the significance of the difference between the maximum ratio of GlnA1 and GlnK1: The ratio does appear higher, but this is mostly because adding large quantities of GlnK1 broadens all peaks at low molecular weight. This happens because the GlnK1 signal starts overlapping with the signal from GlnA1, leading to inflated GlnA1 dimer counts. We therefore do not think that this is biologically significant, especially as the activities do not differ under these conditions.

      (6) Is it possible that the uncleaved GlnA1 tag is preventing interaction with GlnK1? This should be discussed.

      This is of course a very important point. We however realized that Schumacher et al. also used an N-terminal His-tag, so we assume that the N-terminal tag is not hampering the interaction.

      (7) Line 228: Please detail the reported discrepancies in rmsd between the current protein and the gram-negative enzymes.

      The differences in rmsd between our M.mazei GlnA1 structure and the structure of gram-negative enzymes is caused by a) sequence similarity: E.g. M.mazei GlnA1 compared to B.subtilis GlnA have a sequence percent identity of 58.47; b) ligands in the structure: The B.Subtilis structure contains L-Methionine-S-sulfoximine phosphate, a transition state inhibitor, while the M. mazei  structure contains 2OG; c) Methodology: The structural determination methods also contribute to these differences. B. subtilis GlnA was determined using X-ray crystallography, while the M. mazei GlnA1 structure was resolved using Cryo-EM, where the protein behaves differently in ice compared to a crystal.

      (8) Line 747: The figure title claims "dimeric interface" although the manuscript body only refers to "hexameric interface" or "inter-hexamer interface" (line 224). Moreover, the figure 4 legend uses terms such as vertical and horizontal dimers and this too should be uniformized within the manuscript.

      Thank you for your valuable feedback. We have updated both the figure title and the figure legend as well in the main text to ensure consistency in the description.

      (9) Line 752: The description of the color scheme used here is somehow unclear.

      Thanks for pointing this out. We changed the description to make it more comprehensive.

      (10) Please label H14/15 and H14´/H15´in Fig 4C zoom.

      We agree that this has not been very clear. We added helix labels.

      (11) In Figure 4D legend, make sure to note that the binding sites for the substrate are based on homologies with another enzyme poised with these molecules.

      The same should be clear in the text: sites are not known, they are assumed to be, based on homologies (paragraph starting at line 239).

      Concerning this comment we want to point out that we studied the exact same enzyme as the Schumacher group, except that we used 2-OG in our experiments, which they did not.

      (12) Figure 3 appears redundant in light of Figure 4. 

      (13) Line 235: When mentioning F24, please refer to Figure 5.

      Thank you, we changed that accordingly.

      (14) Please provide the distances for the bonds depicted in Figure 4B.

      Thanks for pointing this out, we added distance labels to Figure 4B. For reasons of clarity only to three H-bonds.

      (15) Line 241: D57 is likely serving to abstract a proton from ammonium, what is residue Glu307 potentially doing? The information seems missing in light of how the sentence is built.

      Thanks for pointing this out. According to previous studies both residues are likely involved in proton abstraction - first from ammonium, and then from the formed gamma-ammonium group. Additionally, they contribute in shielding the active site from bulk solvent to prevent hydrolysis of the formed phospho-glutamate.

      (16) Why do the authors assume that increased concentrations of 2-OG are a signal for N starvation only in M. mazei and not in all prokaryotic equivalent systems (line 288)?

      In line 288, we did not claim that this is a unique signal for M. mazei. It is also the central N-starvation signal in Cyanobacteria but not directly perceived by the cyanobacterial GS through binding directly to GS.

      The authors should look into the residues that bind 2-OG and check if they are conserved in other GS. The results of this sequence analysis should be discussed in line with the variable prokaryotic glutamine synthetase types of activity modulation that were exposed in the introduction and Figure 7.

      Please refer to supplementary figure S5, where we already aligned the mentioned glutamine synthetase sequences. Since this was also already discussed in Müller et al. 2024, we did not want to repeat their observations and refer to our supplementary figure in too much detail.

      (17) Figure 5 title: Replace TS by transition state structures of homology enzymes, or alike.

      Thank you for this suggestion. We did not change the title however, since it is not a homologue but the exact same glutamine synthetase from Methanosarcina mazei.

      (18) Line 249: D170 is not shown in Figure 5A or elsewhere in Figure 5.

      Thank you for pointing this out. We added D170 to figure 5A.

      (19) Representative density for the residues binding 2-OG should be provided, maybe in a supplemental figure.

      Thank you for the suggestion. We added the densities of 2-OG-binding residues to figure 4B

      (20) Line 260: Please add a reference when describing the phosphoryl transfer.

      We thank the reviewer for this important point and added that accordingly.

      (21) Line 296: The binding of 2-OG indeed appears to be cooperative, such that at concentrations above its binding affinity to the protein, only dodecamers are seen (under experimental conditions). However, claiming that the oligomerization is fast is not correct when the experimental setup includes 10 minutes of incubation before measurements are done. Please correct this within the entire manuscript.

      A (fast) continuous kinetic assay could have confirmed this point and revealed the oligomerization steps and the intermediaries in the process (maybe monomer/dimers, then dimers/hexamers, and then hexamers/dodecamers). Such assays would have been highly valuable to this study.

      We thank the reviewer for this suggestion, but disagree. It is indeed a rather fast regulation (as activity assays without pre-incubation only takes 1 min longer to reach full activity, see the newly included suppl. Fig S6). Considering other regulation mechanisms like e.g. transcription or translation regulation, an activation that takes only 60 s is actually quite quick.

      (22) Line 305 (and elsewhere in the manuscript): the authors state that 2-OG primes the active site for a transition state. This appears incorrect. The transition state is the highest energy state in an enzymatic reaction progressing from substrate to product. Meaning, the transition state is a state that has a more or less modified form of the original substrate bound to the active site. This is not the case.

      In line 366 an "active open state" appears much more adequate to use. 

      We agree and changed accordingly throughout the manuscript.

      (23) Line 330: Please delete "found". Eventually replace it with "confirmed": As the authors write, others have described this residue as a ligand to glutamine.

      Thanks, we changed that accordingly, although previous descriptions were just based on homologies without the experimental validation.

      (24) The discussion in at various points summarizing again the results. It should be trimmed and improved.

      (25) Line 381: replace "two fast" with "fast"?

      We thank the reviewer for this suggestion, but disagree on this point. We especially wanted to highlight that there are two central nitrogen-metabolites involved in the direct regulation of GlnA1, that means TWO fast direct processes mediated by 2-OG and glutamine.

    1. Reviewer #2 (Public review):

      In this study, Kavaklıoğlu et al. investigated and presented evidence for a role for domesticated transposon protein L1TD1 in enabling its ancestral relative, L1 ORF1p, to retrotranspose in HAP1 human tumor cells. The authors provided insight into the molecular function of L1TD1 and shed some clarifying light on previous studies that showed somewhat contradictory outcomes surrounding L1TD1 expression. Here, L1TD1 expression was correlated with L1 activation in a hypomethylation dependent manner, due to DNMT1 deletion in HAP1 cell line. The authors then identified L1TD1 associated RNAs using RIP-Seq, which display a disconnect between transcript and protein abundance (via Tandem Mass Tag multiplex mass spectrometry analysis). The one exception was for L1TD1 itself, is consistent with a model in which the RNA transcripts associated with L1TD1 are not directly regulated at the translation level. Instead, the authors found L1TD1 protein associated with L1-RNPs and this interaction is associated with increased L1 retrotransposition, at least in the contexts of HAP1 cells. Overall, these results support a model in which L1TD1 is restrained by DNA methylation, but in the absence of this repressive mark, L1TD1 is expression, and collaborates with L1 ORF1p (either directly or through interaction with L1 RNA, which remains unclear based on current results), leads to enhances L1 retrotransposition. These results establish feasibility of this relationship existing in vivo in either development or disease, or both.

      Comments on revised version:

      Thank you for this revised manuscript and for addressing our concerns and suggestions. These improvements have significantly enhanced the quality and reliability of the results presented and have addressed all our questions.

    1. Reviewer #3 (Public review):

      Summary:

      In the manuscript by Lapao et al., the authors uncover a role for the RAB27A effector protein SYTL5 in regulating mitochondrial function and turnover. The authors find that SYTL5 localizes to mitochondria in a RAB27A-dependent way and that loss of SYTL5 (or RAB27A) impairs lysosomal turnover of an inner mitochondrial membrane mitophagy reporter but not a matrix-based one. As the authors see no co-localization of GFP/mScarlet tagged versions of SYTL5 or RAB27A with LC3 or p62, they propose that lysosomal turnover is independent of the conventional autophagy machinery. Finally, the authors go on to show that loss of SYTL5 impacts mitochondrial respiration and ECAR and as such may influence the Warburg effect and tumorigenesis. Of relevance here, the authors go on to show that SYTL5 expression is reduced in adrenocortical carcinomas and this correlates with reduced survival rates.

      Strengths:

      There are clearly interesting and new findings here that will be relevant to those following mitochondrial function, the endocytic pathway, and cancer metabolism.

      Weaknesses:

      The data feel somewhat preliminary in that the conclusions rely on exogenously expressed proteins and reporters, which do not always align.

      As the authors note there are no commercially available antibodies that recognize endogenous SYTL5, hence they have had to stably express GFP-tagged versions. However, it appears that the level of expression dictates co-localization from the examples the authors give (though it is hard to tell as there is a lack of any kind of quantitation for all the fluorescent figures). Therefore, the authors may wish to generate an antibody themselves or tag the endogenous protein using CRISPR.

      In relation to quantitation, the authors found that SYTL5 localizes to multiple compartments or potentially a few compartments that are positive for multiple markers. Some quantitation here would be very useful as it might inform on function.

      The authors find that upon hypoxia/hypoxia-like conditions that punctate structures of SYTL5 and RAB27A form that are positive for Mitotracker, and that a very specific mitophagy assay based on pSu9-Halo system is impaired by siRNA of SYTL5/RAB27A, but another, distinct mitophagy assay (Matrix EGFP-mCherry) shows no change. I think this work would strongly benefit from some measurements with endogenous mitochondrial proteins, both via immunofluorescence and western blot-based flux assays.

      A really interesting aspect is the apparent independence of this mitophagy pathway on the conventional autophagy machinery. However, this is only based on a lack of co-localization between p62 or LC3 with LAMP1 and GFP/mScarlet tagged SYTL5/RAB27A. However, I would not expect them to greatly colocalize in lysosomes as both the p62 and LC3 will become rapidly degraded, while the eGFP and mScarlet tags are relatively resistant to lysosomal hydrolysis. -/+ a lysosome inhibitor might help here and ideally, the functional mitophagy assays should be repeated in autophagy KOs.

      The link to tumorigenesis and cancer survival is very interesting but it is not clear if this is due to the mitochondrially-related aspects of SYTL5 and RAB27A. For example, increased ECAR is seen in the SYTL5 KO cells but not in the RAB27A KO cells (Fig.5D), implying that mitochondrial localization of SYTL5 is not required for the ECAR effect. More work to strengthen the link between the two sections in the paper would help with future directions and impact with respect to future cancer treatment avenues to explore.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Authors has provided a mechanism by which how presence of truncated P53 can inactivate function of full length P53 protein. Authors proposed this happens by sequestration of full length P53 by truncated P53.

      In the study, performed experiments are well described.

      My area of expertise is molecular biology/gene expression, and I have tried to provide suggestions on my area of expertise. The study has been done mainly with overexpression system and I have included few comments which I can think can be helpful to understand effect of truncated P53 on endogenous wild type full length protein. Performing experiments on these lines will add value to the observation according to this reviewer.

      Major comments:

      1. What happens to endogenous wild type full length P53 in the context of mutant/truncated isoforms, that is not clear. Using a P53 antibody which can detect endogenous wild type P53, can authors check if endogenous full length P53 protein is also aggregated as well? It is hard to differentiate if aggregation of full length P53 happens only in overexpression scenario, where lot more both of such proteins are expressed. In normal physiological condition P53 expression is usually low, tightly controlled and its expression get induced in altered cellular condition such as during DNA damage. So, it is important to understand the physiological relevance of such aggregation, which could be possible if authors could investigate effect on endogenous full length P53 following overexpression of mutant isoforms. Response: Thank you very much for your insightful comments. 1) To address "what happens to endogenous wild-type full-length P53 in the context of mutant/truncated isoforms," we employed a human A549 cell line expressing endogenous wild-type p53 under DNA damage conditions such as an etoposide treatment1. We choose the A549 cell line since similar to H1299, it is a lung cancer cell line (www.atcc.org). For comparison, we also transfected the cells with 2 μg of V5-tagged plasmids encoding FLp53 and its isoforms Δ133p53 and Δ160p53. As shown in Figure R1A, lanes 1 and 2, endogenous p53 expression, remained undetectable in A549 cells despite etoposide treatment, which limits our ability to assess the effects of the isoforms on the endogenous wild-type FLp53. We could, however, detect the V5-tagged FLp53 expressed from the plasmid using anti-V5 (rabbit) as well as with anti-DO-1 (mouse) antibody (Figure R1). The latter detects both endogenous wild-type p53 and the V5-tagged FLp53 since the antibody epitope is within the N-terminus (aa 20-25). This result supports the reviewer's comment regarding the low level of expression of endogenous p53 that is insufficient for detection in our experiments. (Figure R1 is included in the file "RC-2024-02608 Figures of Response to Reviewer.)__

      In summary, in line with the reviewer's comment that 'under normal physiological conditions p53 expression is usually low,' we could not detect p53 with an anti-DO-1 antibody. Thus, we proceeded with V5/FLAG-tagged p53 for detection of the effects of the isoforms on p53 stability and function. We also found that protein expression in H1299 cells was more easily detectable than in A549 cells (Compare Figures R1A and B). Thus, we decided to continue with the H1299 cells (p53-null), which would serve as a more suitable model system for this study.

      2) We agree with the reviewer that 'It is hard to differentiate if aggregation of full-length p53 happens only in overexpression scenario'. However, it is not impossible to imagine that such aggregation of FLp53 happens under conditions when p53 and its isoforms are over-expressed in the cell. Although the exact physiological context is not known and beyond the scope of the current work, our results indicate that at higher expression, p53 isoforms drive aggregation of FLp53. Given the challenges of detecting endogenous FLp53, we had to rely on the results obtained with plasmid mediated expression of p53 and its isoforms in p53-null cells.

      Can presence of mutant P53 isoforms can cause functional impairment of wild type full length endogenous P53? That could be tested as well using similar ChIP assay authors has performed, but instead of antibody against the Tagged protein if the authors could check endogenous P53 enrichment in the gene promoter such as P21 following overexpression of mutant isoforms. May be introducing a condition such as DNA damage in such experiment might help where endogenous P53 is induced and more prone to bind to P53 target such as P21.

      Response: Thank you very much for your valuable comments and suggestions. To investigate the potential functional impairment of endogenous wild-type p53 by p53 isoforms, we initially utilized A549 cells (p53 wild-type), aiming to monitor endogenous wild-type p53 expression following DNA damage. However, as mentioned and demonstrated in Figure R1, endogenous p53 expression was too low to be detected under these conditions, making the ChIP assay for analyzing endogenous p53 activity unfeasible. Thus, we decided to utilize plasmid-based expression of FLp53 and focus on the potential functional impairment induced by the isoforms.

      3. On similar lines, authors described:

      "To test this hypothesis, we escalated the ratio of FLp53 to isoforms to 1:10. As expected, the activity of all four promoters decreased significantly at this ratio (Figure 4A-D). Notably, Δ160p53 showed a more potent inhibitory effect than Δ133p53 at the 1:5 ratio on all promoters except for the p21 promoter, where their impacts were similar (Figure 4E-H). However, at the 1:10 ratio, Δ133p53 and Δ160p53 had similar effects on all transactivation except for the MDM2 promoter (Figure 4E-H)."

      Again, in such assay authors used ratio 1:5 to 1:10 full length vs mutant. How authors justify this result in context (which is more relevant context) where one allele is Wild type (functional P53) and another allele is mutated (truncated, can induce aggregation). In this case one would except 1:1 ratio of full-length vs mutant protein, unless other regulation is going which induces expression of mutant isoforms more than wild type full length protein. Probably discussing on these lines might provide more physiological relevance to the observed data.

      Response: Thank you for raising this point regarding the physiological relevance of the ratios used in our study. 1) In the revised manuscript (lines 193-195), we added in this direction that "The elevated Δ133p53 protein modulates p53 target genes such as miR34a and p21, facilitating cancer development2, 3. To mimic conditions where isoforms are upregulated relative to FLp53, we increased the ratios to 1:5 and 1:10." This approach aims to simulate scenarios where isoforms accumulate at higher levels than FLp53, which may be relevant in specific contexts, as also elaborated above.

      2) Regarding the issue of protein expression, where one allele is wild-type and the other is isoform, this assumption is not valid in most contexts. First, human cells have two copies of TPp53 gene (one from each parent). Second, the TP53 gene has two distinct promoters: the proximal promoter (P1) primarily regulates FLp53 and ∆40p53, whereas the second promoter (P2) regulates ∆133p53 and ∆160p534, 5. Additionally, ∆133TP53 is a p53 target gene6, 7 and the expression of Δ133p53 and FLp53 is dynamic in response to various stimuli. Third, the expression of p53 isoforms is regulated at multiple levels, including transcriptional, post-transcriptional, translational, and post-translational processing8. Moreover, different degradation mechanisms modify the protein level of p53 isoforms and FLp538. These differential regulation mechanisms are regulated by various stimuli, and therefore, the 1:1 ratio of FLp53 to ∆133p53 or ∆160p53 may be valid only under certain physiological conditions. In line with this, varied expression levels of FLp53 and its isoforms, including ∆133p53 and ∆160p53, have been reported in several studies3, 4, 9, 10.

      3) In our study, using the pcDNA 3.1 vector under the human cytomegalovirus (CMV) promoter, we observed moderately higher expression levels of ∆133p53 and ∆160p53 relative to FLp53 (Figure R1B). This overexpression scenario provides a model for studying conditions where isoform accumulation might surpass physiological levels, impacting FLp53 function. By employing elevated ratios of these isoforms to FLp53, we aim to investigate the potential effects of isoform accumulation on FLp53.

      4. Finally does this altered function of full length P53 (preferably endogenous one) in presence of truncated P53 has any phenotypic consequence on the cells (if authors choose a cell type which is having wild type functional P53). Doing assay such as apoptosis/cell cycle could help us to get this visualization.

      Response: Thank you for your insightful comments. In the experiment with A549 cells (p53 wild-type), endogenous p53 levels were too low to be detected, even after DNA damage induction. The evaluation of the function of endogenous p53 in the presence of isoforms is hindered, as mentioned above. In the revised manuscript, we utilized H1299 cells with overexpressed proteins for apoptosis studies using the Caspase-Glo® 3/7 assay (Figure 7). This has been shown in the Results section (lines 254-269). "The Δ133p53 and Δ160p53 proteins block pro-apoptotic function of FLp53.

      One of the physiological read-outs of FLp53 is its ability to induce apoptotic cell death11. To investigate the effects of p53 isoforms Δ133p53 and Δ160p53 on FLp53-induced apoptosis, we measured caspase-3 and -7 activities in H1299 cells expressing different p53 isoforms (Figure 7). Caspase activation is a key biochemical event in apoptosis, with the activation of effector caspases (caspase-3 and -7) ultimately leading to apoptosis12. The caspase-3 and -7 activities induced by FLp53 expression was approximately 2.5 times higher than that of the control vector (Figure 7). Co-expression of FLp53 and the isoforms Δ133p53 or Δ160p53 at a ratio of 1: 5 significantly diminished the apoptotic activity of FLp53 (Figure 7). This result aligns well with our reporter gene assay, which demonstrated that elevated expression of Δ133p53 and Δ160p53 impaired the expression of apoptosis-inducing genes BAX and PUMA (Figure 4G and H). Moreover, a reduction in the apoptotic activity of FLp53 was observed irrespective of whether Δ133p53 or Δ160p53 protein was expressed with or without a FLAG tag (Figure 7). This result, therefore, also suggests that the FLAG tag does not affect the apoptotic activity or other physiological functions of FLp53 and its isoforms. Overall, the overexpression of p53 isoforms Δ133p53 and Δ160p53 significantly attenuates FLp53-induced apoptosis, independent of the protein tagging with the FLAG antibody epitope."

      **Referees cross-commenting**

      I think the comments from the other reviewers are very much reasonable and logical.

      Especially all 3 reviewers have indicated, a better way to visualize the aggregation of full-length wild type P53 by truncated P53 (such as looking at endogenous P53# by reviewer 1, having fluorescent tag #by reviewer 2 and reviewer 3 raised concern on the FLAG tag) would add more value to the observation.

      Response: Thank you for these comments. The endogenous p53 protein was undetectable in A549 cells induced by etoposide (Figure R1A). Therefore, we conducted experiments using FLAG/V5-tagged FLp53. To avoid any potential side effects of the FLAG tag on p53 aggregation, we introduced untagged p53 isoforms in the H1299 cells and performed subcellular fractionation. Our revised results, consistent with previous FLAG-tagged p53 isoforms findings, demonstrate that co-expression of untagged isoforms with FLAG-tagged FLp53 significantly induced the aggregation of FLAG-FLp53, while no aggregation was observed when FLAG-tagged FLp53 was expressed alone (Supplementary Figure 6). These results clearly indicate that the FLAG tag itself does not contribute to protein aggregation.

      Additionally, we utilized the A11 antibody to detect protein aggregation, providing additional validation (Figure R3). Given that the fluorescent proteins (~30 kDa) are substantially bigger than the tags used here (~1 kDa) and may influence oligomerization (especially GFP), stability, localization, and function of p53 and its isoforms, we avoided conducting these vital experiments with such artificial large fusions.

      Reviewer #1 (Significance (Required)):

      The work in significant, since it points out more mechanistic insight how wild type full length P53 could be inactivated in the presence of truncated isoforms, this might offer new opportunity to recover P53 function as treatment strategies against cancer.

      Response: Thank you for your insightful comments. We appreciate your recognition of the significance of our work in providing mechanistic insights into how wild-type FLp53 can be inactivated by truncated isoforms. We agree that these findings have potential for exploring new strategies to restore p53 function as a therapeutic approach against cancer.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The manuscript by Zhao and colleagues presents a novel and compelling study on the p53 isoforms, Δ133p53 and Δ160p53, which are associated with aggressive cancer types. The main objective of the study was to understand how these isoforms exert a dominant negative effect on full-length p53 (FLp53). The authors discovered that the Δ133p53 and Δ160p53 proteins exhibit impaired binding to p53-regulated promoters. The data suggest that the predominant mechanism driving the dominant-negative effect is the co-aggregation of FLp53 with Δ133p53 and Δ160p53.

      This study is innovative, well-executed, and supported by thorough data analysis. However, the authors should address the following points:

        • Introduction on Aggregation and Co-aggregation: Given that the focus of the study is on the aggregation and co-aggregation of the isoforms, the introduction should include a dedicated paragraph discussing this issue. There are several original research articles and reviews that could be cited to provide context.* Response: Thank you very much for the valuable comments. We have added the following paragraph in the revised manuscript (lines 74-82): "Protein aggregation has become a central focus of modern biology research and has documented implications in various diseases, including cancer13, 14, 15. Protein aggregates can be of different types ranging from amorphous aggregates to highly structured amyloid or fibrillar aggregates, each with different physiological implications. In the case of p53, whether protein aggregation, and in particular, co-aggregation with large N-terminal deletion isoforms, plays a mechanistic role in its inactivation is yet underexplored. Interestingly, the Δ133p53β isoform has been shown to aggregate in several human cancer cell lines16. Additionally, the Δ40p53α isoform exhibits a high aggregation tendency in endometrial cancer cells17. Although no direct evidence exists for Δ160p53 yet, these findings imply that p53 isoform aggregation may play a major role in their mechanisms of actions."

      2. Antibody Use for Aggregation: To strengthen the evidence for aggregation, the authors should consider using antibodies that specifically bind to aggregates.

      Response: Thank you for your insightful suggestion. We addressed protein aggregation using the A11 antibody which specifically recognizes amyloid-like protein aggregates. We analyzed insoluble nuclear pellet samples prepared under identical conditions as described in Figure 6B. To confirm the presence of p53 proteins, we employed the anti-p53 M19 antibody (Santa Cruz, Cat No. sc-1312) to detect bands corresponding to FLp53 and its isoforms Δ133p53 and Δ160p53. The monomer FLp53 was not detected (Figure R3, lower panel), which may be attributed to the lower binding affinity of the anti-p53 M19 antibody to it. These samples were also immunoprecipitated using the A11 antibody (Thermo Fischer Scientific, Cat No. AHB0052) to detect aggregated proteins. Interestingly, FLp53 and its isoforms, Δ133p53 and Δ160p53, were clearly visible with Anti-A11 antibody when co-expressed at a 1:5 ratio suggesting that they underwent co-aggregation__.__ However, no FLp53 aggregates were observed when it was expressed alone (Figure R2). These results support the conclusion in our manuscript that Δ133p53 and Δ160p53 drive FLp53 aggregation.

      (Figure R2 is included in the file "RC-2024-02608 Figures of Response to Reviewer.)__

      3. Fluorescence Microscopy: Live-cell fluorescence microscopy could be employed to enhance visualization by labeling FLp53 and the isoforms with different fluorescent markers (e.g., EGFP and mCherry tags).

      Response: We appreciate the suggestion to use live-cell fluorescence microscopy with EGFP and mCherry tags for the visualization FLp53 and its isoforms. While we understand the advantages of live-cell imaging with EGFP / mCherry tags, we restrained us from doing such fusions as the GFP or corresponding protein tags are very big (~30 kDa) with respect to the p53 isoform variants (~30 kDa). Other studies have shown that EGFP and mCherry fusions can alter protein oligomerization, solubility and aggregation18, 19. Moreover, most fluorescence proteins are prone to dimerization (i.e. EGFP) or form obligate tetramers (DsRed)20, 21, 22, potentially interfering with the oligomerization and aggregation properties of p53 isoforms, particularly Δ133p53 and Δ160p53.

      Instead, we utilized FLAG- or V5-tag-based immunofluorescence microscopy, a well-established and widely accepted method for visualizing p53 proteins. This method provided precise localization and reliable quantitative data, which we believe meet the needs of the current study. We believe our chosen method is both appropriate and sufficient for addressing the research question.

      Reviewer #2 (Significance (Required)):

      The manuscript by Zhao and colleagues presents a novel and compelling study on the p53 isoforms, Δ133p53 and Δ160p53, which are associated with aggressive cancer types. The main objective of the study was to understand how these isoforms exert a dominant negative effect on full-length p53 (FLp53). The authors discovered that the Δ133p53 and Δ160p53 proteins exhibit impaired binding to p53-regulated promoters. The data suggest that the predominant mechanism driving the dominant-negative effect is the co-aggregation of FLp53 with Δ133p53 and Δ160p53.

      Response: We sincerely thank the reviewer for the thoughtful and positive comments on our manuscript and for highlighting the significance of our findings on the p53 isoforms, Δ133p53 and Δ160p53.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In this manuscript entitled "Δ133p53 and Δ160p53 isoforms of the tumor suppressor protein p53 exert dominant-negative effect primarily by co-aggregation", the authors suggest that the Δ133p53 and Δ160p53 isoforms have high aggregation propensity and that by co-aggregating with canonical p53 (FLp53), they sequestrate it away from DNA thus exerting a dominant-negative effect over it.

      First, the authors should make it clear throughout the manuscript, including the title, that they are investigating Δ133p53α and Δ160p53α since there are 3 Δ133p53 isoforms (α, β, γ), and 3 Δ160p53 isoforms (α, β, γ).

      Response: Thank you for your suggestion. We understand the importance of clearly specifying the isoforms under study. Following your suggestion, we have added α in the title, abstract, and introduction and added the following statement in the Introduction (lines 57-59): "For convenience and simplicity, we have written Δ133p53 and Δ160p53 to represent the α isoforms (Δ133p53α and Δ160p53α) throughout this manuscript."

      One concern is that the authors only consider and explore Δ133p53α and Δ160p53α isoforms as exclusively oncogenic and FLp53 dominant-negative while not discussing evidences of different activities. Indeed, other manuscripts have also shown that Δ133p53α is non-oncogenic and non-mutagenic, do not antagonize every single FLp53 functions and are sometimes associated with good prognosis. To cite a few examples:

      • Hofstetter G. et al. D133p53 is an independent prognostic marker in p53 mutant advanced serous ovarian cancer. Br. J. Cancer 2011, 105, 1593-1599.
      • Bischof, K. et al. Influence of p53 Isoform Expression on Survival in High-Grade Serous Ovarian Cancers. Sci. Rep. 2019, 9,5244.
      • Knezovi´c F. et al. The role of p53 isoforms' expression and p53 mutation status in renal cell cancer prognosis. Urol. Oncol. 2019, 37, 578.e1-578.e10.
      • Gong, L. et al. p53 isoform D113p53/D133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage. Cell Res. 2015, 25, 351-369.
      • Gong, L. et al. p53 isoform D133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming. Sci. Rep. 2016, 6, 37281.
      • Horikawa, I. et al. D133p53 represses p53-inducible senescence genes and enhances the generation of human induced pluripotent stem cells. Cell Death Differ. 2017, 24, 1017-1028.
      • Gong, L. p53 coordinates with D133p53 isoform to promote cell survival under low-level oxidative stress. J. Mol. Cell Biol. 2016, 8, 88-90. Response: Thank you very much for your comment and for highlighting these important studies.

      We agree that Δ133p53 isoforms exhibit complex biological functions, with both oncogenic and non-oncogenic potentials. However, our mission here was primarily to reveal the molecular mechanism for the dominant-negative effects exerted by the Δ133p53α and Δ160p53α isoforms on FLp53 for which the Δ133p53α and Δ160p53α isoforms are suitable model systems. Exploring the oncogenic potential of the isoforms is beyond the scope of the current study and we have not claimed anywhere that we are reporting that. We have carefully revised the manuscript and replaced the respective terms e.g. 'pro-oncogenic activity' with 'dominant-negative effect' in relevant places (e.g. line 90). We have now also added a paragraph with suitable references that introduces the oncogenic and non-oncogenic roles of the p53 isoforms.

      After reviewing the papers you cited, we are not sure that they reflect on oncogenic /non-oncogenic role of the Δ133p53α isoform in different cancer cases. Although our study is not about the oncogenic potential of the isoforms, we have summarized the key findings below:

      • Hofstetter et al., 2011: Demonstrated that Δ133p53α expression improved recurrence-free and overall survival (in a p53 mutant induced advanced serous ovarian cancer, suggesting a potential protective role in this context.
      • Bischof et al., 2019: Found that Δ133p53 mRNA can improve overall survival in high-grade serous ovarian cancers. However, out of 31 patients, only 5 belong to the TP53 wild-type group, while the others carry TP53 mutations.
      • Knezović et al., 2019: Reported downregulation of Δ133p53 in renal cell carcinoma tissues with wild-type p53 compared to normal adjacent tissue, indicating a potential non-oncogenic role, but not conclusively demonstrating it.
      • Gong et al., 2015: Showed that Δ133p53 antagonizes p53-mediated apoptosis and promotes DNA double-strand break repair by upregulating RAD51, LIG4, and RAD52 independently of FLp53.
      • Gong et al., 2016: Demonstrated that overexpression of Δ133p53 promotes efficiency of cell reprogramming by its anti-apoptotic function and promoting DNA DSB repair. The authors hypotheses that this mechanism is involved in increasing RAD51 foci formation and decrease γH2AX foci formation and chromosome aberrations in induced pluripotent stem (iPS) cells, independent of FL p53.
      • Horikawa et al., 2017: Indicated that induced pluripotent stem cells derived from fibroblasts that overexpress Δ133p53 formed non-cancerous tumors in mice compared to induced pluripotent stem cells derived from fibroblasts with complete p53 inhibition. Thus, Δ133p53 overexpression is "non- or less oncogenic and mutagenic" compared to complete p53 inhibition, but it still compromises certain p53-mediated tumor-suppressing pathways. "Overexpressed Δ133p53 prevented FL-p53 from binding to the regulatory regions of p21WAF1 and miR-34a promoters, providing a mechanistic basis for its dominant-negative inhibition of a subset of p53 target genes."
      • Gong, 2016: Suggested that Δ133p53 promotes cell survival under low-level oxidative stress, but its role under different stress conditions remains uncertain. We have revised the Introduction to provide a more balanced discussion of Δ133p53's dule role (lines 62-73):

      "The Δ133p53 isoform exhibit complex biological functions, with both oncogenic and non-oncogenic potentials. Recent studies demonstrate the non-oncogenic yet context-dependent role of the Δ133p53 isoform in cancer development. Δ133p53 expression has been reported to correlate with improved survival in patients with TP53 mutations23, 24, where it promotes cell survival in a non-oncogenic manner25, 26, especially under low oxidative stress27. Alternatively, other recent evidences emphasize the notable oncogenic functions of Δ133p53 as it can inhibit p53-dependent apoptosis by directly interacting with the FLp53 4, 6. The oncogenic function of the newly identified Δ160p53 isoform is less known, although it is associated with p53 mutation-driven tumorigenesis28 and in melanoma cells' aggressiveness10. Whether or not the Δ160p53 isoform also impedes FLp53 function in a similar way as Δ133p53 is an open question. However, these p53 isoforms can certainly compromise p53-mediated tumor suppression by interfering with FLp53 binding to target genes such as p21 and miR-34a2, 29 by dominant-negative effect, the exact mechanism is not known."

      On the figures presented in this manuscript, I have three major concerns:

      *1- Most results in the manuscript rely on the overexpression of the FLAG-tagged or V5-tagged isoforms. The validation of these construct entirely depends on Supplementary figure 3 which the authors claim "rules out the possibility that the FLAG epitope might contribute to this aggregation. However, I am not entirely convinced by that conclusion. Indeed, the ratio between the "regular" isoform and the aggregates is much higher in the FLAG-tagged constructs than in the V5-tagged constructs. We can visualize the aggregates easily in the FLAG-tagged experiment, but the imaging clearly had to be overexposed (given the white coloring demonstrating saturation of the main bands) to visualize them in the V5-tagged experiments. Therefore, I am not convinced that an effect of the FLAG-tag can be ruled out and more convincing data should be added. *

      Response: Thank you for raising this important concern. We have carefully considered your comments and have made several revisions to clarify and strengthen our conclusions.

      First, to address the potential influence of the FLAG and V5 tags on p53 isoform aggregation, we have revised Figure 2 and removed the previous Supplementary Figure 3, where non-specific antibody bindings and higher molecular weight aggregates were not clearly interpretable. In the revised Figure 2, we have removed these potential aggregates, improving the clarity and accuracy of the data.

      To further rule out any tag-related artifacts, we conducted a co-immunoprecipitation assay with FLAG-tagged FLp53 and untagged Δ133p53 and Δ160p53 isoforms. The results (now shown in the new Supplementary Figure 3) completely agree with our previous result with FLAG-tagged and V5-tagged Δ133p53 and Δ160p53 isoforms and show interaction between the partners. This indicates that the FLAG / V5-tags do not influence / interfere with the interaction between FLp53 and the isoforms. We have still used FLAG-tagged FLp53 as the endogenous p53 was undetectable and the FLAG-tagged FLp53 did not aggregate alone.

      In the revised paper, we added the following sentences (Lines 146-152): "To rule out the possibility that the observed interactions between FLp53 and its isoforms Δ133p53 and Δ160p53 were artifacts caused by the FLAG and V5 antibody epitope tags, we co-expressed FLAG-tagged FLp53 with untagged Δ133p53 and Δ160p53. Immunoprecipitation assays demonstrated that FLAG-tagged FLp53 could indeed interact with the untagged Δ133p53 and Δ160p53 isoforms (Supplementary Figure 3, lanes 3 and 4), confirming formation of hetero-oligomers between FLp53 and its isoforms. These findings demonstrate that Δ133p53 and Δ160p53 can oligomerize with FLp53 and with each other."

      Additionally, we performed subcellular fractionation experiments to compare the aggregation and localization of FLAG-tagged FLp53 when co-expressed either with V5-tagged or untagged Δ133p53/Δ160p53. In these experiments, the untagged isoforms also induced FLp53 aggregation, mirroring our previous results with the tagged isoforms (Supplementary Figure 5). We've added this result in the revised manuscript (lines 236-245): "To exclude the possibility that FLAG or V5 tags contribute to protein aggregation, we also conducted subcellular fractionation of H1299 cells expressing FLAG-tagged FLp53 along with untagged Δ133p53 or Δ160p53 at a 1:5 ratio. The results showed (Supplementary Figure 6) a similar distribution of FLp53 across cytoplasmic, nuclear, and insoluble nuclear fractions as in the case of tagged Δ133p53 or Δ160p53 (Figure 6A to D). Notably, the aggregation of untagged Δ133p53 or Δ160p53 markedly promoted the aggregation of FLAG-tagged FLp53 (Supplementary Figure 6B and D), demonstrating that the antibody epitope tags themselves do not contribute to protein aggregation."

      We've also discussed this in the Discussion section (lines 349-356): "In our study, we primarily utilized an overexpression strategy involving FLAG/V5-tagged proteins to investigate the effects of p53 isoforms Δ133p53 and Δ160p53 on the function of FLp53. To address concerns regarding potential overexpression artifacts, we performed the co-immunoprecipitation (Supplementary Figure 6) and caspase-3 and -7 activity (Figure 7) experiments with untagged Δ133p53 and Δ160p53. In both experimental systems, the untagged proteins behaved very similarly to the FLAG/V5 antibody epitope-containing proteins (Figures 6 and 7 and Supplementary Figure 6). Hence, the C-terminal tagging of FLp53 or its isoforms does not alter the biochemical and physiological functions of these proteins."

      In summary, the revised data set and newly added experiments provide strong evidence that neither the FLAG nor the V5 tag contributes to the observed p53 isoform aggregation.

      2- The authors demonstrate that to visualize the dominant-negative effect, Δ133p53α and Δ160p53α must be "present in a higher proportion than FLp53 in the tetramer" and the need at least a transfection ratio 1:5 since the 1:1 ration shows no effect. However, in almost every single cell type, FLp53 is far more expressed than the isoforms which make it very unlikely to reach such stoichiometry in physiological conditions and make me wonder if this mechanism naturally occurs at endogenous level. This limitation should be at least discussed.

      Response: Thank you for your insightful comment. However, evidence suggests that the expression levels of these isoforms such as Δ133p53, can be significantly elevated relative to FLp53 in certain physiological conditions3, 4, 9. For example, in some breast tumors, with Δ133p53 mRNA is expressed at a much levels than FLp53, suggesting a distinct expression profile of p53 isoforms compared to normal breast tissue4. Similarly, in non-small cell lung cancer and the A549 lung cancer cell line, the expression level of Δ133p53 transcript is significantly elevated compared to non-cancerous cells3. Moreover, in specific cholangiocarcinoma cell lines, the Δ133p53 /TAp53 expression ratio has been reported to increase to as high as 3:19. These observations indicate that the dominant-negative effect of isoform Δ133p53 on FLp53 can occur under certain pathological conditions where the relative amounts of the FLp53 and the isoforms would largely vary. Since data on the Δ160p53 isoform are scarce, we infer that the long N-terminal truncated isoforms may share a similar mechanism.

      Figure 5C: I am concerned by the subcellular location of the Δ133p53α and Δ160p53α as they are commonly considered nuclear and not cytoplasmic as shown here, particularly since they retain the 3 nuclear localization sequences like the FLp53 (Bourdon JC et al. 2005; Mondal A et al. 2018; Horikawa I et al, 2017; Joruiz S. et al, 2024). However, Δ133p53α can form cytoplasmic speckles (Horikawa I et al, 2017) when it colocalizes with autophagy markers for its degradation.

      3-The authors should discuss this issue. Could this discrepancy be due to the high overexpression level of these isoforms? A co-staining with autophagy markers (p62, LC3B) would rule out (or confirm) activation of autophagy due to the overwhelming expression of the isoform.

      Response: Thank you for your thoughtful comments. We have thoroughly reviewed all the papers you recommended (Bourdon JC et al., 2005; Mondal A et al., 2018; Horikawa I et al., 2017; Joruiz S. et al., 2024)4, 29, 30, 31. Among these, only the study by Bourdon JC et al. (2005) provided data regarding the localization of Δ133p534. Interestingly, their findings align with our observations, indicating that the protein does not exhibit predominantly nuclear localization in the Figure below. The discrepancy may be caused by a potentially confusing statement in that paper4

      (The Figure from Bourdon JC et al. (2005) is included in the file "RC-2024-02608 Figures of Response to Reviewer.)__

      The localization of p53 is governed by multiple factors, including its nuclear import and export32. The isoforms Δ133p53 and Δ160p53 contain three nuclear localization sequences (NLS)4 . However, the isoforms Δ133p53 and Δ160p53 were potentially trapped in the cytoplasm by aggregation and masking the NLS. This mechanism would prevent nuclear import.

      Further, we acknowledge that Δ133p53 co-aggregates with autophagy substrate p62/SQSTM1 and autophagosome component LC3B in cytoplasm by autophagic degradation during replicative senescence33. We agree that high overexpression of these aggregation-prone proteins may induce endoplasmic reticulum (ER) stress and activates autophagy34. This could explain the cytoplasmic localization in our experiments. However, it is also critical to consider that we observed aggregates in both the cytoplasm and the nucleus (Figures 6B and E and Supplementary Figure 6B). While cytoplasmic localization may involve autophagy-related mechanisms, the nuclear aggregates likely arise from intrinsic isoform properties, such as altered protein folding, independent of autophagy. These dual localizations reflect the complex behavior of Δ133p53 and Δ160p53 isoforms under our experimental conditions.

      In the revised manuscript, we discussed this in Discussion (lines 328-335): "Moreover, the observed cytoplasmic isoform aggregates may reflect autophagy-related degradation, as suggested by the co-localization of Δ133p53 with autophagy substrate p62/SQSTM1 and autophagosome component LC3B33. High overexpression of these aggregation-prone proteins could induce endoplasmic reticulum stress and activate autophagy34. Interestingly, we also observed nuclear aggregation of these isoforms (Figure 6B and E and Supplementary Figure 6B), suggesting that distinct mechanisms, such as intrinsic properties of the isoforms, may govern their localization and behavior within the nucleus. This dual localization underscores the complexity of Δ133p53 and Δ160p53 behavior in cellular systems."

      Minor concerns:

      - Figure 1A: the initiation of the "Δ140p53" is shown instead of "Δ40p53"

      Response: Thank you! The revised Figure 1A has been created in the revised paper.

      • Figure 2A: I would like to see the images cropped a bit higher, so the cut does not happen just above the aggregate bands

      Response: Thank you for this suggestion. We've changed the image and the new Figure 2 has been shown in the revised paper.

      • Figure 3C: what ratio of FLp53/Delta isoform was used?

      Response: We have added the ratio in the figure legend of Figure 3C (lines 845-846) "Relative DNA-binding of the FLp53-FLAG protein to the p53-target gene promoters in the presence of the V5-tagged protein Δ133p53 or Δ160p53 at a 1: 1 ratio."

      • Figure 3C suggests that the "dominant-negative" effect is mostly senescence-specific as it does not affect apoptosis target genes, which is consistent with Horikawa et al, 2017 and Gong et al, 2016 cited above. Furthermore, since these two references and the others from Gong et al. show that Δ133p53α increases DNA repair genes, it would be interesting to look at RAD51, RAD52 or Lig4, and maybe also induce stress.

      Response: Thank you for your thoughtful comments and suggestions. In Figure 3C, the presence of Δ133p53 or Δ160p53 only significantly reduced the binding of FLp53 to the p21 promoter. However, isoforms Δ133p53 and Δ160p53 demonstrated a significant loss of DNA-binding activity at all four promoters: p21, MDM2, and apoptosis target genes BAX and PUMA (Figure 3B). This result suggests that Δ133p53 and Δ160p53 have the potential to influence FLp53 function due to their ability to form hetero-oligomers with FLp53 or their intrinsic tendency to aggregate. To further investigate this, we increased the isoform to FLp53 ratio in Figure 4, which demonstrate that the isoforms Δ133p53 and Δ160p53 exert dominant-negative effects on the function of FLp53.

      These results demonstrate that the isoforms can compromise p53-mediated pathways, consistent with Horikawa et al. (2017), which showed that Δ133p53α overexpression is "non- or less oncogenic and mutagenic" compared to complete p53 inhibition, but still affects specific tumor-suppressing pathways. Furthermore, as noted by Gong et al. (2016), Δ133p53's anti-apoptotic function under certain conditions is independent of FLp53 and unrelated to its dominant-negative effects.

      We appreciate your suggestion to investigate DNA repair genes such as RAD51, RAD52, or Lig4, especially under stress conditions. While these targets are intriguing and relevant, we believe that our current investigation of p53 targets in this manuscript sufficiently supports our conclusions regarding the dominant-negative effect. Further exploration of additional p53 target genes, including those involved in DNA repair, will be an important focus of our future studies.

      • Figure 5A and B: directly comparing the level of FLp53 expressed in cytoplasm or nucleus to the level of Δ133p53α and Δ160p53α expressed in cytoplasm or nucleus does not mean much since these are overexpressed proteins and therefore depend on the level of expression. The authors should rather compare the ratio of cytoplasmic/nuclear FLp53 to the ratio of cytoplasmic/nuclear Δ133p53α and Δ160p53α.

      Response: Thank you very much for this valuable suggestion. In the revised paper, Figure 5B has been recreated. Changes have been made in lines 214-215: "The cytoplasm-to-nucleus ratio of Δ133p53 and Δ160p53 was approximately 1.5-fold higher than that of FLp53 (Figure 5B)."

      **Referees cross-commenting**

      I agree that the system needs to be improved to be more physiological.

      Just to precise, the D133 and D160 isoforms are not truncated mutants, they are naturally occurring isoforms expressed in almost every normal human cell type from an internal promoter within the TP53 gene.

      Using overexpression always raises concerns, but in this case, I am even more careful because the isoforms are almost always less expressed than the FLp53, and here they have to push it 5 to 10 times more expressed than the FLp53 to see the effect which make me fear an artifact effect due to the overwhelming overexpression (which even seems to change the normal localization of the protein).

      To visualize the endogenous proteins, they will have to change cell line as the H1299 they used are p53 null.

      Response: Thank you for these comments. We've addressed the motivation of overexpression in the above responses. We needed to use the plasmid constructs in the p53-null cells to detect the proteins but the expression level was certainly not 'overwhelmingly high'.

      First, we tried the A549 cells (p53 wild-type) under DNA damage conditions, but the endogenous p53 protein was undetectable. Second, several studies reported increased Δ133p53 level compared to wild-type p53 and that it has implications in tumor development2, 3, 4, 9. Third, the apoptosis activity of H1299 cells overexpressing p53 proteins was analyzed in the revised manuscript (Figure 7). The apoptotic activity induced by FLp53 expression was approximately 2.5 times higher than that of the control vector under identical plasmid DNA transfection conditions (Figure 7). These results rule out the possibility that the plasmid-based expression of p53 and its isoforms introduced artifacts in the results. We've discussed this in the Results section (lines 254-269).

      Reviewer #3 (Significance (Required)):

      Overall, the paper is interesting particularly considering the range of techniques used which is the main strength.

      The main limitation to me is the lack of contradictory discussion as all argumentation presents Δ133p53α and Δ160p53α exclusively as oncogenic and strictly FLp53 dominant-negative when, particularly for Δ133p53α, a quite extensive literature suggests a not so clear-cut activity.

      The aggregation mechanism is reported for the first time for Δ133p53α and Δ160p53α, although it was already published for Δ40p53α, Δ133p53β or in mutant p53.

      This manuscript would be a good basic research addition to the p53 field to provide insight in the mechanism for some activities of some p53 isoforms.

      My field of expertise is the p53 isoforms which I have been working on for 11 years in cancer and neuro-degenerative diseases

      Response: Thank you very much for your positive and critical comments. We've included a fair discussion on the oncogenic and non-oncogenic function of Δ133p53 in the Introduction following your suggestion (lines 62-73).

      References

      1. Pitolli C, Wang Y, Candi E, Shi Y, Melino G, Amelio I. p53-Mediated Tumor Suppression: DNA-Damage Response and Alternative Mechanisms. Cancers 11, (2019).

      Fujita K, et al. p53 isoforms Delta133p53 and p53beta are endogenous regulators of replicative cellular senescence. Nature cell biology 11, 1135-1142 (2009).

      Fragou A, et al. Increased Δ133p53 mRNA in lung carcinoma corresponds with reduction of p21 expression. Molecular medicine reports 15, 1455-1460 (2017).

      Bourdon JC, et al. p53 isoforms can regulate p53 transcriptional activity. Genes & development 19, 2122-2137 (2005).

      Ghosh A, Stewart D, Matlashewski G. Regulation of human p53 activity and cell localization by alternative splicing. Molecular and cellular biology 24, 7987-7997 (2004).

      Aoubala M, et al. p53 directly transactivates Δ133p53α, regulating cell fate outcome in response to DNA damage. Cell death and differentiation 18, 248-258 (2011).

      Marcel V, et al. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter. Oncogene 29, 2691-2700 (2010).

      Zhao L, Sanyal S. p53 Isoforms as Cancer Biomarkers and Therapeutic Targets. Cancers 14, (2022).

      Nutthasirikul N, Limpaiboon T, Leelayuwat C, Patrakitkomjorn S, Jearanaikoon P. Ratio disruption of the ∆133p53 and TAp53 isoform equilibrium correlates with poor clinical outcome in intrahepatic cholangiocarcinoma. International journal of oncology 42, 1181-1188 (2013).

      Tadijan A, et al. Altered Expression of Shorter p53 Family Isoforms Can Impact Melanoma Aggressiveness. Cancers 13, (2021).

      Aubrey BJ, Kelly GL, Janic A, Herold MJ, Strasser A. How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression? Cell death and differentiation 25, 104-113 (2018).

      Ghorbani N, Yaghubi R, Davoodi J, Pahlavan S. How does caspases regulation play role in cell decisions? apoptosis and beyond. Molecular and cellular biochemistry 479, 1599-1613 (2024).

      Petronilho EC, et al. Oncogenic p53 triggers amyloid aggregation of p63 and p73 liquid droplets. Communications chemistry 7, 207 (2024).

      Forget KJ, Tremblay G, Roucou X. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53. PloS one 8, e69242 (2013).

      Farmer KM, Ghag G, Puangmalai N, Montalbano M, Bhatt N, Kayed R. P53 aggregation, interactions with tau, and impaired DNA damage response in Alzheimer's disease. Acta neuropathologica communications 8, 132 (2020).

      Arsic N, et al. Δ133p53β isoform pro-invasive activity is regulated through an aggregation-dependent mechanism in cancer cells. Nature communications 12, 5463 (2021).

      Melo Dos Santos N, et al. Loss of the p53 transactivation domain results in high amyloid aggregation of the Δ40p53 isoform in endometrial carcinoma cells. The Journal of biological chemistry 294, 9430-9439 (2019).

      Mestrom L, et al. Artificial Fusion of mCherry Enhances Trehalose Transferase Solubility and Stability. Applied and environmental microbiology 85, (2019).

      Kaba SA, Nene V, Musoke AJ, Vlak JM, van Oers MM. Fusion to green fluorescent protein improves expression levels of Theileria parva sporozoite surface antigen p67 in insect cells. Parasitology 125, 497-505 (2002).

      Snapp EL, et al. Formation of stacked ER cisternae by low affinity protein interactions. The Journal of cell biology 163, 257-269 (2003).

      Jain RK, Joyce PB, Molinete M, Halban PA, Gorr SU. Oligomerization of green fluorescent protein in the secretory pathway of endocrine cells. The Biochemical journal 360, 645-649 (2001).

      Campbell RE, et al. A monomeric red fluorescent protein. Proceedings of the National Academy of Sciences of the United States of America 99, 7877-7882 (2002).

      Hofstetter G, et al. Δ133p53 is an independent prognostic marker in p53 mutant advanced serous ovarian cancer. British journal of cancer 105, 1593-1599 (2011).

      Bischof K, et al. Influence of p53 Isoform Expression on Survival in High-Grade Serous Ovarian Cancers. Scientific reports 9, 5244 (2019).

      Gong L, et al. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage. Cell research 25, 351-369 (2015).

      Gong L, et al. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming. Scientific reports 6, 37281 (2016).

      Gong L, Pan X, Yuan ZM, Peng J, Chen J. p53 coordinates with Δ133p53 isoform to promote cell survival under low-level oxidative stress. Journal of molecular cell biology 8, 88-90 (2016).

      Candeias MM, Hagiwara M, Matsuda M. Cancer-specific mutations in p53 induce the translation of Δ160p53 promoting tumorigenesis. EMBO reports 17, 1542-1551 (2016).

      Horikawa I, et al. Δ133p53 represses p53-inducible senescence genes and enhances the generation of human induced pluripotent stem cells. Cell death and differentiation 24, 1017-1028 (2017).

      Mondal AM, et al. Δ133p53α, a natural p53 isoform, contributes to conditional reprogramming and long-term proliferation of primary epithelial cells. Cell death & disease 9, 750 (2018).

      Joruiz SM, Von Muhlinen N, Horikawa I, Gilbert MR, Harris CC. Distinct functions of wild-type and R273H mutant Δ133p53α differentially regulate glioblastoma aggressiveness and therapy-induced senescence. Cell death & disease 15, 454 (2024).

      O'Brate A, Giannakakou P. The importance of p53 location: nuclear or cytoplasmic zip code? Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy 6, 313-322 (2003).

      Horikawa I, et al. Autophagic degradation of the inhibitory p53 isoform Δ133p53α as a regulatory mechanism for p53-mediated senescence. Nature communications 5, 4706 (2014).

      Lee H, et al. IRE1 plays an essential role in ER stress-mediated aggregation of mutant huntingtin via the inhibition of autophagy flux. Human molecular genetics 21, 101-114 (2012).

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript entitled "Δ133p53 and Δ160p53 isoforms of the tumor suppressor protein p53 exert dominant-negative effect primarily by co-aggregation", the authors suggest that the Δ133p53 and Δ160p53 isoforms have high aggregation propensity and that by co-aggregating with canonical p53 (FLp53), they sequestrate it away from DNA thus exerting a dominant-negative effect over it.

      First, the authors should make it clear throughout the manuscript, including the title, that they are investigating Δ133p53α and Δ160p53α since there are 3 Δ133p53 isoforms (α, β, γ), and 3 Δ160p53 isoforms (α, β, γ).

      One concern is that the authors only consider and explore Δ133p53α and Δ160p53α isoforms as exclusively oncogenic and FLp53 dominant-negative while not discussing evidences of different activities. Indeed, other manuscripts have also shown that Δ133p53α is non-oncogenic and non-mutagenic, do not antagonize every single FLp53 functions and are sometimes associated with good prognosis. To cite a few examples: Hofstetter G. et al. D133p53 is an independent prognostic marker in p53 mutant advanced serous ovarian cancer. Br. J. Cancer 2011, 105, 1593-1599. Bischof, K. et al. Influence of p53 Isoform Expression on Survival in High-Grade Serous Ovarian Cancers. Sci. Rep. 2019, 9,5244. Knezovi´c F. et al. The role of p53 isoforms' expression and p53 mutation status in renal cell cancer prognosis. Urol. Oncol. 2019, 37, 578.e1-578.e10. Gong, L. et al. p53 isoform D113p53/D133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage. Cell Res. 2015, 25, 351-369. Gong, L. et al. p53 isoform D133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming. Sci. Rep. 2016, 6, 37281. Horikawa, I. et al. D133p53 represses p53-inducible senescence genes and enhances the generation of human induced pluripotent stem cells. Cell Death Differ. 2017, 24, 1017-1028. Gong, L. p53 coordinates with D133p53 isoform to promote cell survival under low-level oxidative stress. J. Mol. Cell Biol. 2016, 8, 88-90.

      On the figures presented in this manuscript, I have three major concerns:

      1. Most results in the manuscript rely on the overexpression of the FLAG-tagged or V5-tagged isoforms. The validation of these construct entirely depends on Supplementary figure 3 which the authors claim "rule[s] out the possibility that the FLAG epitope might contribute to this aggregation. However, I am not entirely convinced by that conclusion. Indeed, the ratio between the "regular" isoform and the aggregates is much higher in the FLAG-tagged constructs than in the V5-tagged constructs. We can visualize the aggregates easily in the FLAG-tagged experiment, but the imaging clearly had to be overexposed (given the white coloring demonstrating saturation of the main bands) to visualize them in the V5-tagged experiments. Therefore, I am not convinced that an effect of the FLAG-tag can be ruled out and more convincing data should be added.
      2. The authors demonstrate that to visualize the dominant-negative effect, Δ133p53α and Δ160p53α must be "present in a higher proportion than FLp53 in the tetramer" and the need at least a transfection ratio 1:5 since the 1:1 ration shows no effect. However, in almost every single cell type, FLp53 is far more expressed than the isoforms which make it very unlikely to reach such stoichiometry in physiological conditions and make me wonder if this mechanism naturally occurs at endogenous level. This limitation should be at least discussed.
      3. Figure 5C: I am concerned by the subcellular location of the Δ133p53α and Δ160p53α as they are commonly considered nuclear and not cytoplasmic as shown here, particularly since they retain the 3 nuclear localization sequences like the FLp53 (Bourdon JC et al. 2005; Mondal A et al. 2018; Horikawa I et al, 2017; Joruiz S. et al, 2024). However, Δ133p53α can form cytoplasmic speckles (Horikawa I et al, 2017) when it colocalizes with autophagy markers for its degradation. The authors should discuss this issue. Could this discrepancy be due to the high overexpression level of these isoforms? A co-staining with autophagy markers (p62, LC3B) would rule out (or confirm) activation of autophagy due to the overwhelming expression of the isoform.

      Minor concerns:

      • Figure 1A: the initiation of the "Δ140p53" is shown instead of "Δ40p53"
      • Figure 2A: I would like to see the images cropped a bit higher, so the cut does not happen just above the aggregate bands
      • Figure 3C: what ratio of FLp53/Delta isoform was used?
      • Figure 3C suggests that the "dominant-negative" effect is mostly senescence-specific as it does not affect apoptosis target genes, which is consistent with Horikawa et al, 2017 and Gong et al, 2016 cited above. Furthermore, since these two references and the others from Gong et al. show that Δ133p53α increases DNA repair genes, it would be interesting to look at RAD51, RAD52 or Lig4, and maybe also induce stress.
      • Figure 5A and B: directly comparing the level of FLp53 expressed in cytoplasm or nucleus to the level of Δ133p53α and Δ160p53α expressed in cytoplasm or nucleus does not mean much since these are overexpressed proteins and therefore depend on the level of expression. The authors should rather compare the ratio of cytoplasmic/nuclear FLp53 to the ratio of cytoplasmic/nuclear Δ133p53α and Δ160p53α.

      Referees cross-commenting

      I agree that the system needs to be improved to be more physiological.

      Just to precise, the D133 and D160 isoforms are not truncated mutants, they are naturally occurring isoforms expressed in almost every normal human cell type from an internal promoter within the TP53 gene.

      Using overexpression always raises concerns, but in this case I am even more careful because the isoforms are almost always less expressed than the FLp53, and here they have to push it 5 to 10 times more expressed than the FLp53 to see the effect which make me fear an artifact effect due to the overwhelming overexpression (which even seems to change the normal localization of the protein).

      To visualize the endogenous proteins, they will have to change cell line as the H1299 they used are p53 null.

      Significance

      Overall, the paper is interesting particularly considering the range of techniques used which is the main strength. The main limitation to me is the lack of contradictory discussion as all argumentation presents Δ133p53α and Δ160p53α exclusively as oncogenic and strictly FLp53 dominant-negative when, particularly for Δ133p53α, a quite extensive literature suggests a not so clear-cut activity.

      The aggregation mechanism is reported for the first time for Δ133p53α and Δ160p53α, although it was already published for Δ40p53α, Δ133p53β or in mutant p53.

      This manuscript would be a good basic research addition to the p53 field to provide insight in the mechanism for some activities of some p53 isoforms.

      My field of expertise is the p53 isoforms which I have been working on for 11 years in cancer and neuro-degenerative diseases

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Authors has provided a mechanism by which how presence of truncated P53 can inactivate function of full length P53 protein. Authors proposed this happens by sequestration of full length P53 by truncated P53.

      In the study, performed experiments are well described.

      My area of expertise is molecular biology/gene expression, and I have tried to provide suggestions on my area of expertise. The study has been done mainly with overexpression system and I have included few comments which I can think can be helpful to understand effect of truncated P53 on endogenous wild type full length protein. Performing experiments on these lines will add value to the observation according to this reviewer.

      Major comments:

      1. What happens to endogenous wild type full length P53 in the context of mutant/truncated isoforms, that is not clear. Using a P53 antibody which can detect endogenous wild type P53, can authors check if endogenous full length P53 protein is also aggregated as well? It is hard to differentiate if aggregation of full length P53 happens only in overexpression scenario, where lot more both of such proteins are expressed. In normal physiological condition P53 expression is usually low, tightly controlled and its expression get induced in altered cellular condition such as during DNA damage. So, it is important to understand the physiological relevance of such aggregation, which could be possible if authors could investigate effect on endogenous full length P53 following overexpression of mutant isoforms.
      2. Can presence of mutant P53 isoforms can cause functional impairment of wild type full length endogenous P53? That could be tested as well using similar ChIP assay authors has performed, but instead of antibody against the Tagged protein if the authors could check endogenous P53 enrichment in the gene promoter such as P21 following overexpression of mutant isoforms. May be introducing a condition such as DNA damage in such experiment might help where endogenous P53 is induced and more prone to bind to P53 target such as P21.
      3. On similar lines, authors described: "To test this hypothesis, we escalated the ratio of FLp53 to isoforms to 1:10. As expected, the activity of all four promoters decreased significantly at this ratio (Figure 4A-D). Notably, Δ160p53 showed a more potent inhibitory effect than Δ133p53 at the 1:5 ratio on all promoters except for the p21 promoter, where their impacts were similar (Figure 4E-H). However, at the 1:10 ratio, Δ133p53 and Δ160p53 had similar effects on all transactivation except for the MDM2 promoter (Figure 4E-H)." Again, in such assay authors used ratio 1:5 to 1:10 full length vs mutant. How authors justify this result in context (which is more relevant context) where one allele is Wild type (functional P53) and another allele is mutated (truncated, can induce aggregation). In this case one would except 1:1 ratio of full-length vs mutant protein, unless other regulation is going which induces expression of mutant isoforms more than wild type full length protein. Probably discussing on these lines might provide more physiological relevance to the observed data.
      4. Finally does this altered function of full length P53 (preferably endogenous one) in presence of truncated P53 has any phenotypic consequence on the cells (if authors choose a cell type which is having wild type functional P53). Doing assay such as apoptosis/cell cycle could help us to get this visualization.

      Referees cross-commenting

      I think the comments from the other reviewers are very much reasonable and logical. Especially all 3 reviewers have indicated, a better way to visualize the aggregation of full-length wild type P53 by truncated P53 (such as looking at endogenous P53# by reviewer 1, having fluorescent tag #by reviewer 2 and reviewer 3 raised concern on the FLAG tag) would add more value to the observation.

      Significance

      The work in significant, since it points out more mechanistic insight how wild type full length P53 could be inactivated in the presence of truncated isoforms, this might offer new opportunity to recover P53 function as treatment strategies against cancer.

    1. Reviewer #1 (Public review):

      Summary:

      Wang et al. generate XAP5 and XAP5L knockout mice and find that they are male infertile due to spermatogonial/meiotic arrest and reduced sperm motility, respectively. CUT & Tag data were added in this revision in order to support that XAP5 and XAP5L are antagonistic transcription factors of cilliogenesis.

      Strengths:

      Knockout mouse models provided strong evidence to indicate that XAP5 and XAP5L are critical for spermatogenesis. RNA-seq and CUT & Tag are valuable sources to further explore their molecular mechanisms.

      Weaknesses:

      The authors claim that XAP5 and XAP5L transcriptionally regulate sperm flagella development; however, expression, physiological role, and molecular evidence do not well support this concept. This reviewer still thinks the physiological roles of XAP5 and XAP5l are different. (i) XAP5 is expressed at spermatogonia within testes while XAP5l is localized at round/elongating spermatids (their expressions are different). (ii) Spermatogenesis was arrested at spermatogonia/early spermatocyte stage in Xap5-KO mice while sperm abnormalities were observed in Xap5l-KO mice (their roles are different). This reviewer still can't get the authors' viewpoint that XAP5 and XAP5l are 'antagonistic relationship' to regulate sperm flagella development. RNA-seq and CUT & Tag data are valuable source; however, this reviewer suggests exploring how XAP5 regulates spermatogonia differentiation and how XAP5l regulates sperm flagella motility.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      In the first part of the manuscript the authors present a thorough description of the background and theoretical basis to the identification of a fluorescent pair that permits both FCS and FCCS measurements at the single cell level to enable the determination of Kd values between labelled protein pairs (Figures 1 and 2). The generation of the reagents and subsequent experimental details are thorough and would permit the experiments to be repeated. The first two sections are well argued and appropriately controlled.

      They then tag the endogenous S. pombe cdk1 and cdc13 genes at their 3' ends with sequences that encode miRFP670 (a near infrared fluorescent protein) and mNG (mNeonGreen) respectively and from measurements collected on 13 cells derive a mean Kd value calculated for each of the 13 cells of 0.31{plus minus}0.22 μM. They note that this value agrees with that reported by the Pines lab following labelling of cyclin B1 and CDK1 with genome editing in RPE-1/hTERT cells.

      The final part of the manuscript then extends the technique to a pair-wise analysis of 9 cyclins and 4 CDKs in a human cell line.

      Major Comments

      (i) Materials and Methods: Page 10 "The fitting process was constrained by initial estimates and bounded by physically reasonable limits." Please define physically reasonable limits"

      (ii) For the characterisation of the cell cycle dependent expression of Cdc13 and its association with Cdc2, the level of Cdc13 expression is used to identify cell cycle stage. It would be appropriate to have an independent measure of cell cycle stage (?cell length). In using Cdc13 to identify cell cycle stage, please define the criteria used ie what level of Cdc13-mNG fluorescence intensity was used to define G1 vs S vs G2?

      (iii) Include a control experiment to compare the level of Cdc13 expression in untagged wild-type cells vs the Cdc13-mNG, CDK1- miRFP670 expressing cells to confirm that tagging does not affect Cdc13 expression, cell cycle duration or Cdc13 function.

      (iv). Could the authors consider exploiting the tractability of yeast cells to block and release and/or genetic means to establish synchronous populations to improve data acquisition? This approach could also be employed to assess whether CDK1-cyclin B1 affinity changes with cell cycle stage (as was shown by Pines et al in RPE-1 cells) and would demonstrate that their approach is as equally suitable to sensitively distinguish CDK-cyclin pairs in yeast cells.

      Minor points

      (i) Figure 1. Panels C, F, G and H. Please improve color palette to distinguish the overlapping traces. It might be helpful to remove the edge grey and broaden the color spectrum for visual inclusion (eg straw/blue vs green/red). Could the statement "As expected, mNG exhibited tolerance to the photobleaching when excited at low laser power (< 5%) (Fig. 1C)." be supported by additional labelling on the figure panel.

      The manuscript then goes on to describe the measurement of Kds for 36 CDK-cyclin pairs in HeLa cells by overexpression of labelled CDKs and cyclins following transient overexpression by plasmid co-transfection. This last section of the manuscript requires significant revision.

      Major points

      (i) In analysing the data, the model assumes that the monomeric CDK and cyclin subunits are either bound to form a binary complex or not. Can the authors discuss whether this can be presumed to be the case when they present the results. Either the labelled proteins are overexpressed to such a level that it can be presumed in the data handling that they are behaving as monomeric proteins and the resulting derived Kds reflect binary CDK-cyclin interactions. However, within the cell, the situation is more complex, and both CDKs and cyclins will mostly likely (and dependent on identity) be variably associated with multiple alternative protein partners. Can such effects be discounted in the analysis presented here and what would be the experimental grounds to do so. The authors make note of this fact in the discussion when they note that the results presented in this manuscript differ by circa an order of magnitude for the CDK1-cyclin B1 pairing reported by Pines et al using endogenously labelled proteins. They suggest that the discrepancy might result in part from competition from endogenously unlabelled proteins. This discrepancy has to be addressed.

      (ii) Please provide the confidence interval for the data fit for each CDK-cyclin pair. In panel Figure 4I, the results are represented as a heat map to define the Kd for each CDK-cyclin pair. This panel suggests that the technique can sensitively distinguish alternative CDK-cyclin complexes where their Kd values differ in 1 uM increments. The heat map is presented with block colours, but the key to the color coding is a graded color scheme and it is not possible to move between the two. This disconnect has to be addressed. The accompanying text on pages 18 and 19 is a qualitative description of the results, a comparative and quantitative analysis of the data (Kd values with accompanying confidence intervals) has to be included to justify the apparent strength of the technique to discriminate different CDK-cyclin pairs that Figure 4 implies.

      (iii) For "low affinity" interactions that are determined to be >10 uM. Please define how this value was calculated. Would it be more appropriate to say a value could not be determined as the data could not be fitted?

      (iv) Previous work from the Pines lab using FCS and FCCS to measure the binding of CDK1 to cyclin B1 in RPE-1 cells reported not only a higher affinity for the pair but also that their apparent affinity was dependent on cell cycle stage suggesting that their assembly might be multi-stepped. Both affinity and cell cycle dependency of CDK-cyclin pairings are of great interest to scientists working in the cell cycle field. It could be argued that measurements of the affinities of multiple CDK-cyclin pairs each "averaged out" over the cell cycle will have less impact on the field than a few well-chosen CDK-cyclin pairs characterised in greater depth.

      Minor Points

      (i) For both Figures 3 and 4 address red/green color pair choice.

      Referee cross-commenting

      I would like to thank the other reviewer for their comments about requirements and possible control experiments for the use of the fluorescent probes.

      We agree that the use of tagged proteins overexpressed in cells to measure Kd values has significant limitations:

      (i) Competition between tagged and endogenous proteins

      (ii) Limiting factors that affect CDK-cyclin complex stability (PTMs and contributions from binding and assembly factors mentioned).

      (iii) Cell cycle dependent protein expression

      Points (ii) and (iii) are not applicable to all protein-protein pairs but are significant when trying to determine CDK-cyclin affinities.

      Ideally it would be demonstrated that this approach can return the established values for a limited subset of CDK-cyclin pairs in mammalian cells and so extrapolate the results from yeast cells where endogenous labelling was carried out.

      We also have shared concerns about the data presentation in Figure 4.

      Significance

      Technology: The paper describes a technical advance in identifying a fluorescent probe pair suitable for FCCS in living cells.

      Cell cycle: The ability of CDKs and cyclins to discriminate each other and pair to form complexes that characterise different cell cycle stages and drive progression has long been appreciated. The formation of non-cognate pairings when the cell cycle is perturbed has also been noted and a greater understanding of the in-cell affinities of all possible CDK-cyclin complexes would be a significant advance in our understanding. However, this manuscript currently does not (i) provide statistically validated measures of apparent differences in affinity between different CDK-cyclin pairs and (ii) address whether the measurements are cell cycle dependent. (iii) Interpretation of the results has to take into consideration that both the CDK and cyclin components are transiently over expressed in cells and therefore the values that are measured are difficult to interpret in terms of CDK and cyclin function. These considerations would dampen interest in the findings by cell cycle biologists.

      Expertise: CDKs, cyclin, cell cycle biology.

      Non-expert in technical aspects of fluorescence microscopy

    1. This suffers from a sufficient formalisation of the concept of "similarity". Everything is either so similar that characterisation as "identical", similar or different or very different, depending on the frame of reference. By pointing out some resemblense, you cannot make a justified judgement about the similarity or difference of anything. I would suggest that Luhmann didn't write more about his method himself because it would have been generally fruitless for him as everyone around him was doing exactly the same thing. I asked ca. two dozen professors at the very university about their method (btw. at the very university that Luhmann was a professor at). NONE had anything remotely resembling a Luhmann-Zettelkasten. During his lifetime there was quite some interest in his Zettelkasten, hence the visitors, hence the disappointment of the visitors (people made an effort to review his Zettelkasten): (9/8,3) Geist im Kasten? Zuschauer kommen. Sie bekommen alles zu sehen, und nichts als das – wie beim Pornofilm. Und entsprechend ist die Enttäuschung. - From his own Zettelkasten So: The statement that his practice was basically common place (or even a common place book) is not based on sound reasoning (sufficiently precise in the use of the concept "similarity") There is empirical evidence that it was very uncommon. (Which is obvious if you think about the his theoretical reasoning about his Zettelkasten as heavily informed by the very systems theory that he developed. So, a reasoning unique to him)

      Reply to u/FastSascha at https://old.reddit.com/r/Zettelkasten/comments/1ilvvnc/you_need_to_first_define_the_zettlekasten_methoda/mc01tsr/

      The primary and really only "innovation" for Luhmann's system was his numbering and filing scheme (which he most likely borrowed and adapted from prior sources). His particular scheme only serves to provide specific addresses for finding his notes. Regardless of doing this explicitly, everyone's notes have a physical address and can be cross referenced or linked in any variety of ways. In John Locke's commonplacing method of 1685/1706 he provided an alternate (but equivalent method) of addressing and allowing the finding of notes. Whether you address them specifically or not doesn't change their shape, only the speed by which they may be found. This may shift an affordance of using such a system, but it is invariant from the form of the system. What I'm saying is that the form and shape of Luhmann's notes is identical to the huge swath of prior art within intellectual history. He was not doing something astoundingly new or different. By analogy he was making the same Acheulean hand axe everyone else was making; it's not as if he figured out a way to lash his axe to a stick and then subsequently threw it to invent the spear.

      When I say the method was commonplace at the time, I mean that a broad variety of people used it for similar reasons, for similar outputs, and in incredibly similar methods. You can find a large number of treatises on how to do these methods over time and space, see a variety of examples I've collected in Zotero which I've mentioned several times in the past. Perhaps other German professors weren't using the method(s) as they were slowly dying out over the latter half of the 20th century with the rise and ultimate ubiquity of computers which replaced many of these methods. I'll bet that if probed more deeply they were all doing something and the something they were doing (likely less efficiently and involving less physically evident means) could be seen to be equivalent to Luhmann's.

      This also doesn't mean that these methods weren't actively used in a variety of equivalent forms by people as diverse as Aristotle, Cicero, Quintilian, Seneca, Boethius, Thomas Aquinas, Desiderius Erasmus, Rodolphus Agricola, Philip Melancthon, Konrad Gessner, John Locke, Carl Linnaeus, Thomas Harrison, Vincentius Placcius, Gottfried Wilhelm Leibniz, S. D. Goitein, Gotthard Deutsch, Beatrice Webb, Sir James Murray, Marcel Mauss, Claude Lévi-Strauss, Mortimer J. Adler, Niklas Luhmann, Roland Barthes, Umberto Eco, Jacques Barzun, Vladimir Nabokov, George Carlin, Twyla Tharp, Gertrud Bauer, and even Eminem to name but a few better known examples. If you need additional examples to look at, try searching my Hypothesis account for tag:"zettelkasten examples". Take a look at their examples and come back to me and tell me that beyond the idiosyncrasies of their individual use that they weren't all doing the same thing in roughly the same ways and for roughly the same purposes. While the modalities (digital or analog) and substrates (notebooks, slips, pen, pencil, electrons on silicon, other) may have differed, the thing they were doing and the forms it took are all equivalent.

      Beyond this, the only thing really unique about Luhmann's notes were that he made them on subjects that he had an interest, the same way that your notes are different from mine. But broadly speaking, they all have the same sort of form, function, and general topology.

      If these general methods were so uncommon, how is it that all the manuals on note taking are all so incredibly similar in their prescriptions? How is it that Marbach can do an exhibition in 2013 featuring 6 different zettelkasten, all ostensibly different, but all very much the same?

      Perhaps the easier way to see it all is to call them indexed databases. Yours touches on your fiction, exercise, and nutrition; Luhmann's focuses on sociology and systems theory; mine looks at intellectual history, information theory, evolution, and mathematics; W. K. Kellogg's 640 drawer system in 1906 focused on manufacturing, distributing and selling Corn Flakes; Jonathan Edwards' focused on Christianity. They all have different contents, but at the end of the day, they're just indexed databases with the same forms and functionalities. Their time periods, modalities, substrates, and efficiencies have differed, but at their core they're all far more similar in structure than they are different.

      Perhaps one day, I'll write a deeper treatise with specific definitions and clearer arguments laying out the entire thing, but in the erstwhile, anyone saying that Luhmann's instantiation is somehow more unique than all the others beyond the meaning expressed by Antoine de Saint-Exupéry in The Little Prince is fooling themselves. Instead, I suspect that by realizing you're part of a longer, tried-and-true tradition, your own practice will be far easier and more useful.

      The simplicity of the system (or these multiply-named methods) allows for the rise of a tremendous amount of complexity. This resultant complexity can in turn hide the simplicity of the root system.

      “To me, you are still nothing more than a little boy who is just like a hundred thousand other little boys. And I have no need of you. And you, on your part, have no need of me. To you, I am nothing more than a fox like a hundred thousand other foxes. But if you tame me, then we shall need each other. To me, you will be unique in all the world. To you, I shall be unique in all the world..."

      I can only hope people choose to tame more than Luhmann.

    2. Explain your definition of hierarchical reference system. How is one note in his system higher, better, or more important than another? Where do you see hierarchies? Lets say Luhmann were doing something on bread. First off he has 3 notes and these end up sequenced 1,2,3. Then he does the equivelent of a block link on 1 by creating 1a=banana bread, 1b=flour bread. A good discussion (https://yannherklotz.com/zettelkasten/) If there weren't direct mappings, it should be impossible to copy & paste Luhmann's notes into Obsidian, Logseq, OneNote, Evernote, Excel, or even Wikipedia. That's not true at all. One can dump from one structure into another structure you just potentially lose structure in the mapping. Those systems don't have similar capabilities. Obsidian has folders Logseq does not. Logseq has block level linking Obsidian does not. I can't even reliable map between the first two elements of your list. Now we throw in OneNote that directly takes OLE embeds which means information linked can dynamically change after being embedded. That is say I'm tracking "current BLS inflation data" it will remain permanently current in my note. Neither Obsidian nor Logseq support that. Etc.. Excel, OneNote and Logseq allow for computations in the note (i.e. the note can contain information not directly entered) Obsidian and Wikipedia do not. We might argue about efficiencies, affordances, or speed, but at the end of the day they're all still structurally similar. We are totally disagreeing here. The OLE example being the clearest cut example.

      reply to u/JeffB1517 at https://old.reddit.com/r/Zettelkasten/comments/1ilvvnc/you_need_to_first_define_the_zettlekasten_methoda/mc1y4oj/

      I'm not new here: https://boffosocko.com/research/zettelkasten-commonplace-books-and-note-taking-collection/

      You example of a hierarchy was not a definition. In practice Luhmann eschewed hierarchies, though one could easily modify his system to create them. This has been covered ad nauseam here in conversations on top-down and bottom-up thinking.

      When "dumping" from one program to another, one can almost always easily get around a variety of affordances supplied by one and not another simply by adding additional data, text, references, links, etc. As an example, my paper system can do Logseq's block level linking by simply writing a card address down and specifying word 7, sentence 3, paragraph 4, etc. One can also do this in Obsidian in a variety of other technical means and syntaxes including embedding notes. Block level linking is a nice affordance when available but can be handled in a variety of different (and structurally similar) ways. Books as a technology have been doing block level linking for centuries; in that context it's called footnotes. In more specialized and frequently referenced settings like scholarship on Plato there is Stephanus pagination or chapter and verse numberings in biblical studies. Roam and Logseq aren't really innovating here.

      Similarly your OLE example is a clever and useful affordance, but could be gotten around by providing an equation that is carried out by hand and done each time it's needed---sure it may take more time, but it's doable in every system. This may actually be useful in some contexts as then one would have the time sequences captured and logged in their files for later analysis and display. These affordances are things which may make things easier and simpler in some cases, but they generally don't change the root structure of what is happening. Digital search is an example of a great affordance, except in cases when it returns thousands of hits which then need to be subsequentlly searched. Short indexing methods with pen and paper can be done more quickly in some cases to do the same search because one's notes can provide a lot of other contextual clues (colored cards, wear on cards, physical location of cards, etc.) that a pure digital search does not. I often can do manual searches through 30,000 index cards more quickly and accurately than I can through an equivalent number of digital notes.

      There is a structural equivalence between folders and tags/links in many programs. This is more easily seen in digital contexts where a folder can be programatically generated by executing a search on a string or tag which then results in a "folder" of results. These searches are a quick affordance versus actively maintaining explicit folders otherwise, but the same result could be had even in pen and paper contexts with careful indexing and manual searches (which may just take longer, but it doesn't mean that they can't be done.) Edge-notched cards were heavily used in the mid-20th century to great effect for doing these sorts of searches.

      When people here are asking or talking about a variety of note taking programs, the answer almost always boils down to which one you like best because, in large part, a zettlkasten can be implemented in all of them. Some may just take more work and effort or provide fewer shortcuts or affordances.

    1. Reviewer #3 (Public review):

      Summary:

      The mechanisms by which short-term isolation influences the brain to promote social behavior remain poorly understood. The authors observed that acute isolation enhanced social behaviors, including increased investigation, mounting, and ultrasonic vocalizations (USVs). These effects were evident in same-sex interactions among females and in male-female interactions. Concurrently, cFos expression in the preoptic area (POA) of the hypothalamus was selectively elevated in single-housed females. To further investigate, the authors used an innovative tagging strategy (TRAP2) to manipulate these neurons. Overall, the study identifies a population of hypothalamic neurons that promote various aspects of social behavior after short-term isolation, with effects that are sex- and context-dependent.

      Strengths:

      Understanding the neural circuit mechanisms underlying acute social isolation is an important and timely topic. By employing state-of-the-art techniques to tag neurons active during specific behavioral epochs, the authors identified the preoptic area (POA) as a key locus mediating the effects of social isolation. The experimental design is sound, and the data are of high quality. Notably, the control experiments, which show that chemogenetic inactivation of other hypothalamic regions (AH and VMH) does not affect social behavior, strongly support the specificity of the POA's role within the hypothalamus. Through a combination of behavioral assays, activity-dependent neural tagging, and circuit manipulation techniques, the authors provide compelling evidence for the POA's involvement in behaviors following social isolation. These findings represent a valuable contribution to understanding how hypothalamic circuits adapt to the challenges of social isolation.

      Weaknesses:

      The authors conducted several circuit perturbation experiments, including chemogenetics, ablation, and optogenetics, to investigate the effects of POA-social neurons. They observed that the outcomes of these manipulations varied depending on whether the intervention was chronic (e.g., ablations) or acute (e.g., DREADDs), potentially due to compensatory mechanisms in other brain regions. Furthermore, their additional experiments revealed that the robustness of the manipulations was influenced by the heterozygosity or homozygosity of TRAP2 animals. While these findings suggest that POA neurons contribute to multiple behavioral responses to social isolation, further experiments are needed to clarify their precise roles.

    1. Storage options: Configure settings here to help you recover your work in the event of a crash.

      This appears in the document itself not its "subtabs". Every tab that has a right triangle to it's left has subtabs and some things that don't show up right away could be hiding in the options of the subtabs if not in the main tag

    1. Knowing that there is a recommendation algorithm, users of the platform will try to do things to make the recommendation algorithm amplify their content. This is particularly important for people who make their money from social media content.

      I feel sometimes overuse of this property can worsen our experiences, for example, some people add a lot of irrelavent tags to their post and their post is recommended to a lot of people. But this can be really annoying when you see something that doesn't align with the tag you like.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews: 

      Reviewer #1 (Public review): 

      The conserved AAA-ATPase PCH-2 has been shown in several organisms including C. elegans to remodel classes of HORMAD proteins that act in meiotic pairing and recombination. In some organisms the impact of PCH-2 mutations is subtle but becomes more apparent when other aspects of recombination are perturbed. Patel et al. performed a set of elegant experiments in C. elegans aimed at identifying conserved functions of PCH-2. Their work provides such an opportunity because in C. elegans meiotically expressed HORMADs localize to meiotic chromosomes independently of PCH-2. Work in C. elegans also allows the authors to focus on nuclear PCH-2 functions as opposed to cytoplasmic functions also seen for PCH-2 in other organisms. 

      The authors performed the following experiments: 

      (1) They constructed C. elegans animals with SNPs that enabled them to measure crossing over in intervals that cover most of four of the six chromosomes. They then showed that doublecrossovers, which were common on most of the four chromosomes in wild-type, were absent in pch-2. They also noted shifts in crossover distribution in the four chromosomes. 

      (2) Based on the crossover analysis and previous studies they hypothesized that PCH-2 plays a role at an early stage in meiotic prophase to regulate how SPO-11 induced double-strand breaks are utilized to form crossovers. They tested their hypothesis by performing ionizing irradiation and depleting SPO-11 at different stages in meiotic prophase in wild-type and pch-2 mutant animals. The authors observed that irradiation of meiotic nuclei in zygotene resulted in pch-2 nuclei having a larger number of nuclei with 6 or greater crossovers (as measured by COSA-1 foci) compared to wildtype. Consistent with this observation, SPO11 depletion, starting roughly in zygotene, also resulted in pch-2 nuclei having an increase in 6 or more COSA-1 foci compared to wild type. The increased number at this time point appeared beneficial because a significant decrease in univalents was observed. 

      (3) They then asked if the above phenotypes correlated with the localization of MSH-5, a factor that stabilizes crossover-specific DNA recombination intermediates. They observed that pch-2 mutants displayed an increase in MSH-5 foci at early times in meiotic prophase and an unexpectedly higher number at later times. They conclude based on the differences in early MSH-5 localization and the SPO-11 and irradiation studies that PCH-2 prevents early DSBs from becoming crossovers and early loading of MSH-5. By analyzing different HORMAD proteins that are defective in forming the closed conformation acted upon by PCH-2, they present evidence that MSH-5 loading was regulated by the HIM-3 HORMAD. 

      (4) They performed a crossover homeostasis experiment in which DSB levels were reduced. The goal of this experiment was to test if PCH-2 acts in crossover assurance. Interestingly, in this background PCH-2 negative nuclei displayed higher levels of COSA-1 foci compared to PCH-2 positive nuclei. This observation and a further test of the model suggested that "PCH-2's presence on the SC prevents crossover designation." 

      (5) Based on their observations indicating that early DSBS are prevented from becoming crossovers by PCH-2, the authors hypothesized that the DNA damage kinase CHK-2 and PCH2 act to control how DSBs enter the crossover pathway. This hypothesis was developed based on their finding that PCH-2 prevents early DSBs from becoming crossovers and previous work showing that CHK-2 activity is modulated during meiotic recombination progression. They tested their hypothesis using a mutant synaptonemal complex component that maintains high CHK-2 activity that cannot be turned off to enable crossover designation. Their finding that the pch-2 mutation suppressed the crossover defect (as measured by COSA-1 foci) supports their hypothesis. 

      Based on these studies the authors provide convincing evidence that PCH-2 prevents early DSBs from becoming crossovers and controls the number and distribution of crossovers to promote a regulated mechanism that ensures the formation of obligate crossovers and crossover homeostasis. As the authors note, such a mechanism is consistent with earlier studies suggesting that early DSBs could serve as "scouts" to facilitate homolog pairing or to coordinate the DNA damage response with repair events that lead to crossing over. The detailed mechanistic insights provided in this work will certainly be used to better understand functions for PCH-2 in meiosis in other organisms. My comments below are aimed at improving the clarity of the manuscript. 

      We thank the reviewer for their concise summary of our manuscript and their assessment of our work as “convincing” and providing “detailed mechanistic insight.”

      Comments 

      (1) It appears from reading the Materials and Methods that the SNPs used to measure crossing over were obtained by mating Hawaiian and Bristol strains. It is not clear to this reviewer how the SNPs were introduced into the animals. Was crossing over measured in a single animal line? Were the wild-type and pch-2 mutations made in backgrounds that were isogenic with respect to each other? This is a concern because it is not clear, at least to this reviewer, how much of an impact crossing different ecotypes will have on the frequency and distribution of recombination events (and possibly the recombination intermediates that were studied). 

      We have clarified these issues in the Materials and Methods of our updated preprint. The control and pch-2 mutants were isogenic in either the Bristol or Hawaiian backgrounds. Control lines were the original Bristol and Hawaiian lines and pch-2 mutants were originally made in the Bristol line and backcrossed at least 3 times before analysis. Hawaiian pch-2 mutants were made by backcrossing pch-2 mutants at least 8 times to the Hawaiian background and verifying the presence of Hawaiian SNPs on all chromosomes tested in the recombination assay. To perform the recombination assays, these lines were crossed to generate the relevant F1s.

      (2) The authors state that in pch-2 mutants there was a striking shift of crossovers (line 135) to the PC end for all of the four chromosomes that were tested. I looked at Figure 1 for some time and felt that the results were more ambiguous. Map distances seemed similar at the PC end for wildtype and pch-2 on Chrom. I. While the decrease in crossing over in pch-2 appeared significant for Chrom. I and III, the results for Chrom. IV, and Chrom. X. seemed less clear. Were map distances compared statistically? At least for this reviewer the effects on specific intervals appear less clear and without a bit more detail on how the animals were constructed it's hard for me to follow these conclusions. 

      We hope that the added details above makes the results of these assays more clear. Map distances were compared and did not satisfy statistical significance, except where indicated. While we agree that the comparisons between control animals and pch-2 mutants may seem less clear with individual chromosomes, we argue that more general, consistent patterns become clear when analyzing multiple chromosomes. Indeed, this is why we expanded our recombination analysis beyond Chromosome III and the X Chromosome, as reported in Deshong, 2014. We have edited this sentence to: “Moreover, there was a striking and consistent shift of crossovers to the PC end of all four chromosomes tested.”

      (3) Figure 2. I'm curious why non-irradiated controls were not tested side-by-side for COSA-1 staining. It just seems like a nice control that would strengthen the authors' arguments. 

      We have added these controls in the updated preprint as Figure 2B.

      (4) Figure 3. It took me a while to follow the connection between the COSA-1 staining and DAPI staining panels (12 hrs later). Perhaps an arrow that connects each set of time points between the panels or just a single title on the X-axis that links the two would make things clearer. 

      To make this figure more clear, we have generated two different cartoons for the assay that scores GFP::COSA-1 foci and the assay that scores bivalents. We have also edited this section of the results to make it more clear.

      Reviewer #2 (Public review): 

      Summary: 

      This paper has some intriguing data regarding the different potential roles of Pch-2 in ensuring crossing over. In particular, the alterations in crossover distribution and Msh-5 foci are compelling. My main issue is that some of the models are confusingly presented and would benefit from some reframing. The role of Pch-2 across organisms has been difficult to determine, the ability to separate pairing and synapsis roles in worms provides a great advantage for this paper. 

      Strengths: 

      Beautiful genetic data, clearly made figures. Great system for studying the role of Pch-2 in crossing over. 

      We thank the reviewers for their constructive and useful summary of our manuscript and the analysis of its strengths. 

      Weaknesses: 

      (1) For a general audience, definitions of crossover assurance, crossover eligible intermediates, and crossover designation would be helpful. This applies to both the proposed molecular model and the cytological manifestation that is being scored specifically in C. elegans. 

      We have made these changes in an updated preprint.

      (2) Line 62: Is there evidence that DSBs are introduced gradually throughout the early prophase? Please provide references. 

      We have referenced Woglar and Villeneuve 2018 and Joshi et. al. 2015 to support this statement in the updated preprint.

      (3) Do double crossovers show strong interference in worms? Given that the PC is at the ends of chromosomes don't you expect double crossovers to be near the chromosome ends and thus the PC? 

      Despite their rarity, double crossovers do show interference in worms. However, the PC is limited to one end of the chromosome. Therefore, even if interference ensures the spacing of these double crossovers, the preponderance of one of these crossovers toward one end (and not both ends) suggest something functionally unique about the PC end.

      (4) Line 155 - if the previous data in Deshong et al is helpful it would be useful to briefly describe it and how the experimental caveats led to misinterpretation (or state that further investigation suggests a different model etc.). Many readers are unlikely to look up the paper to find out what this means. 

      We have added this to the updated preprint: “We had previously observed that meiotic nuclei in early prophase were more likely to produce crossovers when DSBs were induced by the Mos transposon in pch-2 mutants than in control animals but experimental caveats limited our ability to properly interpret this experiment.”

      (5) Line 248: I am confused by the meaning of crossover assurance here - you see no difference in the average number of COSA-1 foci in Pch-2 vs. wt at any time point. Is it the increase in cells with >6 COSA-1 foci that shows a loss of crossover assurance? That is the only thing that shows a significant difference (at the one time point) in COSA-1 foci. The number of dapi bodies shows the loss of Pch-2 increases crossover assurance (fewer cells with unattached homologs). So this part is confusing to me. How does reliably detecting foci vs. DAPI bodies explain this? 

      We have removed this section to avoid confusion.

      (6) Line 384: I am confused. I understand that in the dsb-2/pch2 mutant there are fewer COSA-1 foci. So fewer crossovers are designated when DSBs are reduced in the absence of PCH-2.

      How then does this suggest that PCH-2's presence on the SC prevents crossover designation? Its absence is preventing crossover designation at least in the dsb-2 mutant. 

      We have tried to make this more clear in the updated preprint. In this experiment, we had identified three possible explanations for why PCH-2 persists on some nuclei that do not have GFP::COSA-1 foci: 1) PCH-2 removal is coincident with crossover designation; 2) PCH-2 removal depends on crossover designation; and 3) PCH-2 removal facilitates crossover designation. The decrease in the number of GFP::COSA-1 foci in dsb2::AID;pch-2 mutants argues against the first two possibilities, suggesting that the third might be correct. We have edited the sentence to read: “These data argue against the possibility that PCH-2’s removal from the SC is simply in response to or coincident with crossover designation and instead, suggest that PCH-2’s removal from the SC somehow facilitates crossover designation and assurance.”

      (7) Discussion Line 535: How do you know that the crossovers that form near the PCs are Class II and not the other way around? Perhaps early forming Class I crossovers give time for a second Class II crossover to form. In budding yeast, it is thought that synapsis initiation sites are likely sites of crossover designation and class I crossing over. Also, the precursors that form class I and II crossovers may be the same or highly similar to each other, such that Pch-2's actions could equally affect both pathways. 

      We do not know that the crossovers that form near the PC are Class II but hypothesize that they are based on the close, functional relationship that exists between Class I crossovers and synapsis and the apparent antagonistic relationship that exists between Class II crossovers and synapsis. We agree that Class I and Class II crossover precursors are likely to be the same or highly similar, exhibit extensive crosstalk that may complicate straightforward analysis and PCH-2 is likely to affect both, as strongly suggested by our GFP::MSH-5 analysis. We present this hypothesis based on the apparent relationship between PCH-2 and synapsis in several systems but agree that it needs to be formally tested. We have tried to make this argument more clear in the updated preprint.

      Reviewer #3 (Public review): 

      Summary: 

      This manuscript describes an in-depth analysis of the effect of the AAA+ ATPase PCH-2 on meiotic crossover formation in C. elegant. The authors reach several conclusions, and attempt to synthesize a 'universal' framework for the role of this factor in eukaryotic meiosis. 

      Strengths: 

      The manuscript makes use of the advantages of the 'conveyor' belt system within the c.elegans reproductive tract, to enable a series of elegant genetic experiments. 

      We thank this reviewer for the useful assessment of our manuscript and the articulation of its strengths.

      Weaknesses: 

      A weakness of this manuscript is that it heavily relies on certain genetic/cell biological assays that can report on distinct crossover outcomes, without clear and directed control over other aspects and variables that might also impact the final repair outcome. Such assays are currently out of reach in this model system. 

      In general, this manuscript could be more generally accessible to non-C.elegans readers. Currently, the manuscript is hard to digest for non-experts (even if meiosis researchers). In addition, the authors should be careful to consider alternative explanations for certain results. At several steps in the manuscript, results could ostensibly be caused by underlying defects that are currently unknown (for example, can we know for sure that pch-2 mutants do not suffer from altered DSB patterning, and how can we know what the exact functional and genetic interactions between pch-2 and HORMAD mutants tell us?). Alternative explanations are possible and it would serve the reader well to explicitly name and explain these options throughout the manuscript. 

      We have made the manuscript more accessible to non-C. elegans readers and discuss alternate explanations for specific results in the updated preprint. 

      Recommendations for the authors:  

      Reviewing Editor Comments: 

      (1) Please provide 'n' values for each experiment. 

      n values are now included in the Figure legends for each experiment.

      (2) Line 129: Please represent the DCOs as percent or fraction (1%-9.8%, instead of 1-13). 

      We have made this change.

      (3) Figure 3A legend: the grey bar should read 20hr. COSA-1/ 32 hr DAPI. In Figure 3E, it is not clear why 36hr Auxin and 34hr Auxin show a significant difference in DAPI bodies between control and pch-2, but 32hr Auxin treatment does not. Here again 'n' values will help. 

      We have made this change. We also are not sure why the 32 hour auxin treatment did not show a significant difference in DAPI stained bodies. We have included the n values, which are not very different between timepoints and therefore are unlikely to explain the difference. The difference may reflect the time that it takes for SPO-11 function to be completely abrogated.

      (4) Line 360: Please provide the fraction of PCH-2 positive nuclei in dsb-2.

      We have made this change. 

      Please also address all reviewer comments. 

      Reviewer #1 (Recommendations for the authors): 

      (1) Page 3, line 52. While I agree that crossing over is important to generate new haplotypes, work has suggested that the contribution by an independent assortment of homologs to generate new haplotypes is likely to be significantly greater. One reference for this is: Veller et al. PNAS 116:1659. 

      We deeply appreciate this reviewer pointing us to this paper, especially since it argues that controlling crossover distribution contributes to gene shuffling and now cite it in our introduction! While we agree that this paper concludes that independent assortment likely explains the generation of new haplotypes to a greater degree than crossovers, the authors performed this analysis with human chromosomes and explicitly include the caveat that their modeling assumes uniform gene density across chromosomes. For example, we know this is not true in C. elegans. It would be interesting to perform the same analysis with C. elegans chromosomes in control and pch-2 mutants, taking into account this important difference.

      (2) Figure 2. It would really help the reader if an arrow and text were shown below each irradiation sign to indicate the stage in meiosis in which the irradiation was done as well as another arrow in the late pachytene box to show when the COSA-1 foci were analyzed. In general, having text in the figures that help stage the timing in meiosis would help the non C. elegans reader. This is also an issue where staging of C. elegans is shown (Figure 4). 

      We have made these changes to Figure 2. To help readers interpret Figure 4, we have added TZ and LP to the graphs in Figure 4B and 4D and indicated what these acronyms (transition zone and late pachytene, respectively) are in the Figure legend.

      (3) Page 12, line 288. It would be valuable to first outline why the him3-R93Y and htp-3H96Y alleles were chosen. This was eventually done on Page 13, but introducing this earlier would help the reader. 

      We have introduced these mutations earlier in the manuscript.

      (4) Page 13, line 323. A one sentence description of the OLLAS tagging system would be useful. 

      We have added this sentence: “we generated wildtype animals and pch-2 mutants with both GFP::MSH-5 and a version of COSA-1 that has been endogenously tagged at the Nterminus with the epitope tag, OLLAS, a fusion of the E. coli OmpF protein and the mouse Langerin extracellular domain”

      Reviewer #2 (Recommendations for the authors): 

      (1) The title is a little awkward. Consider: PCH-2 controls the number and distribution of crossovers in C. elegans by antagonizing their formation 

      We have made this change.

      (2) Abstract: 

      Consider removing "that is observed" from line 20. 

      We have made this change.

      I'm confused by the meaning of "reinforcement of crossover-eligible intermediates" from line 27. 

      We have removed this phrase from the abstract.

      A definition of crossover assurance would be helpful in the abstract. 

      We have added this to the abstract: “This requirement is known as crossover assurance and is one example of crossover control.”

      (3) Line 36: I know a stickler but many meioses only produce one haploid gamete (mammalian oocytes, for example) 

      Thanks for the reminder! We have removed the “four” from this sentence.

      (4) Line 284 - are you defining MSH-5 foci as crossover-eligible intermediates? If so, please state this earlier. 

      We have added this to the introduction to this section of the results: “In C. elegans, these crossover-eligible intermediates can be visualized by the loading of the pro-crossover factor MSH-5, a component of the meiosis-specific MutSγ complex that stabilizes crossover-specific DNA repair intermediates called joint molecules”

      (5) Can the control be included in Figure S1? 

      We have made this change.

      (6) Can you define that crossover designation is the formation of a COSA-1 focus? 

      We did this in the section introducing GFP::MSH-5: “In the spatiotemporally organized meiotic nuclei of the germline, a functional GFP tagged version of MSH-5, GFP::MSH-5, begins to form a few foci in leptotene/zygotene (the transition zone), becoming more numerous in early pachytene before decreasing in number in mid pachytene to ultimately colocalize with COSA-1 marked sites in late pachytene in a process called designation” 

      (7) Would it be easier to see the effect of DSB to crossover eligible intermediates in Spo-11, Pch-2 vs. Spo-11 mutant with irradiation using your genetic maps? At least for early vs. late breaks? 

      Unfortunately, irradiation does not show the same bias towards genomic location that endogenous double strand breaks do so it is unlikely to recapitulate the effects on the genetic map.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Reviewer #1 (Public review):

      Weaknesses:

      In my estimation, the following would improve this manuscript:

      (1) The physiological relevance of these data could be better highlighted. For instance, future work could revolve around incubating oocytes with oviduct fluid (or OVGP1) to reduce polyspermy in porcine IVF, and naturally improve sperm selection in human IVF.

      Thank you for the suggestions. We have added these physiological relevance points at the end of the discussion.

      (2) Biological and technical replicate values for each experiment are unclear - for semen, oocytes, and oviduct fluid pools. I suggest providing in the Materials and Methods and/or Figure legends.

      Biological and technical replicates are now indicated in M&M. Number of oocytes or ZPs used were already indicated in every Supplementary Table.

      (3) Although differences presented in the bar charts seem obvious, providing statistical analyses would strengthen the manuscript.

      Statistical analyses are now indicated in each bar chart.

      (4) Results are presented as {plus minus} SEM (line 677); however, I believe standard deviation is more appropriate.

      This was a mistake; all the results are indicated as standard deviation.

      (5) Given the many independent experimental variables and combinations, a schematic depiction of the experimental design may benefit readers.

      A schematic depiction of the experimental design is now included as Figure 1. This new Figure modifies the number assigned to the rest of Figures.

      (6) Attention to detail can be improved in parts, as delineated in the "author recommendation" review section.

      Done

      Reviewer #2 (Public review):

      Weaknesses:

      The authors postulate a role for oviductal fluid in species-specific fertilization, but in my opinion, they cannot rule out hormonal effects or differences in the method of oocyte maturation employed.

      As we indicate below, the effect of hormones has been analyzed, and we have demonstrated that it is not the cause of zona pellucida specificity.

      They also cannot unequivocally prove that OVGP1 is the oviductal protein involved in the effect. Additional experiments are necessary to rule out these alternative explanations.

      Our work does not demonstrate that other proteins could be involved, but it does show that OVGP1 is involved in the process.

      When performing the EZPT assay on mouse oocytes obtained either from the ovary or from the oviduct, the oocytes obtained from the ovary came from mice primed with eCG, whereas the ones collected from the oviduct were obtained from superovulated mice (eCG plus hCG). This difference in the hormonal environment may make a difference in the properties of the ZP. Additionally, the ones obtained from the ovary were in vitro matured, which is also different from the freshly ovulated eggs and, again, may change the properties of the ZP. I suggest doing this experiment superovulating both groups of mice but collecting the fully matured MII eggs from the ovary before they get ovulated. In that way the hormonal environment will be the same in both groups and in both groups, oocytes will be matured in vivo. Hence, the only difference will be the exposure to oviductal fluids.

      In Figure 2, we compare ZPs from murine oocytes obtained from the ovary using only PMSG with ZPs from oviductal oocytes treated with both HCG and PMSG. But in Figure 7, however, we compared ZPs from murine oocytes exposed only to PMSG, with the only difference being whether or not they had been in contact with OVGP1. This shows that it is not the effect of the hormone but rather the contact with OVGP1 that determines their specificity.

      Mice with OVGP1 deletion are viable and fertile. It would be quite interesting to investigate the species-specificity of sperm-ZP binding in this model. That would indicate whether OVGP1 is the only glycoprotein involved in determining species-specificity. Alternatively, the authors could immunodeplete OVGP1 from oviductal fluid and then ascertain whether this depleted fluid retains the ability to impede cross-species fertilization.

      We agree with the reviewer that it would be interesting to investigate sperm-ZP binding in this model. Unfortunately, we do not have the OVGP1 knockout mouse strain. We also believe that immunodepletion of OVGP1 would not completely remove the protein, so its effect would likely not be entirely eliminated.

      What is the concentration of OVGP1 in the oviduct? How did the authors decide what concentration of protein to use in the experiments where they exposed ZPs to purified OVGP1? Why did they use this experimental design to check the structure of the ZP by SEM? Why not do it on oocytes exposed to oviductal fluid, which would be more physiological?

      We have included in the manuscript that the concentration of OVGP1 in the oviductal fluid was quantified using ImageJ software by comparing the mean gray value of the band in the oviductal fluid to the band in the recombinant protein lane. By establishing this relationship, along with the known concentration of protein amount in the recombinant one and in the total protein amount of oviductal fluid, the concentration of OVGP1 in the oviductal fluid was determined as the average of three western blots. The concentration of OVGP1 in oviductal fluids was in the range of 100-150 ng/µl in mice and 150-200 ng/µL in cow. We have included also in the manuscript the concentration that we have use for the EZPTs, 30 ng/µL of recombinants OVGP1 (bovine, murine and human) for 30 minutes in 20µL drops. With this concentration, we observed a clear effect on zona specificity with no negative impact on the gametes.

      As you can see in supplementary Fig S8B, we already realized SEM of oocytes exposed to oviductal fluid.

      None of the figures show any statistical analysis. Please perform analysis for all the data presented, include p values, and indicate which statistical tests were performed. The Statistical analysis section in the Methods indicating that repeated measures ANOVA was used must refer to the tables. Was normality tested? I doubt all the data are normally distributed, in which case using ANOVA is not appropriate.

      Statistical results are now included in each Figure and Table. All the statistical analysis are included, all the data pass normality, homogeneity of variance and independence; for this reason the data analysis was conducted by using a one-way ANOVA, followed by Tukey´s post hoc test. Significance level was set at p <0.05.

      Why was OVGP1 selected as the probable culprit of the species specificity? In the Results section entitled "Homology of bovine, human and murine OVGP1 proteins..." the authors delve into the possible role of this protein without any rationale for investigating it. What about other oviductal proteins?

      A sentence indicating this rationale for investigating OVGP1 has been introduced in this paragraph.

      Reviewer #3 (Public review):

      Weaknesses:

      The manuscript began with a well-written introduction, but problems started to surface in the Results section, in the Discussion, as well as in the Materials and Methods. Major concerns include inconsistencies, misinterpretation of results, lacking up-to-date literature search, numerous errors found in the figure legends, misleading and incorrect information given in the Materials and Methods, missing information regarding statistical analysis, and inadequate discussion. These concerns raise questions regarding the authenticity of the study, reliability of the findings, and interpretation of the results. The manuscript does not provide solid and convincing findings to support the conclusion.

      We have modified and clarified all the issues, some of which are misunderstandings, we have also performed the suggested experiment of putting sperm in contact with OVGP1.

      Recommendations for the authors:

      Reviewer #1 (Recommendations for the authors):

      (1) Ensure consistency in (past) tense, for example, "decondensed" (line 102), "induced" (line 103), and elsewhere.

      Done

      (2) Replace "table" with "Table" throughout.

      Done

      (3) The authors often refer to "co-incubation". I believe this should read "incubation". My understanding is that oocytes were incubated with oviduct fluid or sperm but never both simultaneously as "co-incubation" implies.

      Done

      (4) Synonymous terms "OVGP1" and "oviductin" are used interchangeably. Consider using one or the other for consistency.

      We believe that by using both terms, reading is more fluid.

      (5) Delete "around" on line 256 and "approximately" on line 263 and provide actual percentages.

      Done

      (6) The point of the sentence on lines 311-313 is unclear to me.

      Rewritten

      (7) Suggest specifying "wildtype" on line 419.

      All the mice used in this work are wildtype

      (8) Do the authors have details regarding cattle oocyte donor breeds?

      Done

      (9) What do the authors mean by "strengthen" on line 500?

      The word strengthen has been changed to carefully isolated

      (10) Ponceau and vinculin (Figure 3) details are not provided in the manuscript.

      Ponceau and vinculin details are now included in the manuscript

      (11) Address formatting issues (e.g. citation 26 among others).

      Done

      (12) Primary and secondary antibody controls for immunofluorescent imaging (to fully exclude autofluorescence) are lacking.

      Controls for immunofluorescent imaging are indicated in Supplementary Figure S7.

      (13) The corresponding author on the manuscript and in the eLife submission system are different

      It was a problem during submission, now it is corrected.

      Reviewer #2 (Recommendations for the authors):

      (1) For the experiment depicted in Figures 3C and D, the authors need to perform a negative control to demonstrate that this fluorescent signal is specific. What happens if they express a different FLAG-tagged protein instead of bOVGP1 and mOVGP1? FLAG antibodies give quite strong non-specific binding. Or if they expressed untagged bovine and mouse OVGP1?

      The negative controls are in the supplementary Figure S7. A rabbit polyclonal antibody to the human OVGP1 was used for murine and bovine IVM ZPs from ovaries and murine superovulated ZPs recovered from mouse oviducts. There is a remarkable difference in the ones that are not incubated with any OVGP1 and the endogenous one, given the specificity of the antibody.

      Also, IVM mouse and bovine oocytes incubated or not with OF were immunoblotted with anti-Flag-tag antibody. Since any of them present OVGP1 tagged to Flag, there is not signal in the immunofluorescence.

      (2) For the Western blots of recombinant proteins, why are the authors not showing the blots using His and FLAG tag antibodies? Is the 50-kDa band observed for the mouse OVGP1 detected with His-Tag antibody?

      We have included a supplementary figure S6 with the western blot with anti-His and anti-Flag. The protein around 50 kDa is not a specific band (there is not signal with anti-Flag). This new figure modifies the number assigned to the rest of supplementary figures (S6-S8).

      (3) How was the estrous cycle stage determined in mice? It is not described in the Methods.

      Estrous cycle stage was determined in mice by visual examination of the vaginal opening and cytological examination of the vagina smear. This is now included in the M&M

      (4) For sperm binding, what does the percentage mean?

      It was a mistake, percentages were related to pronuclear formation and cleavage not to sperm binding, this is now corrected.

      (5) In Figure 3A, the labels for regions C, D, and E are mixed up. It is regions A and C that are conserved (or orange and blue, if the letters are incorrect). The purple region is only present in the mouse (E?), and the red region (D?) is only in the human form. Also, the legend for this panel is repeated verbatim in the Results section. Please remove one of them.

      Errors in Figure 3a have been corrected. Legend repetition is removed.

      (6) In the title of Figure 1B and in different places in the text, it should be mouse (not mice) oocytes.

      Done

      (7) In line 140, I would change the part indicating "We extracted the cytoplasmic contents from the oocytes". It is not only the cytoplasm, but all the oocyte, including the nucleus and membranes, that are being removed.

      Done

      (8) Please rephrase the sentence in lines 245-247, as it is quite confusing.

      Done

      (9) In line 236, the authors indicate that "During in vitro maturation (IVM), oocytes displayed a porous ZP structure...". Do they mean after IVM? When were those oocytes collected for SEM?

      The sentence has been modified by “after IVF”. Bovine oocytes were collected from slaughterhouse ovaries and were similar to those used in the rest of the experiments in the manuscript.

      (10) In the legend of Figure 1, please indicate what the parthenogenic group is.

      Done

      (11) In the legend to Figure 1G, the text indicates "Note sperm only appear outside the zona". However, I cannot see any sperm in that image.

      The phrase has been removed, as when enlarging the image to better see the sperm that are inside the area, the vision of those that are outside has been lost.

      (12) In the legend to Figure 2 describing the different zona pictures, the letters of the panels are not correct.

      Done

      (13) In line 999, please provide the right concentration for NMase (it indicates 10 μ/mL).

      Done

      (14) Where does the model depicted at the end of the manuscript go? Is it a Figure? A graphical abstract? In that model, please correct some typos: it should be "ZP obtained from ovarian oocytes"; and change specie for species in all three panels.

      Done. It is a model (Fig. 10)

      (15) The FITC-PNA staining to visualize acrosomes is not described in the Methods section.

      Done

      Reviewer #3 (Recommendations for the authors):

      The present study reports findings from a series of experiments suggesting that bovine oviductal fluid and species-specific oviductal glycoprotein (OVGP1 or oviductin) from bovine, murine, or human sources modulate the species specificity of bovine and murine oocytes. The manuscript began with a well-written introduction, but problems started to surface in the Results section, Discussion as well as in the Materials and Methods. Major concerns include inconsistencies, misinterpretation of results, lacking up-to-date literature search, numerous errors found in the figure legends, misleading and incorrect information given in the Materials and Methods, missing information regarding statistical analysis, and inadequate discussion.

      We have modified and clarified all the issues, some of which are misunderstandings, we have also performed the suggested experiment of putting sperm in contact with OVGP1.

      Specific comments:

      (1) Lines 142 to 143 on page 5: It is stated that "Because this experiment was done on empty ZPs, we called this test "empty zona penetration test" (EZPT)". In fact, the experiment was not actually done on empty ZPs, but on oocytes with the ooplasm extracted. Therefore, the zona pellucidae used in the experiment were not empty but contained an intact zona matrix of glycoproteins. The term "EZPT" used by the authors in the manuscript is a misnomer. A better term should be used to reflect the ZPs which were intact and not empty.

      We extracted the cytoplasmic containing all the organelles, nucleus and membranes, and the polar body. This has been clarified in the text.

      (2) The authors need to distinguish between sperm penetration and sperm binding in the manuscript. In lines 169 to 177 on page 6, the authors mixed up the terms "penetration" and "binding" in the text. In writing about events leading to fertilization in reproductive biology, the term "sperm binding" refers to the interaction between the sperm plasma membrane and the oocyte zona pellucida (ZP), whereas the term "sperm penetration" refers to the passage of the sperm through the ZP. Therefore, the statements in lines 169 to 177 describing the binding of bovine, murine, and human sperm to bovine oocytes with and without prior treatment with oviductal fluid are misleading and not correct. In fact, Figure 2 and Table 6 show sperm penetration and not sperm binding.

      Figure 2A and B (now 3A and 3B), and Tables S6 show both sperm penetration (% penetration rate and average sperm in penetrated ZPs) and sperm binding (average sperm bound to ZPs). Throughout the manuscript, a clear distinction is made between sperm attached to the ZP and sperm that have penetrated it.

      (3) Lines 182 to 187 on page 6: What is being described in the text here does not match what is being shown in Figure 3A. As a result, the information provided in lines 182 to 187 is not correct and misleading. For example, it is stated in lines 182 to 183 that "As depicted in Fig. 3A, the sequences of these three OVGP1 have five distinct regions (A, B, C, D and E)." However, Figure 3A shows that hOVGP1 and mOVGP1 both have only 4 regions and bOVGP1 has only 3 regions. None of the three has 5 regions. In lines 183 to 184, the authors continued to state that "Regions A and D are conserved in the different mammals." This statement is also not true because Figure 3A shows that only region A is conserved in all three species but not region D which is found only in the human. What is stated in lines 186 to 187 is also not correct based on the information provided in Figure 3A. It is stated here that "Region C is an insertion present only in the mouse (Mus) and region E is typical of human oviductin." However, based on the color codes provided in Figure 3A, region C is present in all three species while region E is present only in the mouse.

      Errors with naming regions in Figure 3A (now 4A) have been corrected.

      (4) In lines 195 to 197 on page 6, the authors stated that "Western blots of the three OVGP1 recombinants indicated expected sizes based on those of the proteins: 75 kDa for human and murine OVGP1 and around 60 kDa for bovine OVGP1 (Fig. 3B)." However, the expected size of the recombinant human OVGP1 is not in agreement with what has been published in literature regarding the molecular weight of recombinant human OVGP1. It has been previously reported that a single protein band of approximately 110-150 kDa was detected for recombinant human OVGP1 using an antibody against human OVGP1. The authors provided Western blots of murine oviductal fluid and bovine oviductal fluid in Figure 3B but not a Western blot of native human oviductal fluid. The latter should have been included for a comparison with the recombinant human OVGP1.

      We do not have human oviductal fluid, but we have included now a supplementary figure 6S of a western blot with antibody again His and Flag (present in the recombinant OVGP1) which shows that the size of the recombinant protein is as indicated in the Figure 3B (now 4B).

      (5) Lines 220 to 229 on page 7: In this experiment, the authors conducted the EZPT using ZPs from bovine oocytes that were either treated with or without bOVGP1 followed by incubation, respectively, with homologous sperm (bovine) and heterologous sperm (human and murine). This is a logical experiment to determine if OVGP1 plays a species-specific role in setting the specificity of the zona pellucida. However, in the in vivo situation, sperm that reach the lumen of the ampulla region of the oviduct where fertilization takes place are also exposed to oviductal fluid of which OVGP1 is a major constituent. Therefore, an additional experiment in which sperm are treated with OVGP1 prior to incubation with ZP should be carried out for a comparison.

      The additional experiment in which sperm are treated with OVGP1 prior to incubation with ZP has been done (Table S9). No effects were observed. This is now included in the manuscript.

      (6) Regarding the results obtained with the use of neuraminidase (lines 278 to 293 on pages 8 to 9), if neuraminidase treatment of bovine ZP prevented bovine sperm penetration regardless of whether ZPs had been or had not been in contact with OVGP1, that means OVGP1 is not responsible for penetration despite the description of earlier findings in the manuscript. Sialic acid is likely associated with the sugar side chains of ZP glycoproteins and not sugar side chains of OVGP1. To attribute the species-specific property of sialic acid to OVGP1 for sperm binding, an experiment in which OVGP1 will be treated with neuraminidase prior to performing the EZPT is needed.

      We conducted the experiment by treating only OVGP1 with neuraminidase and then isolating OVGP1 from the enzyme previously to incubate treated OVGP1 with ZPs. The results agree with our previous findings, indicating the importance of sialic acid on OVGP1 for sperm binding and penetration, and confirming that OVGP1 is responsible for species-specific penetration. Results are shown in Fig. 9 and Table S14.

      (7) The Discussion appears superficial and a more in-depth discussion regarding the results obtained in the present study in relation to other reports about OVGP1 published in literature is needed (e.g. a recent paper published by Kenji Yamatoya et al. (2023) Biology of Reproduction https://doi.org/10.1093/biolre/ioad159). Lines 317 to 342 of the Discussion on pages 10 to 11 should belong to the Introduction.

      Results of Yamatoya are now included in discussion. Part of the discussion from 317 to 342 are now in the introduction

      (8) In is not clear what the authors exactly want to say in lines 343 to 344 of the Discussion on page 11. It is stated here that "The empty zona penetration test (EZPT) enables heterologous sperm to overcome the oocyte's second barrier, the plasma membrane or oolemma." Do the authors mean that the sperm can now enter the empty space encircled by the ZP without having to go through the plasma membrane or oolemma? In Figure S4 which depicts the method used to empty the ooplasm in the bovine oocyte, does the method extract only the ooplasm (or cytoplasmic contents) leaving behind the intact plasma membrane or oolemma? This needs to be clearly shown and clearly explained. High magnifications of the zona pellucida are also needed to show whether the plasma membrane (or oolemma) is still present and intact after extraction of the ooplasm.

      This is clearly explained in the text. To obtain empty ZP, everything except ZP (nucleus, organelles, membranes and cytoplasmic contents of the oocytes) was removed using a micromanipulator, following the procedure outlined in Figure S4.

      (9) The authors stated in the Discussion in lines 383 to 383 on page 12 that "After ovulation, the changes reported in the carbohydrate composition of the ZP (3, 25) are likely induced by the addition of glycoproteins of oviductal origin, as we have seen here with OVGP1." There is no evidence in the present study to suggest that OVGP1 or glycoproteins of oviductal origin have changed or can change the carbohydrate composition of the ZP. At present, it is not known if OVGP1 or glycoproteins of oviductal origin directly interact with ZP glycoproteins (including ZP1, ZP2, ZP3 and/or ZP4) that make up the zona matrix.

      There is scientific evidence suggesting that oviductal glycoproteins, including OVGP1, interact with the zona pellucida (ZP) glycoproteins of the oocyte. Studies have shown that OVGP1 binds to the ZP of the oocyte. Specifically, OVGP1 is thought to interact with ZP glycoproteins, such as ZP2 and ZP3, in a way that may help stabilize the oocyte or modify the ZP structure during its passage through the oviduct. This interaction is believed to influence processes like sperm binding, oocyte maturation, and potentially the prevention of polyspermy during fertilization. For example, in several studies, the absence of OVGP1 in knockout animals (such as in Ovgp1-KO hamsters) has been associated with impaired fertilization and embryonic development, which indicates the importance of this interaction. However, the detailed molecular mechanisms and functional significance of these interactions require further exploration. We have use the work “likely” to soften this statement.

      Velásquez, J. G., Canovas, S., Barajas, P., Marcos, J., Jiménez‐Movilla, M., Gallego, R. G., ... & Coy, P. (2007). Role of sialic acid in bovine sperm–zona pellucida binding. Molecular reproduction and development, 74(5), 617-628.

      Kunz, P., et al. (2013). "The role of oviductal glycoprotein 1 in sperm–egg interaction and early embryonic development." Reproduction, 145(3), 225-233. DOI: 10.1530/REP-12-0300

      Yamatoya, K., Kurosawa, M., Hirose, M., Miura, Y., Taka, H., Nakano, T., ... & Araki, Y. (2024). The fluid factor OVGP1 provides a significant oviductal microenvironment for the reproductive process in golden hamster. Biology of reproduction, 110(3), 465-475.

      (10) Lines 390 to 391 page 12: The statement "This determines that OVGP1 modifications are critical to define the barrier among the different species of mammals." needs to be rephrased because there is no evidence in the present study showing that OVGP1 has been modified. There are many concerns with errors, important information that is missing, and inconsistencies as well as wrong and misleading information in the Materials and Methods which are troublesome. These concerns raise questions regarding the authenticity and reliability of the study. Some of the major concerns are listed below:

      All concerns have been fixed

      (11) It says in line 399 on page 13 that "Human semen samples were obtained from a normozoospermic donor...". Do the authors really mean that the semen samples were obtained from only one donor?

      Samples were obtained from 3 normozoospermic donor, this is now indicated in M&M

      (12) In lines 409 to 411 on page 13, what do the authors mean by "...the samples were frozen into pellets..."? Was centrifugation of the samples carried out prior to freezing the samples? Secondly, what do the authors mean by "....and stored in liquid nitrogen at -196{degree sign}C or lower.", particularly what do the authors mean by "or lower"? The temperature of liquid nitrogen is -196{degree sign}C. What is the "lower" temperature?

      Centrifugation of the samples were no carried out at this time. A more detailed protocol is now included The word lower has been removed.

      (13) Line 424 on page 13: Provide the full name of "M2" when it is first used in the text then followed by the abbreviation.

      Done

      (14) Is there a reason why different counting chambers were used to determine sperm concentrations? In line 432 on page 13, a Thomas cell counting chamber was used to determine the sperm count of epididymal mouse sperm whereas it is mentioned in line 441 on page 14 that a Neubauer cell counting chamber was used to determine epididymal cat sperm. Furthermore, where did the cat's sperm come from?

      The cat sperm was obtained and processed at the Faculty of Veterinary Medicine and the rest of the samples were processed in the INIA-CSIC lab, and different chambers were used in both places.

      (15) The mention of the use of cat spermatozoa in line 439 on page 14 is a worrisome problem of the manuscript. The present study used bovine, mouse, and human sperm and not cat. Therefore, the sudden mentioning of the use of cat spermatozoa in the Materials and Methods is troublesome and worrisome. It appears that the paragraph from lines 439 to 450 was directly copied and pasted from previously published work. Furthermore, lines 441 to 445 do not flow and do not make sense. In fact, what is described in this paragraph (lines 439 to 450) does not appear to correspond to the method(s) used to obtain the results presented in the Results section of the manuscript.

      I don't understand why the reviewer says we don't use cat sperm. This study uses cat sperm. Results of cat sperm are indicated in the Figure 1A (now 2A). We have modified the M&M to clarify frozen description.

      (16) Similarly, several problems are also found in the paragraphs (lines 453-478 on page 14) describing the methods and procedures to obtain homologous and heterologous IVF of bovine oocytes. Firstly, it is mentioned here (in line 460) that COCs were co-incubated with selected sperm without removing the cumulus cells. However, the results of the sperm penetration experiment indicated otherwise. Figures 2 and 3 show that the oocytes were denuded of cumulus cells. Secondly, it is very worrisome and troublesome to read what is written in line 468 on page 14 that "...from other species (cat, human, mouse, and rabbit)." One wonders where the cat and rabbit came from. Again, it appears that this paragraph was directly copied and pasted from previously published work.

      Cat sperm was used in this manuscript and it is correctly indicated in every section and figures. About IVF and EZPT protocols, in the protocol of IVF for bovine oocytes, COCs were used without removing the cumulus cells. For the EZPT cumulus cells were removed, this is described in the following sections of the material and methods. The word rabbit was a mistake and it has been removed.

      (17) In lines 468 to 469 on page 14, it is mentioned that "Sperm-egg interactions were assessed through a sperm-ZP binding assay...". The authors only examined sperm penetration in their study. Therefore, this needs to be specified in the Materials and Methods. Secondly, the authors did not use the conventional sperm-ZP binding assay in their study. Instead, they used the EZPT in their study. There appear to be many inconsistencies throughout the manuscript.

      When the IVF experiments using bovine COCs were done (Fig 2A and C, Fig 1S to 3S, and Tables 1S to 4S) conventional sperm-egg interaction was assessed at 2.5 hours after IVF. EZPT was used in the rest of experiments. IVF with COCs and EZPT with ZPs are different experiments.

      (18) Lines 480 to 489 on page 15 under the sub-heading of "In vitro culture of presumptive zygotes to first cleavage embryos on Day 2" do not provide the correct methodology used for obtaining the results presented in the manuscript. In line 482, it is not clear where the "synthetic oviductal fluid" came from. In fact, in the Results section, none of the results came from the use of synthetic oviductal fluid. In line 487, humans and rabbits are mentioned here. However, human and rabbit oocytes were not used in the present study. It is very strange indeed to read human and rabbit in the sentence.

      SOF reference is now included. Human results are in Fig 1A; the sentence is referred about the cultures of bovine oocytes inseminated with sperm of bull, human, mouse or cat). Rabbit word is a mistake and is now eliminated of the manuscript.

      (19) In line 500 on page 15, what do the authors mean by "Each oviduct was strengthen by removing the adjacent tissue..."?

      The sentence has been modified.

      (20) On page 15 in the Materials and Methods, the authors described the collection of bovine and mouse oviductal fluid. However, there is no mention of human oviductal fluid and how it was collected. This important information is missing.

      We have not use human oviductal fluid in this manuscript.

      (21) Line 510 on page 15: The sub-heading of "Preparation of empty zonae pellucidae from bovine ovarian oocytes" should be rephrased. As pointed out earlier in my review, the ZPs prepared by the authors were intact and not "empty". It was the oocyte which was empty after extraction of the ooplasm.

      Everything except the ZP were removed from the oocyte, this is now clarified in the manuscript.

      (22) Line 518 on page 16 and line 553 on page 17: "Figure S5" should be "Figure 4S".

      Done

      (23) Line 538 and line 547 on page 16: "mice oocytes" should be "mouse oocytes".

      Done

      (24) On page 17, the procedures for in vitro fertilization, sperm penetration, and binding assessment in mice were described here in lines 560 to 574. Several problems are noted in this paragraph as listed below:<br /> a. As mentioned earlier the authors in the present manuscript mixed up sperm penetration and sperm binding which are two separate events. Based on the results presented in the manuscript, they represent sperm penetration and not sperm binding. Therefore, the authors need to precisely explain in the manuscript whether the results presented refer to sperm penetration or sperm binding.

      Both sperm penetration and binding have been analyzed in this work.

      b. In line 570 on page 17, the term "insemination" is wrongly used here. Insemination is the introduction of semen into the female reproductive tract either through sexual intercourse or through an instrument. The procedure used in the present study was carried out in vitro in a co-incubation manner and not by transferring sperm into the female reproductive tract.

      The word insemination has been changed to incubation

      c. Information regarding procedures for treatment with various oviductal fluid and OVGP1s are all missing in the Materials and Methods.

      This information is now in M&M

      d. The concentrations of various oviductal fluids and OVGP1s used and the number of ZPs used in each incubation are also missing.

      Concentrations are now indicated in the manuscript. All the numbers and ZPs used are indicated in supplementary figures.

      (25) Lines 577 to 603 on pages 17 to 18: Were recombinant bovine and murine glycoproteins prepared using the same methodology? In line 595 on page 18, it is stated that "Supernatant was saved in subsequent experiments." It is not clear exactly what experiments the supernatant was subsequently used in.

      Details about how the bovine and murine glycoproteins were prepared are now included. Sentence about subsequent experiment is delete; supernatant was used for the next steps of protein purification.

      (26) What is being described in lines 604 to 609 on page 18 is problematic. The paragraph starts by saying that "Human recombinant oviductin was obtained from Origene Technologies....". Strangely, the paragraph continues by saying that the recombinant proteins were produced by transfection in HEK293T...". If recombinant human OVGP1 had already been obtained from Origene Technologies, why did the authors want to produce it again? It does not make sense.

      We briefly described the method that Origene used for the production of the human recombinant OVGP1

      (27) In lines 626 to 627 on page 18, it is stated that "Zonae pellucidae previously incubated with OVGP1 proteins from several species and murine oviductal fluid...". Were the zonae pellucidae previously incubated with only murine oviductal fluid or also with others?

      It was only incubated with OVGP1 or with oviductal fluid, this is now clarified in the text.

      (28) In lines 638 and 639 on page 19, can the authors please explain the difference between "endogenous OVGP1 and bOVGP1" and "exogenous recombinant hOVGP1 and mOVGP1"?

      This is now clarified

      (29) As stated in lines 676 to 679 on page 20, statistical analysis was performed in the study. Strangely, no "n" numbers and p values were provided in any of the figures that require statistical analysis. This is problematic.

      Statistical analysis and significant differences are now included in the figures, all the numbers used are included in the supplementary tables that are related with the figures.

      There are also many errors noted in the Figure Legends. These concerns raise questions regarding the reliability of the findings and interpretation of the results. Some major ones that require attention are listed below:

      (30) Figure legend 1 on page 27: In line 912, where did the "cat sperm" come from? In line 913, where did the "feline sperm" come from? In line 918, as pointed out earlier, the term "empty zona penetration test (EZPT)" is a misnomer and should be replaced with a better term. In line 924, it is stated that "Note sperm only appear outside the zona." However, no sperm can be seen outside the zona pellucida shown in Figure 1.

      Cat sperm is used in this manuscript. Term EZPT is now clarified The sentence about sperm outside of ZP is removed

      (31) Figure legend 2 on page 27 (lines 928 to 940) needs to be rewritten. Some of the sentences are not clearly written. Authors, please check all the capital labeling letters some of which appear to be wrong.

      Done

      (32) As is written, Figure legend 3 on pages 28 and 29 (lines 943 to 959) presents many problems:

      a. Contrary to what is stated in the figure legend, not all five regions are present in the hOVGP1, mOVGP1, and bOVGP1.

      Done

      b. Contrary to what is stated in line 946, region D is not conserved in the mouse and bull as shown in Figure 3A, and region C is not present only in the mouse.

      Done

      c. Based on what is shown in Figure 3A, region E is present only in the mouse and not in the human.

      Done

      d. What is stated in line 951 that "Proteins were expressed in mammalian cells..." is not correct. Based on the information provided in the manuscript, recombinant human OVGP1 was obtained from Origene Technologies and was not expressed in mammalian cells as claimed.

      All the recombinant proteins were produced in mammalian cells.

      (33) Figure legend 6 on page 28: In lines 985 to 986, what do the authors mean by "...and combinations of the three oviductins with sperm of the three species."? As is written, it appears that the bovine ZPs were pretreated with a combination of all three oviductins and then co-incubated with sperm from the bull, mouse and human together.

      We have clarified this sentence

      (34) What is described in the figure legend for the supplemental figure (Figure S7) does not make sense.

      Legend of Fig S7 (now S8) is related to pictures A to E, the legend is now clarified.

      (35) In addition to the figures and supplemental figures provided in the manuscript, there is also an additional figure labeled with "Model" showing three diagrams. Strangely, there is no mention of this additional figure in the manuscript. There is no figure legend for or description of this figure. It is not clear what is being shown in this figure, and it is not clear about the purpose of the use of this figure.

      We have included a legend to the model that is now Figure 10.

    1. A dialogue tag tells who is speaking.

      Sometimes a dialogue tag is unneeded because of clarity through context, meaning that the context of the conversation makes it clear who is speaking. This can appear in back-and-forth conversation between characters.

    1. Author response:

      The following is the authors’ response to the original reviews.

      eLife Assessment

      This manuscript describes the impact of modulating signaling by a key regulatory enzyme, Dual Leucine Zipper Kinase (DLK), on hippocampal neurons. The results are interesting and will be important for scientists interested in synapse formation, axon specification, and cell death. The methods and interpretation of the data are solid, but the study can be further strengthened with some additional studies and controls.

      We greatly appreciate the thorough review and thoughtful suggestions from the reviewers and editors on our original manuscript. We provide point-to-point response below.  We added new studies on P10 mice and controls as suggested, and made revision of figures and texts for clarification. The revised manuscript includes three new supplemental figures; major text revision is copied under response.

      Reviewer #1 (Public Review):

      Summary:

      In this work, Ritchie and colleagues explore functional consequences of neuronal over-expression or deletion of the MAP3K DLK that their labs and others have strongly implicated in both axon degeneration, neuronal cell death, and axon regeneration. Their recent work in eLife (Li, 2021) showed that inducible over-expression of DLK (or the related LZK) induces neuronal death in the cerebellum. Here, they extend this work to show that inducible over-expression in Vglut1+ neurons also kills excitatory neurons in hippocampal CA1, but not CA3. They complement this very interesting finding with translatomics to quantify genes whose mRNAs are differentially translated in the context of DLK over-expression or knockout, the latter manipulation having little to no effect on the phenotypes measured. The authors note that several genes and pathways are differentially regulated according to whether DLK is over-expressed or knocked out. They note DLK-dependent changes in genes related to synaptic function and the cytoskeleton and ultimately relate this in cultured neurons to findings that DLK over-expression negatively impacts synapse number and changes microtubules and neurites, though with a less obvious correlation.

      Strengths:

      This work represents a conceptual advance in defining DLK-dependent changes in translation. Moreover, the finding that DLK may differentially impact neuronal death will become the basis for future studies exploring whether DLK contributes to differential neuronal susceptibility to death, which is a broadly important topic.

      We thank the reviewer for the comments on the value of our work.

      Weaknesses:

      This seems like two works in parallel that the authors have not yet connected. First is that DLK affects the translation of an interesting set of genes, and second, that DLK(OE) kills some neurons, disrupts their synapses, and affects neurite growth in culture.

      Specific questions:

      (1) Is DLK effectively knocked out? The authors reference the floxxed allele in their 2016 work (PMID: 27511108), however, the methods of this paper say that the mouse will be characterized in a future publication. Has this ever been published? The major concern is that here the authors show that Cre-mediated deletion results in a smaller molecular weight protein and the maintenance of mRNA levels.

      We apologize for out-of-date citation of the DLK(cKO)<sup>fl/fl</sup> mice.  The DLK(cKO)<sup>fl/fl</sup> mice have been published in (Li et al., 2021; Saikia et al., 2022); excision of the flox-ed exon was verified using several Cre drivers (Pv-Cre, AAV-Cre, and VGlut1-Cre in this study).  The flox-ed exon contains the initiation ATG and 148 amino acids.  By western blot analysis using antibodies against C-terminal peptides of DLK on cerebellar extracts (in Li et al., 2021) and hippocampal extracts (this study), the full-length DLK protein was significantly reduced (Fig 1A-B); DLK is expressed in other hippocampal cells, in addition to glutamatergic neurons, explaining remaining full-length DLK detected. 

      Our Ribo-seq of VGlut1-Cre; DLK(cKO)<sup>fl/fl</sup> detected remaining Dlk mRNAs lacking the floxed exon (Fig.S1C), which has several candidate ATG at amino acid 223 and after (Fig.S1C1). We detected a very faint band for smaller molecular weight proteins on western blots, only when the membrane was exposed under 5X longer exposure using Pico PLUS Chemiluminescent Substrate (Thermo Scientific, 34580) and a Licor Odyssey XF Imager (revised Fig. S1B). This smaller molecular weight protein might be produced using any candidate ATGs, but would represent an N-terminal truncated DLK protein lacking the ATP binding site and ~1/4 of the kinase domain, i.e. not a functional kinase. 

      The revised manuscript has updated citation for DLK(cKO)<sup>fl/fl</sup>. Revised Fig.S1B includes images of a western blot under normal exposure vs longer exposure of western blots using anti-DLK antibodies. New Fig.S1C1 shows effects of floxed exon on DLK.

      (2) Why does DLK(OE) not kill CA3 neurons? The phenomenon is clear but there is no link to gene expression changes. In fact, the highlighted transcript in this work, Stmn4, changes in a DLK-dependent manner in CA3.

      We agree that this is a very interesting question not answered by our gene expression analysis.  While we verified Stmn4 expression levels to correlate to the levels of DLK, we do not think that increased Stmn4 per se in DLK(iOE) is a major factor accounting for CA1 death vs CA3 survival. Several published studies have also reported regulation of Stmn4 mRNAs in other cell types, in the contexts of cell death (Watkins et al., 2013; Le Pichon et al., 2017) and axon regeneration and cytoskeleton disruption (Asghari Adib et al., 2024; DeVault et al., 2024; Hu et al., 2019;  Shin et al., 2019). As Stmns have significant expression and function redundancy, conventional knockdown or overexpression of individual Stmn generally does not lead to detectable effects on cellular function. As CA3 neurons are widely known for their dense connections and show resilience to NMDA-mediated neurotoxicity (Sammons et al., 2024; Vornov et al., 1991), we speculate that the differential vulnerability of CA1 and CA3 under DLK(iOE) is a reflection of both the intrinsic property, such as gene expression, and also their circuit connection. 

      In the revised manuscript, we have included following statement on pg 18:

      ‘While our data does not pinpoint the molecular changes explaining why CA3 would show less vulnerability to increased DLK, we may speculate that DLK(iOE) induced signal transduction amplification may differ in CA1 vs CA3. CA1 genes appear to be more strongly regulated than CA3 genes, consistent with our observation that increased c-Jun expression in CA1 is greater than that in CA3. Other parallel molecular factors may also contribute to resilience of CA3 neurons to DLK(iOE), such as HSP70 chaperones, different JNK isoforms, and phosphatases, some of which showed differential expression in our RiboTag analysis of DLK(iOE) vs WT (shown in File S2. WT vs DLK(iOE) DEGs). Together with other genes that show dependency on DLK, the DLK and Jun regulatory network contributes to the regional differences in hippocampal neuronal vulnerability under pathological conditions.’

      Further we state in ‘Limitation of our study’ on pg 20:

      ‘Our analysis also does not directly address why CA3 neurons are less vulnerable to increased DLK expression. Future studies using cell-type specific RiboTag profiling and other methods at a refined time window will be required to address how DLK dependent signaling interacts with other networks underlying hippocampal regional neuron vulnerability to pathological insults.’

      We hope our data will stimulate continued interests for testable hypothesis in future studies.

      (3) Why are whole hippocampi analyzed to IP ribosome-associated mRNAs? The authors nicely show a differential effect of DLK on CA1 vs CA3, but then - at least according to their methods ¬- lyse whole hippocampi to perform IP/sequencing. Their data are therefore a mix of cells where DLK does and does not change cell death. The key issue is whether DLK does/does not have an effect based on the expression changes it drives.

      At the time of planning the Ribo-Tag experiment several years ago, we focused on the hippocampal glutamatergic neurons. Due to technical difficulty in micro-dissecting individual hippocampal regions from this early timepoint, we opted to use whole hippocampi to isolate ribosome-associated mRNAs. We agree with the reviewer that it is important to sort out DLK-dependent general gene expression changes vs those specific to a particular cell type where DLK impacts its survival. With emerging CA1, CA3 and other cell-type specific Cre drivers and advanced RNAseq technology, we hope that our work will stimulate broad interest in these questions in future studies. 

      In the revised manuscript, we have included new analysis comparing our Vglut1-RiboTag profiling (P15) with CamK2-RiboTag (for CA1) and Grik4-RiboTag (for CA3) (P42) published in Traunmüller et al., 2023 (GSE209870). We find that >80% of the top ranked genes in their CamK2-RiboTag (for CA1) and Girk4-RiboTag (for CA3) were detected in our VGlut1-RiboTag (revised methods and Supplemental Excel File S3). CA1-enriched genes tended to be expressed higher in DLK(cKO), compared to control, whereas CA3-enriched genes showed less significant correlation to DLK expression levels. Additionally, many genes known to specify CA1 fate do not show significant downregulation in DLK(iOE). This analysis, along with other data in our manuscript, is consistent with an idea that DLK does not regulate neuronal fate.

      In the revised manuscript, we presented this additional analysis in Fig. S6K-L, and expanded text description on page 9:

      ‘Additionally, we compared our Vglut1-RiboTag datasets with CamK2-RiboTag and Grik4-RiboTag datasets from 6-week-old wild type mice reported by (Traunmüller et al., 2023; GSE209870). We defined a list of genes enriched in CamK2-expressing CA1 neurons relative to Grik4-expressing CA3 neurons (CA1 genes), and those enriched in Grik4-expressing CA3 neurons (CA3 genes) (File S3). When compared with the entire list of Vglut1-RiboTag profiling in our control and DLK(cKO), we found CA1 genes tended to be expressed more in DLK(cKO) mice, compared to control (Fig.S6K), while CA3 genes showed a slight enrichment in control though the trend was less significant, and were less clustered towards one genotype (Fig.S6L). Moreover, many CA1 genes related to cell-type specification, such as FoxP1, Satb2, Wfs1, Gpr161, Adcy8, Ndst3, Chrna5, Ldb2, Ptpru, and Ntm, did not show significant downregulation when DLK was overexpressed. These observations imply that DLK likely specifically down-regulates CA1 genes both under normal conditions and when overexpressed, with a stronger effect on CA1 genes, compared to CA3 genes. Overall, the informatic analysis suggests that decreased expression of CA1 enriched genes may contribute to CA1 neuron vulnerability to elevated DLK, although it is also possible that the observed down-regulation of these genes is a secondary effect associated with CA1 neuron degeneration’.

      (4) Is the subtle decrease in synapse number (Basson/Homer co-loc.) in the DLK (OE) simply a function of neurons (and their synapses, presumably) having died? At the P15 time point that the authors choose because cell death is minimal, there is still a ~25% reduction in CA1 thickness (Figure 2B), which is larger than the ~15% change in synapses (Figure 5H) they describe.

      We thank reviewer for the question. To address this, we have analyzed synapses in the CA1 region at P10 in DLK(iOE) mice when there was no detectable loss of neurons. At P10, we did not detect significant changes in Bassoon, Homer1, or colocalized puncta in CA1 (Fig.S11A-F). In P15 DLK(iOE) mice, Homer1 puncta were slightly smaller (Fig.5L) and showed a significant decrease in CA1 SR (Fig.5I).

      In the revised manuscript we have also redone our statistical analysis of synapses, using mice rather than ROIs (revised Fig. 5), as recommended by R3. We also analyzed synapses in CA3, and found no significant differences in P10 or P15 (Fig.S12).  We would interpret the data to mean that the effects of DLK(OE) on synapses in CA1 may represent an early step in neuronal death. We hope that future studies will shed clarity on this question.

      Reviewer #2 (Public Review):

      This manuscript describes the impact of deleting or enhancing the expression of the neuronal-specific kinase DLK in glutamatergic hippocampal neurons using clever genetic strategies, which demonstrates that DLK deletion had minimal effects while overexpression resulted in neurodegeneration in vivo. To determine the molecular mechanisms underlying this effect, ribotag mice were used to determine changes in active translation which identified Jun and STMN4 as DLK-dependent genes that may contribute to this effect. Finally, experiments in cultured neurons were conducted to better understand the in vivo effects. These experiments demonstrated that DLK overexpression resulted in morphological and synaptic abnormalities.

      Strengths:

      This study provides interesting new insights into the role of DLK in the normal function of hippocampal neurons. Specifically, the study identifies:

      (1) CA1 vs CA3 hippocampal neurons have differing sensitivity to increased DLK signaling.

      (2) DLK-dependent signaling in these neurons is similar to but distinct from the downstream factors identified in other cell types, highlighted by the identification of STMN4 as a downstream signal.

      (3) DLK overexpression in hippocampal neurons results in signaling that is similar to that induced by neuronal injury.

      The study also provides confirmatory evidence that supports previously published work through orthogonal methods, which adds additional confidence to our understanding of DLK signaling in neurons. Taken together, this is a useful addition to our understanding of DLK function.

      We thank the reviewer for careful reading and positive comments.

      Weaknesses:

      There are a few weaknesses that limit the impact of this manuscript, most of which are pointed out by the authors in the discussion. Namely:

      (1) It is difficult to distinguish whether the changes in the translatome identified by the authors are DLK-dependent transcriptional changes, DLK-dependent post-transcriptional changes or secondary gene expression changes that occur as a result of the neurodegeneration that occurs in vivo. Additional expression analysis at earlier time points could be one method to address this concern.

      We appreciate the reviewer’s comment, and have performed new analysis on c-Jun and p-c-Jun levels in CA1, CA3, and DG in P10 DLK(OE) mice. Our data suggest that in CA3 elevations in p-c-Jun and c-Jun occur separately from cell death in a DLK-dependent manner, though the high elevation of both p-c-Jun and c-Jun in CA1 correlates with cell death.

      The data is presented in revised Fig.S7A,B, and described in revised text on pg 9-10:

      ‘In control mice, glutamatergic neurons in CA1 had low but detectable c-Jun immunostaining at P10 and P15, but reduced intensity at P60; those in CA3 showed an overall low level of c-Jun immunostaining at P10, P15 and P60; and those in DG showed a low level of c-Jun immunostaining at P10 and P15, and an increased intensity at P60 (Fig.S7A,C,E). In Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice at P10 when no discernable neuron degeneration was seen in any regions of hippocampus, only CA3 neurons showed a significant increase of immunostaining intensity of c-Jun, compared to control (Fig.S7A). In P15 mice, we observed further increased immunostaining intensity of c-Jun in CA1, CA3, and DG, with the strongest increase (~4-fold) in CA1, compared to age-matched control mice (Fig.S7C). The overall increased c-Jun staining is consistent with RiboTag analysis.’

      Also, on pg.10:

      In Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice, we observed increased p-c-Jun positive nuclei in CA1 at P10, and strong increase in CA1 (~10-fold), CA3 (~6-fold), and DG (~8-fold) at P15 (Fig.S7B,D).

      (2) Related to the above, it is difficult to conclusively determine from the current data whether the changes in synaptic proteins observed in vivo are a secondary result of neuronal degeneration or a primary impact on synapse formation. The in vitro studies suggest this has the potential to be a primary effect, though the difference in experimental paradigm makes it impossible to determine whether the same mechanisms are present in vitro and in vivo.

      We appreciate the comment, which is related to R1 point 4. We have performed further analysis and revised the text on pg.12 with the following text:

      ‘To assess effects of DLK overexpression on synapses, we immunostained hippocampal sections from both P10 and P15, with age-matched littermate controls. Quantification of Bassoon and Homer1 immunostaining revealed no significant differences in CA1 SR and CA3 SR and SL in P10 mice of _<_i>Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> and control (Fig.S11A-F, S12A-J). In P15, Bassoon density and size in CA1 SR were comparable in both mice (Fig 5G, H, K), while Homer1 density and size were reduced in DLK(iOE) (Fig.5G,I, L). Overall synapse number in CA1 SR was similar in DLK(iOE) and control mice (Fig.5J). Similar analysis on CA3 SR and SL detected no significant difference from control (Fig.S12M-V).’

      We would interpret the data to mean that the effects of DLK(OE) on synapses in CA1 may represent an early step in neuronal death. We hope that future studies will shed clarity on this question.

      Additionally, to address whether the same mechanisms are present in vitro, we have performed further analysis on cultured hippocampal neurons. As described in the Methods, we made hippocampal neuron cultures from P1 pups of the following crosses:

      For control: Vglut1<sup>Cre/+</sup> X Rosa26<sup>tdT/+</sup> 

      For DLKcKO: Vglut1<sup>Cre/+</sup>;DLK(cKO)<sup>fl/fl</sup>  X Vglut1<sup>Cre/+</sup>;DLK(cKO)<sup>fl/fl</sup>;Rosa26<sup>tdT/+</sup> 

      For DLKiOE: H11-DLK<sup>iOE/iOE</sup> X Vglut1<sup>Cre/+</sup>;Rosa26<sup>tdT/+</sup> 

      Dissociated cells from a given litter were pooled into the same culture. Because there were different proportions of neurons with our genotype of interest in each culture, it is not simple to know whether DLK was causing significant cell death.

      On pg 13, we stated our observation:

      ‘We did not notice an obvious effect of DLK(iOE) or DLK(cKO) on neuron density in cultures at DIV2. To assess neuronal type distribution in our cultures, we immunostained DIV14 neurons with antibodies for Satb2, as a CA1 marker (Nielsen et al., 2010), and Prox1, as a marker of DG neurons (Iwano et al., 2012). We did not observe significant differences in the proportion of cells labeled with each marker in DLK(cKO) or DLK(iOE) cultures (Fig.S13E). These data are consistent with the idea that DLK signaling does not have a strong role in neuron-type specification both in vivo and in vitro’.

      (3) The phenotype of DLK cKO mice is very subtle (consistent with previous reports) and while the outcome of increased DLK levels is interesting, the relevance to physiological DLK signaling is less clear. What does seem possible is that increased DLK may phenocopy other neuronal injuries but there are no real comparisons to directly address this in the manuscript. It would be helpful for the authors to provide this analysis as well as a table with all of the translational changes along with fold changes.

      Thank you for the suggestion. The fold changes of genes showing significantly altered expression in DLK(cKO) and DLK(iOE) are provided in the excel files (Supplementary excel File S1 WT vs DLK(cKO) DEGs and File S2. WT vs DLK(iOE) DEGs, highlighted columns B and F).  

      On pg 6, we revised the text as following to include comparison of DLK levels in other physiological conditions and our mice:

      ‘Several studies have reported that DLK protein levels increase under a variety of conditions, including optic nerve crush (Watkins et al., 2013), NGF withdrawal (~2 fold) (Huntwork-Rodriguez et al., 2013; Larhammar et al., 2017), and sciatic nerve injury (Larhammar et al., 2017). Induced human neurons show increased DLK abundance about ~4 fold in response to ApoE4 treatment (Huang et al., 2019). Increased expression of DLK can lead to its activation through dimerization and autophosphorylation (Nihalani et al., 2000)’.

      And,

      ‘Additional analysis at the mRNA level (supplemental excel, File S2. WT vs DLK(iOE) DEGs) and at the protein level (Fig.S8E) suggest that the increase in DLK abundance was around 3 times the control level. The localization patterns of DLK protein appeared to vary depending on region of hippocampus and age of animals in both control and Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice (Fig.S3C).’

      In Discussion, we state (pg. 16): ‘The levels of DLK in our DLK(iOE) mice model appear comparable to those reported under traumatic injury and chronic stress.’

      (4) For the in vivo experiments, it is unclear whether multiple sections from each animal were quantified for each condition. More information here would be helpful and it is important that any quantification takes multiple sections from each animal into account to account for natural variability.

      We apologize this was unclear in the original manuscript.

      In the revised methods, under Confocal imaging and quantification (pg 33), we stated: “For brain tissue, three sections per mouse were imaged with a minimum of three mice per genotype for data analysis.”

      In revised figure legends, we made it clear that multiple sections from each animal have been used for quantification in all instances, i.e. “Each dot represents averaged thickness from 3 sections per mouse, N≥4 mice/genotype per timepoint.” 

      In Fig.1F-H: “Each dot represents averaged intensity from 3 sections per mouse”

      In Fig.S3B “Data points represent individual mice, averages taken across 3 sections per mouse”

      Reviewer #3 (Public Review):

      Dr Jin and colleagues revisit DLK and its established multifactorial roles in neuronal development, axonal injury, and neurodegeneration. The ambitious aim here is to understand the DLK-dependent gene network in the brain and, to pursue this, they explore the role of DLK in hippocampal glutamatergic neurons using conditional knockout and induced overexpression mice. They produce evidence that dorsal CA1 and dentate gyrus neurons are vulnerable to elevated expression of DLK, while CA3 neurons appear unaffected. Then they identify the DLK-dependent translatome featured by conserved molecular signatures and cell-type specificity. Their evidence suggests that increased DLK signaling is associated with possible STMN4 disruptions to microtubules, among else. They also produce evidence on cultured hippocampal neurons showing that expression levels of DLK are associated with changes in neurite outgrowth, axon specification, and synapse formation. They posit that downstream translational events related to DLK signaling in hippocampal glutamatergic neurons are a generalizable paradigm for understanding neurodegenerative diseases.

      Strengths

      This is an interesting paper based on a lot of work and a high number of diverse experiments that point to the pervasive roles of DLK in the development of select glutamatergic hippocampal neurons. One should applaud the authors for their work in constructing sophisticated molecular cre-lox tools and their expert Ribotag analysis, as well as technical skill and scholarly treatment of the literature. I am somewhat more skeptical of interpretations and conclusions on spatial anatomical selectivity without stereological approaches and also going directly from (extremely complex) Ribotag profiling patterns to relevance based on immunohistochemistry and no additional interventions to manipulate (e.g. by knocking down or blocking) their top Ribotag profile hits. Also, it seems to this reviewer that major developmental claims in the paper are based on gene translational profiling dependent on DLK expression, not DLK activation, despite some evidence in the paper that there is a correlation between the two. Therefore, observed patterns and correlations may or may not be physiologically or pathologically relevant. Generalizability to neurodegenerative diseases is an overreach not justified by the scope, approach, and findings of the paper.

      We thank the reviewer for the encouraging and constructive comments on the manuscript.

      Weaknesses and Suggestions:

      The authors state that the rationale for the translatomic studies is to "to gain molecular understanding of gene expression associated with DLK in glutamatergic neurons" and to characterize the "DLK-dependent molecular and cellular network", However, a problem with the experimental design is the selection of an anatomical region at a time point featured by active neurodegeneration. Therefore, it is not straightforward that the differentially expressed genes or pathways caused by DLK overexpression changes could be due to processes related to neurodegeneration. Indeed, the authors find enrichment of signals related to pathways involved in extracellular matrix organization, apoptosis, unfolded protein responses, the complement cascade, DNA damage responses, and depletion of signals related to mitochondrial electron transport, etc., all of which could be the consequence of neurodegeneration regardless of cause. A more appropriate design to discover DLK-dependent pathways might be to look at a region and/or a time point that is not confounded by neurodegeneration.

      We appreciate reviewer’s comment. We included our thoughts in ‘Limitation of the study’ (pg 20):

      ‘Future studies using cell-type specific RiboTag profiling and other methods at a refined time window will be required to address how DLK dependent signaling interacts with other networks underlying hippocampal regional neuron vulnerability to pathological insults.’

      In a related vein, the authors ask "if the differentially expressed genes associated with DLK(iOE) might show correlation to neuronal vulnerability" and, to answer this question, they select the set of differentially expressed genes after DLK overexpression and assess their expression patterns in various regions under normal conditions. It looks to me that this selection is already confounded by neurodegeneration which could be the cause for their downregulation. Therefore, such gene profiles may not be directly linked to neuronal vulnerability. A similar issue also relates to the conclusion that "...the enrichment of DLK-dependent translation of genes in CA1 suggests that the decreased expression of these genes may contribute to CA1 neuron vulnerability to elevated DLK".

      We agree with the reviewer’s concern that it is difficult to separate neurodegenerative consequences from changes caused by DLK solely based on our translatomics studies on P15 DLK(iOE) mice.  As responded to reviewer 1 (point 4) and reviewer 2 (point 1), we have included new analysis of P10 mice (Fig.S7A,B) when neurons did not show detectable sign of degeneration.

      We consider several lines of evidence supporting that some differentially expressed genes in DLK(iOE) vs control may likely be specific for increased DLK signaling.

      First, the genes identified in DLK(iOE) vs control represent a small set of genes (260), which is comparable to other DLK dependent datasets (Asghari Adib et al., 2024) but shows cell-type specificity.

      Second, our analysis using rank-rank hypergeometric overlap (RRHO) detects a significant correlation between upregulated genes from DLK(iOE) vs downregulated genes in DLK(cKO), and vice versa, suggesting that expression of a similar set of genes is depended on DLK (Fig.3C, S6C-E). Consistently, GO term analysis using the list of genes coordinately regulated by DLK, derived from our RRHO analysis, leads to identification of similar GO terms related to up- and downregulated genes as using DLK(iOE)-RiboTag data alone. SynGO analysis of DLK(iOE) regulated genes and DLK(cKO) regulated genes also identified similar synaptic processes regulated by significantly regulated genes (Fig.3F and S6J).  

      Third, we performed additional analysis comparing our Vglut1-RiboTag dataset with CamK2-RiboTag and Grik4-RiboTag datasets from 6-week-old wild type mice reported by (Traunmüller et al., 2023; GSE209870). We observed >80% overlap among the top ranked genes (revised Methods). We described this analysis on pg 9 and Fig. S6K-L (and Supplemental Excel File S3):

      ‘Additionally, we compared our Vglut1-RiboTag datasets with CamK2-RiboTag and Grik4-RiboTag datasets from 6-week-old wild type mice reported by (Traunmüller et al., 2023; GSE209870). We defined a list of genes enriched in CamK2-expressing CA1 neurons relative to Grik4-expressing CA3 neurons (CA1 genes), and those enriched in Grik4-expressing CA3 neurons (CA3 genes) (File S3). When compared with the entire list of Vglut1-RiboTag profiling in our control and DLK(cKO), we found CA1 genes tended to be expressed more in DLK(cKO) mice, compared to control (Fig.S6K), while CA3 genes showed a slight enrichment in control though the trend was less significant, and were less clustered towards one genotype (Fig.S6L). Moreover, many CA1 genes related to cell-type specification, such as FoxP1, Satb2, Wfs1, Gpr161, Adcy8, Ndst3, Chrna5, Ldb2, Ptpru, and Ntm, did not show significant downregulation when DLK was overexpressed. These observations imply that DLK likely specifically down-regulates CA1 genes both under normal conditions and when overexpressed, with a stronger effect on CA1 genes, compared to CA3 genes. Overall, the informatic analysis suggests that decreased expression of CA1 enriched genes may contribute to CA1 neuron vulnerability to elevated DLK, although it is also possible that the observed down-regulation of these genes is a secondary effect associated with CA1 neuron degeneration.’

      To understand the role and relevance of the DLK overexpression model, there should be a discussion of to what extent it corresponds to endogenous levels of DLK expression or DLK-MAPK pathway activation under baseline or pathological conditions.

      We appreciate the suggestion, which is similar to R2 point 3. We have revised the text and discussion to include how DLK levels may be altered in other physiological conditions vs our mice.

      Pg. 6: ‘Several studies have reported that DLK protein levels increase under a variety of conditions, including optic nerve crush (Watkins et al., 2013), NGF withdrawal (~2 fold) (Huntwork-Rodriguez et al., 2013; Larhammar et al., 2017), and sciatic nerve injury (Larhammar et al., 2017). Induced human neurons show increased DLK abundance about ~4 fold in response to ApoE4 treatment (Huang et al., 2019). Increased expression of DLK can lead to its activation through dimerization and autophosphorylation (Nihalani et al., 2000)’.

      And,

      ‘Additional analysis at the mRNA level (supplemental excel, File S2. WT vs DLK(iOE) DEGs) and at the protein level (Fig.S8E) suggest that the increase in DLK abundance was around 3 times the control level. The localization patterns of DLK protein appeared to vary depending on region of hippocampus and age of animals in both control and Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice (Fig.S3C).’

      In Discussion (pg. 16): ‘The levels of DLK in our DLK(iOE) mice model appear comparable to those reported under traumatic injury and chronic stress.’

      The authors posit that "dorsal CA1 neurons are vulnerable to elevated DLK expression, while neurons in CA3 appear largely resistant to DLK overexpression". This statement assumes that DLK expression levels start at a similar baseline among regions. Do the authors have any such data? Ideally, they should show whether DLK expression and p-c-Jun (as a marker of downstream DLK signaling) are the same or different across regions in both WT and overexpression mice. For example, what are the DLK/p-c-Jun expression levels in regions other than CA1 in Supplementary Figures 2-3 and how do they compare with each other? Normalization to baseline for each region does not allow such a comparison. Also, in Supplementary Figure 6, analyses and comparisons between regions are done at a time point when degeneration has already started. Ideally, these should be done at P10.

      We thank the reviewer for raising these points. In the revised manuscript we have included protein expression analysis of DLK (Fig S3), c-Jun, and p-c-Jun at P10 (Fig. S7).

      We provided a quantification of DLK immunostaining intensity in CA1 and CA3 in Fig.S3D,E and find roughly comparable levels between regions.

      Pg. 6: ‘Additional analysis at the mRNA level (supplemental excel, File S2. WT vs DLK(iOE) DEGs) and at the protein level (Fig.S8E) suggest that the increase in DLK abundance was around 3 times the control level. The localization patterns of DLK protein appeared to vary depending on region of hippocampus and age of animals in both control and Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice (Fig.S3C).’

      We provided our quantifications without normalization to baseline in each region for c-Jun and p-c-Jun, and revised the text accordingly:

      Pg. 9-10: ‘In control mice, glutamatergic neurons in CA1 had low but detectable c-Jun immunostaining at P10 and P15, but reduced intensity at P60; those in CA3 showed an overall low level of c-Jun immunostaining at P10, P15 and P60; and those in DG showed a low level of c-Jun immunostaining at P10 and P15, and an increased intensity at P60 (Fig.S7A,C,E). In Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice at P10 when no discernable neuron degeneration was seen in any regions of hippocampus, only CA3 neurons showed a significant increase of immunostaining intensity of c-Jun, compared to control (Fig.S7A). In P15 mice, we observed further increased immunostaining intensity of c-Jun in CA1, CA3, and DG, with the strongest increase (~4-fold) in CA1, compared to age-matched control mice (Fig.S7C). The overall increased c-Jun staining is consistent with RiboTag analysis’.

      Pg. 10: ‘In Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice, we observed increased p-c-Jun positive nuclei in CA1 at P10, and strong increase in CA1 (~10-fold), CA3 (~6-fold), and DG (~8-fold) at P15 (Fig.S7B,D).

      Illustration of proposed selective changes in hippocampal sector volume needs to be very carefully prepared in view of the substantial claims on selective vulnerability. In 2A under P15 and especially P60, it is difficult to see the difference - this needs lower magnification and a lot of care that anteroposterior levels are identical because hippocampal sector anatomy and volumes of sectors vary from level to level. One wonders if the cortex shrinks, too. This is important.

      Thank you for raising the point. We have provided images to view the anteroposterior level in Fig.S2A-C. We have noticed cortex in DLK(OE) mice to become thinner, along with expansion of ventricles in some animals at later timepoints (Fig.S2C).

      One cannot be sure that there is selective death of hippocampal sectors with DLK overexpression versus, say, rearrangement of hippocampal architecture. One may need stereological analysis, otherwise this substantial claim appears overinterpreted.

      We appreciate the comment.

      In the revised manuscript, we included a new supplemental figure (Fig. S2) showing lower magnification images of coronal sections, and used cautionary wording, such as ‘CA3 is less vulnerable, compared to CA1’, to minimize the impression of over-interpretation.  By NeuN staining, at P10, P15, P60, we did not observe detectable difference in overall hippocampus architecture, apart from noted cell death of CA1 and DG and associated thinning of each of the layers. At 46 weeks, some animals showed differences in the overall shape of dorsal hippocampus, though this appeared to reflect a disproportionately large CA3 region compared to other regions (Fig S2). Increased GFAP staining (Fig.S5A-C) was detected in CA1 but not in CA3, and microglia by IBA1 staining (Fig.S5E) also displayed less reactivity in CA3, compared to CA1. Thus, based on NeuN staining, GFAP staining, IBA1 staining and analysis of the differentially regulated genes, we infer that the effect of DLK(iOE) in CA1 is different than the effect on CA3.

      Is the GFAP excess reflective of neuroinflammation? What do microglial markers show? The presence of neuroinflammation does not bode well with apoptosis. Speaking of which, TUNEL in one cell in Supplementary Figure 4E is not strong evidence of a more widespread apoptotic event in CA1.

      We have included staining data for the microglia marker IBA1. Both GFAP and IBA1 showed evidence of reactivity particularly in the CA1 region (S5A-E), supporting the differential vulnerability in different regions, though whether cell death is primarily due to apoptosis is unclear.

      We agree that our data of sparse TUNEL staining at P15 (Fig S5F,G) do not rule out whether other mechanisms of cell death may also occur.  We have included this in our limitations (pg.20) “While we find evidence for apoptosis, other forms of cell death may also occur.”

      In several places in the paper (as illustrated in Figure 4B, Supplementary Figure 2B, etc.): the unit of biological observation in animal models is typically not a cell, but an organism, in which averaged measures are generated. This is a significant methodological problem because it is not easy to sample neurons without involving stereological methods. With the approach taken here, there is a risk that significance may be overblown.

      We appreciate the reviewer’s point. We used same region for quantification of RNAscope, genotype-blind when possible. We revised the graphs to show mean values for individual mice in Fig.4B, 4C, and Fig.S3B (previously Fig.S2B).

      Other Comments and Questions:

      Supplementary Figure 9: The authors state that data points are shown for individual ROIs - ideally, they should also show averages for biological replicates. Can the authors confirm that statistical analyses are based on biological replicates (mice) and not ROIs?

      We have revised the graphs to show averages from individual mice in Fig.5B-D, F5E-F (previously Fig.S9G-I), Fig.5H-J, and Fig.5K-L (previously Fig.S9J-L)  and Fig.S10B,C,E,F (previously Fig.S9B,C, E,F). The statistical analyses are based on biological replicates of mice.

      For in vitro experiments, what is the effect of DLK overexpression on neuronal viability and density? Could these variables confound effects on synaptogenesis/synapse maturation?

      As described in the Methods, we made hippocampal neuron cultures from P1 pups of the following crosses:

      For control: Vglut1<sup>Cre/+</sup> X Rosa26<sup>tdT/+</sup> 

      For DLKcKO: Vglut1<sup>Cre/+</sup>;DLK(cKO)<sup>fl/fl</sup>  X Vglut1<sup>Cre/+</sup>;DLK(cKO)<sup>fl/fl</sup>;Rosa26<sup>tdT/+</sup> 

      For DLKiOE: H11-DLK<sup>iOE/iOE</sup> X Vglut1<sup>Cre/+</sup>;Rosa26<sup>tdT/+</sup> 

      Dissociated cells from a given litter were pooled into the same culture. Because there were different proportions of neurons with our genotype of interest in each culture, it is not simple to know whether DLK was causing significant cell death.

      On pg 13, we stated our observation:

      ‘We did not notice an obvious effect of DLK(iOE) or DLK(cKO) on neuron density in cultures at DIV2. To assess neuronal type distribution in our cultures, we immunostained DIV14 neurons with antibodies for Satb2, as a CA1 marker (Nielsen et al., 2010), and Prox1, as a marker of DG neurons (Iwano et al., 2012). We did not observe significant differences in the proportion of cells labeled with each marker in DLK(cKO) or DLK(iOE) cultures (Fig.S13E). These data are consistent with the idea that DLK signaling does not have a strong role in neuron-type specification both in vivo and in vitro’.

      We cannot rule out whether variable factors in our cultures may confound effects on synaptogenesis/synapse maturation, and would hope future studies will shed clarity.

      Correlations between c-jun expression and phosphorylation are extremely important and need to be carefully and convincingly documented. I am a bit concerned about Supplementary Figure 6 images, especially 6B-CA1 (no difference between control and KO, too small images) and 6D (no p-c-Jun expression at all anywhere in the hippocampus at P15?).

      At P10, P15, and P60 we stained for p-c-Jun using the Rabbit monoclonal p-c-Jun (Ser73) (D47G9) antibody from Cell Signaling (cat# 3270) at a 1:200 dilution and imaged using an LSM800 confocal microscope with a 20x objective. We observed p-c-Jun to be quite low generally in control animals. We have replaced the images in Fig.S7F (previously S6D), and adjusted the brightness/contrast to enable better visualization of the low signal in Fig.S7B,D,F (previously Fig.S6B,D).

      We revised our text to present the data carefully as stated above:

      Pg. 9-10: ‘In control mice, glutamatergic neurons in CA1 had low but detectable c-Jun immunostaining at P10 and P15, but reduced intensity at P60; those in CA3 showed an overall low level of c-Jun immunostaining at P10, P15 and P60; and those in DG showed a low level of c-Jun immunostaining at P10 and P15, and an increased intensity at P60 (Fig.S7A,C,E). In Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice at P10 when no discernable neuron degeneration was seen in any regions of hippocampus, only CA3 neurons showed a significant increase of immunostaining intensity of c-Jun, compared to control (Fig.S7A). In P15 mice, we observed further increased immunostaining intensity of c-Jun in CA1, CA3, and DG, with the strongest increase (~4-fold) in CA1, compared to age-matched control mice (Fig.S7C). The overall increased c-Jun staining is consistent with RiboTag analysis’.

      Pg. 10: ‘In Vglut1<sup>Cre/+</sup>;H11-DLK<sup>iOE/+</sup> mice, we observed increased p-c-Jun positive nuclei in CA1 at P10, and strong increase in CA1 (~10-fold), CA3 (~6-fold), and DG (~8-fold) at P15 (Fig.S7B,D).

      Recommendations for the authors:

      Several major and minor reservations were raised. The major issues are the need for more information about the over-expression of DLK and a need to extrapolate to an in vivo condition with DLK. A considerable amount of useful information is presented with some very nicely done experiments but it is not yet a coherent or integrated story. The lack of impact of DLK overexpression in some neurons is perhaps the most impactful observation of the study and would be great to have more information around the differential transcriptional/signaling response in these cell types. There is also a need for more experimental details and to address several questions about the mouse genetic and translatome analysis. They are valid concerns that require attention by the authors.

      We thank the editors and reviewers for their thoughtful evaluation and suggestions.  We hope that the editors and reviewers find that the new data and text changes in our revised manuscript, along with above point-to-point response, have addressed the concerns and strengthened our findings.

      Minor points:

      (1)The authors state that deletion of DLK has no effect on CA1 at 1yr, however, the image of CA1 in Figure S1D shows substantially fewer NeuN+ neurons. Is this a representative field of view?

      We have re-examined images, and observed no effect on hippocampal morphology at 1 yr. We now included representative images in the revised Fig S1D.

      (2) Is the DLK protein section staining in Figure 2C a real signal? The staining looks like speckles and is purely somatic. Axonal staining is widely expected based on the literature and the authors' own work. There should be a specificity control.

      To our knowledge, axonal staining of DLK reported in the literature is mostly based on cultured DRG neurons. In addition to the reported axonal localization, DLK is present in the cell soma, near the golgi (Hirai et al., 2002), and in the post-synaptic density (Pozniak et al., 2013).

      In the revised manuscript, we addressed this point by including controls with no primary antibody, and using an antibody against the closely related kinase, LZK. These additional data are shown in (Fig.S3C,D) (previously Fig.S2C), supporting that DLK protein staining represents real signal.  At P10 and P15, DLK immunostaining around CA3 showed axonal staining of the mossy fibers, as well as in the soma and dendritic layers (Fig.S3C,D). A similar pattern was also seen in primary cultured neurons (Fig 6A).

      (3) The protein expression of DLK in the transgenic overexpressor (Figure S7C) looks, to the resolution of this blot, to be at least 50kD heavier than 'WT' DLK. Can the authors explain this discrepancy?

      The Cre-induced DLK(iOE) transgene has T2A and tdTomato in-frame to C-terminus of DLK. It is known that T2A ‘self-cleavage’ is often incomplete. DLK-T2A-tdTomato would be about 50 kD bigger than WT DLK. We now include the transgene design in revised Fig S1D, and also stated in figure legend of Fig.S8C (previously S7C) that ‘Larger molecular weight band of DLK in Vglut1<sup>Cre/+</sup>;H11-DLKiOE/+ would match the predicted molecular weight of DLK-T2A-tdTomato if T2A-peptide induced ‘self-cleavage’ due to ribosomal skipping is ineffective (Fig.S1D).’

      (4) Expression changes in DLK affect various aspects of neurites in CA1 cultures (Figure 6), and changes in DLK also modestly affect STMN4 (and 2, perhaps indirectly) levels (Figure S7C), but there is no indication that DLK acts via STMN4 to cause these changes. It is not clear what to make of these data. Of note, Stmn4 levels change in response to DLK in CA3, without DLK affecting cell death in this region.

      We appreciate and agree with the comment. Other studies (Asghari Adib et al., 2024; DeVault et al., 2024; Hu et al., 2019; Larhammar et al., 2017; Le Pichon et al., 2017; Shin et al., 2019; Watkins et al., 2013) reported expression changes in Stmn4 mRNAs in other cell types and cellular contexts, which appeared to depend on DLK. Hippocampal neurons express multiple Stmns (Fig.S8A). While we present our analysis on the effects of DLK dosage on Stmn4, and also Stmn2, we do not think that DLK-induced changes of Stmn4 expression per se is a major factor underlying CA1 cell death vs CA3 survival.

      In the revised manuscript, we addressed this point in ‘Limitation of our study’ (pg 20):

      ‘Additional experiments will be needed to elucidate in vivo roles of STMN4 and its interaction with other STMNs’.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:  

      Reviewer #1 (Public Review):  

      Summary:  

      The study by Pudlowski et al. investigates how the intricate structure of centrioles is formed by studying the role of a complex formed by delta- and epsilon-tubulin and the TEDC1 and TEDC2 proteins. For this, they employ knockout cell lines, EM, and ultrastructure expansion microscopy as well as pull-downs. Previous work has indicated a role of delta- and epsilon-tubulin in triplet microtubule formation. Without triplet microtubules centriolar cylinders can still form, but are unstable, resulting in futile rounds of de novo centriole assembly during S phase and disassembly during mitosis. Here the authors show that all four proteins function as a complex and knockout of any of the four proteins results in the same phenotype. They further find that mutant centrioles lack inner scaffold proteins and contain an extended proximal end including markers such as SAS6 and CEP135, suggesting that triplet microtubule formation is linked to limiting proximal end extension and formation of the central region that contains the inner scaffold. Finally, they show that mutant centrioles seem to undergo elongation during early mitosis before disassembly, although it is not clear if this may also be due to prolonged mitotic duration in mutants.  

      Strengths:  

      Overall this is a well-performed study, well presented, with conclusions mostly supported by the data. The use of knockout cell lines and rescue experiments is convincing.  

      Weaknesses:  

      In some cases, additional controls and quantification would be needed, in particular regarding cell cycle and centriole elongation stages, to make the data and conclusions more robust. 

      We thank the reviewer for these comments and have improved our analyses of these as detailed below.

      Reviewer #2 (Public Review):  

      Summary:  

      In this article, the authors study the function of TEDC1 and TEDC2, two proteins previously reported to interact with TUBD1 and TUBE1. Previous work by the same group had shown that TUBD1 and TUBE1 are required for centriole assembly and that human cells lacking these proteins form abnormal centrioles that only have singlet microtubules that disintegrate in mitosis. In this new work, the authors demonstrate that TEDC1 and TEDC2 depletion results in the same phenotype with abnormal centrioles that also disintegrate into mitosis. In addition, they were able to localize these proteins to the proximal end of the centriole, a result not previously achieved with TUBD1 and TUBE1, providing a better understanding of where and when the complex is involved in centriole growth.  

      Strengths:  

      The results are very convincing, particularly the phenotype, which is the same as previously observed for TUBD1 and TUBE1. The U-ExM localization is also convincing:

      despite a signal that's not very homogeneous, it's clear that the complex is in the proximal region of the centriole and procentriole. The phenotype observed in U-ExM on the elongation of the cartwheel is also spectacular and opens the question of the regulation of the size of this structure. The authors also report convincing results on direct interactions between TUBD1, TUBE1, TEDC1, and TEDC2, and an intriguing structural prediction suggesting that TEDC1 and TEDC2 form a heterodimer that interacts with the TUBD1- TUBE1 heterodimer.  

      Weaknesses:  

      The phenotypes observed in U-ExM on cartwheel elongation merit further quantification, enabling the field to appreciate better what is happening at the level of this structure.  

      We thank the reviewer for these comments and have improved our analyses of cartwheel elongation as detailed below.

      Reviewer #3 (Public Review):  

      Summary:  

      Human cells deficient in delta-tubulin or epsilon-tubulin form unstable centrioles, which lack triplet microtubules and undergo a futile formation and disintegration cycle. In this study, the authors show that human cells lacking the associated proteins TEDC1 or TEDC2 have these identical phenotypes. They use genetics to knockout TEDC1 or TEDC2 in p53negative RPE-1 cells and expansion microscopy to structurally characterize mutant centrioles. Biochemical methods and AlphaFold-multimer prediction software are used to investigate interactions between tubulins and TEDC1 and TEDC2.  

      The study shows that mutant centrioles are built only of A tubules, which elongate and extend their proximal region, fail to incorporate structural components, and finally disintegrate in mitosis. In addition, they demonstrate that delta-tubulin or epsilon-tubulin and TEDC1 and TEDC2 form one complex and that TEDC1 TEDC2 can interact independently of tubulins. Finally, they show that the localization of four proteins is mutually dependent.  

      Strengths:  

      The results presented here are mostly convincing, the study is exciting and important, and the manuscript is well-written. The study shows that delta-tubulin, epsilon-tubulin, TEDC1, and TEDC2 function together to build a stable and functional centriole, significantly contributing to the field and our understanding of the centriole assembly process.  

      Weaknesses:  

      The ultrastructural characterization of TEDC1 and TEDC2 obtained by U-ExM is inconclusive. Improving the quality of the signals is paramount for this manuscript.  

      We thank the reviewer for these comments and have improved our imaging of TEDC1 and TEDC2 localization, as detailed below.

      Recommendations for the authors:

      Reviewing Editor (Recommendations For The Authors):  

      The reviewers agreed that the conclusions are largely supported by solid evidence, but felt that improving the following aspects would make some of the data more convincing:  

      (1) The UExM localizations of TEDC1/2 are not very convincing and the reviewers suggest to complement these with alternative super-resolution approaches (e.g. SIM) and/or different labeling techniques such as pre-expansion labeling using STAR red/orange secondaries (also robust for SIM and STED), use of the Halo tag, different tag antibodies, etc 

      We thank the reviewers for these recommendations and have adapted two of these strategies to improve our imaging of TEDC1 and TEDC2 localization. First, we used an alternative super-resolution approach, a Yokogawa CSU-W1 SoRA confocal scanner (resolution = 120 nm) and imaged cells grown on coverslips (not expanded). We found that TEDC1 and TEDC2 localize to procentrioles and the proximal end of parental centrioles (Fig 2 – Supplementary Figure 1a, b). Second, we used a recently described expansion gel chemistry (Kong et al., Methods Mol Biol 2024) combined with Abberior Star red and orange secondary antibodies. This technique resulted in robust signal at centrosomes and in the cytoplasm and indicated that TEDC1 and TEDC2 localize near the centriole walls of procentrioles and the proximal region of parental centrioles, near CEP44 (Fig 2 – Supplementary Figure 1c, d). These results complement and support our initial observations (Fig 2C, D) and we have edited the text to reflect this (lines 157-163). We also note that these Flag tag and V5 tag primary antibodies are specific and have little background signal in all applications (Fig 2 – Supplementary Fig 1E-J), while other commercially available antibodies against these tags did exhibit non-specific signal. 

      (2) The cell cycle classifications of centrioles would strongly benefit, apart from a better description, from adding quantifications of average centriole length at a given stage based on tubulin staining (not acTub). 

      We thank the reviewers for these recommendations. We have added an improved description of our cell cycle analyses (lines 234-237). We have also added new analyses for centriole length as measured by staining with alpha-tubulin (Fig 4 – Supp 3 and Fig 4 – Supp 4). We find that in all mutants, acetylated tubulin elongates along with alpha-tubulin in a similar way as control centrioles.

      Reviewer #1 (Recommendations For The Authors):  

      Specific points:  

      (1) The introduction is a bit oddly structured. About halfway through it summarizes what is going to be presented in the study, giving the impression that it is about to conclude, but then continues with additional, detailed introduction paragraphs. Overall, the authors may also want to consider making it more concise.

      We thank the reviewer for these suggestions and have shortened and restructured the introduction for clarity and conciseness.

      (2) The text should explain to the non-expert reader why endogenous proteins are not detected and why exogenously expressed, tagged versions are used. Related to this, the authors state overexpression, but what is this assessment based on? Does expression at the endogenous level also rescue? At least by western blot, these questions should be addressed. 

      In the text, we have added clarification about why endogenous proteins were not detected for immunofluorescence (lines 149-151). To quantify the overexpression, we have added Western blots of TEDC1 and TEDC2 to Fig 1 – Supplementary Figure 1E,F. We note that endogenous levels of both proteins are very low, and the rescue constructs are overexpressed 20 to 70 fold above endogenous levels.  

      (3) The figures should clearly indicate when tagged proteins are used and detected.

      Currently, this info is only found in the legends but should be in the figure panels as well. 

      We have made these changes to the figure panels in Fig 2, Fig 2 – Supp 1, and Fig 3.

      (4)  I could not find a description and reference to Figure 2 Supplement 2 and 3. 

      We have replaced these supplements with new supplementary figures for TEDC1 and TEDC2 localization (Fig 2 – Supp 1).

      (5) The multiple bands including unspecific (?) bands should be labeled to guide the reader in the western blots. 

      We have labeled nonspecific bands in our Western blots with asterisks (Fig 1 – Supp 1, Fig 3)

      (6) The alphafold prediction suggests that TUBD1 can bind to the TED complex in the absence of TUBE1 can this be shown? This would be a nice validation of the predicted architecture of the complex. I also missed a bit of a discussion of the predicted architecture. How could it be linked to triplet microtubule formation? Is the latest alphafold version 3 adding anything to this analysis? 

      In our pulldown experiments, we found that TUBD1 cannot bind to TEDC1 or TEDC2 in the absence of TUBE1 (Fig 3C, D, IB: TUBD1). We performed this experiment with three biological replicates and found the same result. It is possible that TUBD1 and TUBE1 form an intact heterodimer, similar to alpha-tubulin and beta-tubulin, and this will be an exciting area of future research.

      We have added new analysis from AlphaFold3 (Fig 3 – Supp 1B). AlphaFold3 predicts a similar structure as AlphaFold Multimer.

      We have also added additional discussion about the AlphaFold prediction to the text (lines 220-222, 365-367). Thanks to the reviewer for pointing out this oversight.

      (7) I suggest briefly explaining in the text how cells and centrioles at different cell cycle stages were identified. I found some info in the legend of Figure 1, but no info for other figures or in the text. Related to this, how are procentrioles defined in de novo formation? There is no parental centriole to serve as a reference. 

      We have added a brief explanation of the synchronization and identification in lines 234237. We have also clarified the text regarding de novo centrioles, and now term these “de novo centrioles in the first cell cycle after their formation” (lines 271-272).

      (8) Related to point 7: using acetylated tubulin as a universal length and width marker seems unreliable since it is a PTM. The authors should use general tubulin staining to estimate centriole dimensions, or at least establish that acetylated tubulin correlates well with the overall tubulin signal in all mutants. 

      We have added two supplementary data figures (Fig 4 – supp 3 and Fig 4 – supp 4) in which we co-stain control and mutant centrioles with alpha-tubulin. We found that acetylated tubulin marked mutant centrioles well and as alpha-tubulin length increased, acetylated tubulin length also increased. 

      (9) Presence and absence of various centriolar proteins. These analyses lack a clear reference for the precise centriole elongation stage. This is particularly problematic for proteins that are recruited at specific later stages (such as inner scaffold proteins). The staining should be correlated with centriole length measurements, ideally using general tubulin staining.  

      As described for point 8, we have added two supplementary data figures in which we costain control and mutant centrioles with alpha-tubulin and found that acetylated tubulin also increases as overall tubulin length increases in all mutants. We note that inner scaffold proteins are absent in all our mutant centrioles at all stages of the cell and centriole cycle, as also previously reported for POC5 in Wang et al., 2017.

      Reviewer #2 (Recommendations For The Authors):  

      Here's a list of points I think could be improved:  

      -  As the authors previously published, the centriole appears to have a smaller internal diameter than mature centrioles. Could the authors measure to see if the phenotype is identical? Is the centriole blocked in the bloom phase (Laporte et al. 2024)? 

      We have added an additional supplementary figure (Fig 4 – supp 5) to show that mutant centrioles have smaller diameters than mature centrioles, as we previously reported for the delta-tubulin and epsilon-tubulin mutant centrioles by EM. We thank the reviewers for the additional question of the bloom phase. Given the comparatively smaller number of centrioles we analyzed in this paper compared to Laporte et al (50 to 80 centrioles per condition here, versus 800 centrioles in Laporte et al), it is difficult to definitively conclude whether there is a block in bloom phase. This would be an interesting area for future research.  

      -  The images of the centrioles in EM are beautiful. Would it be possible to apply a symmetrisation on it to better see the centriolar structures? For example, is the A-C linker present? 

      We thank the reviewer for this excellent suggestion. Using centrioleJ, we find that the A-C linker is absent from mutant centrioles. The symmetrized images have been added to Fig 1 – Supplementary Fig 2, and additional discussion has been added to the text (line 143-144, line 368-374).  

      -  How many EM images were taken? Did the centrioles have 100% A-microtubule only or sometimes with B-MT? 

      For TEM, we focused on centrioles that were positioned to give perfect cross-section images of the centriolar microtubules, and thus did not take images of off-angle or rotated centrioles. Given the difficulty of this experiment (centrioles are small structures within the cell, centrosomes are single-copy organelles, and off-angle centrioles were not imaged), we were lucky to image 3 centrioles that were in perfect cross-section – 2 for Tedc1<sup>-/-</sup> and 1 for Tedc2<sup>-/-</sup>. Our images indicate that these centrioles only have A-tubules (Fig 1 – Supp Fig

      2).

      -  In Figure 2 - it would be preferable to write TEDC2-flag or TEDC1-flag and not TEDC2/1. 

      We have made this change

      -  It seems that Figures 2C and D aren't cited, and some of the data in the supplemental data are not described in the main text. 

      We have replaced these supplements with new supplementary figures for TEDC1 and TEDC2 localization (Fig 2 – Supp 1).

      -  The signal in U-ExM with the anti-Flag antibody is heterogeneous. Did the authors test several anti-FLAG antibodies in U-ExM? 

      We tested several anti-Flag and anti-V5 antibodies for our analyses, and chose these because they have little background signal in all applications (Fig 2 – Supplementary Fig 1E-J). Other commercially available antibodies against these tags did exhibit non-specific signal.

      -  The AlphaFold prediction is difficult to interpret, the authors should provide more views and the PDB file. 

      We have added 2 additional views of the AlphaFold prediction in Fig 3 – Supp 1A.

      -  In general, but particularly for Figure 4: the length doesn't seem to be divided by the expansion factor, it is therefore difficult to compare with known EM dimensions. Can the authors correct the scale bars? 

      We have corrected the scale bars for all figures to account for the expansion factor.

      -  Concerning Gamma-tubulin that is "recruited to the lumen of centrioles by the inner scaffold, had localization defects in mutant centrioles. However, we were unable to reliably detect gamma-tubulin within the lumen of control or de novo-formed centrioles in S or G2-phase (Figure 4 - Supplement 1E), and thus were unable to test this hypothesis". In Laporte et al 2024, Gamma-tubulin arrives later than the inner scaffold and only on mature centrioles, so this result appears to be in line with previous observation. However, the authors should be able to detect a proximal signal under the microtubules of the procentriole, is this the case? 

      We agree that this is an exciting question. However, in our expansion microscopy staining, we frequently observe that gamma-tubulin surrounds centrioles, corresponding to its role in the pericentriolar material (PCM). In our hands, we find it difficult to distinguish between centriolar gamma-tubulin at the base of the A-tubule from gamma-tubulin within the PCM.  

      -  In the signal elongation of SAS-6, STIL, CEP135, CPAP, and CEP44, would it be possible to quantify the length of these signals (with dimensions divided by the expansion factor for comparison with known TEM distances)? 

      We have quantified the lengths of SAS-6 and CEP135 in new Fig 4 – Supp 3 and Fig 4 – Supp 4.  

      -  The authors observe that centrin is present, but only as a SFI1 dot-like localization (which is another protein that would be interesting to look at), and not an inner scaffold localization. Can the authors elaborate? These results suggest that the distal part is correctly formed with only a microtubule singlet. 

      We agree with the reviewer’s interpretation that the centriole distal tip is likely correctly formed with only singlet microtubules, as both distal centrin and CP110 are present. We have added this point to the discussion (line 415).

      -The authors observe that CPAP is elongated, but CPAP has two locations, proximal and distal. Is it distal or proximal elongation? Is the proximal signal of CPAP longer than that of CEP44 in the mutants? The authors discuss that the elongation could come from overexpression of CPAP, but here it seems that the centriole is not overlong, just the structures around the cartwheel. 

      We thank the reviewer for this point. It is difficult for us to conclude whether the proximal or distal region is extended in the mutants, as our mutant centrioles lacks a visible separation between these two regions. It would be interesting to probe this question in the future by testing whether subdomains of CPAP may be differentially regulated in our mutants.

      Reviewer #3 (Recommendations For The Authors):  

      It isn't apparent to me what was counted in Figure 1C. Were all centrioles (mother centrioles and procentrioles) counted? Where is the 40% in control cells coming from? Can this set of data be presented differently? 

      We apologize for the confusion. In this figure, all centrioles were counted. We have updated the figure legend for clarity. We performed this analysis in a similar way as in Wang et al., 2017 to better compare phenotypes.  

      Figure 2C. and the text lines 182-187: The ultrastructural characterization of TEDC1 and TEDC2 suffers from the low quality of the TEDC1 and TEDC2 signals obtained postexpansion. In comparison with robust low-resolution immunosignal, it appears that most of the signal cannot be recovered after expansion. Another sub-resolution imaging method to re-analyze TEDC1 and TEDC22 localization would be essential. The same concern applies to Figures 2 - Supplement 2 and 3. Also, Figure 2 - Supplement 2 and Supplement 3 do not seem to be cited. 

      We thank the reviewer for these recommendations. As also mentioned above, we used an alternative super-resolution approach, a Yokogawa CSU-W1 SoRA confocal scanner (resolution = 120 nm), and found that TEDC1 and TEDC2 localize to procentrioles and the proximal end of parental centrioles (Fig 2 – Supplementary Figure 1a, b). Second, we used a recently described expansion gel chemistry (Kong et al., Methods Mol Biol 2024) combined with Abberior Star red and orange secondary antibodies. This technique resulted in robust signal at centrosomes and in the cytoplasm and indicated that TEDC1 and TEDC2 localize near the centriole walls of procentrioles and the proximal region of parental centrioles, near CEP44 (Fig 2 – Supplementary Figure 1c, d). These stainings complement and support our initial observations (Fig 2C, D) and we have edited the text to reflect this (lines 157-163). We have also removed the supplementary figures that were uncited in the text.

      TUBD1 and TUBE1 form a dimer and TEDC2 and TEDC1 can interact. Any speculation as to why TEDC2 does not pull down both TUBE1 and TUBD1? 

      We apologize for the confusion. TEDC2 does pull down both TUBE1 and TUBD1 (Fig 3D, pull-down, second column, Tedc2-V5-APEX2 rescuing the Tedc2<sup>-/-</sup> cells pulls down TUBD1, TUBE1, and TEDC1).  

      Figure 4A and B. The authors use acetylated tubulin to determine the length of procentrioles in the S and G2 phases. However, procentrioles are not acetylated on their distal ends in these cell phase phases (as the authors also mention further in the text). Why has alpha tubulin not been used since it works well in U-ExM? The average size of the control, G2 procentrioles, seems too small in Figure 4A and not consistent with other imaging data (for instance, in Figure 4 - Supplement 1 C, Cp110, and CPAP staining). There is no statistical analysis in F4A.  

      We have added two supplementary data figures (Fig 4 – supp 3 and Fig 4 – supp 4) in which we co-stain control and mutant centrioles with alpha-tubulin. We found that acetylated tubulin correlates well with overall tubulin signal in all mutants. We have added statistical analysis to the figure legend of Fig 4A.

      Lines 260 - 262: "These results indicate that centrioles with singlet microtubules can elongate to the same length as controls, and therefore that triplet microtubules are not essential for regulating centriole length." It is hard to agree with this statement. Mutant procentrioles show aberrantly elongated proximal signals of several tested proteins. In addition, in lines 326 - 328, the authors state that "Together, these results indicate that centrioles lacking compound microtubules are unable to properly regulate the length of the proximal end."  

      We thank the reviewer and have clarified the statement to state that these results indicate that centrioles with singlet microtubules can elongate to the same overall length as control centrioles in G2 phase.  

      Line 353: The authors suggest that elongated procentriole structure in mitosis may represent intermediates in centriole disassembly. Another interpretation, more in line with the EM data from Wang et al., 2017, would be that these mutant procentrioles first additionally elongate before they disassemble in late mitosis. The aberrant intermediate structure concept would need further exploration. For instance, anti-alpha/beta-tubulin antibodies could be used to investigate centriole microtubules.  

      We apologize for the confusion and have edited this section for clarity (lines 341-343): “We conclude that in our mutant cells, centrioles elongate in early mitosis to form an aberrant intermediate structure, followed by fragmentation in late mitosis.”

      References need to be included in lines 122, 277, 279. 

      We have added these references

      Line 281: Add references PMID: 30559430 and PMID: 32526902.  

      We have added these references (lines 265-266).

      Line 289: "Moreover, our results suggest that centriole glutamylation is a multistep process, in which long glutamate side chains are added later during centriole maturation." This does not seem like an original observation. For instance, see PMID: 32526902.  

      We have added this reference (lines 273-274).

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public review): 

      Hotinger et al. explore the population dynamics of Salmonella enterica serovar Typhimurium in mice using genetically tagged bacteria. In addition to physiological observations, pathology assessments, and CFU measurements, the study emphasizes quantifying host bottleneck sizes that limit Salmonella colonization and dissemination. The authors also investigate the genetic distances between bacterial populations at various infection sites within the host.

      Initially, the study confirms that pretreatment with the antibiotic streptomycin before inoculation via orogastric gavage increases the bacterial burden in the gastrointestinal (GI) tract, leading to more severe symptoms and heightened fecal shedding of bacteria. This pretreatment also significantly reduces between-animal variation in bacterial burden and fecal shedding. The authors then calculate founding population sizes across different organs, discovering a severe bottleneck in the intestine, with founding populations reduced by approximately 10^6-fold compared to the inoculum size. Streptomycin pretreatment increases the founding population size and bacterial replication in the GI tract. Moreover, by calculating genetic distances between populations, the authors demonstrate that, in untreated mice, Salmonella populations within the GI tract are genetically dissimilar, suggesting limited exchange between colonization sites. In contrast, streptomycin pretreatment reduces genetic distances, indicating increased exchange.

      In extraintestinal organs, the bacterial burden is generally not substantially increased by streptomycin pretreatment, with significant differences observed only in the mesenteric lymph nodes and bile. However, the founding population sizes in these organs are increased. By comparing genetic distances between organs, the authors provide evidence that subpopulations colonizing extraintestinal organs diverge early after infection from those in the GI tract. This hypothesis is further tested by measuring bacterial burden and founding population sizes in the liver and GI tract at 5 and 120 hours post-infection. Additionally, they compare orogastric gavage infection with the less injurious method of infection via drinking, finding similar results for CFUs, founding populations, and genetic distances. These results argue against injuries during gavage as a route of direct infection. 

      To bypass bottlenecks associated with the GI tract, the authors compare intravenous (IV) and intraperitoneal (IP) routes of infection. They find approximately a 10-fold increase in bacterial burden and founding population size in immune-rich organs with IV/IP routes compared to orogastric gavage in streptomycin-pretreated animals. This difference is interpreted as a result of "extra steps required to reach systemic organs."

      While IP and IV routes yield similar results in immune-rich organs, IP infections lead to higher bacterial burdens in nearby sites, such as the pancreas, adipose tissue, and intraperitoneal wash, as well as somewhat increased founding population sizes. The authors correlate these findings with the presence of white lesions in adipose tissue. Genetic distance comparisons reveal that, apart from the spleen and liver, IP infections lead to genetically distinct populations in infected organs, whereas IV infections generally result in higher genetic similarity. 

      Finally, the authors investigate GI tract reseeding, identifying two distinct routes. They observe that the GI tracts of IP/IV-infected mice are colonized either by a clonal or a diversely tagged bacterial population. In clonally reseeded animals, the genetic distance within the GI tract is very low (often zero) compared to the bile population, which is predominantly clonal or pauciclonal. These animals also display pathological signs, such as cloudy/hardened bile and increased bacterial burden, leading the authors to conclude that the GI tract was reseeded by bacteria from the gallbladder bile. In contrast, animals reseeded by more complex bacterial populations show that bile contributes only a minor fraction of the tags. Given the large founding population size in these animals' GI tracts, which is larger than in orogastrically infected animals, the authors suggest a highly permissive second reseeding route, largely independent of bile. They speculate that this route may involve a reversal of known mechanisms that the pathogen uses to escape from the intestine. 

      The manuscript presents a substantial body of work that offers a meticulously detailed understanding of the population dynamics of S. Typhimurium in mice. It quantifies the processes shaping the within-host dynamics of this pathogen and provides new insights into its spread, including previously unrecognized dissemination routes. The methodology is appropriate and carefully executed, and the manuscript is well-written, clearly presented, and concise. The authors' conclusions are well-supported by experimental results and thoroughly discussed. This work underscores the power of using highly diverse barcoded pathogens to uncover the within-host population dynamics of infections and will likely inspire further investigations into the molecular mechanisms underlying the bottlenecks and dissemination routes described here.

      Major point:

      Substantial conclusions in the manuscript rely on genetic distance measurements using the Cavalli-Sforza chord distance. However, it is unclear whether these genetic distance measurements are independent of the founding population size. I would anticipate that in populations with larger founding population sizes, where the relative tag frequencies are closer to those in the inoculum, the genetic distances would appear smaller compared to populations with smaller founding sizes independent of their actual relatedness. This potential dependency could have implications for the interpretation of findings, such as those in Figures 2B and 2D, where antibiotic-pretreated animals consistently exhibit higher founding population sizes and smaller genetic distances compared to untreated animals.

      Thank you for raising this important point regarding reliance on cord distances for gauging genetic distance in barcoded populations. The reviewer is correct that samples with more founders will be more similar to the inoculum and thus inherently more similar to other samples that also have more founders. However, creation of libraries containing very large numbers of unique barcodes can often circumvent this issue. In this case, the effect size of chance-based similarity is not large enough to change the interpretation of the data in Figures 2B and 2D. In our case, the library has ~6x10<sup>4</sup> barcodes, and the founding populations in Figure 2B are ~10<sup>3</sup>. Randomly resampling to create two populations of 10<sup>3</sup> cells from an initial population with 6x10<sup>4</sup> barcodes is expected to yield largely distinct populations with very little similarity. Thus, the similarity between streptomycin-treated populations in Figure 2D is likely the result of biology rather than chance.  

      Reviewer #2 (Public review):

      In this paper, Hotinger et. al. propose an improved barcoded library system, called STAMPR, to study Salmonella population dynamics during infection. Using this system, the authors demonstrate significant diversity in the colonization of different Salmonella clones (defined by the presence of different barcodes) not only across different organs (liver, spleen, adipose tissues, pancreas, and gall bladder) but also within different compartments of the same gastrointestinal tissue. Additionally, this system revealed that microbiota competition is the major bottleneck in Salmonella intestinal colonization, which can be mitigated by streptomycin treatment. However, this has been demonstrated previously in numerous publications. They also show that there was minimal sharing between populations found in the intestine and those in the other organs. Upon IV and IP infection to bypass the intestinal bottleneck, they were able to demonstrate, using this library, that Salmonella can renter the intestine through two possible routes. One route is essentially the reverse path used to escape the gut, leading to a diverse intestinal population; while the other, through the bile, typically results in a clonal population. Although the authors showed that the STAMPR pipeline improved the ability to identify founder populations and their diversity within the same animal during infections, some of the conclusions appear speculative and not fully supported.

      (1) It's particularly interesting how the authors, using this system, demonstrate the dominant role of the microbiota bottleneck in Salmonella colonization and how it is widened by antibiotic treatment (Figure 1). Additionally, the ability to track Salmonella reseeding of the gut from other organs starting with IV and IP injections of the pathogen provides a new tool to study population dynamics (Figure 5). However, I don't think it is possible to argue that the proximal and distal small intestine, Peyer's patches (PPs), cecum, colon, and feces have different founder populations for reasons other than stochastic variations. All the barcoded Salmonella clones have the same fitness and the fact that some are found or expanded in one region of the gastrointestinal tract rather than another likely results from random chance - such as being forced in a specific region of the gut for physical or spatial reasons-and subsequent expansion, rather than any inherent biological cause. For example, some bacteria may randomly adhere to the mucus, some may swim toward the epithelial layer, while others remain in the lumen; all will proliferate in those respective sites. In this way, different founder populations arise based on random localization during movement through the gastrointestinal tract, which is an observation, but it doesn't significantly contribute to understanding pathogen colonization dynamics or pathogenesis. Therefore, I would suggest placing less emphasis on describing these differences or better discussing this aspect, especially in the context of the gastrointestinal tract.

      Thank you for helping us identify this area for further clarification. We agree with the reviewer’s interpretation that seeding of proximal and distal small intestine, Peyer's patches (PPs), cecum, colon, and feces with different founder populations is likely caused by stochastic variations, consistent with separate stochastic bottlenecks to establishing these separate niches. To clarify this point we have modified the text in the results section, “Streptomycin treatment decreases compartmentalization of S. Typhimurium populations within the intestine”.

      Change to text:

      “Except for the cecum and colon, in untreated animals the S. Typhimurium populations in different regions of the intestine were dissimilar (Avg. GD ranged from 0.369 to 0.729, 2D left); i.e., there is little sharing between populations in the intestine. These data suggest that there are separate bottlenecks in different regions of the intestine that cause stochastic differences in the identity of the founders. Interestingly, when these founders replicate, they do not mix, remaining compartmentalized with little sharing between populations throughout the intestinal tract (i.e., barcodes found in one region are not in other regions, Figure S3). This was surprising as the luminal contents, an environment presumably conducive to bacterial movement, were not removed from these samples.”

      In this section we are interested in the underlying biology that occurs after the initial bottleneck to preserve this compartmentalization during outgrowth of the intestinal population. In other words, what prevents these separate populations from merging (e.g., what prevents the bacteria replicating in the proximal small intestine from traveling through the intestine and establishing a niche in the distal small intestine)? While we do not explore the mechanisms of compartmentalization, we observe that it is disrupted by streptomycin pretreatment, suggesting a microbiota-dependent biological cause. 

      (2) I do think that STAMPR is useful for studying the dynamics of pathogen spread to organs where Salmonella likely resides intracellularly (Figure 3). The observation that the liver is colonized by an early intestinal population, which continues to proliferate at a steady rate throughout the infection, is very interesting and may be due to the unique nature of the organ compared to the mucosal environment. What is the biological relevance during infection? Do the authors observe the same pattern (Figures 3C and G) when normalizing the population data for the spleen and mesenteric lymph nodes (mLN)? If not, what do the authors think is driving this different distribution?

      Thank you for raising this interesting point. These data indicate that the liver is seeded from the intestine early during infection. The timing and source of dissemination have relevance for understanding how host and pathogen variables control the spread of bacteria to systemic sites. For example, our conclusion (early dissemination) indicates that the immune state of a host at the time of exposure to a pathogen, and for a short period thereafter, are what primarily influence the process of dissemination, not the later response to an active infection. 

      We observe that the liver and mucosal environments within the intestine have similar colonization behaviors. Both niches are seeded early during infection, followed by steady pathogen proliferation and compartmentalization that apparently inhibits further seeding. This results in the identity of barcodes in the liver population remaining distinct from the intestinal populations, and the intestinal populations remaining distinct from each other.

      We observe a similar pattern to the liver in the spleen and MLN (the barcodes in the spleen and MLN are dissimilar to the population in the intestine). To clarify this point, we have modified the text (below) and added this analysis as a supplemental figure (S4).

      Change to text:

      Genetic distance comparison of liver samples to other sites revealed that, regardless of streptomycin treatment, there was very little sharing of barcodes between the intestine and extraintestinal sites (Avg. GD >0.75, Figure 3C). Furthermore, the MLN and spleen populations also lacked similarity with the intestine (Figure S4). These analyses strongly support the idea that S. Typhimurium disseminates to extraintestinal organs relatively early following inoculation, before it establishes a replicative niche in the intestine.

      (3) Figure 6: Could the bile pathology be due to increased general bacterial translocation rather than Salmonella colonization specifically? Did the authors check for the presence of other bacteria (potentially also proliferating) in the bile? Do the authors know whether Salmonella's metabolic activity in the bile could be responsible for gallbladder pathology?

      The reviewer raises interesting points for future work. We did not check whether other bacterial species are translocating during S. Typhimurium infection. The relevance of Salmonella’s metabolic activity is also very interesting, and we hope these questions will be answered by future studies.

      Recommendations for the authors:

      Reviewer #1 (Recommendations for the authors):

      Minor points:

      (1) P. 9/10 "... the marked delay in shedding after IP and IV relative to orogastric inoculation suggest that the S. Typhimurium population encounters substantial bottleneck(s) on the route(s) from extraintestinal sites back to the intestine.": Can you conclude that from the data? It could also be possible that there is a biological mechanism (other than chance events) that delays the re-entry to the intestine.

      We propose that the delay in shedding indicates additional obstacles that bacteria face when re-entering the intestine, and that there are likely biological mechanisms that cause this delay. However, these unknown mechanisms effectively act as additional bottlenecks by causing a stochastic loss of population diversity. 

      (2) P. 11 "...both organs would likely contain all 10 barcodes. In contrast, a library with 10,000 barcodes can be used to distinguish between a bottleneck resulting in Ns = 1,000 and Ns = 10,000, since these bottlenecks result in a different number of barcodes in output samples. Furthermore, high diversity libraries reduce the likelihood that two tissue samples share the same barcode(s) due to random chance, enabling more accurate quantification of bacterial dissemination.": I agree with the general analysis, but I find it misleading to talk about the presence of barcodes when the analyses in this manuscript are based on the much more powerful comparison of relative abundance of individual tags instead of their presence or absence.

      The reviewer raises an excellent point, and the distinction between relative abundance versus presence/absence is discussed extensively in the original STAMPR manuscript. Although relative abundance is powerful, the primary metric used in this study (Ns) is calculated principally from the number of barcodes, corrected (via simulations) for the probability of observing the same barcode across distinct founders. Although this correction procedure does rely on barcode abundance, the primary driver of founding population quantification is the number of barcodes.

      (3) P.14 "the library in LB supplemented with SM was not significantly different than the parent strain" and Figure 2C: How was significance tested? How many times were the growth curves recorded? On my print-out, the red color has different shades for different growth curves.

      Significance was tested with a Mann-Whitney and growth curves were performed 5 times. Growth curves are displayed with 50% opacity, and as a result multiple curves directly on top of each other appear darker. The legend to S2 has been modified accordingly.

      (4) P.16: close bracket in the equation for FRD calculation.

      Done

      (5) Figure 2C "Average CFU per founder": I found the wording confusing at first as I thought you divided the average bacterial burden per organ by Ns, instead of averaging the CFU/Ns calculated for each mouse.

      The wording has been clarified. 

      (6) Figure 3B: It would be helpful to include expected genetic distances in the schematic as it is difficult to infer the genetic distance when only two of three, respectively, different "barcode colors" are used. While I find the explanation in the main text intuitive, a graphical representation would have helped me.

      Thank you for the suggestion. Unfortunately, using colors to represent barcodes is imperfect and limits the diversity that can be depicted. We have modified Figure 3B to further clarify. 

      (7) Figure 3C: Why do you compare the genetic distance to the liver, when you discuss the genetic distance of the intestinal population? Is it not possible that the intestinal populations are similar to the extraintestinal organs except the liver?

      For clarity, we chose to highlight exclusively the liver. However, we observed a similar pattern to the liver in other extraintestinal organs. To clarify the generalizability of this point we have added a supplemental figure with comparisons to MLN and Spleen (Supplemental figure S4) as well as further text.

      (8) Figure 3C & S5A: I found "+SM" and "+SM, Drinking" confusing and would have preferred "+SM, Gavage" and "+SM, Drinking" for clarity.

      Done, thank you for the suggestion.

      (9) Figure 3G&H: I find it worthy of discussion that the bacterial burden increases over time, while the founding population decreases. Does that not indicate that replication only occurs at specific sites leading to the amplification of only a few barcodes and thereby a larger change of the relative barcode abundance compared to the inoculum?

      From 5h to 120h the size of the founding population decreases in multiple intestinal sites. This likely indicates that the impact of the initial bottleneck is still ongoing at 5h, although further temporal analysis would be required to define the exact timing of the bottleneck. Notably, the passage time through the mouse intestine is ~5h. Many of the founders observed at 5h could be a population that will never establish a replicative niche, and failing to colonize be shed in the feces, bottlenecking the population between 5h and 120h. To clarify this point we have added the following text:

      Section “S. Typhimurium disseminates out of the intestine before establishing an intestinal replicative niche”.

      “In contrast to the liver, there were more founders present in samples from the intestine (particularly in the colon) at 5 hours versus 120 hours (Figure 3H). These data likely indicate that many of the founders observed in the intestine at 5 hours are shed in the feces prior to establishing a replicative niche, and demonstrates that the forces restricting the S. Typhimurium population in the intestine act over a period of > 5 hours.”  

      (10) Figure S2A: I do not understand this figure. Why are there more than 70.000 tags listed? I was under the impression the barcode library in S. Typhimurium had 55.000 tags while only the plasmid pSM1 had more than 70.000 (but the plasmid should not be relevant here). Why are there distinct lines at approximately 10^-5 and a bit lower? I would have expected continuously distributed barcode frequencies.

      During barcode analysis, each library is mapped to the total barcode list in the barcode donor pSM1, which contains ~70,000 barcodes. This enables consistent analysis across different bacterial libraries. The designation “barcode number” refers to the barcode number in pSM1, meaning many of the barcodes in the Salmonella library are at zero reads. This graph type was chosen to show there was no bias toward a particular barcode, however there is significant overlap of the points, making individual barcode frequencies difficult to see. We have changed the x-axis to state “pSM1 Barcode Number” and clarified in the figure legend.

      Since the y-axes on these graphs is on a log10 scale, the lines represent barcodes with 1 read, 2 reads, 3 reads, etc. As the number of reads per barcode increases linearly, the space between them decreases on logarithmic axes.

      (11) There are a few typos in the figure legends of the supplementary material. For example Figure S2: S. Typhimurium not italicized, ~7x105 no superscript. Fig. S4&5 ", Open circles" is "O" is capitalized.

      Typos have been corrected.

  3. Jan 2025
    1. IMPORTANT: never “Print to PDF” when exporting a Word Document to PDF. A screen reader user may still be able to access the text of a PDF created in this way, but heading structure, alternative text, and any other tag structure will be lost.

      Never use print to PDF

    1. if you publish galleys in PDF, you can set the language tag for the document as follows: Open the Document Properties dialog: Choose File > Properties Select a language from the Language menu in the Reading Options area of the Advanced tab.

      Setting default language for PDF galleys in OJS

    2. If you use OJS with multiple languages, make sure to use the proper language locale for that language (e.g. French locale for the French language) as the locale determines the language tag for the page.

      Expectations for multiple language journals in OJS>

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary: It has been known for many years that some peroxisomal proteins are imported by the major peroxisomal protein import receptor Pex5, which recognises the C terminal targeting signal PTS1, despite either lacking a PTS1 or if the PTS1 is blocked. Some proteins are also able to 'piggyback' into peroxisomes by binding to a partner which possesses a PTS. Eci1, the subject of this study is such a protein. This manuscript identified a PTS1-independent, non-canonical interaction interface between S. cerevisiae PEX5 and imported protein Eci1. Confocal imaging was used to observe the PTS1-independent import of Eci1 into peroxisomes and to establish dependence of Pex5 even in the absence of its piggyback partner Dci1. The authors purified the Pex5-Eci1 complex and used Cryo-EM to provide a structure of the purified PEX5-Eci1 complex. In general, this manuscript is well written and easy to read.

      Major points

      Most of the experiments presented are well-designed and accompanied with appropriate controls. However, please mention how many times the experiments have been repeated and how many biological samples were used in the analysis.The authors should also consider the following suggestions substantiate their conclusions:

      Figure 1A: Include full-length Eci1 with an N-terminal fluorophore, Eci1 PTS1-deletion with N-terminal fluorophore, and the PTS1 deletion with a C-terminal fluorophore, to control for any disturbance of targeting by the C terminal NG tag.

      Figure 1C: Confirm the Eci1 and Dci1 levels (if an antibody is available for the latter) by western blot. It is difficult to compare expression levels when comparing just a small number of cells in the microscope. Western blot would give a more robust evaluation of protein levels and help corroborate the claim that Eci1 expression is decreased in the absence of Dci1 if the authors wish to stand by this conclusion.

      Figure 2: confirm the deletion and overexpression of PEX9, PEX5, and PEX7 by western blot of the relevant strains. The production of these strains is not described in the manuscript. If they have been previously described this should be referenced if not it should be included.

      Figure 2: Validate these strains by checking import of a canonical PTS1 and canonical PTS2 and pex9 dependent protein to ensure they function as they should, unless these strains have been published elsewhere in which case their characterisation can be referenced.

      Figure 3: The gel should include a standard of a known amount of the lysate used in the pull down to enable a semi-quantitative estimation of the amount of Eci1 protein captured by PEX5 with and without its PTS1. Also include Eci1 with a C-terminal fluorophore to be comparable with the in vivo data in Figs 1 and 2. A control with no pex5 for background would be useful. A full Coomassie-blue stained gel (not western blot) is required to demonstrate the direct interaction as with the western blot it cannot be excluded that other proteins bridge the interaction since this is a pull down from lysate not purified proteins. OPTIONAL:Interestingly the surface on Eci1 which binds pex5 is where CoA binds in the active enzyme. Would CoA compete for binding to Pex5? (could add it into the pull down expt?)

      Figure S2: The complex between pex5 and eci1 is solved by cryo EM. Eci1 is hexameric usually 1 but sometimes 2 or 3 pex5s are bound to the complex. The size-exclusion chromatography figure with calculated molecular weight is required to support the stoichiometry. A native gel to show the complex, as well as a denaturing gel (using the complex) to show the individual proteins will be beneficial.

      Figure S9: Would Eci1 compete with Dci1 to bind to Pex5 since they share highly conserved interfaces? If so, why did the deletion of Dci1 impair Eci1 location? Or is this just reduced expression in the dci1 deletion background? (See point 2) This seems counterintuitive/contradictory so please comment.

      OPTIONAL: As the authors acknowledge this work is in vitro. It would have been interesting to examine the role of this interface in vivo by mutating one or more of the residues in Eci 1 identified as being important for the interaction. Granted that mutation can affect the folding of the protein, but the binding region is on the surface so it may not, and this can be readily checked e.g by enzyme activity or limited proteolysis.

      OPTIONAL: Similarly, it would have been interesting to see if mutating the residues of PEX5 involved in the interface affect the import of other cargoes than eci1 or if reciprocal mutations in pex5 and Eci1 e.g switching charges could restore an import defect.

      OPTIONAL If 8 & 9 isn't possible could a co-evolutionary analysis of the interface residues provide further independent evidence for their functional importance? They have looked at conservation of residues in Eci1 but this could be extended to a co-evolution analysis.

      Minor points

      Figure 1C and throughout the manuscript state clearly whether the same confocal settings are used when comparing fluorescence intensity of different images/samples.

      Figure S2B: Please use different colours for PEX5 and Eci1 for clarity.

      Figure 4A: please indicate the PTS1 for the other 5 molecules of Eci1. Are they buried? Or not seen? Please add explanation.

      Figure 4B, C, and D: please colour the circled helix in PEX5 so that it can be more easily seen.

      Please indicate the EBI-mediated interaction in Figure 4C. The relationship between 4C and 4D could be explained better as they are not viewed from the same direction

      Figure S3: As the authors indicated, Pex5 binds with multiple conformations and forms a variable interface with an Eci1 subunit. Does this mean different types of non-canonical interface are possible? Please discuss this.

      Figure 5A and B: they should be labelled as PEX5 TPR domain

      Figure S8 is very helpful in understanding the interface and could be included in Figure 5.

      Significance

      While cargo recognition by Pex5-PTS1 is well understood in molecular detail there are proteins which either lack a PTS1 or have a nonessential PTS1 that still require Pex5 for import into peroxisomes. This study provides a structural view of interaction between Pex5 and its cargo Eci1, a protein that does have a PTS1 but which is not essential for import. It's not the first example of a PEX5-cargo structure to show a non-canonical binding interface and the results are compared to the human pex5-AGT structure. It is an important addition to understanding how so-called PTS context dependent or non1 non2 proteins can be imported. Is this the first structure showing Pex5 bound to an oligomer cargo? Previous work is appropriately cited in the manuscript.

      The study will be of interest to audiences interested in protein-protein interaction and in protein targeting to organelles. This manuscript presents additional knowledge on how an oligomeric PTS1-independent protein can be imported into peroxisomes. The potential of other proteins using the similar importing mechanism can be tested to understand how one receptor can use apparently multiple binding modes to import a wide range of different proteins.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Proteins are imported into peroxisomes by mobile receptors such as PEX5. PEX5 recognizes cargo proteins in the cytosol by their peroxisome targeting signal (PTS) and then shuttles them across the peroxisomal membrane into the matrix. While most peroxisomal proteins contain well-characterized signals that bind to PEX5 either directly (PTS1) or through PEX7 (PTS2), some proteins interact with PEX5 independently of these canonical signals. The molecular basis of these unconventional interactions has been poorly understood.

      The manuscript by Peer et al. deals with one such protein called Eci1 in yeast. Eci1 has a PTS1 signal at its C terminus and a putative PTS2 signal at its N terminus, yet the authors show that neither of these signals is required for import of Eci1 into peroxisomes. They also show that import of Eci1 cannot be entirely explained by piggy-backing on its paralog Dci1. Regardless, import of Eci1 depends entirely on PEX5, indicating that Eci1 can bind to PEX5 unconventionally. To identify this additional interface, the authors solve the cryo-EM structure of PEX5 bound to Eci1 (which is a hexamer). Surprisingly, the structure reveals that PEX5 binds to only one of the six Eci1 subunits, and that two distinct interfaces are apparent. One reflects the canonical interaction between the PTS1 signal of Eci1 and the receptor's cognate PTS1-binding TPR domain. The other interface is novel and of potential interest. It involves a region of Eci1 that engages a segment of PEX5 upstream of the TPR domain. This segment has not been previously implicated in binding protein cargo.

      Major issues:

      1. The major issue with the paper is that the novel interface between Eci1 and PEX5 has not been demonstrated to be important for import into peroxisomes. Specifically, mutagenesis of both sides of the interface is required to demonstrate that this interaction mediates import of Eci1 lacking the canonical PTS1 signal (and also in the absence of the paralog Dci1). Such data are indisputably a precondition for publication of this paper. Pull-down experiments should also be performed to demonstrate that the interface is sufficient for interacting with PEX5 in the absence of the PTS1 signal on Eci1.
      2. The paper hinges on the demonstration of a residual interaction between PEX5 and Eci1 lacking its PTS1 signal. However, the pull-down experiment in Figure 3 that allegedly shows this result lacks a critical control for non-specific binding of Eci1 to the nickel beads alone. Also, this experiment does not show a direct interaction between PEX5 and Eci1, since the two proteins are co-expressed in bacteria and then pulled down using an engineered His-tag in PEX5. This experiment should be repeated using PEX5 and Eci1 purified separately and then mixed in vitro. Please show a coomassie-stained SDS-PAGE gel to assess protein purity in addition to the immunoblot, and please show the pull-down in a more conventional way comparing the input and the bound fraction (it is unclear what is meant by soluble and elution fractions).
      3. The presentation of the structure in Figure 4 should be improved. An overview of the complex should be shown first, and then each interface should be pointed out in a different view (and accordingly labeled). It is distracting and not necessary to show all six subunits of Eci1 in different colors. The non-conventional interface should be shown more clearly, with key amino acids numbered and labeled, and the configurations of their side chains highlighted. Please also highlight the salt bridges and hydrogen bonds at this interface that are mentioned in the text but never illustrated.
      4. The data in Figs. S2 and S3 raise doubts about the reported resolution of PEX5 in the cryo-EM structure. Please provide examples of the density map and the fit to the model.
      5. Please provide data for the purification of the complex between PEX5 and Eci1, including a gel-filtration chromatogram and an SDS-PAGE gel of the purified sample used for cryo-EM.
      6. OPTIONAL: The observation that the non-conventional interface between PEX5 with Eci1 corresponds to the site of CoA binding is interesting. This interaction might keep the enzyme inactive while in the cytosol and bound to PEX5, until it would be correctly delivered into peroxisomes and released from the receptor. Alternatively, it could also reflect regulation of Eci1 import by CoA. This idea could easily be tested by pull-down experiments performed with or without CoA, or perhaps by an in vitro Eci1 activity assay in the presence or absence of PEX5. The significance of the paper would be considerably improved if this interaction reflected a mechanism to regulate Eci1 activity or import.

      Minor issues:

      1. The manuscript has many grammatical mistakes which should be addressed. The absence of line numbers precludes us from indicating specific issues.
      2. In general, when referring to a single subunit from the Eci1 hexamer, please use the terms subunit or protomer, and avoid the use of the term monomer which is misleading.
      3. In Fig. 1C, it is unclear whether the experiment was performed in the absence or presence of PEX11. Since the paper hinges on the demonstration of an unconventional interaction between Eci1 and PEX5, perhaps this experiment should be performed in pex11 knockout cells (to enlarge peroxisomes as in Fig. 1B) to show that the residual peroxisomal localization indeed corresponds to the matrix.
      4. In Fig. 6, it would help to show each structure individually and then the overlay.
      5. Fig. S4 should include a scale bar and box size.
      6. Why are phosphorylation sites indicated in Fig. S6?
      7. In Fig. S8, please show the structures of Eci1 bound to PEX5 and to CoA individually, and then the overlay. The figure is very diffucult to understand otherwise.
      8. In Fig. S9, please label the homologous interface residues on Eci1 and Dci1 in individual views, and then show the overlay.

      Significance

      The main finding of the paper is a noncanonical interaction between Eci1 and the peroxisomal import receptor PEX5. This interaction could solve a longstanding mystery about how Eci1 can be targeted to peroxisomes in the absence of its canonical peroxisome targeting signal. Because the authors have not demonstrated that this interaction is sufficient for import of Eci1 in vivo, this key conclusion of the paper remains unconfirmed. If this omission were corrected, the paper would add another example to the growing list of proteins that are imported into peroxisomes by binding unconventionally to PEX5.

      The authors employ an interesting strategy to confirm that Eci1 is correctly imported into the peroxisomal matrix in vivo (and not just recruited to the cytosolic surface of the peroxisomal membrane). This strategy involves enlarging peroxisomes (which normally are diffraction limited) by knocking out a factor required for peroxisome division, allowing the matrix to be resolved from the limiting membrane by light microscopy. Failure to adequately demonstrate import into the matrix had plagued many earlier studies on protein targeting to peroxisomes. The strategy employed in this paper could therefore be useful to other researchers.

      In its current form, the manuscript would be of some interest to the peroxisomal community and perhaps also to researchers studying protein targeting to membrane-bounded organelles. However, if the authors could show that the novel interface between PEX5 and Eci1 functions in part to regulate Eci1 enzymatic activity (or conversely, Eci1 import by CoA), then the paper would be of much broader interest to the fields of metabolism and metabolic regulation.

    1. a dialogue tag is not always necessary once it is established who is speaking.

      Dialogue tags become redundant once the speaker's identity is clear, allowing for a more fluid and natural conversation in writing. The hypothesis suggests that minimizing unnecessary tags enhances readability and maintains the story’s pacing without disrupting immersion.

    1. The single juvenile seal was instrumented with a Wildlife Computers SPOT6 tag, which only provided Argos satellite tracking data

      Elaborate as to why there was as single juvenile in the study.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by Zhu et al describes a novel role for MED26, a subunit of the Mediator complex, in erythroid development. The authors have discovered that MED26 promotes transcriptional pausing of RNA Pol II, by recruiting pausing-related factors.

      Strengths:

      This is a well-executed study. The authors have employed a range of cutting-edge and appropriate techniques to generate their data, including: CUT&Tag to profile chromatin changes and mediator complex distribution; nuclear run-on sequencing (PRO-seq) to study Pol II dynamics; knockout mice to determine the phenotype of MED26 perturbation in vivo; an ex vivo erythroid differentiation system to perform additional, important, biochemical and perturbation experiments; immunoprecipitation mass spectrometry (IP-MS); and the "optoDroplet" assay to study phase-separation and molecular condensates.

      This is a real highlight of the study. The authors have managed to generate a comprehensive picture by employing these multiple techniques. In doing so, they have also managed to provide greater molecular insight into the workings of the MEDIATOR complex, an important multi-protein complex that plays an important role in a range of biological contexts. The insights the authors have uncovered for different subunits in erythropoiesis will very likely have ramifications in many other settings, in both healthy biology and disease contexts.

      Weaknesses:

      There are almost no discernible weaknesses in the techniques used, nor the interpretation of the data. The IP-MS data was generated in HEK293 cells when it could have been performed in the human CD34+ HSPC system that they employed to generate a number of the other data. This would have been a more natural setting and would have enabled a more like-for-like comparison with the other data.

    1. Reviewer #1 (Public Review):

      Summary:

      In this manuscript, "PAbFold: Linear Antibody Epitope Prediction using AlphaFold2", the authors generate a python wrapper for the screening of antibody-peptide interactions using AlphaFold, and test the performance of AlphaFold on 3 antibody-peptide complexes. In line with previous observations regarding the ability of AlphaFold to predict antibody structures and antigen binding, the results are mixed. While the authors are able to use AlphaFold to identify and experimentally validate a previously characterized broad binding epitope with impressive precision, they are unable to consistently identify the proper binding registers for their control [Myc-tag, HA-tag] peptides. Further, it appears that the reproducibility and generality of these results are low, with new versions of AlphaFold negatively impacting the predictive power. However, if this reproducibility issue is solved, and the test set is greatly increased, this manuscript could contribute strongly towards our ability to predict antibody-antigen interactions.

      Strengths:

      Due to the high significance, but difficulty, of the prediction of antibody-antigen interactions, any attempts to break down these predictions into more tractable problems should be applauded. The authors' approach of focusing on linear epitopes (peptides) is clever, reducing some of the complexities inherent to antibody binding. Further, the ability of AlphaFold to narrow down a previously broadly identified experimental epitope is impressive. The subsequent experimental validation of this more precisely identified epitope makes for a nice data point in the assessment of AlphaFold's ability to predict antibody-antigen interactions.

      Weaknesses:

      Without a larger set of test antibody-peptide interactions, it is unclear whether or not AlphaFold can precisely identify the binding register of a given antibody to a given peptide antigen. Even within the small test set of 3 antibody-peptide complexes, performance is variable and depends upon the scFv scaffold used for unclear reasons. Lastly, the apparent poor reproducibility is concerning, and it is not clear why the results should rely so strongly on which multi-sequence alignment (MSA) version is used, when neither the antibody CDR loops nor the peptide are likely to strongly rely on these MSAs for contact prediction.

      Major Point-by-Point Comments:

      (1) The central concern for this manuscript is the apparent lack of reproducibility. The way the authors discuss the issue (lines 523-554) it sounds as though they are unable to reproduce their initial results (which are reported in the main text), even when previous versions of AlphaFold2 are used. If this is the case, it does not seem that AlphaFold can be a reliable tool for predicting antibody-peptide interactions.

      (2) Aside from the fundamental issue of reproducibility, the number of validating tests is insufficient to assess the ability of AlphaFold to predict antibody-peptide interactions. Given the authors' use of AlphaFold to identify antibody binding to a linear epitope within a whole protein (in the mBG17:SARS-Cov-2 nucleocapsid protein interaction), they should expand their test set well beyond Myc- and HA-tags using antibody-antigen interactions from existing large structural databases.

      (3) As discussed in lines 358-361, the authors are unsure if their primary control tests (antibody binding to Myc-tag and HA-tag) are included in the training data. Lines 324-330 suggest that even if the peptides are not included in the AlphaFold training data because they contain fewer than 10 amino acids, the antibody structures may very well be included, with an obvious "void" that would be best filled by a peptide. The authors must confirm that their tests are not included in the AlphaFold training data, or re-run the analysis with these templates removed.

      (4) The ability of AlphaFold to refine the linear epitope of antibody mBG17 is quite impressive and robust to the reproducibility issues the authors have run into. However, Figure 4 seems to suggest that the target epitope adopts an alpha-helical structure. This may be why the score is so high and the prediction is so robust. It would be very useful to see along with the pLDDT by residue plots a structure prediction by residue plot. This would help to see if the high confidence pLDDT is coming more from confidence in the docking of the peptide or confidence in the structure of the peptide.

      (5) Related to the above comment, pLDDT is insufficient as a metric for assessing antibody-antigen interactions. There is a chance (as is nicely shown in Figure S3C) that AlphaFold can be confident and wrong. Here we see two orange-yellow dots (fairly high confidence) that place the peptide COM far from the true binding region. While running the recommended larger validation above, the authors should also include a peptide RMSD or COM distance metric, to show that the peptide identity is confident, and the peptide placement is roughly correct. These predictions are not nearly as valuable if AlphaFold is getting the right answer for the wrong reasons (i.e. high pLDDT but peptide binding to a non-CDR loop region). Eventual users of the software will likely want to make point mutations or perturb the binding regions identified by the structural predictions (as the authors do in Figure 4).

      Comments on revisions:

      I have read the author's responses and the revised manuscript. The authors did not sufficiently address my comments, nor the fundamental issue with the manuscript.

      By the authors' own admission, many of the results presented in the current version of the manuscript cannot be reproduced without relying on locally saved MSAs. In other words, there is almost no evidence presented that this pipeline will predict antibody-antigen interactions using currently publicly available software. This manuscript is reduced to essentially a case study (N=1) in how one might go about making such predictions coupled with pretty good experimental evidence backing up this singular prediction.

    1. 支持相联方式:4WAY

      将缓存分为多个组(Set),每组中有固定数量的缓存块(Block)。一个内存地址只能映射到特定的组,但可以存储在该组内的任意块中 而其中的4-way 相连方式(4-way set associative)是一种缓存组织方式。 4-way 相连方式是一种权衡性能与成本的缓存设计方案,适用于大多数处理器的 L1 缓存(如 ICache 或 DCache)。它在直接映射缓存和全相连缓存之间提供了折中点,既提升了缓存命中率,又保持了相对较低的硬件复杂性

      include <stdio.h>

      include <stdlib.h>

      include <stdbool.h>

      define CACHE_SIZE 16 // 缓存总块数

      define BLOCK_SIZE 4 // 每组内的块数(4-way)

      define NUM_SETS (CACHE_SIZE / BLOCK_SIZE) // 组数

      typedef struct { int valid; // 有效位 int tag; // 地址标签 int last_used; // LRU 计数 } CacheBlock;

      // 定义缓存(二维数组,每组包含多个块) CacheBlock cache[NUM_SETS][BLOCK_SIZE];

      // 全局计数器用于 LRU 替换策略 int global_time = 0;

      // 计算组索引 int get_set_index(int address) { return address % NUM_SETS; // 简单取模 }

      // 计算标签 int get_tag(int address) { return address / NUM_SETS; // 地址除以组数 }

      // 缓存查找和替换 bool access_cache(int address) { int set_index = get_set_index(address); int tag = get_tag(address);

      // 查找对应的组
      for (int i = 0; i < BLOCK_SIZE; i++) {
          if (cache[set_index][i].valid && cache[set_index][i].tag == tag) {
              // 缓存命中,更新 LRU
              cache[set_index][i].last_used = global_time++;
              return true; // 命中
          }
      }
      
      // 缓存未命中,需要替换
      // 找到需要替换的块(使用 LRU 策略)
      int lru_index = 0;
      for (int i = 1; i < BLOCK_SIZE; i++) {
          if (cache[set_index][i].last_used < cache[set_index][lru_index].last_used) {
              lru_index = i;
          }
      }
      
      // 替换 LRU 块
      cache[set_index][lru_index].valid = 1;
      cache[set_index][lru_index].tag = tag;
      cache[set_index][lru_index].last_used = global_time++;
      return false; // 未命中
      

      }

      int main() { // 初始化缓存 for (int i = 0; i < NUM_SETS; i++) { for (int j = 0; j < BLOCK_SIZE; j++) { cache[i][j].valid = 0; cache[i][j].tag = -1; cache[i][j].last_used = 0; } }

      // 模拟访问
      int addresses[] = {0, 0, 8, 12,4, 8, 20, 12, 4, 32};
      int n = sizeof(addresses) / sizeof(addresses[0]);
      
      for (int i = 0; i < n; i++) {
          int address = addresses[i];
          if (access_cache(address)) {
              printf("Address %d: Cache HIT\n", address);
          } else {
              printf("Address %d: Cache MISS\n", address);
          }
      }
      
      return 0;
      

      }

    Annotators

    1. Als 2010 am Tag des Gedenkens an die Opfer des Nationalsozialismus der israe­lische Staatspräsident Shimon Peres im Bundestag sprach, erhoben sich anschließend alle Abgeordneten – bis auf Sahra Wagenknecht (damals noch Linkspartei) und Buchholz.

      Und Sevim Dagdelen.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1

      Evidence, reproducibility and clarity

      Summary: The manuscript by Yang et al. describes a new CME accessory protein. CCDC32 has been previously suggested to interact with AP2 and in the present work the authors confirm this interaction and show that it is a bona fide CME regulator. In agreement with its interaction with AP2, CCDC32 recruitment to CCPs mirrors the accumulation of clathrin. Knockdown of CCDC32 reduces the amount of productive CCPs, suggestive of a stabilisation role in early clathrin assemblies. Immunoprecipitation experiments mapped the interaction of CCDC42 to the α-appendage of the AP2 complex α-subunit. Finally, the authors show that the CCDC32 nonsense mutations found in patients with cardio-facial-neuro-developmental syndrome disrupt the interaction of this protein to the AP2 complex. The manuscript is well written and the conclusions regarding the role of CCDC32 in CME are supported by good quality data. As detailed below, a few improvements/clarifications are needed to reinforce some of the conclusions, especially the ones regarding CFNDS.

      Response: We thank the referee for their positive comments. In light of a recently published paper describing CCDC32 as a co-chaperone required for AP2 assembly (Wan et al., PNAS, 2024, see reviewer 2), we have added several additional experiments to address all concerns and consequently gained further insight into CCDC32-AP2 interactions and the important dual role of CCDC32 in regulating CME.

      Major comments:

      1) Why did the protein could just be visualized at CCPs after knockdown of the endogenous protein? This is highly unusual, especially on stable cell lines. Could this be that the tag is interfering with the expressed protein function rendering it incapable of outcompeting the endogenous? Does this points to a regulated recruitment?

      Response: The reviewer is correct, this would be unusual; however, it is not the case. We misspoke in the text (although the figure legend was correct) these experiments were performed without siRNA knockdown and we can indeed detect eGFP-CCDC32 being recruited to CCPs in the presence of endogenous protein. Nonetheless, we repeated the experiment to be certain.

      2) The disease mutation used in the paper does not correspond to the truncation found in patients. The authors use an 1-54 truncation, but the patients described in Harel et al. have frame shifts at the positions 19 (Thr19Tyrfs*12) and 64 (Glu64Glyfs*12), while the patient described in Abdalla et al. have the deletion of two introns, leading to a frameshift around amino acid 90. Moreover, to be precisely test the function of these disease mutations, one would need to add the extra amino acids generated by the frame shift. For example, as denoted in the mutation description in Harel et al., the frameshift at position 19 changes the Threonine 19 to a Tyrosine and ads a run of 12 extra amino acids (Thr19Tyrfs*12).

      Response: The label of the disease mutant p.(Thr19Tyrfs∗12) and p.(Glu64Glyfs∗12) is based on a 194aa polypeptide version of CCDC32 initiated at a nonconventional start site that contains a 9 aa peptide (VRGSCLRFQ) upstream of the N-terminus we show. Thus, we are indeed using the appropriate mutation site (see: https://www.uniprot.org/uniprotkb/Q9BV29/entry). The reviewer is correct that we have not included the extra 12 aa in our construct; however as these residues are not present in the other CFNDS mutants, we think it unlikely that they contribute to the disease phenotype. Rather, as neither of the clinically observed mutations contain the 78-98 aa sequence required for AP2 binding and CME function, we are confident that this defect contributed to the disease. Thus, we are including the data on the CCDC32(1-54) mutant, as we believe these results provide a valuable physiological context to our studies.

      3) The frameshift caused by the CFNDS mutations (especially the one studied) will likely lead to nonsense mediated RNA decay (NMD). The frameshift is well within the rules where NMD generally kicks in. Therefore, I am unsure about the functional insights of expressing a disease-related protein which is likely not present in patients.

      Response: We thank the reviewer for bringing up this concern. However, as shown in new Figure S1, the mutant protein is expressed at comparable levels as the WT, suggesting that NMD is not occurring.

      4) Coiled coils generally form stable dimers. The typically hydrophobic core of these structures is not suitable for transient interactions. This complicates the interpretation of the results regarding the role of this region as the place where the interaction to AP2 occurs. If the coiled coil holds a stable CCDC32 dimer, disrupting this dimer could reduce the affinity to AP2 (by reduced avidity) to the actual binding site. A construct with an orthogonal dimeriser or a pulldown of the delta78-98 protein with of the GST AP2a-AD could be a good way to sort this issue.

      Response: We were unable to model a stable dimer (or other oligomer) of this protein with high confidence using Alphafold 3.0. Moreover, we were unable to detect endogenous CCDC32 co-immunoprecipitating with eGFP-CCDC32 (Fig. S6C). Thus, we believe that the moniker, based solely on the alpha-helical content of the protein is a misnomer. We have explained this in the main text.

      Minor comments:

      1) The authors interchangeably use the term "flat CCPs" and "flat clathrin lattices". While these are indeed related, flat clathrin lattices have been also used to refer to "clathrin plaques". To avoid confusion, I suggest sticking to the term "flat CCPs" to refer to the CCPs which are in their early stages of maturation.

      Response: Agreed. Thank you for the suggestion. We have renamed these structures flat clathrin assemblies, as they do not acquire the curvature needed to classify them as pits, and do not grow to the size that would classify then as plaques.

      Significance

      General assessment: CME drives the internalisation of hundreds of receptors and surface proteins in practically all tissues, making it an essential process for various physiological processes. This versatility comes at the cost of a large number of molecular players and regulators. To understand this complexity, unravelling all the components of this process is vital. The manuscript by Yang et al. gives an important contribution to this effort as it describes a new CME regulator, CCDC32, which acts directly at the main CME adaptor AP2. The link to disease is interesting, but the authors need to refine their experiments. The requirement for endogenous knockdown for recruitment of the tagged CCDC32 is unusual and requires further exploration.

      Advance: The increased frequency of abortive events presented by CCDC32 knockdown cells is very interesting, as it hints to an active mechanism that regulates the stabilisation and growth of clathrin coated pits. The exact way clathrin coated pits are stabilised is still an open question in the field.

      Audience: This is a basic research manuscript. However, given the essential role of CME in physiology and the growing number of CME players involved in disease, this manuscript can reach broader audiences.

      Response: We thank the referee for recognizing the 'interesting' advances our studies have made and for considering these studies as 'an important contribution' to 'an essential process for various physiological processes' and able 'to reach broader audiences'. We have addressed and reconciled the reviewer's concerns in our revised manuscript.

      Field of expertise of the reviewer: Clathrin mediated endocytosis, cell biology, microscopy, biochemistry.


      Reviewer #2

      Evidence, reproducibility and clarity

      In this manuscript, the authors demonstrate that CCDC32 regulates clathrin-mediated endocytosis (CME). Some of the findings are consistent with a recent report by Wan et al. (2024 PNAS), such as the observation that CCDC32 depletion reduces transferrin uptake and diminishes the formation of clathrin-coated pits. The primary function of CCDC32 is to regulate AP2 assembly, and its depletion leads to AP2 degradation. However, this study did not examine AP2 expression levels. CCDC32 may bind to the appendage domain of AP2 alpha, but it also binds to the core domain of AP2 alpha. Overall, while this work presents some interesting ideas, it remains unclear whether CCDC32 regulates AP2 beyond the assembly step.

      Response: We thank the reviewer for drawing our attention to the Wan et al. paper, that appeared while this work was under review. However, our in vivo data are not fully consistent with the report from Wan et al. The discrepancies reveal a dual function of CCDC32 in CME that was masked by complete knockout vs siRNA knockdown of the protein, and also likely affected by the position of the GFP-tag (C- vs N-terminal) on this small protein. Thus:

      • Contrary to Wan et al., we do not detect any loss of AP2 expression (see new Figure S3A-B) upon siRNA knockdown. Most likely the ~40% residual CCDC32 present after siRNA knockdown is sufficient to fulfill its catalytic chaperone function but not its structural role in regulating CME beyond the AP2 assembly step.
      • Contrary to Wan et al., we have shown that CCDC32 indeed interacts with intact AP2 complex (Figure S3C and 6B,C) showing that all 4 subunits of the AP2 complex co-IP with full length eGFP-CCDC32. Interestingly, whereas the full length CCDC32 pulls down the intact AP2 complex, co-IP of the ∆78-98 mutant retains its ability to pull down the b2-µ2 hemicomplex, its interactions with α:σ2 are severely reduced. While this result is consistent with the report of Wan et al that CCDC32 binds to the α:σ2 hemi-complex, it also suggests that the interactions between CCDC32 and AP2 are more complex and will require further studies.
      • Contrary to Wan et al., we provide strong evidence that CCDC32 is recruited to CCPs. Interestingly, modeling with AlphaFold 3.0 identifies a highly probably interaction between alpha helices encoded by residues 66-91 on CCDC32 and residues 418-438 on a. The latter are masked by µ2-C in the closed confirmation of the AP2 core, but exposed in the open confirmation triggered by cargo binding, suggesting that CCDC32 might only bind to membrane-bound AP2. Thus, our findings are indeed novel and indicate striking multifunctional roles for CCDC32 in CME, making the protein well worth further study.

      • Besides its role in AP2 assembly, CCDC32 may potentially have another function on the membrane. However, there is no direct evidence showing that CCDC32 associates with the plasma membrane.

      Response: We disagree, our data clearly shows that CCDC32 is recruited to CCPs (Fig. 1B) and that CCPs that fail to recruit CCDC32 are short-lived and likely abortive (Fig. 1C). Wan et al. did not observe any colocalization of C-terminally tagged CCDC32 to CCPs, whereas we detect recruitment of our N-terminally tagged construct, which we also show is functional (Fig. 6F). Further, we have demonstrated the importance of the C-terminal region of CCDC32 in membrane association (see new Fig. S7). Thus, we speculate that a C-terminally tagged CCDC32 might not be fully functional. Indeed, SIM images of the C-terminally-tagged CCDC32 in Wan et al., show large (~100 nm) structures in the cytosol, which may reflect aggregation.

      CCDC32 binds to multiple regions on AP2, including the core domain. It is important to distinguish the functional roles of these different binding sites.

      Response: We have localized the AP2-ear binding region to residues 78-99 and shown these to be critical for the functions we have identified. As described above we now include data that are complementary to those of Wan et al. However, our data also clearly points to additional binding modalities. We agree that it will be important and map these additional interactions and identify their functional roles, but this is beyond the scope of this paper.

      AP2 expression levels should be examined in CCDC32 depleted cells. If AP2 is gone, it is not surprising that clathrin-coated pits are defective.

      Response: Agreed and we have confirmed this by western blotting (Figure S3A-B) and detect no reduction in levels of any of the AP2 subunits in CCDC32 siRNA knockdown cells. As stated above this could be due to residual CCDC32 present in the siRNA KD vs the CRISPR-mediated gene KO.

      If the authors aim to establish a secondary function for CCDC32, they need to thoroughly discuss the known chaperone function of CCDC32 and consider whether and how CCDC32 regulates a downstream step in CME.

      Response: Agreed. We have described the Wan et al paper, which came out while our manuscript was in review, in our Introduction. As described above, there are areas of agreement and of discrepancies, which are thoroughly documented and discussed throughout the revised manuscript.

      The quality of Figure 1A is very low, making it difficult to assess the localization and quantify the data.

      Response: The low signal:noise in Fig. 1A the reviewer is concerned about is due to a diffuse distribution of CCDC32 on the inner surface of the plasma membrane. We now, more explicitly describe this binding, which we believe reflects a specific interaction mediated by the C-terminus of CCDC32; thus the degree of diffuse membrane binding we observe follows: eGFP-CCDC32(FL)> eGFP-CCDC32(∆78-98)>eGFP-CCDC32(1-54)~eGFP/background (see new Fig. S7). Importantly, the colocalization of CCDC32 at CCPs is confirmed by the dynamic imaging of CCPs (Fig 1B).

      In Figure 6, why aren't AP2 mu and sigma subunits shown?

      Response: Agreed. Not being aware of CCDC32's possible dual role as a chaperone, we had assumed that the AP2 complex was intact. We have now added this data in Figure 6 B,C and Fig. S3C, as discussed above.

      Page 5, top, this sentence is confusing: "their surface area (~17 x 10 nm2) remains significantly less than that required for the average 100 nm diameter CCV (~3.2 x 103 nm2)."

      Response: Thank you for the criticism. We have clarified the sentence and corrected a typo, which would definitely be confusing. The section now reads, "While the flat CCSs we detected in CCDC32 knockdown cells were significantly larger than in control cells (Fig. 4D, mean diameter of 147 nm vs. 127 nm, respectively), they are much smaller than typical long-lived flat clathrin lattices (d{greater than or equal to}300 nm)(Grove et al., 2014). Indeed, the surface area of the flat CCSs that accumulate in CCDC32 KD cells (mean ~1.69 x 104 nm2) remains significantly less than the surface area of an average 100 nm diameter CCV (~3.14 x 104 nm2). Thus, we refer to these structures as 'flat clathrin assemblies' because they are neither curved 'pits' nor large 'lattices'. Rather, the flat clathrin assemblies represent early, likely defective, intermediates in CCP formation."

      Significance

      Please see above.(from above: Overall, while this work presents some interesting ideas, it remains unclear whether CCDC32 regulates AP2 beyond the assembly step)

      Response: Our responses above argue that we have indeed established that CCDC32 regulates AP2 beyond the assembly step. We have also identified several discrepancies between our findings and those reported by Wan et al., most notably binding between CCDC32 and mature AP2 complexes and the AP2-dependent recruitment of CCDC32 to CCPs. It is possible that these discrepancies may be due to the position of the GFP tag (ours is N-terminal, theirs is C-terminal; we show that the N-terminal tagged CCDC32 rescues the knockdown phenotype, while Wan et al., do not provide evidence for functionality of the C-terminal construct).

      __Reviewer #3 __

      Evidence, reproducibility and clarity (Required):

      In this manuscript, Yang et al. characterize the endocytic accessory protein CCDC32, which has implications in cardio-facio-neuro-developmental syndrome (CFNDS). The authors clearly demonstrate that the protein CCDC32 has a role in the early stages of endocytosis, mainly through the interaction with the major endocytic adaptor protein AP2, and they identify regions taking part in this recognition. Through live cell fluorescence imaging and electron microscopy of endocytic pits, the authors characterize the lifetimes of endocytic sites, the formation rate of endocytic sites and pits and the invagination depth, in addition to transferrin receptor (TfnR) uptake experiments. Binding between CCDC32 and CCDC32 mutants to the AP2 alpha appendage domain is assessed by pull down experiments. Together, these experiments allow deriving a phenotype of CCDC32 knock-down and CCDC32 mutants within endocytosis, which is a very robust system, in which defects are not so easily detected. A mutation of CCDC32, known to play a role in CFNDS, is also addressed in this study and shown to have endocytic defects.

      Response: We thank the reviewer for their positive remarks regarding the quality of our data and the strength of our conclusions.

      In summary, the authors present a strong combination of techniques, assessing the impact of CCDC32 in clathrin mediated endocytosis and its binding to AP2, whereby the following major and minor points remain to be addressed:

      • The authors show that CCDC32 depletion leads to the formation of brighter and static clathrin coated structures (Figure 2), but that these were only prevalent to 7.8% and masked the 'normal' dynamic CCPs. At the same time, the authors show that the absence of CCDC32 induces pits with shorter life times (Figure 1 and Figure 2), the 'majority' of the pits. Clarification is needed as to how the authors arrive at these conclusions and these numbers. The authors should also provide (and visualize) the corresponding statistics. The same statement is made again later on in the manuscript, where the authors explain their electron microscopy data. Was the number derived from there?

      These points are critical to understanding CCDC32's role in endocytosis and is key to understanding the model presented in Figure 8. The numbers of how many pits accumulate in flat lattices versus normal endocytosis progression and the actual time scales could be included in this model and would make the figure much stronger.

      Response: Thank you for these comments. We understand the paradox between the visual impression and the reality of our dynamic measurements. We have been visually misled by this in previous work (Chen et al., 2020), which emphasizes the importance of unbiased image analysis afforded to us through the well-documented cmeAnalysis pipeline, developed by us (Aguet et al., 2013) and now used by many others (e.g. (He et al., 2020)).

      The % of static structures was not derived from electron microscopy data, but quantified using cmeAnalysis, which automatedly provides the lifetime distribution of CCPs. We have now clarified this in the manuscript and added a histogram (Fig. S4) quantifying the fraction of CCPs in lifetime cohorts 150s (static).

      • In relation to the above point, the statistics of Figure 2E-G and the analysis leading there should also be explained in more detail: For example, what are the individual points in the plot (also in Figures 6G and 7G)? The authors should also use a few phrases to explain software they use, for example DASC, in the main text.

      Response: Each point in these bar graphs represents a movie, where n{greater than or equal to}12. These details have been added to the respective figure legend. We have also added a brief description of DASC analysis in the text.

      • There are several questions related to the knock-down experiments that need to be addressed:

      Firstly, knock-down of CCDC32 does not seem to be very strong (Figure S2B). Can the level of knock-down be quantified?

      Response: We have now quantified the KD efficiency. It is ~60%. This turns out to be fortuitous (see responses to reviewer 2), as a recent publication, which came out after we completed our study, has shown by CRISPR-mediated knockout, that CCD32 also plays an essential chaperone function required for AP2 assembly. We do not see any reduction in AP2 levels or its complex formation under our conditions (see new Supplemental Figure S3), which suggests that the effects of CCDC32 on CCP dynamics are more sensitive to CCDC32 concentration than its roles as a chaperone. Our phenotypes would have been masked by more efficient depletion of CCDC32.

      In page 6 it is indicated that the eGFP-CCDC32(1-54) and eGFP-CCDC32(∆78-98) constructs are siRNA-resistant. However in Fig S2B, these proteins do not show any signal in the western blot, so it is not clear if they are expressed or simply not detected by the antibody. The presence of these proteins after silencing endogenous CCDC32 needs to be confirmed to support Figures 6 and Figures 7, which critically rely on the presence of the CCDC32 mutants.

      Response: Unfortunately, the C-terminally truncated CCDC32 proteins are not detected because they lack the antibody epitope, indeed even the D78-98 deletion is poorly detected (compare the GFP blot in new S1A with the anti-CCDC32 blot in S1B). However, these constructs contain the same siRNA-resistance mutation as the full length protein. That they are expressed and siRNA resistant can be seen in Fig. S2A (now Fig. S1A) blotting for GFP.

      In Figures 6 and 7, siRNA knock-down of CCDC32 is only indicated for sub-figures F to G. Is this really the case? If not, the authors should clarify. The siRNA knock-down in Figure 1 is also only mentioned in the text, not in the figure legend. The authors should pay attention to make their figure legends easy to understand and unambiguous.

      Response: No, it is not the case. Thank you for pointing out the uncertainty. We have added these details to the Figure legends and checked all Figure legends to ensure that they clearly describe the data shown.

      • It is not exactly clear how the curves in Figure 3C (lower panel) on the invagination depth were obtained. Can the authors clarify this a bit more? For example, what are kT and kE in Figure 3A? What is I0? And how did the authors derive the logarithmic function used to quantify the invagination depth? In the main text, the authors say that the traces were 'logarithmically transformed'. This is not a technical term. The authors should refer to the actual equation used in the figure.

      Response: This analysis was developed by the Kirchhausen lab (Saffarian and Kirchhausen, 2008). We have added these details and reference them in the Figure legend and in the text. We also now use the more accurate descriptor 'log-transformed'.

      • In the discussion, the claim 'The resulting dysregulation of AP2 inhibits CME, which further results in the development of CFNDS.' is maybe a bit too strong of a statement. Firstly, because the authors show themselves that CME is perturbed, but by no means inhibited. Secondly, the molecular link to CFNDS remains unclear. Even though CCDC32 mutants seem to be responsible for CFNDS and one of the mutant has been shown in this study to have a defect in endocytosis and AP2 binding, a direct link between CCDC32's function in endocytosis and CFNDS remains elusive. The authors should thus provide a more balanced discussion on this topic.

      Response: We have modified and softened our conclusions, which now read that the phenotypes we see likely "contribute to" rather than "cause" the disease.

      • In Figure S1, the authors annotate the presence of a coiled-coil domain, which they also use later on in the manuscript to generate mutations. Could the authors specify (and cite) where and how this coiled-coil domain has been identified? Is this predicted helix indeed a coiled-coil domain, or just a helix, as indicated by the authors in the discussion?

      Response: See response to Reviewer 1, point 4. We have changed this wording to alpha-helix. The 'coiled-coil' reference is historical and unlikely a true reflection of CCDC32 structure. AlphaFold 3.0 predictions were unable to identify with certainly any coiled-coil structures, even if we modelled potential dimers or trimers; and we find no evidence of dimerization of CCDC32 in vivo. We have clarified this in the text.

      Minor comments

      • In general, a more detailed explanation of the microscopy techniques used and the information they report would be beneficial to provide access to the article also to non-expert readers in the field. This concerns particularly the analysis methods used, for example: How were the cohort-averaged fluorescence intensity and lifetime traces obtained? How do the tools cmeAnalysis and DASC work? A brief explanation would be helpful.

      Response: We have expanded Methods to add these details, and also described them in the main text.

      • The axis label of Figure 2B is not quite clear. What does 'TfnR uptake % of surface bound' mean? Maybe the authors could explain this in more detail in the figure legend? Is the drop in uptake efficiency also accessible by visual inspection of the images? It would be interesting to see that.

      Response: This is a standard measure of CME efficiency. 'TfnR uptake % of surface bound' = Internalized TfnR/Surface bound TfnR. Again, images may be misleading as defects in CME lead to increased levels of TfnR on the cell surface, which in turn would result in more Tfn uptake even if the rate of CME is decreased.

      • Figure 4: How is the occupancy of CCPs in the plasma membrane measured? What are the criteria used to divide CCSs into Flat, Dome or Sphere categories?

      Response: We have expanded Methods to add these details. Based on the degree of invagination, the shapes of CCSs were classified as either: flat CCSs with no obvious invagination; dome-shaped CCSs that had a hemispherical or less invaginated shape with visible edges of the clathrin lattice; and spherical CCSs that had a round shape with the invisible edges of clathrin lattice in 2D projection images. In most cases, the shapes were obvious in 2D PREM images. In uncertain cases, the degree of CCS invagination was determined using images tilted at {plus minus}10-20 degrees. The area of CCSs were measured using ImageJ and used for the calculation of the CCS occupancy on the plasma membrane.

      • Figure 5B: Can the authors explain, where exactly the GFP was engineered into AP2 alpha? This construct does not seem to be explained in the methods section.

      Response: We have added this information. The construct, which corresponds to an insertion of GFP into the flexible hinge region of AP2, at aa649, was first described by (Mino et al., 2020) and shown to be fully functional. This information has been added to the Methods section.

      • Figure S1B: The authors should indicate the colour code used for the structural model.

      Response: We have expanded our structural modeling using AlphaFold 3.0 in light of the recent publication suggesting the CCDC32 interacts with the µ2 subunit and does not bind full length AP2. These results are described in the text. The color coding now reflects certainty values given by AlphaFold 3.0 (Fig. S6B, D).

      • The list of primers referred to in the materials and methods section does not exist. There is a Table S1, but this contains different data. The actual Table S1 is not referenced in the main text. This should be done.

      Response: We apologize for this error. We have now added this information in Table S2.

      __ Significance (Required):__

      In this study, the authors analyse a so-far poorly understood endocytic accessory protein, CCDC32, and its implication for endocytosis. The experimental tool set used, allowing to quantify CCP dynamics and invagination is clearly a strength of the article that allows assessing the impact of an accessory protein towards the endocytic uptake mechanism, which is normally very robust towards mutations. Only through this detailed analysis of endocytosis progression could the authors detect clear differences in the presence and absence of CCDC32 and its mutants. If the above points are successfully addressed, the study will provide very interesting and highly relevant work allowing a better understanding of the early phases in CME with implication for disease.

      The study is thus of potential interest to an audience interested in CME, in disease and its molecular reasons, as well as for readers interested in intrinsically disordered proteins to a certain extent, claiming thus a relatively broad audience. The presented results may initiate further studies of the so-far poorly understood and less well known accessory protein CCDC32.

      Response: We thank the reviewer for their positive comments on the significance of our findings and the importance of our detailed phenotypic analysis made possible by quantitative live cell microscopy. We also believe that our new structural modeling of CCDC32 and our findings of complex and extensive interactions with AP2 make the reviewers point regarding intrinsically disordered proteins even more interesting and relevant to a broad audience. We trust that our revisions indeed address the reviewer's concerns.

      The field of expertise of the reviewer is structural biology, biochemistry and clathrin mediated endocytosis. Expertise in cell biology is rather superficial.


      References:

      Aguet, F., Costin N. Antonescu, M. Mettlen, Sandra L. Schmid, and G. Danuser. 2013. Advances in Analysis of Low Signal-to-Noise Images Link Dynamin and AP2 to the Functions of an Endocytic Checkpoint. Developmental Cell. 26:279-291.

      Chen, Z., R.E. Mino, M. Mettlen, P. Michaely, M. Bhave, D.K. Reed, and S.L. Schmid. 2020. Wbox2: A clathrin terminal domain-derived peptide inhibitor of clathrin-mediated endocytosis. Journal of Cell Biology. 219.

      Grove, J., D.J. Metcalf, A.E. Knight, S.T. Wavre-Shapton, T. Sun, E.D. Protonotarios, L.D. Griffin, J. Lippincott-Schwartz, and M. Marsh. 2014. Flat clathrin lattices: stable features of the plasma membrane. Mol Biol Cell. 25:3581-3594.

      He, K., E. Song, S. Upadhyayula, S. Dang, R. Gaudin, W. Skillern, K. Bu, B.R. Capraro, I. Rapoport, I. Kusters, M. Ma, and T. Kirchhausen. 2020. Dynamics of Auxilin 1 and GAK in clathrin-mediated traffic. J Cell Biol. 219.

      Mino, R.E., Z. Chen, M. Mettlen, and S.L. Schmid. 2020. An internally eGFP-tagged α-adaptin is a fully functional and improved fiduciary marker for clathrin-coated pit dynamics. Traffic. 21:603-616.

      Saffarian, S., and T. Kirchhausen. 2008. Differential evanescence nanometry: live-cell fluorescence measurements with 10-nm axial resolution on the plasma membrane. Biophys J. 94:2333-2342.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The manuscript by Yang et al. describes a new CME accessory protein. CCDC32 has been previously suggested to interact with AP2 and in the present work the authors confirm this interaction and show that it is a bona fide CME regulator. I agreement with its interaction with AP2, CCDC32 recruitment to CCPs mirrors the accumulation of clathrin. Knockdown of CCDC32 reduces the amount of productive CCPs, suggestive of a stabilisation role in early clathrin assemblies. Immunoprecipitation experiments mapped the interaction of CCDC42 to the α-appendage of the AP2 complex α-subunit. Finally, the authors show that the CCDC32 nonsense mutations found in patients with cardio-facial-neuro-developmental syndrome disrupt the interaction of this protein to the AP2 complex. The manuscript is well written and the conclusions regarding the role of CCDC32 in CME are supported by good quality data. As detailed below, a few improvements/clarifications are needed to reinforce some of the conclusions, especially the ones regarding CFNDS.

      Major comments:

      1. Why did the protein could just be visualized at CCPs after knockdown of the endogenous protein? This is highly unusual, especially on stable cell lines. Could this be that the tag is interfering with the expressed protein function rendering it incapable of outcompeting the endogenous? Does this points to a regulated recruitment?
      2. The disease mutation used in the paper does not correspond to the truncation found in patients. The authors use an 1-54 truncation, but the patients described in Harel et al. have frame shifts at the positions 19 (Thr19Tyrfs12) and 64 (Glu64Glyfs12), while the patient described in Abdalla et al. have the deletion of two introns, leading to a frameshift around amino acid 90. Moreover, to be precisely test the function of these disease mutations, one would need to add the extra amino acids generated by the frame shift. For example, as denoted in the mutation description in Harel et al., the frameshift at position 19 changes the Threonine 19 to a Tyrosine and ads a run of 12 extra amino acids (Thr19Tyrfs*12).
      3. The frameshift caused by the CFNDS mutations (especially the one studied) will likely lead to nonsense mediated RNA decay (NMD). The frameshift is well within the rules where NMD generally kicks in. Therefore, I am unsure about the functional insights of expressing a disease-related protein which is likely not present in patients.
      4. Coiled coils generally form stable dimers. The typically hydrophobic core of these structures is not suitable for transient interactions. This complicates the interpretation of the results regarding the role of this region as the place where the interaction to AP2 occurs. If the coiled coil holds a stable CCDC32 dimer, disrupting this dimer could reduce the affinity to AP2 (by reduced avidity) to the actual binding site. A construct with an orthogonal dimeriser or a pulldown of the delta78-98 protein with of the GST AP2a-AD could be a good way to sort this issue.

      Minor comments:

      1. The authors interchangeably use the term "flat CCPs" and "flat clathrin lattices". While these are indeed related, flat clathrin lattices have been also used to refer to "clathrin plaques". To avoid confusion, I suggest sticking to the term "flat CCPs" to refer to the CCPs which are in their early stages of maturation.

      Significance

      General assessment:

      CME drives the internalisation of hundreds of receptors and surface proteins in practically all tissues, making it an essential process for various physiological processes. This versatility comes at the cost of a large number of molecular players and regulators. To understand this complexity, unravelling all the components of this process is vital. The manuscript by Yang et al. gives an important contribution to this effort as it describes a new CME regulator, CCDC32, which acts directly at the main CME adaptor AP2. The link to disease is interesting, but the authors need to refine their experiments. The requirement for endogenous knockdown for recruitment of the tagged CCDC32 is unusual and requires further exploration.

      Advance:

      The increased frequency of abortive events presented by CCDC32 knockdown cells is very interesting, as it hints to an active mechanism that regulates the stabilisation and growth of clathrin coated pits. The exact way clathrin coated pits are stabilised is still an open question in the field.

      Audience:

      This is a basic research manuscript. However, given the essential role of CME in physiology and the growing number of CME players involved in disease, this manuscript can reach broader audiences.

      Field of expertise of the reviewer:

      Clathrin mediated endocytosis, cell biology, microscopy, biochemistry.

    1. Author response:

      We thank all the reviewers for their insightful comments on this work.

      Response to Reviewer #1:

      We greatly appreciate your comments on the general reliability and significance of our work. We fully agree that it would have been ideal to have additional evidence related to the role of PEBP1 in HRI activation. Unfortunately, we have not been able to find phospho-HRI antibodies that work reliably. The literature seems to agree with this as a band shift using total-HRI antibodies is usually used to study HRI activation. However, with the cell lines showing the most robust effect with PEBP1 knockout or knockdown, we are yet to convince ourselves with the band shifts we see. This could be addressed by optimizing phos-tag gels although these gels can be a bit tricky with complex samples such as cell lysates which contain many phosphoproteins.

      To address the interaction between PEBP1 and eIF2alpha more rigorously we were inspired by the insights you and reviewer #2 provided. While we are unable to do further experiments, we now think it would indeed be possible to do this with either using the purified proteins and/or CETSA WB. These experiments could also provide further evidence for the role of PEBP1 phosphorylation. Although phosphorylation of PEBP1 at S153 has been implicated as being important for other functions of PEBP1, we are not sure about its role here. It may indeed have little relevance for ISR signalling.

      For the in vitro thermal shift assay, we have performed two independent experiments. While it appears that there is a slight destabilization of PEBP1 by oligomycin, the ultimate conclusion of this experiment remains incomplete as there could be alternative explanations despite the apparent simplicity of the assay due the fluorescence background by oligomycin only. We now provide a lysate based CETSA analysis which does not display the same PEBP1 stabilization as the intact cell experiment. As for the signal saturation in ATF4-luciferase reporter assay, this is a valid point.

      Response to Reviewer #2:

      We strongly agree that CETSA has a lot of potential to inform us about cellular state changes and this was indeed the starting point for this project. We apologize for being (too) brief with the explanations of the TPP/MS-CETSA approach and we have now added a bit more detail. With regard to the cut-offs used for the mass spectrometry analysis, you are absolutely right that we did not establish a stringent cut-off that would show the specificity of each drug treatment. Our take on the data was that using the p values (and ignoring the fold-changes) of individual protein changes as in Fig 1D, we can see that mitochondrial perturbations display a coordinated response. We now realize that the downside of this representation is that it obscures the largest and specific drug effects. As mentioned in the response to Reviewer #1, we now also think that it would be possible to obtain more evidence for the potential interaction between PEBP1 and eIF2alpha using CETSA-based assays.

      Response to Reviewer #3:

      Thank you for your assessment, we agree that this manuscript would have been made much stronger by having clearer mechanistic insights. As mentioned in the responses to other reviewers above, we aim to address this limitation in part by looking at the putative interaction between PEBP1 and eIF2alpha with orthogonal approaches. However, we do realize that analysis of protein-protein interactions can be notoriously challenging due to false negative and false positive findings. As with any scientific endeavor, we will keep in mind alternative explanations to the observations, which could eventually provide that cohesive model explaining how precisely PEBP1, directly or indirectly, influences ISR signalling.

      Recommendations for the authors:

      Reviewer #1 (Recommendations for the authors): 

      The data overall are very solid, and I would only recommend the following minor changes: 

      (1) Line 187 and line 268: there is perhaps a trend towards slightly increased ATF4-luc reporter with PEBP1-S153D, but it is not statistically significant, so I would tone down the wording here. 

      We now modified this part to "This data is consistent with the modest increase…" .

      (2) The recently discovered SIFI complex (Haakonsen 2024, https://doi.org/10.1038/s41586023-06985-7) regulates both HRI and DELE1 through bifunctional localization/degron motifs. It seems like PEBP1 also contains such a motif, which suggests a potential mechanism for enrichment near mitochondria, perhaps even in response to stress. Maybe the authors could further speculate on this in the discussion. 

      While working on the manuscript, we considered the possibility that PEBP1 function could be related to SIFI complex and concluded that here is a critical difference: while  SIFI specifically acts to turn off stress response signalling, loss of PEBP1 prevents eIF2alpha phosphorylation. We did not however consider that PEBP1 could have a localization/degron motif. Motif analysis by deepmito (busca.biocomp.unibo.it) and similar tools did not identify any conventional mitochondrial targeting signal although we acknowledge that PEBP1 has a terminal alpha-helix which was identified for SIFI complex recognition. We are not sure why you think PEBP1 contains such a motif and therefore are hesitant to speculate on this further in the manuscript.

      (3) Line 358: references 50 and 45 are identical. 

      Thank you for spotting this. Corrected now. 

      (4) Figure S1D: it looks like Oligomycin has a significant background fluorescence, which makes interpretation of these graphs difficult - do you have measurements of the compound alone that can be used to subtract this background from the data? Based on the Tm I would say it does stabilize recombinant PEBP1, and there is no quantification of the variance across the 3 replicates to say there is no difference. 

      You are right, this assay is problematic due to the background fluorescence. The measurements with oligomycin only and subtracting this background results in slightly negative values and nonsensical thermal shift curves. We now additionally show quantification from two different experiments (unfortunately we ran out of reagents for further experiments), and this quantification shows that if anything, oligomycin causes mild destabilization of recombinant PEBP1. We also used lysate CETSA assay which does not show thermal stabilization of PEBP1 by oligomycin, ruling out a direct effect. We attempted to use ferrostatin1 as a positive control as it may bind PEBP1-ALOX protein complex, and it appeared to show marginal stabilization of PEBP1. 

      Reviewer #2 (Recommendations for the authors): 

      I have a few comments for the authors to address: 

      (1) The MS-CETSA experiment is quite briefly described and this could be expanded somewhat. Not clear if multiple biological replicates are used. Is there any cutoff in data analysis based on fold change size (which correlated to the significance of cellular effects), etc? As expected from only one early timepoint (see eg PMID: 38328090), there appear to be a limited number of significant shifts over the background (as judged from Figure S1A). In the Excel result file, however (if I read it right) there are large numbers of proteins that are assigned as stabilized or destabilized. This might be to mark the direction of potential shifts, but considering that most of these are likely not hits, this labeling could give a false impression. Could be good to revisit this and have a column for what could be considered significant hits, where a fold change cutoff could help in selecting the most biologically relevant hits. This would allow Figure 1D to be made crisper when it likely dramatically overestimates the overlap between significant CETSA shifts for these drugs.  

      Fair point, while we focused more on PEBP1, it is important to have sufficient description of the methods. We used duplicate samples for the MS, which is probably the most important point which was absent from the original submission as is now added to the methods. We also added slightly more description on the data analysis. While the AID method does not explicitly use log2 fold changes, it does consider the relative abundance of proteins under different temperature fractions. Since the Tm (melting temperature) for each protein can be at any temperature, we felt that if would be complicated to compare fractions where the protein stability is changed the most and even more so if we consider both significance and log2FC. Therefore, we used this multivariate approach which indicates the proteins with most likely changes across the range of temperatures. To acknowledge that most of the statistically significant changes are not the much over the background as you correctly pointed out, we now add to the main text that “However, most of these changes are relatively small. To focus our analysis on the most significant and biologically relevant changes…” We also agree that it may be confusing that the AID output reports de/stabilization direction for all proteins. In general, we are not big fans of cutoffs as these are always arbitrary, but with multivariate p value of 0.1 it becomes clear that there are only a relatively small number of hits with larger changes. We have now added to the guide in the data sheet that "Primarily, use the adjusted p value of the log10 Multivariate normal pvalue for selecting the overall statistically significant hits (p<0.05 equals  -1.30 or smaller; p<0.01 equals  -2 or smaller)". We have also added to the guide part of the table that “Note that this prediction does not consider whether the change is significant or not, it only shows the direction of change”

      (2) On page 4 the authors state "We reasoned that thermal stability of proteins might be particularly interesting in the context of mitochondrial metabolism as temperature-sensitive fluorescent probes suggest that mitochondrial temperature in metabolically active cells is close to 50{degree sign}C". I don't see the relevance of this statement as an argument for using TPP/CETSA. When this is also not further addressed in the work, it could be deleted.

      Deleted. We agree, while this is an interesting point, it is not that relevant in this paper. 

      (3) To exclude direct drug binding to PEBP1, a thermofluor experiment is performed (Fig S1D). However, the experiment gives a high background at the lower temperatures and it could be argued that this is due to the flouroprobe binding to a hydrophobic pocket of the protein, and that oligomycin at higher concentrations competes with this binding, attenuating fluorescence. These are complex experiments and there could be other explanations, but the authors should address this. An alternative means to provide support for non-binding would be a lysate CETSA experiment, with very short (1-3 minutes) drug exposure before heating. This would typically give a shift when the protein is indicated to be CETSA responsive as in this case. 

      Agree. However, we don't have good means to perform the thermofluor experiments to rule out alternative explanations. What we can say is (as discussed above for reviewer #1, point 4) that quantification from two different experiments shows that oligomycin is does not thermally stabilizing recombinant PEBP1. To complement this conclusion, we used lysate CETSA assay which does not show thermal stabilization of PEBP1 by oligomycin. In this assay we attempted to use ferrostatin1 as a positive control as it may bind PEBP1-ALOX protein complex, and it appeared to show marginal stabilization of PEBP1. But since we lack a robust positive control for these assays, some doubt will inevitably remain.

      (4) The authors appear to have missed that there is already a MS-CETSA study in the literature on oligomycin, from Sun et al (PMID: 30925293). Although this data is from a different cell line and at a slightly longer drug treatment and is primarily used to access intracellular effects of decreased ATP levels induced by oligomycin, the authors should refer to this data and maybe address similarities if any.  

      Apologies for the oversight, the oligomycin data from this paper eluded us at it was mainly presented in the supplementary data. We compared the two datasets and find found some overlap despite the differences in the experimental details. Both datasets share translational components (e.g. EIF6 and ribosomal proteins), but most notably our other top hit BANF1 which we mentioned in the main text was also identified by Sun et al. We have updated the manuscript text as "Other proteins affected by oligomycin included BANF1, which binds DNA in an ATP dependent manner [16], and has also identified as an oligomycin stabilized protein in a previous MS-CETA experiment [23]", citing the Sun et al paper.   

      (5) The confirmation of protein-protein interaction is notoriously prone to false positives. The authors need to use overexpression and a sensitive reporter to get positive data but collect additional data using mutants which provide further support. Typically, this would be enough to confirm an interaction in the literature, although some doubt easily lingers. When the authors already have a stringent in-cell interaction assay for PEBP1 in the CETSA thermal shift, it would be very elegant to also apply the CETSA WB assay to the overexpressed constructs and demonstrate differences in the response of oligomycin, including the mutants. I am not sure this is feasible but it should be straightforward to test. 

      This is a very good suggestion. Unfortunately, due to the time constraints of the graduate students (who must write up their thesis very soon), we are not able to perform and repeat such experiments to the level of confidence that we would like.

      (6) At places the story could be hard to follow, partly due to the frequent introduction of new compounds, with not always well-stated rationale. It could be useful to have a table also in the main manuscript with all the compounds used, with the rationale for their use stated. Although some of the cellular pathways addressed are shown in miniatures in figures, it could be useful to have an introduction figure for the known ISR pathways, at least in the supplement. There are also a number of typos to correct. 

      We agree that there are many compounds used. We have attempted to clarify their use by adding this information into the table of used compounds in the methods and adding an overall schematic to Fig S1G and a note on line 132 "(see Figure 1-figure supplement 1G for summary of drugs used to target PEBP1 and ISR in this manuscript). We have also attempted to remove typos as far as possible.

      (7) EIF2a phosphorylation in S1E does not appear to be more significant for Sodium Arsenite argued to be a positive control, than CCCP, which is argued to be negative. Maybe enough with one positive control in this figure? 

      This experiment was used as a justification for our 30 min time point for the proteomics. By showing the 30 min and 4 h time points as Fig 1G and Figure 1-figure supplement 1F, our point was to demonstrate that the kinetics of phosphorylation and dephosphorylation are relevant. As you correctly pointed out, the stress response induced by sodium arsenite, but also tunicamycin is already attenuated at the 4h time point. We prefer to keep all samples to facilitate comparisons.

      (8) Page 7 reference to Figure S2H, which doesn't exist. Should be S3H.  

      Apologies for the mistake, now corrected to Figure 2-figure supplement 1B.

      (9) Finally, although the TPP labeling of the method is used widely in the literature this is CETSA with MS detection and MS-CETSA is a better term. This is about thermal shifts of individual proteins which is a very well-established biophysical concept. In contrast, the term Thermal Proteome Profiling does not relate to any biophysical concept, or real cell biology concept, as far as I can see, and is a partly misguided term. 

      We changed the term TPP into MS-CETSA, but also include the term TPP in the introduction to facilitate finding this paper by people using the TPP term.

      Reviewer #3 (Recommendations for the authors): 

      Major Issues 

      (1) The one major issue of this work is the lack of a mechanism showing precisely how PEBP1 amplifies the mitochondrial integrated stress response. The work, as it is described, presents data suggesting PEBP1's role in the ISR but fails to present a more conclusive mechanism. The idea of mitochondrial stress causing PEBP1 to bind to eIF2a, amplifying ISR is somewhat vague. Thus, the lack of a more defined model considerably weakens the argument, as the data is largely corollary, showing KO and modulation of PEBP1 definitely has a unique effect on the ISR, however, it is not conclusive proof of what the authors claim. While KO of PEBP1 diminishes the phosphorylation of eIF2a, taken together with the binding to eIF2a, different pathways could be simultaneously activated, and it seems premature to surmise that PEBP1 is specific to mitochondrial stress. Could PEBP1 be reacting to decreased ATP? Release of a protein from the mitochondria in response to stress? Is PEBP1's primary role as a modulator of the ISR, or does it have a role in non-stress-related translation? A cohesive model would tie together these separate indirect findings and constitute a considerable discovery for the ISR field, and the mitochondrial stress field.  

      Thank you for your assessment, we agree that this manuscript would have been much stronger by having clearer mechanistic insights. As with any scientific endeavor, we will keep in mind alternative explanations to the observations, which could eventually provide that cohesive model explaining how precisely PEBP1, directly or indirectly, influences ISR signalling.

      (2) The data relies on the initial identification of PEBP1 thermal stabilization concomitant with mitochondrial ISR induction post-treatment of several small molecules. However, the experiment was performed using a single timepoint of 30 minutes. There was no specific rationale for the choice of this time point for the thermal proteome profiling. 

      The reasoning for this was explicitly stated:  "We reasoned that treating intact cells with the drugs for only 30 min would allow us to observe rapid and direct effects related to metabolic flux and/or signaling related to mitochondrial dysfunction in the absence of major changes in protein expression levels.”

      Minor Issues 

      (1) In Lines 163-166 the authors state "The cells from Pebp1 KO animals displayed reduced expression of common ISR genes (Figure 2F), despite upregulation of unfolded protein response genes Ern1 (Ire1α) and Atf6 genes. This gene expression data therefore suggests that Pebp1 knockout in vivo suppresses induction of the ISR". This statement should be reassessed. While an arm of the UPR does stimulate ISR, this arm is controlled by PERK, and canonically IRE1 and ATF6 do not typically activate the ISR, thus their upregulation is likely unrelated to ISR activation and does not contribute the evidence necessary for this statement. 

      Apologies for the confusion, we aimed to highlight that as there is an increase in the two UPR arms, it is more likely that ISR instead of UPR is reduced. We have now changed the statement to the following:

      "The cells from Pebp1 PEBP1 KO animals displayed reduced expression of common ISR genes (Figure 2F), while there was mild upregulation of the unfolded protein response genes Ern1 (Ire1α) and Atf6 genes. This gene expression data therefore suggests that the reduced expression of common ISR genes is less likely to be mediated by changes in PERK, the third UPR arm, and more likely due to suppression of ISR by Pebp1 knockout in vivo."

      (2) In Lines 169 and 170 the authors state "Western blotting indicated reduced phosphorylation of eIF2α in RPE1 cells lacking PEBP1, suggesting that PEBP1 is involved in regulating ISR signaling between mitochondria and eIF2α". This conclusion is not supported by evidence. A number of pathways could be activated in these knockout cells, and simply observing an increase in p-eIF2α after knocking out PEBP1 does not constitute an interaction, as correlation doesn't mean causation. This KO could indirectly affect the ISR, with PEBP1 having no role in the ISR. While taken together there is enough circumstantial evidence in the manuscript to suggest a role for PEBP1 in the ISR, statements such as these have to be revised so as not to overreach the conclusions that can be achieved from the data, especially with no discernible mechanism.  

      We have now revised this statement by removing the conclusion and stating only the observation:  "Western blotting indicated reduced phosphorylation of eIF2α in RPE1 cells lacking PEBP1 (Fig. 3A)."

    1. Reviewer #2 (Public Review):

      Kanie et al have recently characterized DAP protein CEP89 as important for the recruitment of the ciliary vesicle. Here, they describe a novel interacting partner for CEP89 that can bind membranes and therefore mediates its role in ciliary vesicle recruitment. An initial LAP tag pull-down and mass spectrometry experiment finds NCS-1 and C3ORF14 as CEP89 interactors. This interaction is mapped in the context of the ciliary vesicle formation. From the data presented, it is clear that, upon knockout, the function of these proteins might be compensated by others, as the phenotype can eventually recover over time.

      In terms of the biological significance of this interaction, it would be good to examine (via co-immunoprecipitation) whether the CEP89/NCS-1/C3ORF14 interaction takes place upon serum starvation. Does the complex change?

      Also, for the subdistal appendage localization of NCS-1 and C3ORF14, would this also change upon serum starvation?

      For the ciliation results and the recruitment of IFT88 in CEP89 knockout cell lines, this contradicts previous work from Tanos et al (PMID: 23348840), as well as Hou et al (PMID: 36669498). A parallel comparison using siRNA, a transient knockout system, or a degron system would help understand this. A similar point goes for Figure 4, where the effect on ciliogenesis is minimal in knockout cells, but acute siRNA has been shown to have a stronger phenotype.

      An elegant phenotype rescue is shown in Figure 5. An interesting question would be, how does this mutant and/or the myristoylation affect the recruitment of C3ORF14?

      For the EF-hand mutants, it would be good to use control mutants, from known Ca2+ binding proteins as a control for the experiment shown.

    1. Reviewer #3 (Public review):

      Summary:

      In this report, De Franceschi et al. purify components of the Cdv machinery in archaeon M. sedula and probe their interactions with membrane and with one-another in vitro using two main assays - liposome flotation and fluorescent imaging of encapsulated proteins. This has the potential to add to the field by showing how the order of protein recruitment seen in cells is related to the differential capacity of individual proteins to bind membranes when alone or when combined.

      Strengths:

      Using the floatation assay, they demonstrate that CdvA and CdvB bind liposomes when combined. While CdvB1 also binds liposomes under these conditions, in the floatation assay, CdvB2 lacking its C-terminus is not efficiently recruited to membranes unless CdvAB or CdvB1 are present. The authors then employ a clever liposome assay that generates chained spherical liposomes connected by thin membrane necks, which allows them to accurately control the buffer composition inside and outside of the liposome. With this, they show that all four proteins accumulate in necks of dumbbell-shaped liposomes that mimic the shape of constricting necks in cell division. Taken altogether, these data lead them to propose that Cdv proteins are sequentially recruited to the membrane as has also been suggested by in vivo studies of ESCRT-III dependent cell division in crenarchaea.

      Weaknesses:

      These experiments provide a good starting point for the in vitro study the interaction of Cdv system components with the membrane and their consecutive recruitment. However, several experimental controls are missing that complicate their ability to draw strong conclusions. Moreover, some results are inconsistent across the two main assays which make the findings difficult to interpret.

      (1) Missing controls.

      Various protein mixtures are assessed for their membrane-binding properties in different ways. However, it is difficult to interpret the effect of any specific protein combination, when the same experiment is not presented in a way that includes separate tests for all individual components. In this sense, the paper lacks important controls.

      For example, Fig 1C is missing the CdvB-only control. The authors remark that CdvB did not polymerise (data not shown) but do not comment on whether it binds membrane in their assays. In the introduction, Samson et al., 2011 is cited as a reference to show that CdvB does not bind membrane. However, here the authors are working with protein from a different organism in a different buffer, using a different membrane composition and a different assay. Given that so many variables are changing, it would be good to present how M. sedula CdvB behaves under these conditions.

      Similarly, there is no data showing how CdvB alone or CdvA alone behave in the dumbbell liposome assay. Without these controls, it's impossible to say whether CdvA recruits CdvB or the other way around.

      The manuscript would be much stronger if such data could be added.

      (2) Some of the discrepancies in the data generated using different assays are not discussed.

      The authors show that CdvB2∆C binds membrane and localizes to membrane necks in the dumbbell liposome assay, but no membrane binding is detected in the flotation assay. The discrepancy between these results further highlights the need for CdvB-only and CdvA-only controls.

      (3) Validation of the liposome assay.

      The experimental setup to create dumbbell-shaped liposomes seems great and is a clever novel approach pioneered by the team. Not only can the authors manipulate liposome shape, they also state that this allows them to accurately control the species present on the inside and outside of the liposome. Interpreting the results of the liposome assay, however, depends on the geometry being correct. To make this clearer, it would seem important to include controls to prove that all the protein imaged at membrane necks lie on the inside of liposomes. In the images in SFig3 there appears to be protein outside of the liposome. It would also be helpful to present data to show test whether the necks are open, as suggested in the paper, by using FRAP or some other related technique.

      (4) Quantification of results from the liposome assay.

      The paper would be strengthened by the inclusion of more quantitative data relating to the liposome assay. Firstly, only a single field of view is shown for each condition. Because of this, the reader cannot know whether this is a representative image, or an outlier? Can the authors do some quantification of the data to demonstrate this? The line scan profiles in the supplemental figures would be an example of this, but again in these Figures only a single image is analyzed.

      We would recommend that the authors present quantitative data to show the extent of co-localization at the necks in each case. They also need a metric to report instances in which protein is not seen at the neck, e.g. CdvB2 but not CdvB1 in Fig2I, which rules out a simple curvature preference for CdvB2 as stated in line 182.

      Secondly, the authors state that they see CdvB2∆C recruited to the membrane by CdvB1 (lines 184-187, Fig 2I). However, this simple conclusion is not borne out in the data. Inspecting the CdvB2∆C panels of Fig 2I, Fig3C, and Fig3D, CdvB2∆C signal can be seen at positions which don't colocalize with other proteins. The authors also observe CdvB2∆C localizing to membrane necks by itself (Fig 2E). Therefore, while CdvB1 and CdvB2∆C colocalize in the flotation assay, there is no strong evidence for CdvB2∆C recruitment by CdvB1 in dumbbells. This is further underscored by the observation that in the presented data, all Cdv proteins always appear to localize at dumbbell necks, irrespective of what other components are present inside the liposome. Although one nice control is presented (ZipA), this suggests that more work is required to be sure that the proteins are behaving properly in this assay. For example, if membrane binding surfaces of Cdv proteins are mutated, does this lead to the accumulation of proteins in the bulk of the liposome as expected?

      (5) Rings.

      The authors should comment on why they never observe large Cdv rings in their experiments. In crenarchaeal cell division, CdvA and CdvB have been observed to form large rings in the middle of the 1 micron cell, before constriction. Only in the later stages of division are the ESCRTs localized to the constricting neck, at a time when CdvA is no longer present in the ring. Therefore, if the in vitro assay used by the authors really recapitulated the biology, one would expect to see large CdvAB rings in Figs 1EF. This is ignored in the model. In the proposed model of ring assembly (line 252), CdvAB ring formation is mentioned, but authors do not discuss the fact that they do not observe CdvAB rings - only foci at membrane necks. The discussion section would benefit from the authors commenting on this.

      (6) Stoichiometry

      It is not clear why 100% of the visible CdvA and 100% of the the visible CdvB are shifted to the lipid fraction in 1C. Perhaps this is a matter of quantification. Can the authors comment on the stoichiometry here?

      (7) Significance of quantification of MBP-tagged filaments.

      Authors use tagging and removal of MBP as a convenient, controllable system to trigger polymerisation of various Cdv proteins. However, it is unclear what is the value and significance of reporting the width and length of the short linear filaments that are formed by the MBP-tagged proteins. Presumably they are artefactual assemblies generated by the presence of the tag? Similar Figure 2C doesn't seem a useful addition to the paper.

    1. The <img> tag creates a holding space for the referenced image.

      علامة img تُنشئ مساحة مخصصة لعرض الصورة المشار إليها.

    1. Author response:

      Public Reviews:

      Reviewer #1 (Public review):

      This a comprehensive study that sheds light on how Wag31 functions and localises in mycobacterial cells. A clear link to interactions with CL is shown using a combination of microscopy in combination with fusion fluorescent constructs, and lipid specific dyes. Furthermore, studies using mutant versions of Wag31 shed light on the functionalities of each domain in the protein. My concerns/suggestions for the manuscript are minor:

      (1) Ln 130. A better clarification/discussion is required here. It is clear that both depletion and overexpression have an effect on levels of various lipids, but subsequent descriptions show that they affect different classes of lipids.

      We thank the reviewer for the comments. We will improve Ln130 in the manuscript. The lipid classes that get impacted by the depletion of Wag31 vs overexpression are different. Wag31 is an adaptor protein that interacts with proteins of the ACCase complex (Meniche et al., 2014; Xu et al., 2014) that synthesize fatty acid precursors and regulate their activity (Habibi Arejan et al., 2022).

      The varied response to lipid homeostasis could be attributed to a change in the stoichiometry of these interactions with Wag31. While Wag31 depletion would prevent such interactions from occurring and might affect lipid synthesis that directly depends on Wag31-protein partner interactions, its overexpression would lead to promiscuous interactions and a change in the stoichiometry of native interactions, ultimately modulating lipid synthesis pathways.

      (2) The pulldown assays results are interesting, but links are tentative.

      The interactome of Wag31 was identified through the immunoprecipitation of Flag-tagged Wag31 complemented at an integrative locus in Wag31 mutant background to avoid overexpression artifacts. We used Msm::gfp expressing an integrative copy (at L5 locus) of FLAG-GFP as a control to subtract non-specific interactions. The experiment was performed in biological triplicates, and interactors that appeared in all replicates were selected for further analysis. Although we identified more than 100 interactors of Wag31, we analyzed only the top 25 hits, with a PSM cut-off ≥18 and unique peptides≥5. Additionally, two of Wag31's established interactors, AccD5 and Rne, were among the top five hits, thus validating our data.

      Though we agree that the interactions can either be direct or through a third partner, the fact that we obtained known interactors of Wag31 makes us believe these interactions are genuine. Moreover, we performed pulldown experiments for validation by mixing E. coli lysates expressing His-Wag31 full-length or truncated protein with M. smegmatis lysates expressing FLAG-tagged interacting proteins. The wash conditions used were quite stringent for these pull-down assays—the wash buffer contained 1% Triton X100, eliminating all non-specific and indirect interactions.  However, we agree that we cannot conclusively state that the interactions are direct without purifying the proteins and performing the experiment. We will describe this caveat in the revised manuscript. 

      (3) The authors may perhaps like to rephrase claims of effects lipid homeostasis, as my understanding is that lipid localisation rather than catabolism/breakdown is affected.

      In this manuscript, we are trying to convey that Wag31 is a spatiotemporal regulator of lipid metabolism. It is a peripheral protein that is hooked to the membrane via Cardiolipin and forms a scaffold at the poles, which helps localize several enzymes involved in lipid metabolism.

      Homeostasis is the process by which an organism maintains a steady-state of balance and stability in response to changes.  Depletion of Wag31 not only results in delocalisation of lipids in intracellular lipid inclusions but also leads to changes in the levels of various lipid classes. Advancement in the field of spatial biology underscores the importance of native localization of various biological molecules crucial for maintaining a steady-cell of the cell. Hence, we have used the word “homeostasis” to describe both the changes observed in lipid metabolism.

      Reviewer #2 (Public review):

      Summary

      Kapoor et. al. investigated the role of the mycobacterial protein Wag31 in lipid and peptidoglycan synthesis and sought to delineate the role of the N- and C- terminal domains of Wag31. They demonstrated that modulating Wag31 levels influences lipid homeostasis in M. smegmatis and cardiolipin (CL) localisation in cells. Wag31 was found to preferentially bind CL-containing liposomes, and deleting the N-terminus of the protein significantly decreased this interaction. Novel interactions between Wag31 and proteins involved in lipid metabolism and cell wall synthesis were identified, suggesting that Wag31 recruits proteins to the intracellular membrane domain by direct interaction.

      Strengths:

      (1) The importance of Wag31 in maintaining lipid homeostasis is supported by several lines of evidence.

      (2) The interaction between Wag31 and cardiolipin, and the role of the N-terminus in this interaction was convincingly demonstrated.

      Weaknesses:

      (1) MS experiments provide some evidence for novel protein-protein interactions. However, the pull-down experiments lack a valid negative control.

      We thank the reviewer for the comments. We will include a valid negative control in the experiment. We would choose ~2 mycobacterial proteins that are not a part of our interactome study and perform a similar pull-down experiment with them and a positive control (known interactor of Wag31).

      (2) The role of the N-terminus in the protein-protein interaction has not been ruled out.

      Previously, we attempted to express the N-terminal (1-60 aa) and the C-terminal (60-212 aa) proteins in various mycobacterial shuttle vectors to perform MS/MS experiments. Despite numerous efforts, neither was expressed with the N/C-terminal FLAG tag nor without any tag in episomal or integrative vectors due to the instability of the protein. Eventually, we successfully expressed the C-terminal Wag31 with an N and C-terminal hexa-His tag. However, this expression was not sufficient or stable enough for us to perform Ni affinity pull-down experiments for mass spectrometry.  The N-terminal of Wag31 could not be expressed in M. smegmatis even with N and C-terminal Hexa-His tags.

      To rule out the role of the N-terminal in mediating protein-protein interactions, we plan to attempt to express N-terminal of Wag31with N and C-terminal hexa-His tag in E. coli. If this clone successfully expresses in E. coli, we will perform pull-down experiments as described in Figure 7.

      Reviewer #3 (Public review):

      Summary:

      This manuscript describes the characterization of mycobacterial cytoskeleton protein Wag31, examining its role in orchestrating protein-lipid and protein-protein interactions essential for mycobacterial survival. The most significant finding is that Wag31, which directs polar elongation and maintains the intracellular membrane domain, was revealed to have membrane tethering capabilities.

      Strengths:

      The authors provided a detailed analysis of Wag31 domain architecture, revealing distinct functional roles: the N-terminal domain facilitates lipid binding and membrane tethering, while the C-terminal domain mediates protein-protein interactions. Overall, this study offers a robust and new understanding of Wag31 function.

      Weaknesses:

      The following major concerns should be addressed.

      • Authors use 10-N-Nonyl-acridine orange (NAO) as a marker for cardiolipin localization. However, given that NAO is known to bind to various anionic phospholipids, how do the authors know that what they are seeing is specifically visualizing cardiolipin and not a different anionic phospholipid? For example, phosphatidylinositol is another abundant anionic phospholipid in mycobacterial plasma membrane.

      We thank the reviewer for the comments. Despite its promiscuous binding to other anionic phospholipids, 10-N-Nonyl-acridine orange is widely used to stain Cardiolipin and determine its localisation in bacterial cells and mitochondria of eukaryotes (Garcia Fernandez et al., 2004; Mileykovskaya & Dowhan, 2000; Renner & Weibel, 2011).  This is because it has a stronger affinity for Cardiolipin than other anionic phospholipids with the affinity constant being 2 × 10<sup>6</sup> M<sup>−1</sup> for Cardiolipin association and 7 × 10<sup>4</sup> M<sup>−1</sup> for that of phosphatidylserine and phosphatidylinositol association (Petit et al., 1992). Additionally, there is not yet another stain available for detecting Cardiolipin. Our protein-lipid binding assays suggest that Wag31 preferentially binds to Cardiolipin over other anionic phospholipids (Fig. 4b), hence it is likely that the majority of redistribution of NAO fluorescence that we observe might be contributed by Cardiolipin mislocalization due to altered Wag31 levels, with smaller degree of NAO redistribution intensity coming indirectly from other anionic phospholipids displaced from the membrane due to the loss of membrane integrity and cell shape changes due to Wag31.

      • Authors' data show that the N-terminal region of Wag31 is important for membrane tethering. The authors' data also show that the N-terminal region is important for sustaining mycobacterial morphology. However, the authors' statement in Line 256 "These results highlight the importance of tethering for sustaining mycobacterial morphology and survival" requires additional proof. It remains possible that the N-terminal region has another unknown activity, and this yet-unknown activity rather than the membrane tethering activity drives the morphological maintenance. Similarly, the N-terminal region is important for lipid homeostasis, but the statement in Line 270, "the maintenance of lipid homeostasis by Wag31 is a consequence of its tethering activity" requires additional proof. The authors should tone down these overstatements or provide additional data to support their claims.

      We agree with the reviewer that there exists a possibility for another function of the N-terminal that may contribute to sustaining mycobacterial physiology and survival. We would revise our statements in the paper to accurately reflect the data. Results shown suggest that the tethering activity of the N-terminal region may contribute to mycobacterial morphology and survival. However, additional functions of this region can’t be ruled out. Similarly, the maintenance of lipid homeostasis by Wag31 may be associated with its tethering activity, although other mechanisms could also contribute to this process. 

      • Authors suggest that Wag31 acts as a scaffold for the IMD (Fig. 8). However, Meniche et. al. has shown that MurG as well as GlfT2, two well-characterized IMD proteins, do not colocalize with Wag31 (DivIVA) (https://doi.org/10.1073/pnas.1402158111). IMD proteins are always slightly subpolar while Wag31 is located to the tip of the cell. Therefore, the authors' biochemical data cannot be easily reconciled with microscopic observations in the literature. This raises a question regarding the validity of protein-protein interaction shown in Figure 7. Since this pull-down assay was conducted by mixing E. coli lysate expressing Wag31 and Msm lysate expression Wag31 interactors like MurG, it is possible that the interactions are not direct. Authors should interpret their data more cautiously. If authors cannot provide additional data and sufficient justifications, they should avoid proposing a confusing model like Figure 8 that contradicts published observations.

      In the literature, MurG and GlfT2 have been shown to have polar localization (Freeman et al., 2023; Hayashi et al., 2016; Kado et al., 2023), and two groups have shown slightly sub-polar localization of MurG (García-Heredia et al., 2021; Meniche et al., 2014). Additionally, (Freeman et al., 2023) they showed SepIVA to be a spatio-temporal regulator of MurG. MS/MS analysis of Wag31 immunoprecipitation data yielded both MurG and SepIVA to be interactors of Wag31 (Fig. 3). Given Wag31 also displays polar localisation, it likely associates with the polar MurG. However, since a sub-polar localization of MurG has also been reported, it is possible that they do not interact directly, and another protein mediates their interaction. We will modify the model proposed in Fig. 8 based on the above.

      We agree that for validation of interaction, we performed pulldown experiments by mixing E. coli lysates expressing His-Wag31 full-length or truncated protein with M. smegmatis lysates expressing FLAG-tagged interacting proteins. The wash conditions used were quite stringent for these pull-down assays—the wash buffer containing 1% Triton X100, which eliminates all non-specific and indirect interactions.  However, we agree that we cannot conclusively state that the interactions are direct without purifying the proteins and performing the experiment. We will describe this caveat in the revised manuscript and propose a model reflecting our results.

      References:

      Freeman, A. H., Tembiwa, K., Brenner, J. R., Chase, M. R., Fortune, S. M., Morita, Y. S., & Boutte, C. C. (2023). Arginine methylation sites on SepIVA help balance elongation and septation in Mycobacterium smegmatis. Mol Microbiol, 119(2), 208-223. https://doi.org/10.1111/mmi.15006

      Garcia Fernandez, M. I., Ceccarelli, D., & Muscatello, U. (2004). Use of the fluorescent dye 10-N-nonyl acridine orange in quantitative and location assays of cardiolipin: a study on different experimental models. Anal Biochem, 328(2), 174-180. https://doi.org/10.1016/j.ab.2004.01.020

      García-Heredia, A., Kado, T., Sein, C. E., Puffal, J., Osman, S. H., Judd, J., Gray, T. A., Morita, Y. S., & Siegrist, M. S. (2021). Membrane-partitioned cell wall synthesis in mycobacteria. eLife, 10. https://doi.org/10.7554/eLife.60263

      Habibi Arejan, N., Ensinck, D., Diacovich, L., Patel, P. B., Quintanilla, S. Y., Emami Saleh, A., Gramajo, H., & Boutte, C. C. (2022). Polar protein Wag31 both activates and inhibits cell wall metabolism at the poles and septum. Front Microbiol, 13, 1085918. https://doi.org/10.3389/fmicb.2022.1085918

      Hayashi, J. M., Luo, C. Y., Mayfield, J. A., Hsu, T., Fukuda, T., Walfield, A. L., Giffen, S. R., Leszyk, J. D., Baer, C. E., Bennion, O. T., Madduri, A., Shaffer, S. A., Aldridge, B. B., Sassetti, C. M., Sandler, S. J., Kinoshita, T., Moody, D. B., & Morita, Y. S. (2016). Spatially distinct and metabolically active membrane domain in mycobacteria. Proc Natl Acad Sci U S A, 113(19), 5400-5405. https://doi.org/10.1073/pnas.1525165113

      Kado, T., Akbary, Z., Motooka, D., Sparks, I. L., Melzer, E. S., Nakamura, S., Rojas, E. R., Morita, Y. S., & Siegrist, M. S. (2023). A cell wall synthase accelerates plasma membrane partitioning in mycobacteria. eLife, 12, e81924. https://doi.org/10.7554/eLife.81924

      Meniche, X., Otten, R., Siegrist, M. S., Baer, C. E., Murphy, K. C., Bertozzi, C. R., & Sassetti, C. M. (2014). Subpolar addition of new cell wall is directed by DivIVA in mycobacteria. Proc Natl Acad Sci U S A, 111(31), E3243-3251. https://doi.org/10.1073/pnas.1402158111

      Mileykovskaya, E., & Dowhan, W. (2000). Visualization of phospholipid domains in Escherichia coli by using the cardiolipin-specific fluorescent dye 10-N-nonyl acridine orange. J Bacteriol, 182(4), 1172-1175. https://doi.org/10.1128/JB.182.4.1172-1175.2000

      Petit, J. M., Maftah, A., Ratinaud, M. H., & Julien, R. (1992). 10N-nonyl acridine orange interacts with cardiolipin and allows the quantification of this phospholipid in isolated mitochondria. Eur J Biochem, 209(1), 267-273. https://doi.org/10.1111/j.1432-1033.1992.tb17285.x

      Renner, L. D., & Weibel, D. B. (2011). Cardiolipin microdomains localize to negatively curved regions of Escherichia coli membranes. Proc Natl Acad Sci U S A, 108(15), 6264-6269. https://doi.org/10.1073/pnas.1015757108

      Xu, W. X., Zhang, L., Mai, J. T., Peng, R. C., Yang, E. Z., Peng, C., & Wang, H. H. (2014). The Wag31 protein interacts with AccA3 and coordinates cell wall lipid permeability and lipophilic drug resistance in Mycobacterium smegmatis. Biochem Biophys Res Commun, 448(3), 255-260. https://doi.org/10.1016/j.bbrc.2014.04.116

    1. pgs 34-35 Pa had nickname phrases for Laura and Mary. Pa warmed up next to them by the fire. Pa when home early played a variation of tag called "mad dog". Pa's name is Charles.

    Annotators

  4. notebooksharing.space notebooksharing.space
    1. # Your answers here # Konvertiere die Einheiten (m pro Tag -> mm pro Tag) precipitation = ds['tp'] * 1000 # Konvertiere von Meter auf Millimeter (1m = 1000mm) # Berechne den durchschnittlichen Niederschlag pro Monat monthly_precipitation = precipitation.groupby('time.month').mean(dim='time') # Monate Januar (1) und August (8) months = [1, 8] # Setze das Colormap für die Karte cmap = 'YlGnBu' # Levels für die Farbabstufung levels = [0.5, 1, 2, 3, 4, 5, 7, 10, 15, 20, 40] # Erstelle die Plots für Januar und August untereinander, mit der Robinson-Projektion fig, axs = plt.subplots(2, 1, figsize=(10, 12), subplot_kw={'projection': ccrs.Robinson()}) for i, month in enumerate(months): # Wähle die Achse für den jeweiligen Plot ax = axs[i] # Erstelle die Karte für den entsprechenden Monat data = monthly_precipitation.sel(month=month) # Plot der Niederschlagskarte data.plot(ax=ax, transform=ccrs.PlateCarree(), cmap=cmap, levels=levels, cbar_kwargs={'label': 'Precipitation (mm/day)'}) # Füge Küstenlinien und Gitterlinien hinzu ax.coastlines() ax.gridlines(draw_labels=True, linewidth=0.5, color='gray', linestyle='--') # Setze den Titel je nach Monat ax.set_title(f'Average Daily Precipitation in {["January", "August"][i]}') # Zeige die Plots plt.tight_layout() plt.show()

      Looks good! ;-)

  5. inst-fs-iad-prod.inscloudgate.net inst-fs-iad-prod.inscloudgate.net
    1. When I inquire about gifted and talented (GAT or TAG) programs, many of them instinctively begin to describe, in detail, the differentiated curricu-lum, enrichment opportunities, and vastly different experiences each program entails. Children of color, boys, and students from economically exploited backgrounds are consistently excluded and underrepresented in such programs (Callahan, 2005).

      I found this especially to be true growing up in elementary school, where there were much more kids from underprivileged backgrounds in the non magnet/gifted programs. However, I did not question or understand why this was at such a young age.

    1. Example Chapter for the Open Curriculum Development Model

      Explore equity-minded design strategies and choices in this example chapter! Select a numbered tag to jump to each annotation on the page. Each annotation is accessible to people who use screen reader software.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their general comment and for the critical evaluation of our analyses and results interpretation. Their comments greatly helped us to improve the manuscript.

      • *

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary: An analysis of an Arabidopsis VSP13 presumed lipid transport is provided. The analysis pretty much follows similar studies done on yeast and human homologs. Key findings are the identification of multiple products from the locus due to differential splicing, analysis of lipid binding and transport properties, subcellular location, tissue specific promoter activity, mutant analysis suggesting a role in lipid remodeling following phosphate deprivation, but no physiological or growth defects of the mutants. Major points: The paper is generally written and documented, the experiments are well conducted and follow established protocols. The following major points should be considered:

      1. There are complementary lipid binding assays that should be considered such as liposome binding assays, or lipid/western dot blots. All of these might give slightly different results and may inform a consensus. Of course, non-membrane lipids such as TAG cannot be tested in a liposome assay.

      Concerning lipid transfer proteins (LTPs), it is important to differentiate the lipid binding capacity related to the transport specificity (which lipids are transported by a LTP?) from the lipid binding capacity linked to the targeting of a LTP to a specific membrane (a LTP can bind a specific lipid via a domain distinct from the lipid transfer domain to be targeted in cells, but will not transport this lipid). Both aspects are of high interest to be determined. Our goal here was to focus on the identification of the lipids bound to AtVPS13M1 and to be likely transported, which is why we used a truncation (1-335) corresponding to the N-term part of the hydrophobic tunnel. Liposome binding assays and lipid dot blots are necessary to answer the question of the membrane binding capacity of the protein. We think that this aspect is out of the scope of the current article as it will require to express and purify other AtVPS13M1 domains that are known to bind lipids such as the two PH domains and the C2. This will be the scope of future investigations in our lab.

      Similarly, lipid transfer based only on fluorophore-labeled lipids may be misleading because the fluorophore could affect binding. It is mentioned that the protein in this assay is tethered by 3xHis to the liposomes. Un less I ma missing something, I do not understand how that should work. This needs to be better explained.

      We truly agree with Reviewer 1 that the presence of a fluorophore could affect lipid binding to the protein. In this assay, lipids are labeled on their polar head and it is therefore difficult to conclude about the specificity of our protein in term of transport. This assay is used as a qualitative assay to show that AtVPS13M1(1-335) is able to transfer lipids in vitro, and in the manuscript, we did not make any conclusion about its transport specificity based on this assay, but rather used the binding assay to assess the binding, and likely transport, specificity of AtVPS13M1. FRET-based assay is a well-accepted assay in the lipid transfer community to easily probe lipid transport in vitro and has been used in the past to assess transfer capacity of different proteins, including for VPS13 proteins (for examples, see (Kumar et al., 2018; Hanna et al., 2022; Valverde et al., 2019)).

      To be able to transfer lipids from one liposome to another, both liposomes have to be in close proximity. Therefore, we attached our protein on donor acceptors, to favor the transport of the fluorescent lipids from the donor to the acceptor liposomes. Then, we progressively increased acceptor liposomes concentration to favor liposome proximity and the chance to have lipid transfer. We added a scheme on Figure 3B of the revised version of the manuscript to clarify the principle of the assay. In addition, we provided further control experiments suggested by Reviewers 2 and 3 showing that the fluorescence signal intensity depend on AtVPS13M1(1-335) protein concentration and that no fluorescence increase is measured with a control protein (Tom20.3) (see Figure 3C-D of the revised manuscript).

      The in vivo lipid binding assay could be obscured by the fact that the protein was produced in insect cells and lipid binding occurs during the producing. What is the evidence that added plants calli lipids can replace lipids already present during isolation.

      Actually we don’t really know whether the insect cells lipids initially bound to AtVPS13M1(1-335) are replaced by calli lipids or whether they bound to still available lipid binding sites on the protein. But we have two main lines of evidence showing that our purified protein can bind plant lipids even in the presence of insect cells lipids: 1) our protein can bind SQDG and MGDG, two plants specific lipids, and 2) as explained p.8 (lines 243-254), lipids coming from both organisms have a specific acyl-chain composition, with insect cells fatty acids mainly composed of C16 and C18 with 0 or 1 unsaturation whereas plant lipids can have up to 3 unsaturations. By analyzing and presenting on the histograms lipid species from insect cells, calli and those bound to AtVPS13M1(1-335), we were able to conclude that for all the lipid classes besides PS, a wide range of lipid species deriving from both organisms was bound to our protein. The data about the lipid species bound to AtVPS13M1(1-335) are presented in Figure 2E and S2.

      The effects on lipid composition of the mutants are not very drastic from what I can tell. Furthermore, how does this fit with the lipid composition of mitochondria where the protein appears to be mostly located?

      It is true that lipid composition variations in the mutants are not drastic but still statistically significant. As a general point in the field of lipid transfer, it is not very common to have major changes in total lipidome on single mutants of lipid transfer proteins because of a high redundancy of lipid transport pathway in cells. This is particularly true for VPS13 proteins, as exemplified by multiple studies. Major lipid phenotypes can be revealed in specific conditions, such as phosphate starvation in our case, or when looking at specific organelles or specific tissues and/or developmental stages. This is explained and illustrated by examples in the discussion part p. 16 (line 526-532). In addition, as suggested by Reviewer 3, we performed further lipid analysis on calli and also on rosettes under Pi starvation and found a similar trend (Figure 4 and S4 of the revised version of the manuscript). Thus, we believe that, even if not drastic, these variations during Pi starvation are a real phenotype of our mutants.

      As we found that our protein is located at the mitochondrial surface, we agree that Reviewer 1’s suggestion to perform lipidomic analyses on isolated mitochondria will be of high interest but this will be the scope of future studies that we will performed in our lab. First, we would like to identify all the organelles at which AtVPS13M1 is localized before performing subfractionations of these different organelles from the same pool of cell cultures grown in presence or absence of phosphate.

      For the localization of the fusion protein, has it been tested whether the furoin is functional? This should be tested (e.g. by reversion of lipid composition).

      As we did not observe major developmental phenotypes in our mutants, complementation should be indeed tested by performing lipidomic analyses in calli or plants grown in presence or absence of Pi, which is a time-consuming and expensive experiment. Because we used the fusions mainly for tissue expression study and subcellular localization and not for functional analyses, we believe that this is not an essential control to be performed for this work.

      It is speculated that different splice forms are located to different compartments. Can that be tested and used to explain the observed subcellular location patterns?

      Indeed some splice forms can modify the sequence of domains putatively involved in protein localization. This could be tested by producing synthetic constructs with one specific exon organization, which is challenging according to the size of AtVPS13M1 cDNA (around 12kb). In addition, our long-read sequencing experiment and PCR analyses revealed the existence of six transcripts, a major one representing around 92% and the five others representing less than 2.5% (Figure 1D). Among the five less abundant transcripts, four produce proteins with a premature stop codon and are likely to arise from splicing defects as explained in the discussion part p. 15 (lines 488-496). One produces a full-length protein with an additional loop in the VAB domain but because of the low abundance of this alternative transcript (1.4%), we believe it does not contribute significantly to the major localization we observed in plants and did not attend to analyze its localization.

      GUS fusion data only probe promoter activity but not all levels of gene expression. That caveat should be discussed.

      We are aware of this drawback and that is the reason why we fused the GUS enzyme directly to our protein expressed under its native locus (i.e. with endogenous promoter and exons/introns) as depicted in Figure 5A. Therefore, our construction allows to assess directly AtVPS13M1 protein level in plant tissues.

      Minor points: 1. Extraplastidic DGDG and export from chloroplasts following phosphate derivation was first reported in PMID: 10973486.

      We added this reference in the text.

      Check throughout the correct usage of gene expression as genes are expressed and proteins produced.

      Many thanks for this remark, we modified the text accordingly

      In general, the paper is too long. Redundancies between introduction, results and discussion should be removed to streamline.

      We reduced the text to avoid redundancy.

      I suggest to redraw the excel graphs to increase line thickness and enlarge font size to increase presentation and readability.

      We tried as much as we can to enlarge graphs and font size increasing readability.

      Reviewer #1 (Significance (Required)):

      Significance: Interorganellar lipid trafficking is an important topic and especially under studied in plants. Identifying components involved represents significant progress in the field. Similarly, lipid remodeling following phosphate derivation is an important phenomenon and the current advances our understanding.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary: The manuscript "AtVPS13M1 is involved in lipid remodelling in low phosphate and is located at the mitochondria surface in plants" by Leterme et al. identifies the protein VPS13M1 as a lipid transporter in Arabidopsis thaliana with important functions during phosphate starvation. The researchers were able to localise this protein to mitochondria via GFP-targeting in Arabidopsis. Although VPS13 proteins are well described in yeast and mammals, highlighting their importance in many vital cellular processes, there is very little information on them in plants. This manuscript provides new insights into plant VPS13 proteins and contributes to a better understanding of these proteins and their role in abiotic stress responses, such as phosphate starvation.

      Major points: - Please describe and define the domains of the VPS13M1 protein in detail, providing also a figure for that. Figure 1 is mainly describing possible splice variants, whereas the characteristics of the protein are missing.

      We have added information on AtVPS13M1 domain organization in the introduction (p.4, lines 103-109) and referred to Figure 1A that described protein domain organization. We did not added too much details as plant VPS13 protein domains organization was extensively described in two previous studies cited several times in the manuscript (Leterme et al., 2023; Levine, 2022).

      • Please compare the expression level of VPS13M1 in the presence and in the absence of phosphate.

      Many thanks for this suggestion. We performed qRT-PCR analyses of AtVPS13M1 from mRNA extracted from calli grown six days in presence and absence of phosphate. The results obtained did not reveal variations in mRNA level. The results were added in Figure S1A of the revised version of the manuscript and discussed in p.5 (lines 154-156).

      • Page 9, second paragraph: Here, the lipid transport capability of AtVPS13M1 is described. Varying concentrations of this recombinant protein should be used in this test. Further, it is not highlighted, that a truncated version of VSP13M1 is able to transport lipids. This is surprising, since this truncated version is less than 10% of the total protein (only aa 1-335).

      We agree with reviewer 2 that increasing protein concentration is an important control to perform. We included an experiment with an increasing quantity of protein (2X and 4X) in the revised version of the manuscript and showed that the signal intensity increased faster when protein concentration is higher (Figure 3D of the revised manuscript). As requested by Reviewer 3, we also included a negative control with Tom20.3 to show that the signal increase after the addition of AtVPS13M1(1-335) is specific to this protein (Figure 3C of the revised manuscript).

      The transport ability of the N-terminal part of VPS13 was demonstrated in yeast and mammals VPS13D (Kumar et al., 2018; Wang et al., 2021). We highlighted this p. 7 (lines 213-218) of the revised version of the manuscript. This is explained by the inherent structure of VPS13 proteins that are composed of several repeats of the same domain type called RBG (for repeating β-groove), each forming a β-sheet with a hydrophobic surface. The higher the number of RBG repeats, the longer the hydrophobic tunnel is. The (1-335) N-terminal region corresponds to two RBG unit repeats forming a “small” tunnel able to bind and transfer lipids. The number of RBG repeats has influence on the quantity of lipids bound per protein in vitro, the longest the protein is, the highest the number of lipid molecules bound is (Kumar et al., 2018), but the effect on protein length on in vitro lipid transfer capacity has not been investigated yet to the best of our knowledge.

      • Also, for phenotype analysis, T-DNA insertion mutants are used that still contain VPS13M1 transcripts. Although protein fragments where not detected by proteomic analysis, this might be due to low sensitivity of the proteomic assay. Further the lipid transport domain of VPS13M1 (aa 1-335) might not be affected by the T-DNA insertions at all. Here more detailed analysis needs to be done to prove that indeed loss-of protein function occurs in the mutants.

      We do not have other methods than proteomic to test whether our mutants are KO or not. We tried unsuccessfully to produce antibodies. Mass spectrometry is the most sensitive method but the absence of detection indeed does not mean the absence of the protein. From proteomic data, we can conclude that at least, our mutants present a decrease in AtVPS13M1 protein level, thus we called them “knock down” in the revised version of the manuscript and added the following sentence p. 9 (lines 297-300): “As the absence of detection of a protein by mass spectrometry-based proteomics does not allow us to strictly claim the absence of this protein in the sample, we concluded that AtVPS13M1 expression in both atvps13m1-1 and atvps13m1-4 was below the detection limit and consider them as knock down (KD) for AtVPS13M1.”

      • Localisation in mitochondria: As the Yepet signal is very weak, a control image of not transfected plant tissue needs to be included. Otherwise, it might be hard to distinguish the Yepet signal from background signal. The localisation data presented in Figure 5 does not allow the conclusion that VPS13M1 is localized at the surface of mitochondria as stated in the title. It only indicates (provided respective controls see above) that VPS13M1 is in mitochondria. Please provide more detailed analysis such as targeting to tobacco protoplasts, immunoblots or in vitro protein import assays. Also test +Pi vs. -Pi to see if VPS13M1 localisation is altered in dependence of Pi.

      Indeed our Yepet signal is not very strong but on the experiments we performed on Col0 non-transformed plants, we did not very often see fluorescence background in the leaves’ vascular tissue, that is why we focused our study on this tissue. We sometimes observed some background signals in some cells that are clearly different from AtVPS13M1-3xYepet signals and never co-localized with mitochondria. Examples of these aspecific signals are presented in Figure S6E of the revised version of the manuscript.

      We agree with reviewer 2 that our confocal images suggested, but not demonstrated, a localization at the surface of mitochondria. To confirm the localization, we generated calli cell cultures from AtVPS13M1-3xYepet lines and performed subcellular fractionations and western blot analyses confirming that AtVPS13M1 was indeed enriched in mitochondria and also in microsomal fractions (Figure 6G of the revised version). Then we performed mild proteolytic digestion of the isolated mitochondria with thermolysin and show that AtVPS13M1 was degraded, as the outer membrane protein Tom20.3, but not the inner membrane protein AtMic60, showing that AtVPS13M1 is indeed at the surface of mitochondria (Figure 5H of the revised manuscript). We believe that this experiment, in addition to the confocal images showing a signal around mitochondria, convincingly demonstrates that AtVPS13M1 is located at the surface of mitochondria.

      The localization of AtVPS13M1 under Pi starvation is a very important question that we tried to investigate without success. Indeed, we intended to perform confocal imaging on seedlings grown in liquid media to easily perform Pi starvation as described for the analysis of AtVPS13M1 tissue expression with β-glucuronidase constructs. However, the level of fluorescence background was very high in seedlings and no clear differences between non-transformed and AtVPS13M1-3xYepet lines were observed, even in root tips where the protein is supposed to be the most highly expressed according to β-glucuronidase assays. Example of images obtained are presented in Figure R1. We concluded that the level of expression of our construct was too low in seedlings. The constructions of lines with a higher AtVPS13M1 expression level, by changing the promotor, to better analyze AtVPS13M1 in different tissues or in response to Pi starvation will be the scope of future work in our laboratory in order to investigate AtVPS13M1 localization under low Pi.

      Phenotype analysis needs to be done under Pi stress and not under cold stress! Further, root architecture and root growth should also be done under Pi depletion. Here the title is also misleading, it is not at all clear why the authors switch from phosphate starvation to cold stress.

      In the revised version of the manuscript, we analyzed the seedlings root growth of two mutants (atvps13m1-3 and m1-4) under low Pi and did not notice significant differences (Figure 7E, S7D of the revised version). We analyzed growth under cold stress because this stress also promotes remodeling of lipids, but we agree that it goes beyond the scope of this article that is focused on Pi starvation and we removed this part from the revised manuscript.

      Minor points: Page 3, line 1: what does the abbreviation VPS stand for?

      The definition of VPS (Vacuolar Protein Sorting) was added.

      Page 3, line 1: change "amino acids residues" to "amino acid residues"

      This was done.

      Page 3, line 8 - 12: please rewrite this sentence. You write, that because of their distribution VPS13 proteins do exhibit many important physiological roles. The opposite is true: They are widely distributed in the cell because of their involvement in many physiological processes.

      We changed the sentence to “ VPS13 proteins localize to a wide variety of membranes and membrane contact sites (MCSs) in yeast and human (Dziurdzik and Conibear, 2021). This broad distribution on different organelles and MCSs is important to sustain their important roles in numerous cellular and organellar processes such as meiosis and sporulation, maintenance of actin skeleton and cell morphology, mitochondrial function, regulation of cellular phosphatidylinositol phosphates level and biogenesis of autophagosome and acrosome (Dziurdzik and Conibear, 2021; Hanna et al., 2023; Leonzino et al., 2021).”

      Page 6, line6: change "cDNA obtained from A. thaliana" to "cDNA generated from A. thaliana.

      This was done.

      Page 6, line 10: change" 7.6kb" to "7.6 kb"

      This was done.

      Page 7: address this question: can the isoforms form functional VPS13 proteins? This might help to postulate whether these isoforms are a result of defective splicing events.

      We addressed this aspect in the discussion p.15 at lines 486-502.

      Figure 2 B: Change "AtVPS13M1"to "AtVPS13M1(1-335)"

      This was done.

      Figure 2, legend: -put a blank before µM in each case.

      This was done.

      -Change 0,125µM to 0.125 µM

      This was done.

      -what does "in absence (A-0µM)" mean?

      This means that the Acceptor liposomes are at 0 µM. To clarify, we changed it to “Acceptor 0 µM” in the revised version of the manuscript (Figure 3C).

      -Which statistical analysis was employed?

      We performed a non-parametric Mann-Whitney test in the revised version of the manuscript. This was indicated in the legend.

      -Further, rewrite the sentence "Mass spectrometry (MS) analysis of lipids bound to AtVPS13M1(1-335) or Tom20 (negative control) after incubation with calli total lipids. Results are expresses in nmol of lipids per nmol of proteins (C) or in mol% (D)". -"C" and "D" are not directly comparable, as in "C" no Tom20 was used and in "C" no insect cells were used.

      -Further, in "D" the experimental setup is not clear. AtVPS13(1-335) is supposed to be purified protein after incubation with calli lipids (figure 2, A). Further, in the same figure, lipid composition of "insect cells" and "calli-Pi" are compared àwhy? Please clarify this.

      C and D are two different representations of the same results providing different types of information. In C., the results are expressed in nmol of lipids / nmol of proteins to assess 1) that the level of lipids found in AtVPS13M1(1-335) purifications is significantly higher than what we can expect from the background (assessed using Tom20) and 2) what are the classes of lipids that associate or not to AtVPS13M1(1-335). In D. the lipid distribution in mol% is presented for AtVPS13M1(1-335) as well as for total extracts from calli and insect cells to be able to compare if one lipid class is particularly enriched or not in AtVPS13M1(1-335) purifications compared to the initial extracts with which the protein was incubated. As an example, it allows to deduce that the absence of DGDG detected in the AtVPS13M1(1-335) purifications is not linked to a low level of DGDG in the calli extract, because it represented around 15 mol%, but likely to a weak affinity of the protein for this lipid. We did not represent the Tom20 lipid distribution on this graph because it represents background of lipid binding to the purification column and might suggest that Tom20 binds lipids. We changed the legend in this way and hope that it is clearer now: “C-D. Mass spectrometry (MS) analysis of lipids bound to AtVPS13M1(1-335) or Tom20 (negative control) after incubation with calli total lipids and repurification. Results are expresses in nmol of lipids per nmol of proteins in order to analyze the absolute quantity of the different lipid classes bound to AtVPS13M1(1-335) compared to Tom20 negative control (C), and in mol% to assess the global distribution of lipid classes in AtVPS13M1(1-335) purifications compared to the total lipid extract of insect cells and calli (D).”

      Figure 3: -t-test requires a normal distribution of the data. This is not possible for an n=3. Please use an adequate analysis.

      We performed more replicates and used non-parametric Mann-Whitney analyses in the revised version of the manuscript.

      -Please clarify the meaning of the letters on the top of the bars in the legend.

      This corresponded to the significance of t-tests performed in the first version of the manuscript that were reported in Table S3. As in the new version we performed Mann-Whitney tests, we highlighted the significance by stars and in the figure legends.

      Please, make it clear that two figures belong to C.

      This was clarified in the legend.

      -Reorganise the order of figure 3 (AàBàCàD)

      Because of the configuration of the different histograms presented in the figure, we were not able to change the order but we believed that the graphs can be easily red this way.

      Page 10, 3. Paragraph: since the finding, that no peptides were found in the VSP13M1 ko lines, although transcription was not altered, is surprising, please include the proteomic data in the supplement

      Proteomic data were deposited on PRIDE with the identifier PXD052019. They will remain not publicly accessible until the acceptance of the manuscript.

      Page 11, line 17: The in vitro experiments showed a low affinity of VSP13M1 towards galactolipids. It is further claimed that this is consistent with the finding of the AtVSP13M1 Ko line in vivo, that in absence of PI, no change in DGDG content could be observed. However, the "absence" of VSP13M1 in vivo might still result in a bigger VSP13M1 protein, than the truncated form (1-335) used for the in vitro experiments

      It is true that our in vitro experiments were performed only with a portion of AtVPS13M1 and that the length of the protein could influence protein binding specificity. We removed this assessment from the manuscript.

      Page 13, lane 8: you should reconsider the use of a triple Yepet tag: If two or more identical fluorescent molecules are in close proximity, their fluorescence emission is quenched, which results in a weak signal (as the one that you obtained). See: Zhuang et al. 2000 (PNAS) Fluorescence quenching: A tool for single-molecule protein-folding study

      Many thanks to point this paper. We use a triple Yepet because AtVPS13M1 has a very low level of expression and because this strategy was used successfully to visualize proteins for which the signal was below the detection level with a single GFP (Zhou et al., 2011). The quenching of the 3xYepet might also depend on the conformation they adopt on the targeting protein.

      Page 13, line 14: change 1µm to 1 µm

      This was done.

      Page 13, line 29: please reduce the sentence to the first part: if A does not colocalize with B, it is not necessary to mention that B does not colocalise with A.

      The sentence was modified accordingly.

      Page 14, 2. Paragraph: it is not conclusive that phenotype analysis is suddenly conducted with plants under cold stress, since everything was about Pi-starvation and the role of VSP13M1. Lipid remodelling under Pi stress completely differs from the lipid remodelling under cold stress.

      We eliminated this part in the revised version of the manuscript.

      Page 14, line 20: change figure to Figure

      This was done.

      Page 07, line 17: change artifact to artefact

      This was done.

      Reviewer #2 (Significance (Required)):

      General assessment: The paper is well written and technically sound. However, some points could be identified, that definitely need a revision. Overall, we got the impression that so far, the data gathered are still quite preliminary and need some more detailed investigations prior to publication (see major points).

      Advance: The study definitely fills a gap of knowledge since not much is known on the function of plant VPS13 proteins so far.

      Audience: The study is of very high interest to the plant lipid community but as well of general interest for Plant Molecular Biology and intracellular transport.

      Our expertise: Plant membrane transport and lipid homeostasis.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The manuscript by Leterme et al. (2024) describes the characterization of VPS13M1 from Arabidopsis. VPS13 proteins have been analyzed in yeast and animals, where they establish lipid transfer connections between organelles, but not much is known about VPS13 proteins in plants. First, different splicing forms were characterized, and the form A was identified as the most relevant one with 92% of the transcripts. The protein (just N-terminal 335 amino acids out of ca. 3000 amino acids) was expressed in insect cells and purified. Next, the protein was used for lipid binding assays with NBD-labeled lipids followed by analysis in polyacrylamide gel electrophoresis. VPS13M1 bound to PC, PE, PS and PA. Then, the protein from insect cells was incubated with Arabidopsis callus lipids, and lipids bound to VPS13M1 analyzed by LC-MS/MS. Lipid transfer between liposomes was measured by the change in fluorescence in donor liposomes derived from two labeled lipids after addition of the protein caused by lipid transfer and dilution to acceptor liposomes. T-DNA insertion mutants were isolated and the lipids measured in callus derived from these mutants. Protein localization in different plant organs was recorded with a GUS fusion construct transferred into transgenic plants. The protein was localized to mitochondria using a VPS13M1-Yepet fusion construct transferred into mutant plants. The mutant plants show no visible difference to wild type, even when the plants were grown under stress conditions like low temperature. The main message of the title is that VPS13M1 localizes to the mitochondria which is well documented, and it is involved in lipid remodeling under low phosphate conditions.

      The lipid transfer assay shown in Figure 2F lacks a negative control. This would be the experiment with donor and acceptor liposomes in the presence of another protein like Tom20.

      Many thanks for this suggestion. In the revised version of the manuscript, we performed a fluorescent lipid transport assay with Tom20.3 in the presence of 25 µM of donor liposomes and 1.5 mM of acceptor liposomes, the condition for which we observed a maximum of transport for AtVPS13M1(1-335). As expected, no fluorescence increase was observed. The results are presented in the Figure 3C of the revised manuscript.

      The lipid data (Fig. 3 and Fig. S4) do not sufficiently support the second claim, i.e. that the protein is involved in lipid remodeling under low P. Data in Fig. 3C are derived from only 3 replicates and in Fig. S4 from only 2 replicas with considerable error bars. Having only 2 replicates is definitely not sufficient. Fig. 3C shows a suppression in the decrease in PE and PC at 4 d of P deprivation (significant for two mutants for PE, for only one for PC). Fig. S4A shows suppression of the decrease in PC at 6 d after P deprivation (significant for both mutants), but no significant effect on PE. Fig. 4SB shows no significant change in PE or PC at -P after 8 d of P deprivation. The data are not consistent. There are also problems with the statistics in Fig. 3 and Fig. S4. The authors used T-test, but place letters a, b, c on top of the bars. Usually, asterisks should be used to indicate significant differences. Data indicate medians and ranges, not mean and SD. In Fig. S4, how can you indicate median and range if you have only 2 replicates? Why did the authors use callus for lipid measurements? Why not use leaves and root tissues? What does adjusted nmol mean? What does the dashed line at 1.05 on the y axis mean? Taken together, I suggest to repeat lipid measurements with leaves and roots from plantets grown under +P and -P conditions in tissue culture with 5 replcates. Significant differences can be analyzed on the level of absolute (nmol per mg FW/DW) or relative (%) amounts.

      Here are our answers to concerns about the design of our lipidomics experiments:

      We used calli for lipid measurement because it is very easy to control growth conditions and to performed phosphate starvation from this cell cultures. The second reason is that it is a non-photosynthetic tissue with a high level of phospholipids and a low level of galactoglycerolipids and it is easier to monitor the modification of the balance phospholipids/galactoglycerolipids in this system. The lipid analysis on calli at 4 days of growth in presence or absence of Pi were performed on 3 biological replicates but on two different mutants (atvps13m-1 and m1-3) and we drew our conclusions based on variations that were significant for both mutants. In the revised version of the manuscript, we performed further lipidomic analyses on calli from Col0 and another mutant (atvps13m1-2) after 6 days of growth in presence or absence of Pi (Figure 4E, S4A-C, n=4-5) and added new data on a photosynthetic tissue (rosettes) from Col0 and atvps13m1-3 mutant. For rosettes analysis, seeds were germinated 4 days in plates with 1 mM Pi and then transferred on plates with 1 mM or 5 µM of Pi. Rosettes were harvested and lipids analyzed after 6 days (Figure 4F-G, S4D, n=4-5). All the data were represented with medians and ranges because we believe that median is less sensitive to extreme values than mean and might better represent what is occurring. Ranges highlight the minimal and maximal value of the data analyzed and we believe it is a representative view of the variability we obtained between biological samples.

      Lipid measurement are done by mass spectrometry. As it was already reported, mass spectrometry quantification is not trivial as the intensity of the response depends on the nature of the molecule (for a review, see (Jouhet et al., 2024)). To counteract this ionisation problem, we developed a method with an external standard that we called Quantified Control (QC) corresponding to an A. thaliana callus lipid extract for which the precised lipid composition was determined by TLC and GC-FID. All our MS signals were “adjusted” to the signal of this QC as described in (Jouhet et al., 2017). Therefore our lipid measurement are in adjusted nmol. In material and method we modified the sentence accordingly p22 lines 720-723: “Lipid amounts (pmol) were adjusted for response differences between internal standards and endogenous lipids and by comparison with a quality control (QC).” This allows to represent all the lipid classes on a same graph and to have an estimation of the lipid classes distribution. To assess the significance of our results, we used in the revised version of the manuscript non-parametric Mann-Whitney tests and added stars representing the p-value on charts. This was indicated in the figure legends.

      Here are our answers to concerns about the interpretation of our lipidomics experiments:

      To summarize, in the revised version of the manuscript, lipid analyses were performed in calli from 3 different mutants (two at day 4, one at day 6) and in the rosettes from one of these mutants. All the results are presented in Figure 4 and S4. In all the experiments, we found that in +Pi, there is no major modifications in the lipid content or composition. In –Pi, we found that the total glycerolipid content is always higher in the mutant compared to the Col0, whatever the tissue or mutant considered (Figure 4A and S4A, D). In calli, this higher increase in lipid content is mainly due to an accumulation of phospholipids and in rosettes, of galactolipids. Because of high variability between our biological replicates, we did not always found significant differences in the absolute amount of lipids in –Pi. However, the analysis of the fold change in lipid content in –Pi vs +Pi always pointed toward a reduced extent of phospholipid degradation. We also added in these graphs the fold change for the total phospholipids and total galactolipids contents in the revised version of the manuscript. We believe that the new analyses we performed strengthen our conclusion about the role of AtVPS13M1 in phospholipid degradation and not on the recycling of precursors backbone to feed galactoglycerolipids synthesis at the chloroplast envelope.

      Page 9, line 15: Please use the standard form of abbreviations of lipid molecular species with colon, e.g. PC32:0, not PC32-0

      The lipid species nomenclature has been changed accordingly.

      Page 11, line 4, (atvps13m1.1 and m1.3: please indicate the existence of mutant alleles with dashes, i.e. (atvps13m1-1 and atvps13m1-3

      Names of the mutants have been changed accordingly.

      Page 14, line 21: which line is indicated by atvps13m1.2-4? What does -4 indicate here?

      This indicates that mutants m1-2 to m1-4 were analyzed.

      Page 16, line 25: many abbreviations used here are very specific and not well known to the general audience e.g. ONT, IR, PTC, NMD etc. I think it is OK to mention them here, but still use the full terms, given that they are not used very frequently in the manuscript.

      We kept ONT abbreviation because it was cited many times in both the results and discussion part. IR, PTC and NMD were cited only in the discussion and were eliminated.

      Page 19, line 11. The authors cite Hsueh et al and Yang et al for LPTD1 playing a role in lipid homeostasis during P deficiency. But Yang et al. described the function of a SEC14 protein in Arabidopsis and rice during P deficiency. Is SEC14 related to LPTD1?

      Many thanks for noticing this mistake. We removed the citation Yang et al. in the revised version of the manuscript.

      Reference Tangpranomkorn et al. 2022: In the text, it says that this is a preprint, but in the Reference list, this is indicated with "Plant Biology" as Journal. In the internet, I could only find this manuscript in bioRxiv.

      This manuscript was accepted in “New Phytologist” in December 2024 and is now cited accordingly in the new version of the manuscript.

      Reviewer #3 (Significance (Required)):

      The manuscript by Leterme et al describes the characterization of the lipid binding and transport protein VTPS13M1 from Arabidopsis. I think that the liposome assay needs to be done with a negative control. Furthermore, I have major concerns with the lipid data in Fig. 3C and Fig. S4. These lipid data of the current manuscript need to be redone. I do not agree that the lipid data allow the conclusion that "AtVPS13M1 is involved in lipid remodeling in low phosphate" as stated in the title.

      References cited in this document:

      Dziurdzik, S.K., and E. Conibear. 2021. The Vps13 Family of Lipid Transporters and Its Role at Membrane Contact Sites. Int J Mol Sci. 22:2905. doi:10.3390/ijms22062905.

      Hanna, M., A. Guillén-Samander, and P. De Camilli. 2023. RBG Motif Bridge-Like Lipid Transport Proteins: Structure, Functions, and Open Questions. Annu Rev Cell Dev Biol. 39:409–434. doi:10.1146/annurev-cellbio-120420-014634.

      Hanna, M.G., P.H. Suen, Y. Wu, K.M. Reinisch, and P. De Camilli. 2022. SHIP164 is a chorein motif lipid transfer protein that controls endosome–Golgi membrane traffic. Journal of Cell Biology. 221:e202111018. doi:10.1083/jcb.202111018.

      Jouhet, J., E. Alves, Y. Boutté, S. Darnet, F. Domergue, T. Durand, P. Fischer, L. Fouillen, M. Grube, J. Joubès, U. Kalnenieks, J.M. Kargul, I. Khozin-Goldberg, C. Leblanc, S. Letsiou, J. Lupette, G.V. Markov, I. Medina, T. Melo, P. Mojzeš, S. Momchilova, S. Mongrand, A.S.P. Moreira, B.B. Neves, C. Oger, F. Rey, S. Santaeufemia, H. Schaller, G. Schleyer, Z. Tietel, G. Zammit, C. Ziv, and R. Domingues. 2024. Plant and algal lipidomes: Analysis, composition, and their societal significance. Progress in Lipid Research. 96:101290. doi:10.1016/j.plipres.2024.101290.

      Jouhet, J., J. Lupette, O. Clerc, L. Magneschi, M. Bedhomme, S. Collin, S. Roy, E. Maréchal, and F. Rébeillé. 2017. LC-MS/MS versus TLC plus GC methods: Consistency of glycerolipid and fatty acid profiles in microalgae and higher plant cells and effect of a nitrogen starvation. PLoS ONE. 12:e0182423. doi:10.1371/journal.pone.0182423.

      Kumar, N., M. Leonzino, W. Hancock-Cerutti, F.A. Horenkamp, P. Li, J.A. Lees, H. Wheeler, K.M. Reinisch, and P. De Camilli. 2018. VPS13A and VPS13C are lipid transport proteins differentially localized at ER contact sites. J Cell Biol. 217:3625–3639. doi:10.1083/jcb.201807019.

      Leonzino, M., K.M. Reinisch, and P. De Camilli. 2021. Insights into VPS13 properties and function reveal a new mechanism of eukaryotic lipid transport. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids. 1866:159003. doi:10.1016/j.bbalip.2021.159003.

      Leterme, S., O. Bastien, R.A. Cigliano, A. Amato, and M. Michaud. 2023. Phylogenetic and Structural Analyses of VPS13 Proteins in Archaeplastida Reveal Their Complex Evolutionary History in Viridiplantae. Contact (Thousand Oaks). 6:1–23. doi:10.1177/25152564231211976.

      Levine, T.P. 2022. Sequence Analysis and Structural Predictions of Lipid Transfer Bridges in the Repeating Beta Groove (RBG) Superfamily Reveal Past and Present Domain Variations Affecting Form, Function and Interactions of VPS13, ATG2, SHIP164, Hobbit and Tweek. Contact. 5:251525642211343. doi:10.1177/25152564221134328.

      Valverde, D.P., S. Yu, V. Boggavarapu, N. Kumar, J.A. Lees, T. Walz, K.M. Reinisch, and T.J. Melia. 2019. ATG2 transports lipids to promote autophagosome biogenesis. J Cell Biol. 218:1787–1798. doi:10.1083/jcb.201811139.

      Wang, J., N. Fang, J. Xiong, Y. Du, Y. Cao, and W.-K. Ji. 2021. An ESCRT-dependent step in fatty acid transfer from lipid droplets to mitochondria through VPS13D−TSG101 interactions. Nat Commun. 12:1252. doi:10.1038/s41467-021-21525-5.

      Zhou, R., L.M. Benavente, A.N. Stepanova, and J.M. Alonso. 2011. A recombineering-based gene tagging system for Arabidopsis. Plant J. 66:712–723. doi:10.1111/j.1365-313X.2011.04524.x.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      The manuscript "AtVPS13M1 is involved in lipid remodelling in low phosphate and is located at the mitochondria surface in plants" by Leterme et al. identifies the protein VPS13M1 as a lipid transporter in Arabidopsis thaliana with important functions during phosphate starvation. The researchers were able to localise this protein to mitochondria via GFP-targeting in Arabidopsis. Although VPS13 proteins are well described in yeast and mammals, highlighting their importance in many vital cellular processes, there is very little information on them in plants. This manuscript provides new insights into plant VPS13 proteins and contributes to a better understanding of these proteins and their role in abiotic stress responses, such as phosphate starvation.

      Major points:

      • Please describe and define the domains of the VPS13M1 protein in detail, providing also a figure for that. Figure 1 is mainly describing possible splice variants, whereas the characteristics of the protein are missing.
      • Please compare the expression level of VPS13M1 in the presence and in the absence of phosphate.
      • Page 9, second paragraph: Here, the lipid transport capability of AtVPS13M1 is described. Varying concentrations of this recombinant protein should be used in this test. Further, it is not highlighted, that a truncated version of VSP13M1 is able to transport lipids. This is surprising, since this truncated version is less than 10% of the total protein (only aa 1-335).
      • Also, for phenotype analysis, T-DNA insertion mutants are used that still contain VPS13M1 transcripts. Although protein fragments where not detected by proteomic analysis, this might be due to low sensitivity of the proteomic assay. Further the lipid transport domain of VPS13M1 (aa 1-335) might not be affected by the T-DNA insertions at all. Here more detailed analysis needs to be done to prove that indeed loss-of protein function occurs in the mutants.
      • Localisation in mitochondria: As the Yepet signal is very weak, a control image of not transfected plant tissue needs to be included. Otherwise, it might be hard to distinguish the Yepet signal from background signal. The localisation data presented in Figure 5 does not allow the conclusion that VPS13M1 is localized at the surface of mitochondria as stated in the title. It only indicates (provided respective controls see above) that VPS13M1 is in mitochondria. Please provide more detailed analysis such as targeting to tobacco protoplasts, immunoblots or in vitro protein import assays. Also test +Pi vs. -Pi to see if VPS13M1 localisation is altered in dependence of Pi.
      • Phenotype analysis needs to be done under Pi stress and not under cold stress! Further, root architecture and root growth should also be done under Pi depletion. Here the title is also misleading, it is not at all clear why the authors switch from phosphate starvation to cold stress.

      Minor points:

      Page 3, line 1: what does the abbreviation VPS stand for?

      Page 3, line 1: change "amino acids residues" to "amino acid residues"

      Page 3, line 8 - 12: please rewrite this sentence. You write, that because of their distribution VPS13 proteins do exhibit many important physiological roles. The opposite is true: They are widely distributed in the cell because of their involvement in many physiological processes.

      Page 6, line6: change "cDNA obtained from A. thaliana" to "cDNA generated from A. thaliana.

      Page 6, line 10: change" 7.6kb" to "7.6 kb"

      Page 7: address this question: can the isoforms form functional VPS13 proteins? This might help to postulate whether these isoforms are a result of defective splicing events.

      Figure 2 B: Change "AtVPS13M1"to "AtVPS13M1(1-335)"

      Figure 2, legend:

      • put a blank before µM in each case.
      • Change 0,125µM to 0.125 µM
      • what does "in absence (A-0µM)" mean?
      • Which statistical analysis was employed?
      • Further, rewrite the sentence "Mass spectrometry (MS) analysis of lipids bound to AtVPS13M1(1-335) or Tom20 (negative control) after incubation with calli total lipids. Results are expresses in nmol of lipids per nmol of proteins (C) or in mol% (D)".
      • "C" and "D" are not directly comparable, as in "C" no Tom20 was used and in "C" no insect cells were used.
      • Further, in "D" the experimental setup is not clear. AtVPS13(1-335) is supposed to be purified protein after incubation with calli lipids (figure 2, A). Further, in the same figure, lipid composition of "insect cells" and "calli-Pi" are compared why? Please clarify this. Figure 3:
      • t-test requires a normal distribution of the data. This is not possible for an n=3. Please use an adequate analysis.
      • Please clarify the meaning of the letters on the top of the bars in the legend. Please, make it clear that two figures belong to C.
      • Reorganise the order of figure 3 (ABCD)

      Page 10, 3. Paragraph: since the finding, that no peptides were found in the VSP13M1 ko lines, although transcription was not altered, is surprising, please include the proteomic data in the supplement

      Page 11, line 17: The in vitro experiments showed a low affinity of VSP13M1 towards galactolipids. It is further claimed that this is consistent with the finding of the AtVSP13M1 Ko line in vivo, that in absence of PI, no change in DGDG content could be observed. However, the "absence" of VSP13M1 in vivo might still result in a bigger VSP13M1 protein, than the truncated form (1-335) used for the in vitro experiments

      Page 13, lane 8: you should reconsider the use of a triple Yepet tag: If two or more identical fluorescent molecules are in close proximity, their fluorescence emission is quenched, which results in a weak signal (as the one that you obtained). See: Zhuang et al. 2000 (PNAS) Fluorescence quenching: A tool for single-molecule protein-folding study

      Page 13, line 14: change 1µm to 1 µm

      Page 13, line 29: please reduce the sentence to the first part: if A does not colocalize with B, it is not necessary to mention that B does not colocalise with A.

      Page 14, 2. Paragraph: it is not conclusive that phenotype analysis is suddenly conducted with plants under cold stress, since everything was about Pi-starvation and the role of VSP13M1. Lipid remodelling under Pi stress completely differs from the lipid remodelling under cold stress.

      Page 14, line 20: change figure to Figure

      Page 07, line 17: change artifact to artefact

      Significance

      General assessment:

      The paper is well written and technically sound. However, some points could be identified, that definitely need a revision. Overall, we got the impression that so far, the data gathered are still quite preliminary and need some more detailed investigations prior to publication (see major points).

      Advance: The study definitely fills a gap of knowledge since not much is known on the function of plant VPS13 proteins so far.

      Audience: The study is of very high interest to the plant lipid community but as well of general interest for Plant Molecular Biology and intracellular transport.

      Our expertise: Plant membrane transport and lipid homeostasis.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary: An analysis of an Arabidopsis VSP13 presumed lipid transport is provided. The analysis pretty much follows similar studies done on yeast and human homologs. Key findings are the identification of multiple products from the locus due to differential splicing, analysis of lipid binding and transport properties, subcellular location, tissue specific promoter activity, mutant analysis suggesting a role in lipid remodeling following phosphate deprivation, but no physiological or growth defects of the mutants.

      Major points: The paper is generally written and documented, the experiments are well conducted and follow established protocols. The following major points should be considered:

      1. There are complementary lipid binding assays that should be considered such as liposome binding assays, or lipid/western dot blots. All of these might give slightly different results and may inform a consensus. Of course, non-membrane lipids such as TAG cannot be tested in a liposome assay.
      2. Similarly, lipid transfer based only on fluorophore-labeled lipids may be misleading because the fluorophore could affect binding. It is mentioned that the protein in this assay is tethered by 3xHiis to the liposomes. Un less I ma missing something, I do not understand how that should work. This needs to be better explained.
      3. The in vivo lipid binding assay could be obscured by the fact that the protein was produced in insect cells and lipid binding occurs during the producing. What is the evidence that added plants calli lipids can replace lipids already present during isolation.
      4. The effects on lipid composition of the mutants are not very drastic from what I can tell. Furthermore, how does this fit with the lipid composition of mitochondria where the protein appears to be mostly located?
      5. For the localization of the fusion protein, has it been tested whether the furoin is functional? This should be tested (e.g. by reversion of lipid composition).
      6. It is speculated that different splice forms are located to different compartments. Can that be tested and used to explain the observed subcellular location patterns?
      7. GUS fusion data only probe promoter activity but not all levels of gene expression. That caveat should be discussed.

      Minor points:

      1. Extraplastidic DGDG and export from chloroplasts following phosphate derivation was first reported in PMID: 10973486.
      2. Check throughout the correct usage of gene expression as genes are expressed and proteins produced.
      3. In general, the paper is too long. Redundancies between introduction, results and discussion should be removed to streamline.
      4. I suggest to redraw the excel graphs to increase line thickness and enlarge font size to increase presentation and readability.

      Significance

      Interorganellar lipid trafficking is an important topic and especially under studied in plants. Identifying components involved represents significant progress in the field. Similarly, lipid remodeling following phosphate derivation is an important phenomenon and the current advances our understanding.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      The manuscript by Bell et. al. describes an analysis of the effects of removing one of two mutually exclusive splice exons at two distinct sites in the Drosophila CaV2 calcium channel Cacophony (Cac). The authors perform imaging and electrophysiology, along with some behavioral analysis of larval locomotion, to determine whether these alternatively spliced variants have the potential to diversify Cac function in presynaptic output at larval neuromuscular junctions. The author provided valuable insights into how alternative splicing at two sites in the calcium channel alters its function.

      Strengths:

      The authors find that both of the second alternatively spliced exons (I-IIA and I-IIB) that are found in the intracellular loop between the 1st and second set of transmembrane domains can support Cac function. However, loss of the I-IIB isoform (predicted to alter potential beta subunit interactions) results in 50% fewer channels at active zones and a decrease in neurotransmitter release and the ability to support presynaptic homeostatic potentiation. Overall, the study provides new insights into Cac diversity at two alternatively spliced sites within the protein, adding to our understanding of how regulation of presynaptic calcium channel function can be regulated by splicing.

      Weaknesses:

      The authors find that one splice isoform (IS4B) in the first S4 voltage sensor is essential for the protein's function in promoting neurotransmitter release, while the other isoform (IS4A) is dispensable. The authors conclude that IS4B is required to localize Cac channels to active zones. However, I find it more likely that IS4B is required for channel stability and leads to the protein being degraded, rather than any effect on active zone localization. More analysis would be required to establish that as the mechanism for the unique requirement for IS4B.

      (1) We thank the reviewer for this important point. In fact, all three reviewers raised the same question, and the reviewing editor pointed out that caution or additional experiments were required to distinguish between IS4 splicing being important for cac channel localization versus channel stability/degradation. We provide multiple sets of experiments as well as text and figure revisions to strengthen our claim that the IS4B exon is required for cacophony channels to enter motoneuron presynaptic boutons and localize to active zones.

      a. If IS4B was indeed required for cac channel stability (and not for localization to active zones) IS4A channels should be instable wherever they are. This is not the case because we have recorded somatodendritic cacophony currents from IS4A expressing adult motoneurons that were devoid of cac channels with the IS4B exon. Therefore, IS4A cac channels are not instable but underlie somatodendritic voltage dependent calcium currents in these motoneurons. These new data are now shown in the revised figure 3C and referred to in the text on page 7, line 42 to page 8 line 9.

      b. Similarly, if IS4B was required for channel stability, it should not be present anywhere in the nervous system. We tested this by immunohistochemistry for GFP tagged IS4A channels in the larval CNS. Although IS4A channels are sparsely expressed, which is consistent with low expression levels seen in the Western blots (Fig. 1E), there are always defined and reproducible patterns of IS4A label in the larval brain lobes as well as in the anterior part of the VNC. This again shows that the absence of IS4A from presynaptic active zones is not caused by channel instability, because the channel is expressed in other parts of the nervous system. These data are shown in the new supplementary figure 1 and referred to in the text on page 15, lines 3 to 8.

      c. As suggested in a similar context by reviewers 1 and 2, we now show enlargements of the presence of IS4B channels in presynaptic active zones as well as enlargements of the absence of IS4A channels in presynaptic active zones in the revised figures 2A-C and 3A. In these images, no IS4A label is detectable in active zones or anywhere else throughout the axon terminals, thus indicating that IS4B is required for expressing cac channels in the axon terminal boutons and localizing it to active zones. Text and figure legends have been adjusted accordingly.

      d. Related to this, reviewer 1 also recommended to quantify the IS4A and ISB4 channel intensity and co-localization with the active zone marker brp (recommendation for authors). After following the reviewers’ suggestion to adjust the background values in IS4A and IS4B immunolabels to identical (revised Figs. 2A-C), it becomes obvious that IS4A channel are not detectable above background in presynaptic terminals or active zones, thus intensity is close to zero. We still calculated the Pearsons co-localization coefficient for both IS4 variants with the active zone marker brp. For IS4B channels the Pearson’s correlation coefficient is control like, just above 0.6, whereas for IS4A channels we do not find colocalization with brp (Pearson’s below 0.25). These new analyses are now shown in the revised figure 2D and referred to on page 6, lines 33 to 38.

      e. Consistent with our finding that IS4B is required for cac channel localization to presynaptic active zones, upon removal of IS4B we find no evoked synaptic transmission (Fig. 2 in initial submission, now Fig. 3B).

      Together these data are in line with a unique requirement of IS4B at presynaptic active zones (not excluding additional functions of IS4B), whereas IS4A containing cac isoforms are not found in presynaptic active zones and mediate different functions.

      Reviewer #2 (Public Review):

      This study by Bell et al. focuses on understanding the roles of two alternatively spliced exons in the single Drosophila Cav2 gene cac. The authors generate a series of cac alleles in which one or the other mutually exclusive exons are deleted to determine the functional consequences at the neuromuscular junction. They find alternative splicing at one exon encoding part of the voltage sensor impacts the activation voltage as well as localization to the active zone. In contrast, splicing at the second exon pair does not impact Cav2 channel localization, but it appears to determine the abundance of the channel at active zones.

      Together, the authors propose that alternative splicing at the Cac locus enables diversity in Cav2 function generated through isoform diversity generated at the single Cav2 alpha subunit gene encoded in Drosophila.

      Overall this is an excellent, rigorously validated study that defines unanticipated functions for alternative splicing in Cav2 channels. The authors have generated an important toolkit of mutually exclusive Cac splice isoforms that will be of broad utility for the field, and show convincing evidence for distinct consequences of alternative splicing of this single Cav2 channel at synapses. Importantly, the authors use electrophysiology and quantitative live sptPALM imaging to determine the impacts of Cac alternative splicing on synaptic function. There are some outstanding questions regarding the mechanisms underlying the changes in Cac localization and function, and some additional suggestions are listed below for the authors to consider in strengthening this study. Nonetheless, this is a compelling investigation of alternative splicing in Cav2 channels that should be of interest to many researchers.

      (2) We believe that the additional data on cac IS4A isoform localization and function as detailed above (response to public review 1) has strengthened the manuscript and answered some of the remaining questions the reviewer refers to. We are also grateful for the specific additional reviewer suggestions which we have addressed point-by-point and refer to below (section recommendations for authors).

      Reviewer #3 (Public Review):

      Summary:

      Bell and colleagues studied how different splice isoforms of voltage-gated CaV2 calcium channels affect channel expression, localization, function, synaptic transmission, and locomotor behavior at the larval Drosophila neuromuscular junction. They reveal that one mutually exclusive exon located in the fourth transmembrane domain encoding the voltage sensor is essential for calcium channel expression, function, active zone localization, and synaptic transmission. Furthermore, a second mutually exclusive exon residing in an intracellular loop containing the binding sites for Caβ and G-protein βγ subunits promotes the expression and synaptic localization of around ~50% of CaV2 channels, thereby contributing to ~50% of synaptic transmission. This isoform enhances release probability, as evident from increased short-term depression, is vital for homeostatic potentiation of neurotransmitter release induced by glutamate receptor impairment, and promotes locomotion. The roles of the two other tested isoforms remain less clear.

      Strengths:

      The study is based on solid data that was obtained with a diverse set of approaches. Moreover, it generated valuable transgenic flies that will facilitate future research on the role of calcium channel splice isoforms in neural function.

      Weaknesses:

      (1) Based on the data shown in Figures 2A-C, and 2H, it is difficult to judge the localization of the cac isoforms. Could they analyze cac localization with regard to Brp localization (similar to Figure 3; the term "co-localization" should be avoided for confocal data), as well as cac and Brp fluorescence intensity in the different genotypes for the experiments shown in Figure 2 and 3 (Brp intensity appears lower in the dI-IIA example shown in Figure 3G)? Furthermore, heterozygous dIS4B imaging data (Figure 2C) should be quantified and compared to heterozygous cacsfGFP/+.

      According to the reviewer’s suggestion, we have quantified cac localization relative to brp localization by computing the Pearson’s correlation coefficient for controls and IS4A as well as IS4B animals. These new data are shown in the revised Fig. 2D and referred to on page 6, lines 33-38. Furthermore, we now confirm control-like Pearson’s correlation coefficients for all exon out variants except ΔIS4B and show Pearson’s correlation coefficients for all genotypes side-by-side in the revised Fig. 4D (legend has been adjusted accordingly). In addition, in response to the recommendations to authors, we now provide selective enlargements for the co-labeling of Brp and each exon out variant in the revised figures 2-4. We have also adjusted the background in Fig. 2C (ΔIS4B) to match that in Figs. 2A and B (control and ΔIS4A). This allows a fair comparison of cac intensities following excision of IS4B versus excision of IS4A and control (see also Fig 3). Together, this demonstrates the absence of IS4A label in presynaptic active zones much clearer. As suggested, we have also quantified brp puncta intensity on m6/7 across homozygous exon excision mutants and found no differences (this is now stated for IS4A/IS4B in the results text on page 6, lines 37/38 and for I-IIA/I-IIB on page 8, lines 42-44.). We did not quantify the intensity of cacophony puncta upon excision of IS4B because the label revealed no significant difference from background (which can be seen much better in the images now), but the brp intensities remained control-like even upon excision of IS4B.

      (2) They conclude that I-II splicing is not required for cac localization (p. 13). However, cac channel number is reduced in dI-IIB. Could the channels be mis-localized (e.g., in the soma/axon)? What is their definition of localization? Could cac be also mis-localized in dIS4B? Furthermore, the Western Blots indicate a prominent decrease in cac levels in dIS4B/+ and dI-IIB (Figure 1D). How do the decreased protein levels seen in both genotypes fit to a "localization" defect? Could decreased cac expression levels explain the phenotypes alone?

      We have now precisely defined what we mean by cac localization, namely the selective label of cac channels in presynaptic active zones that are defined as brp puncta, but no cac label elsewhere in the presynaptic bouton (page 6, lines 18 to 20). On the level of CLSM microscopy this corresponds to overlapping cac puncta and brp puncta, but no cac label elsewhere in the bouton. Based on the additional analysis and data sets outlined in our response 1 (see above) we conclude that excision of IS4B does not cause channel mislocalization because we find reproducible expression patterns elsewhere in the nervous system as well as somatodendritic cac current in ΔIS4B (for detail see above). Therefore, the isoforms containing the mutually exclusive IS4A exon are expressed and mediate other functions, but cannot substitute IS4B containing isoforms at the presynaptic AZ. In fact, our Western blots are in line with reduced cac expression if all isoforms that mediate evoked release are missing, again indicating that the presynapse specific cac isoforms cannot be replaced by other cac isoforms. This is also in line with the sparse expression of IS4A throughout the CNS as seen in the new supplementary figure 1 (for detail see above).

      (3) Cac-IS4B is required for Cav2 expression, active zone localization, and synaptic transmission. Similarly, loss of cac-I-IIB reduces calcium channel expression and number. Hence, the major phenotype of the tested splice isoforms is the loss of/a reduction in Cav2 channel number. What is the physiological role of these isoforms? Is the idea that channel numbers can be regulated by splicing? Is there any data from other systems relating channel number regulation to splicing (vs. transcription or post-transcriptional regulation)?

      Our data are not consistent with the idea that splicing regulates channel numbers. Rather, splicing can be used to generate channels with specific properties that match the demand at the site of expression. For the IS4 exon pair we find differences in activation voltage between IS4A and IS4B channels (revised Fig. 3C), with IS4B being required for sustained HVA current. IS4A does not localize to presynaptic active zones at the NMJ and is only sparsely expressed elsewhere in the NS (new supplementary Fig. 1). By contrast, IS4B is abundantly expressed in many neuropils. Therefore, taking out IS4B takes out the more abundant IS4 isoform. This is consistent with different expression levels for IS4 isoforms that have different functions, but we do not find evidence for splicing regulating expression levels per se.

      Similarly, the I-II mutually exclusive exon pair differs markedly in the presence or absence of G-protein βγ binding sites that play a role in acute channel regulation as well the conservation of the sequence for β-subunit binding (see page 5, lines 9-17). Channel number reduction in active zones occurs specifically if expression of the cac channels with the G<sub>βγ</sub>-binding site as well as the more conserved β-subunit binding is prohibited by excision of the I-IIB exon (see Fig. 5F). Vice versa, excision of I-IIA does not result in reduced channel numbers. This scenario is consistent with the hypothesis that conserved β-subunit binding affects channel number in the active zone (see page 17, lines 3 to 6 and lines 33-36), but we have no evidence that I-II splicing per se affects channel number.

      (4) Although not supported by statistics, and as appreciated by the authors (p. 14), there is a slight increase in PSC amplitude in dIS4A mutants (Figure 2). Similarly, PSC amplitudes appear slightly larger (Figure 3J), and cac fluorescence intensity is slightly higher (Figure 3H) in dI-IIA mutants. Furthermore, cac intensity and PSC amplitude distributions appear larger in dI-IIA mutants (Figures 3H, J), suggesting a correlation between cac levels and release. Can they exclude that IS4A and/or I-IIA negatively regulate release? I suggest increasing the sample size for Canton S to assess whether dIS4A mutant PSCs differ from controls (Figure 2E). Experiments at lower extracellular calcium may help reveal potential increases in PSC amplitude in the two genotypes (but are not required). A potential increase in PSC amplitude in either isoform would be very interesting because it would suggest that cac splicing could negatively regulate release.

      There are several possibilities to explain this, but as none of the effects is statistically significant, we prefer to not investigate this in further depth. However, given that we cannot find IS4A in presynaptic active zones (revised figures 2C and 3A plus the new enlargements 2Ci and 3Ai, revised text page 6, lines 22 to 24 and 29 to 31, and page 7, second paragraph, same as public response 1D) IS4A channels cannot have a direct negative effect on release probability. Nonetheless, given that IS4A containing cac isoforms mediate functions in other neuronal compartments (see revised Fig. 3C) it may regulate release indirectly by affecting e.g. action potential shape. Moreover, in response to the more detailed suggestions to authors we provide new data that give additional insight.

      (5) They provide compelling evidence that IS4A is required for the amplitude of somatic sustained HVA calcium currents. However, the evidence for effects on biophysical properties and activation voltage (p. 13) is less convincing. Is the phenotype confined to the sustained phase, or are other aspects of the current also affected (Figure 2J)? Could they also show the quantification of further parameters, such as CaV2 peak current density, charge density, as well as inactivation kinetics for the two genotypes? I also suggest plotting peaknormalized HVA current density and conductance (G/Gmax) as a function of Vm. Could a decrease in current density due to decreased channel expression be the only phenotype? How would changes in the sustained phase translate into altered synaptic transmission in response to AP stimulation?

      Most importantly, sustained HVA current is abolished upon excision of IS4B (not IS4A, we think the reviewer accidentally mixed up the genotype) and presynaptic active zones at the NMJ contain only cac isoforms with the IS4B exon. This indicates that the cac isoforms that mediate evoked release encode HVA channels. The somatodendritic currents shown in the revised figure 3C (previously 2J) that remain upon excision of IS4B are mediated by IS4A containing cac isoforms. Please note that these never localize to the presynaptic active zone, and thus do not contribute to evoked release. Therefore, the interpretation is that specifically sustained HVA current encoded by IS4B cac isoforms is required for synaptic transmission. Reduced cac current density due to decreased channel expression is not the cause for impaired evoked release upon IS4B excision, but instead, the cause is the absence of any cac channels in active zones. IS4B-containing cac isoforms encode sustained HVA current, and we speculate that this might be a well suited current to minimize cacophony channel inactivation in the presynaptic active zone. Given that HVA current shows fast voltage dependent activation and fast inactivation upon repolarization, it is useful at large intraburst firing frequencies as observed during crawling (Kadas et al., 2017) without excessive cac inactivation (see page 15, Kadas, lines 16 to 20).

      However, we agree with the reviewer that a deeper electrophysiological analysis of splice isoform specific cac currents will be instructive. We have now added traces of control and ΔIS4B from a holding potential of -90 mv (revised Fig. 3C, bottom traces and revised text on page 7, line 43 to page 8, lines 1 to 10), and these are also consistent with IS4B mediating sustained HVA cac current. However, further analysis of activation and inactivation voltages and kinetics suffers form space clamp issues in recordings from the somata of such complex neurons (DLM motoneurons of the adult fly contain roughly 6000 µm of dendrites with over 4000 branches, Ryglewski et al., 2017, Neuron 93(3):632-645). Therefore, we will analyze the currents in a heterologous expression system and present these data to the scientific community as a separate study at a later time point.

      (6) Why was the STED data analysis confined to the same optical section, and not to max. intensity z-projections? How many and which optical sections were considered for each active zone? What were the criteria for choosing the optical sections? Was synapse orientation considered for the nearest neighbor Cac - Brp cluster distance analysis? How do the nearest-neighbor distances compare between "planar" and "side-view" Brp puncta?

      Maximum intensity z-projections would be imprecise because they can artificially suggest close proximity of label that is close by in x and y but far away in z. Therefore, the analysis was executed in xy-direction of various planes of entire 3D image stacks. We considered active zones of different orientations (Figs. 5C, D) to account for all planes. In fact, we searched the entire z-stacks until we found active zones of all orientations within the same boutons, as shown in figures 5C1-C6. The same active zone orientations were analyzed for all exon-out mutants with cac localization in active zones. The distance between cac and brp did not change if viewed from the side or any other orientation. We now explain this in more clarity in the results text on page 9, lines 23/24.

      (7) Cac clusters localize to the Brp center (e.g., Liu et al., 2011). They conclude that Cav2 localization within Brp is not affected in the cac variants (p. 8). However, their analysis is not informative regarding a potential offset between the central cac cluster and the Brp "ring". Did they/could they analyze cac localization with regard to Brp ring center localization of planar synapses, as well as Brp-ring dimensions?

      In the top views (planar) we did not find any clear offset in cac orientation to brp between genotypes. In such planar synapses (top views, Fig. 5D, left row) we did not find any difference in Brp ring dimensions. We did not quantify brp ring dimensions rigorously, because this study focusses on cac splice isoform-specific localization and function. Possible effects of different cac isoforms on brp-ring dimensions or other aspects of scaffold structure are not central to our study, in particular given that brp puncta are clearly present even if cac is absent from the synapse (Fig. 3A), indicating that cac is not instructive for the formation of the brp scaffold.

      (8) Given the accelerated PSC decay/ decreased half width in dI-IIA (Fig. 5Q), I recommend reporting PSC charge in Figure 3, and PPR charge in Figures 5A-D. The charge-based PPRs of dI-IIA mutants likely resemble WT more closely than the amplitude-based PPR. In addition, miniature PSC decay kinetics should be reported, as they may contribute to altered decay kinetics. How could faster cac inactivation kinetics in response to single AP stimulation result in a decreased PSC half-width? Is there any evidence for an effect of calcium current inactivation on PSC kinetics? On a similar note, is there any evidence that AP waveform changes accelerate PSC kinetics? PSC decay kinetics are mainly determined by GluR decay kinetics/desensitization. The arguments supporting the role of cac splice isoforms in PSC kinetics outlined in the discussion section are not convincing and should be revised.

      We agree that reporting charge in figure 3 is informative and do so in the revised text. Since the result (no significant difference in the PSCs between between CS, cac<sup>GFP</sup>, <sup>ΔI-IIA</sup>, and transheterozygous I-IIA/I-IIB, but significantly smaller values in ΔI-IIB) remained unchanged no matter whether charge or amplitude were analyzed, we decided to leave the figure as is and report the additional analysis in the text (page 8, lines 40 to 42). This way, both types of analysis are reported. Please note that EPSC amplitude is slightly but not significantly increased upon excision of I-IIA (Fig. 4J), whereas EPSC half amplitude width is significantly smaller (Fig. 5Q, now revised Fig 6R). Together, a tendency of increased EPSC amplitudes and smaller half amplitude width result in statistically insignificant changes in EPSC in ∆I-IIA (now discussed on page 15, lines 37 to 40). We also understand the reviewer’s concern attributing altered EPSC kinetics to presynaptic cac channel properties. We have toned down our interpretation in the discussion and list possible alterations in presynaptic AP shape or cac channel kinetics as alternative explanations (not conclusions; see revised discussion on page 15, line 40 to page 16, line 2). Moreover, we have quantified postsynaptic GluRIIA abundance to test whether altered PSC kinetics are caused by altered GluRIIA expression. In our opinion, the latter is more instructive than mini decay kinetic analysis because this depends strongly on the distance of the recording electrode to the actual site of transmission in these large muscle cells. Although we find no difference in GluRIIA expression levels we now clearly state that we cannot exclude other changes in GluR receptor fields, which of course, could also explain altered PSC kinetics. We have updated the discussion on page 16, lines 2/3 accordingly.

      (9) Paired-pulse ratios (PPRs): On how many sweeps are the PPRs based? In which sequence were the intervals applied? Are PPR values based on the average of the second over the first PSC amplitudes of all sweeps, or on the PPRs of each sweep and then averaged? The latter calculation may result in spurious facilitation, and thus to the large PPRs seen in dI-IIB mutants (Kim & Alger, 2001; doi: 10.1523/JNEUROSCI.21-2409608.2001).

      We agree that the PP protocol and analyses had to be described more precisely in the methods and have done so on page 23, lines 31 to 37 in the methods. Mean PPR values are based on the PPRs of each sweep and then averaged. We are aware of the study of Kim and Alger 2001 and have re-analyzed the PP data in both ways outlined by the reviewer. We get identical results with either analyses method. Spurious facilitation is thus not an issue in our data. We now explain this in the methods section along with the PPR protocol. The large spread seen in dI-IIB is indeed caused by reduced calcium influx into active zones with fewer channels, as anticipated by the reviewer (see next point).

      (10) Could the dI-IIB phenotype be simply explained by a decrease in channel number/ release probability? To test this, I propose investigating PPRs and short-term dynamics during train stimulation at lower extracellular Ca2+ concentration in WT. The Ca2+ concentration could be titrated such that the first PSC amplitude is similar between WT and dI-IIB mutants. This experiment would test if the increased PPR/depression variability is a secondary consequence of a decrease in Ca2+ influx, or specific to the splice isoform.

      In fact, the interpretation that decreased PSC amplitude upon I-IIB excision is caused mainly by reduced channel number is precisely our interpretation (see discussion page 14, last paragraph to page 15, first paragraph in the original submission, now page 16, second paragraph paragraph). In addition, we are grateful for the reviewer’s suggestion to triturate the external calcium such that the first PSC amplitude in matches in ∆I-IIB and control. This experiment tests whether altered short term plasticity is solely a function of altered channel number or whether additional causes, such as altered channel properties, also play into this. We triturated the first pulse amplitude in ∆I-IIB to match control and find that paired pulse ratio and the variance thereof are not different anymore. Therefore, the differences observed in identical external calcium can be fully explained by altered channel numbers. This additional dataset is shown in the revised figures 6D and E and referred to in the results section on page 10, lines 14 to 25 and the discussion on page16, lines 36 to 38.

      (11) How were the depression kinetics analyzed? How many trains were used for each cell, and how do the tau values depend on the first PSC amplitude? Time constants in the range of a few (5-10) milliseconds are not informative for train stimulations with a frequency of 1 or 10 Hz (the unit is missing in Figure 5H). Also, the data shown in Figures 5E-K suggest slower time constants than 5-10 ms. Together, are the data indeed consistent with the idea that dIIIB does not only affect cac channel number, but also PPR/depression variability (p. 9)?

      For each animal the amplitudes of all subsequent PSCs in each train were plotted over time and fitted with a single exponential. For depression at 1 and 10 Hz, we used one train per animal, and 5-6 animals per genotype (as reflected in the data points in Figs. 6I, M). This is now explained in more detail in the revised methods section (page 23, lines 39 to 41). The tau values are not affected by the amplitude of the first PSC. First, we carefully re-fitted new and previously presented depression data and find that the taus for depression at low stimulation frequencies (1 and 10Hz) are not affected by exon excisions at the I-II site. We thank the reviewer for detecting our error in units and tau values in the previous figure panels 5H and L (this has now been corrected in the revised figure panels 6I and M). Given that PSC amplitude upon I-IIB excision is significantly smaller than in controls and following I-IIA excision, we suspected that the time course of depression at low stimulation frequency is not significantly affected by the amount of calcium influx during the first PSC. To further test this, we followed the reviewer ’s suggestion and re-measured depression at 1 and 10 Hz for cac-GFP controls and for delta I-IIB in a higher external calcium concentration (1.8 mM), so that the first PSC was increased in amplitude in both genotypes (1.8 mM external calcium triturates the PSC amplitude in delta I-IIB to match that of controls measured in 0.5 mM external calcium, see revised Figs. 6H, L). Neither in control, nor in delta I-IIB did this affect the time course of synaptic depression (see revised Figs. 6I, M). This indicates that at low stimulation frequencies (1 and 10Hz) the time course of depression is not affected by mean quantal content. This is consistent with the paired pulse ratio at 100 ms interpulse interval shown in figures 6A-D. However, for synaptic depression at 1 Hz stimulation the variability of the data is higher for delta I-IIB (independent of external calcium concentration, see rev. Fig. 6I), which might also be due to reduced channel number in this genotype. Taken together, the data are in line with the idea that altered cac channel numbers in active zones are sufficient to explain all effects that we observe upon I-IIB excision on PPRs and synaptic depression at low stimulation frequencies. This is now clarified in the revised text on page 12, lines 3 to 7.

      (12) The GFP-tagged I-IIA and mEOS4b-tagged I-IIB cac puncta shown in Figure 6N appear larger than the Brp puncta. Endogenously tagged cac puncta are typically smaller than Brp puncta (Gratz et al., 2019). Also, the I-IIA and I-IIB fluorescence sometimes appear to be partially non-overlapping. First, I suggest adding panels that show all three channels merged. Second, could they analyze the area and area overlap of I-IIA and I-IIB with regard to each other and to Brp, and compare it to cac-GFP? Any speculation as to how the different tags could affect localization? Finally, I recommend moving the dI-IIA and dI-IIB localization data shown in Figure 6N to an earlier figure (Figure 1 or Figure 3).

      We now show panels with the two I-II cac isoforms merged in the revised figure 7H (previously 6N). We also tested merging all three labels as suggested, but found this not instructive for the reader. We thank the reviewer for pointing out that the Brp puncta appeared smaller than the cac puncta in some panels. We carefully went through the data and found that the Brp puncta are not systematically smaller than the cac puncta. Please note that punctum size can appear quite differently, depending on different staining qualities as well as different laser intensities and different point spread in different imaging channels. The purpose of this figure was not to analyze punctum size and labeling intensity, but instead, to demonstrate that I-IIA and I-IIB are both present in most active zones, but some active zones show only I-IIB labeling, as quantified in figure 7I. We did not follow the suggestion to conduct additional co-localization analyses and compare it with cac-GFP controls, because Pearson co-localization coefficients for cac-GFP and all exon-out variants analyzed, including delta I-IIA and delta I-IIB are presented in the revised figure 4D. Moreover, delta I-IIA and delta I-IIB show similar Manders 1 and 2 co-localization coefficients with Brp (see Figs. 4E, F). We do not want to speculate whether the different tags have any effect on localization precision. Artificial differences in localization precision can also be suggested by different antibodies, but we know from our STED analyses with identical tags and antibodies for all isoforms that I-IIA and I-IIB co-localize identically with Brp (see Figs. 5A-E). Finally, we prefer to not move the figure because we believe it is informative to show our finding that active zones usually contain both splice I-II variants together with the finding that only I-IIB is required for PHP.

      Recommendations for the authors:

      Reviewing Editor Comments:

      We thank you for your submission. All three reviewers urge caution in interpreting the S4 splice variant playing a role specifically in Cac localization, as opposed to just leading to instability and degradation. There are other issues with the electrophysiological experiments, a need for improved imaging and analyses, and some areas of interpretation detailed in the reviews.

      We agree that additional data was required to conclude that IS4 splicing plays a specific role in cac channel localization and is not just leading to channel instability and degradation. As outlined in detail in our response to reviewer 1, comment 1, we conducted several sets of experiments to support our interpretation. First, electrophysiological experiments show that upon removal of IS4B, which eliminates synaptic transmission at the larval NMJ and cac positive label in presynaptic active zones, somatodendritic cac current is reliably recorded (new data in revised figure 3C). This is not in line with a channel instability or degradation effect, but instead with IS4B containing isoforms being required and sufficient for evoked release from NMJ motor terminals, whereas IS4A isoforms are not sufficient for evoked release from axon terminals, but IS4A isoforms alone can mediate a distinct component of somatodendritic calcium current. Second, immunohostochemical analyses reveal that IS4A, which is not present in NMJ presynaptic active zones, is expressed sparsely, but in reproducible patterns in the larval brain lobes and in specific regions of the anterior VNC parts (new supplementary figure 1). Again, the absence of a IS4A-containing cac isoform from presynaptic active zones but their simultaneous presence in other parts of the nervous system is in accord with isoform specific localization, but not with general channel isoform instability. Third, enlargements of NMJ boutons with brp positive presynaptic active zones confirm the absence of IS4A and the presence of IS4B in active zones (these enlargements are now shown in the revised figures 2A-C, 3A, and 4A-C). Fourth, as suggested we have quantified the Pearson co-localization of IS4 isoforms with Brp in presynaptic active zones (revised Fig. 2D). This confirms quantitatively similar co-localization of IS4B and control with Brp, but no co-localization of IS4A with Brp. In fact, the labeling intensity of IS4A in presynaptic active zones is quantitatively not significantly different from background, no IS4A label is detected anywhere in the axon terminals at the NMJ, but we find IS4 label in the CNS. Together, these data strongly support our interpretation that the IS4 splice site plays a distinct role in cac channel localization. Figure legends as well as results and discussion section have been modified accordingly (the respective page and line numbers are listed in our-point-by-point responses).

      In addition, we have carefully addressed all other public comments as well as all other recommendations for authors by providing multiple new data sets, new image analyses, and revising text. Addressing the insightful comments of all three reviewers and the reviewing editor has greatly helped to make the manuscript better.

      Reviewer #1 (Recommendations For The Authors):

      The conclusion that the IS4B exon controls Cac localization to active zones versus simply being required for channel abundance is not well supported. The authors need to either mention both possibilities or provide stronger support for the active zone localization model if they want to emphasize this point.

      We agree and have included several additional data sets as outlined in our response to point 1 of reviewer 1 and to the reviewing editor (see above). These new data strongly support our interpretation that the IS4B exon controls Cac localization to active zones and is not simply required for channel abundance. The additions to the figures and accompanying text (including the respective figure panel, page, and line numbers) are listed in the point-bypoint responses to the reviewers’ public suggestions.

      Figure 2C staining for Cac localization in the delta 4B line is difficult to compare to the others, as the background staining is so high (muscles are green for example). As such, it is hard to determine whether the arrows in C are just background.

      We had over-emphasized the green label to show that there really is no cacophony label in active zones. However, we agree that this hampered image interpretation. Thus, we have adjusted brightness such that it matches the other genotypes (see new figure panel 2C, and figure 3A, bottom). Revising the figure as suggested by the reviewer shows much more clearly that IS4B puncta are detected exclusively in presynaptic active zones, whereas IS4A channels are not detectable in active zones or anywhere else in the axon terminal boutons. Quantification of IS4A label in brp positive active zones confirms that labeling intensity is not significantly above background (page 6, lines 29 to 31 and page 7, lines 19 to 21). Therefore, IS4A is not detectable in active zones at the NMJ.

      It seems more likely that the removal of the 4B exon simply destabilizes the protein and causes it to be degraded (as suggested by the Western), rather than mislocalizing it away from active zones. It's hard to imagine how some residue changes in the S4 voltage sensor would control active zone localization to begin with. The authors should note that the alternative explanation is that the protein is just degraded when the 4B exon is removed.

      Based on additional data and analyses, we disagree with the interpretation that removal of IS4B disrupts protein integrity and present multiple lines of evidence that support sparse expression of IS4A channels (ΔIS4B). As outlined in our response to reviewer 1 and to the reviewing editor, we show (1) in new immunohistochemical stainings (new supplementary figure 1) that upon removal of IS4B, sparse label is detectable in the VNC and the brain lobes (for detail see above). (2) In our new figure 3C, we show cacophony-mediated somatodendritic calcium currents recorded from adult flight motoneurons in a control situation and upon removal of IS4B that leaves only IS4A channels. This clearly demonstrates that IS4A underlies a substantial component of the HVA somatodendritic calcium current, although it is absence from axon terminals. This is in line with isoform specific functions at different locations, but not with IS4A instability/degradation. (3) We do not agree with the reviewer’s interpretation of the Western Blot data in figure 1E (formerly figure 1D). Together with our immunohistochemical data that show sparse cacophony IS4A expression, we think that the faint band upon removal of IS4B in a heterozygous background (that reduces labeled channels even further) reflects the sparseness of IS4A expression. This sparseness is not due to channel instability, but to IS4A functions that are less abundant than the ubiquitously expressed cac<sup>IS4B</sup> channels at presynaptic active zones of fast chemical synapses (see page 15, lines 24 to 29).

      If they really want to claim the 4B exon governs active zone localization, much higher quality imaging is required (with enlarged views of individual boutons and their AZs, rather than the low-quality full NMJ imaging provided). Similarly, higher resolution imaging of Cac localization at Muscle 12 (Figure 2H) boutons would be very useful, as the current images are blurry and hard to interpret. Figure 6N shows beautiful high-resolution Cac and Brp imaging in single boutons for the I-II exon manipulations - the authors should do the same for the 4B line. For all immuno in Figure 2, it is important to quantify Cac intensity as well. There is no quantification provided, just a sample image. The authors should provide quantification as they do for the delta I-II exons in Figure 3.

      We did as suggested and added figure panels to figure 2A-C and to new figures 3A (formerly part of figure 2 and 4A-C (formerly figure 3) showing magnified label at the NMJ AZs to better judge on cacophony expression after exon excision. These data are now referred to in the results section on page 6, lines 22 to 24, page 7, lines 18 to 21 and page 8, lines 17/18.

      As suggested, we now also provide quantification of co-localization with brp puncta as Pearson’s correlation coefficient for control, IS4B, and IS4A in the new figure panel 2D (text on page 6, lines 34 to 38). This further underscores control-like active zone localization of IS4B but no significant active zone localization of IS4A. As suggested, we quantified now also the intensity of IS4B label in active zones, and it was not different from control (see revised figure 4H and text on page 8, lines 38/39). We did not quantify the intensity of IS4A label, because it was not over background (text, page 6, lines 30/31).

      Reviewer #2 (Recommendations For The Authors):

      (1a) Questions about the engineered Cac splice isoform alleles:

      The authors using CRISPR gene editing to selectively remove the entire alternatively spliced exons of interest. Do the authors know what happens to the cac transcript with the deleted exon? Is the deleted exon just skipped and spliced to the next exon? Or does the transcript instead undergo nonsense-mediated decay?

      We do not believe that there is nonsense mediated mRNA decay, because for all exon excisions the respective mRNA and protein are made. Protein has been detected on the level of Western blotting and immunocytochemistry. Therefore, we are certain that the mRNA is viable for each exon excision (and we have confirmed this for low abundance cac protein isoforms by rt-PCR), but only subsets of cac isoforms can be made from mRNAs that are lacking specific exons. However, we can not make any statements as to whether the lack of specific protein isoforms exerts feedback on mRNA stability, the rate of transcription and translation, or other unknown effects.

      (1b) While it is clear that the IS4 exons encode part of the voltage sensor in the first repeat, are there studies in Drosophila to support the putative Ca-beta and G-protein beta-gamma binding sites in the I-II loop? Or are these inferred from Mammalian studies?

      To the best of our knowledge, there are no studies in Drosophila that unambiguously show Caβ and Gβγ binding sites in the I-II loop of cacophony. However, sequence analysis strongly suggests that I-IIB contains both, a Caβ as well as a Gβγ binding site (AID: α-interacting domain) because the binding motif QXXER is present. In mouse Cav2.1 and Ca<sub>v</sub>2.2 channels the sequence is QQIER, while in Drosophila cacophony I-IIB it is QQLER. In the alternative IIIA, this motif is not present, strongly suggesting that G<sub>βγ</sub> subunits cannot interact at the AID. However, as already suggested by Smith et al. (1998), based on sequence analysis, Ca<sub>β</sub> should still be able to bind, although possibly with a lower affinity. We agree that this information should be given to the reader and have revised the text accordingly on page 5, lines 9 to 17.

      (1c) The authors assert that splicing of Cav2/cac in flies is a means to encode diversity, as mammals obviously have 4 Cav2 genes vs 1 in flies. However, as the authors likely know, mammalian Cav2 channels also have various splice isoforms encoded in each of the 4 Cav2 genes. The authors should discuss in more detail what is known about the splicing of individual mammalian Cav2 channels and whether there are any homologous properties in mammalian channels controlled by alternative splicing.

      We agree and now provide a more comprehensive discussion of vertebrate Ca<sub>v</sub>2 splicing and its impact on channel function. In line to what we report in Drosophila, properties like G<sub>βγ</sub> binding and activation voltage can also be affected by alternative splicing in vertebrate Ca<sub>v</sub>2 channel, through the exon patterns are quite different from Drosophila. We integrated this part on page 14, first paragraph) in the revised discussion. The respective text is below for the reviewer’s convenience:

      “However, alternative splicing increases functional diversity also in mammalian Ca<sub>v</sub>2 channels. Although the mutually exclusive splice site in the S4 segment of the first homologous repeat (IS4) is not present in vertebrate Cav channels, alternative splicing in the extracellular linker region between S3 and S4 is at a position to potentially change voltage sensor properties (Bezanilla 2002). Alternative splice sites in rat Ca<sub>v</sub>2.1 exon 24 (homologous repeat III) and in exon 31 (homologous repeat IV) within the S3-S4 loop modulate channel pharmacology, such as differences in the sensitivity of Ca<sub>v</sub>2.1 to Agatoxin. Alternative splicing is thus a potential cause for the different pharmacological profiles of P- and Q-channels (both Ca<sub>v</sub>2.1; Bourinet et al. 1999). Moreover, the intracellular loop connecting homologous repeats I and II is encoded by 3-5 exons and provides strong interaction with G<sub>βγ</sub>-subunits (Herlitze et al. 1996). In Ca<sub>v</sub>2.1 channels, binding to G<sub>βγ</sub> subunits is potentially modulated by alternative splicing of exon 10 (Bourinet et al. 1999). Moreover, whole cell currents of splice forms α1A-a (no Valine at position 421) and α1A-b (with Valine) represent alternative variants for the I-II intracellular loop in rat Ca<sub>v</sub>2.1 and Ca<sub>v</sub>2.2 channels. While α1A-a exhibits fast inactivation and more negative activation, α1A-b has delayed inactivation and a positive shift in the IV-curve (Bourinet et al. 1999). This is phenotypically similar to what we find for the mutually exclusive exons at the IS4 site, in which IS4B mediates high voltage activated cacophony currents while IS4A channels activate at more negative potentials and show transient current (Fig. 3; see also Ryglewski et al. 2012). Furthermore, altered Ca<sub>β</sub> interaction have been shown for splice isoforms in loop III (Bourinet et al. 1999), similar to what we suspect for the I-II site in cacophony. Finally, in mammalian VGCCs, the C-terminus presents a large splicing hub affecting channel function as well as coupling distance to other proteins. Taken together, Ca<sub>v</sub>2  channel diversity is greatly enhanced by alternative splicing also in vertebrates, but the specific two mutually exclusive exon pairs investigated here are not present in vertebrate Ca<sub>v</sub>2 genes.”

      (1d) In Figure 1, it would be helpful to see the entire cac genomic locus with all introns/exons and the 4 specific exons targeted for deletion.

      We agree and have changed figure 1 accordingly.

      (2a) Cav2.IS4B deletion alleles:

      More work is necessary to explain the localization of Cac controlled by the IS4B exon. First, can the authors determine whether actual Cac channels are present at NMJ boutons? The authors seem to indicate that in the IS4B deletion mutants, some Cac (GFP) signal remains in a diffuse pattern across NMJ boutons. However, from the imaging of wild-type Cac-GFP (and previous studies), there is no Cac signal outside of active zones defined by the BRP signal. It would benefit the study to a) take additional, higher resolution images of the remaining Cac signal at NMJs in IS4B deletion mutants, and b) comment on whether the apparent remaining signal in these mutants is only observed in the absence of IS4Bcontaining Cac channels, or if the IS4A-positive channels are normally observed (but perhaps mis-localized?).

      We have conducted additional analyses to show convincingly that IS4A channels (that remain upon IS4B deletion) are absent from presynaptic active zone. Please see also responses to reviewers 1 and 3. By adjusting the background values in of CLSM images to identical values in control, delta IS4A, and delta IS4B, as well as by providing selective enlargements as suggested, the figure panels 2C, Ci and 3A now show much clearer, that upon deletion of IS4B no cac label remains in active zones or anywhere else in the axon terminal boutons (see text on page 6, lines 22 to 24). This is further confirmed by quantification showing the in IS4B mutants cac labeling intensity in active zones is not above background (see text on page 6, lines 27 to 31). We never intended to indicate that there was cac signal outside of active zones defined by the brp signal, and we now carefully went through the text to not indicate this possibility unintentionally anywhere in the manuscript.

      (2b) Do the authors know whether any presynaptic Ca2+ influx is contributed by IS4Apositive Cac channels at boutons, given the potential diffuse localization? There are various approaches for doing presynaptic Ca2+ imaging that could provide insight into this question.

      We agree that this is an interesting question. However, based on the revisions made, we now show with more clarity that IS4A channels are absent from the presynaptic terminal at the NMJ. IS4A labeling intensities within active zones and anywhere else in the axon terminals are not different from background (see text on page 6, lines 27 to 31 and revised Figs. 2C, Ci, and 3A with new selective enlargements in response to comments of both other reviewers). This is in line with our finding that evoked synaptic transmission from NMJ axon terminals to muscle cells is mostly absent upon excision of IS4B (see Fig. 3B). The very small amplitude EPSC (below 5 % of the normal amplitude of evoked EPSCs) that can still be recorded in the absence of IS4B is similar to what is observed in cac null mutant junctions and is mediated by calcium influx through another voltage gated calcium channels, a Ca<sub>v</sub>1 homolog named Dmca1D, as we have previously published (Krick et al., 2021, PNAS 118(28):e2106621118. Gathering additional support for the absence of IS4A from presynaptic terminals by calcium imaging experiments would suffer significantly from the presence of additional types of VGCCs in presynaptic terminals (for sure Dmca1D (Krick et al., 2021) and potentially also the Ca<sub>v</sub>3 homolog DmαG or Dm-α1T). Such experiments would require mosaic null mutants for cac and DmαG channels in a mosaic IS4B excision mutant, which, if feasible at all, would be very hard and time consuming to generate. In the light of the additional clarification that IS4A is not located in NMJ axon terminal boutons, as shown by additional labeling intensity analysis, revised figures with selective enlargement, and revised text, we feel confident to state that IS4A is not sufficient for evoked SV release.

      (2c) Mechanistically, how are amino acid changes in one of the voltage sensing domains in Cac related to trafficking/stabilization/localization of Cac to AZs?

      This is an exciting question that has occupied our discussions a lot. Some sorting mechanism must exist that recognizes the correct protein isoforms, just as sorting and transport mechanisms exist that transport other synaptic proteins to the synapse. We do not think that the few amino acid changes in the voltage sensor are directly involved in protein targeting. We rather believe that the cacophony variants that happen to contain this specific voltage sensor are selected for transport out to the synapse. There are possibilities to achieve this cell biological, but we have not further addressed potential mechanisms because we do not want enter the realms of speculation.

      (3) How are auxiliary subunits impacted in the Cac isoform mutants?

      Recent work by Kate O'Connor-Giles has shown that both Stj and Ca-Beta subunits localize to active zones along with Cac at the Drosophila NMJ. Endogenously tagged Stj and CaBeta alleles are now available, so it would be of interest to determine if Stj and particular Cabeta levels or localization change in the various Cac isoform alleles. This would be particularly interesting given the putative binding site for Ca-beta encoded in the I-II linker.

      We agree that the synthesis of the work of Kate O'Connor-Giles group and our study open up new avenues to explore exciting hypotheses about differential coupling of specific cacophony splice isoforms with distinct accessory proteins such as Caβ and α<sub>2</sub>δ subunits. However, this requires numerous full sets of additional experiments and is beyond the scope of this study.

      (4a) Interpretation of short-term plasticity in the I-IIB exon deletion:

      The changes in short-term plasticity presented in Figure 5 are interpreted as an additional phenotype due to the loss of the I-IIB exon, but it seems this might be entirely explained simply due to the reduced Cac levels. Reduced Cac levels at active zones will obviously reduce Ca2+ influx and neurotransmitter release. This may be really the only phenotype/function of the I-IIB exon. Hence, to determine whether loss of the I-IIB exon encodes any functions in short-term plasticity, separate from reduced Cac levels, the authors should compare short-term plasticity in I-IIB loss alleles compared to wild type with starting EPSC amplitudes are equal (for example by reducing extracellular Ca2+ levels in wild type to achieve the same levels at in Cac I-IIB exon deleted alleles). Reduced release probability, simply by reduced Ca2+ influx (either by reduced Cac abundance or extracellular Ca2+) should result in more variability in transmission, so I am not sure there is any particular function of the I-IIB exon in maintaining transmission variability beyond controlling Cac abundance at active zones.

      For two reasons we are particularly grateful for this comment. First, it shows us that we needed to explain much clearer that our interpretation is that changes in paired pulse ratios (PPRs) and in depression at low stimulation frequencies are a causal consequence of lower channel numbers upon I-IIB exon deletion, precisely as pointed out by the reviewer. We have carefully revised the text accordingly on page 10, lines 14-25, page 11, lines 3-7 and 22-28; page 16, lines 36-38. Second, the experiment suggested by the reviewer is superb to provide additional evidence that the cause of altered PPRs is in fact reduced channel number, but not altered channel properties. Accordingly, we have conducted additional TEVC recordings in elevated external calcium (1.8 mM) so that the single PSC amplitudes in I-IIB excision animals match those of controls in 0.5 mM extracellular calcium. This makes the amplitudes and the variance of PPR for all interpulse intervals tested control-like (see revised Figs. 6D, E). This strongly indicates that differences observed in PPRs as well as the variance thereof were caused by the amount of calcium influx during the first EPSC, and thus by different channel numbers in active zones.

      (4b) Another point about the data in Figure 5: If "behaviorally relevant" motor neuron stimulation and recordings are the goal, the authors should also record under physiological Ca2+ conditions (1.8 mM), rather than the highly reduced Ca2+ levels (0.5 mM) they are using in their protocols.

      Although we doubt that the effective extracellular calcium concentration that determines the electromotoric force for calcium to enter the ensheathed motoneuron terminals in vivo during crawling is known, we followed the reviewer’s suggestion partly and have repeated the high frequency stimulation trains for ΔI-IIB in 1.8 mM calcium. As for short-term plasticity this brings the charge conducted to values as observed in control and in ΔI-IIA in 0.5 mM calcium. Therefore, all difference observed in previous figure 5 (now revised figure 6) can be accounted to different channel numbers in presynaptic active zones. This is now explained on page 11, lines 19-28. For controls recordings at high frequency stimulation in higher external calcium (e.g. 2 mM) have previously been published and show significant synaptic depression (e.g. Krick et al., 2021, PNAS). Given that in the exon out variants we do not expect any differences except from those caused by different channel numbers, we did not repeat these experiments for control and ΔI-IIA.

      (5a) Mechanism of Cac's role in PHP :

      As the authors likely know, mutations in Cac were previously reported to disrupt PHP expression (see Frank et al., 2006 Neuron). Inexplicably, this finding and publication were not cited anywhere in this manuscript (this paper should also be cited when introducing PhTx, as it was the first to characterize PhTx as a means of acutely inducing PHP). In the Frank et al. paper (and in several subsequent studies), PHP was shown to be blocked in mutations in Cac, namely the CacS allele. This allele, like the I-IIB excision allele, reduces baseline transmission presumably due to reduced Ca2+ influx through Cac. The authors should at a minimum discuss these previous findings and how they relate to what they find in Figure 6 regarding the block in PHP in the Cac I-IIB excision allele.

      We thank the reviewer for pointing this out and apologize for this oversight. We agree that it is imperative to cite the 2006 paper by Frank et al. when introducing PhTx mediated PHP as well as when discussing cac the effects of cac mutants on PHP together with other published work. We have revised the text accordingly on page 12, lines 9-11 and 21-23 and on page 17, lines 29-33.

      In terms of data presentation in Fig. 6, as is typical in the field, the authors should normalize their mEPSC/QC data as a percentage of baseline (+PhTx/-PhTx). This makes it easier to see the reduction in mEPSC values (the "homeostatic pressure" on the system) and then the homeostatic enhancement in QC. Similarly, in Fig. 6M, the authors should show both mEPSC and QC as a percentage of baseline (wild type or non-GluRIIA mutant background).

      We agree and have changed figure presentation accordingly. Figure 7 (formerly figure 6) was updated as was the accompanying results text on page 12, lines 23-40.

      (6) Cac I-IIA and I-IIB excision allele colocalization at AZs:

      These are very nice and important experiments shown in Figures 6N and O, which I suggest the authors consider analyzing in further detail. Most significantly:

      (6i) The authors nicely show that most AZs have a mix of both Cac IIA and IIB isoforms. Using simple intensity analysis, can the authors say anything about whether there is a consistent stoichiometric ratio of IIA vs IIB at single AZs? It is difficult to extract actual numbers of IIA vs IIB at individual AZs without having both isoforms labeled mEOS4b, but as a rough estimate can the authors say whether the immunofluorescence intensity of IIA:IIB is similar across each AZ? Or is there broad heterogeneity, with some AZs having low vs high ratios of each isoform (as the authors suggest across proximal to distal NMJ AZs)?

      We agree and have conducted experiments and analyses to provide these data. We measured the cac puncta fluorescence intensities for heterozygous cac<sup>sfGFP</sup>/cac, cacIIIA<sup>sfGFP</sup>/cacI-IIB, and cacI-IIB<sup>sfGFP</sup>/cacI-IIA animals. We preferred this strategy, because intensity was always measured from cac puncta with the same GFP tag. Next, we normalized all values to the intensities obtained in active zones from heterozygous cac<sup>sfGFP</sup>/cac controls and then plotted the intensities of I-IIA versus I-IIB containing active zones side by side. Across junctions and animals, we find a consistent ratio 2:1 in the relative intensities of I-IIB and I-IIA, thus indicating on average roughly twice as many I-IIB as compared to I-IIA channels across active zones. This is consistent with the counts in our STED analysis (see Fig. 5F). These new data are shown in the new figure panel 7J and referred to on page 13, lines 10-16 in the revised text.

      (6ii) Intensity analysis of Cac IIA vs IIB after PHP: Previous studies have shown Cac abundance increases at NMJ AZs after PHP. Can the authors determine whether both Cac IIA vs IIB isoforms increase after PHP or whether just one isoform is targeted for this enhancement?

      We already show that PHP is not possible in the absence of I-IIB channels (see figure 7). However, we agree that it is an interesting question to test whether I-IIA channel are added in the presence of I-IIB channels during PHP, but we consider this a detail beyond the scope of this study.

      Minor points:

      (1) Including line numbers in the manuscript would help to make reviewing easier.

      We agree and now provide line numbers.

      (2) Several typos (abstract "The By contrast", etc).

      We carefully double checked for typos.

      (3) Throughout the manuscript, the authors refer to Cac alleles and channels as "Cav2", which is unconventional in the field. Unless there is a compelling reason to deviate, I suggest the authors stick to referring to "Cac" (i.e. cacdIS4B, etc) rather than Cav2. The authors make clear in the introduction that Cac is the sole fly Cav2 channel, so there shouldn't be a need to constantly reinforce that cac=Cav2.

      We agree and have changed all fly Ca<sub>v</sub>2 reference to cac.

      (4) In some figures/text the authors use "PSC" to refer to "postsynaptic current", while in others (i.e. Figure 6) they switch to the more conventional terms of mEPSC or EPSC. I suggest the authors stick to a common convention (mEPSC and EPSC).

      We have changed PSC to EPSC throughout.

      Reviewer #3 (Recommendations For The Authors):

      (1) The abstract could focus more on the results at the expense of the background.

      We agree and have deleted the second introductory background sentence and added information on PPRs and depression during low frequency stimulation.

      (2) What does "strict" active zone localization refer to? Could they please define the term strict?

      Strict active zone localization means that cac puncta are detected in active zones but no cac label above background is found anywhere else throughout the presynaptic terminal, now defined on page 6, lines 27-29.

      (3) Single boutons/zoomed versions of the confocal images shown in Figures 2A-C, 2H, and 3A-C would be very helpful.

      We have provided these panels as suggested (see above and revised figures 2-4). Figure 3 is now figure 4.

      (4) The authors cite Ghelani et al. (2023) for increased cac levels during homeostatic plasticity. I recommend citing earlier work making similar observations (Gratz et al., 2019; DOI: 10.1523/JNEUROSCI.3068-18.2019), and linking them to increased presynaptic calcium influx (Müller & Davis, 2012; DOI: 10.1016/j.cub.2012.04.018).

      We agree and have added Gratz et al. 2019 and Davis and Müller 2012 to the results section on page 12, lines 17/18 and lines 21-23, in the discussion on page 17, lines 29-33.

      (5) The data shown in Figure 3 does not directly support the conclusion of altered release probability in dI-IIB. I therefore suggest changing the legend's title.

      We have reworded to “Excisions at the I-II exon do not affect active zone cacophony localization but can alter cacsfGFP label intensity in active zones and PSC amplitude” as this is reflecting the data shown in the figure panels more directly.

      (6) It would be helpful to specify "adult flight muscle" in Figure 2J.

      We agree that it is helpful to specify in the figure (now revised figure 3C) that the voltage clamp recordings of somatodendritic calcium current were conducted in adult flight motoneurons and have revised the headline of figure panel 3C and the legend accordingly. Please note, these are not muscle cells but central neurons.

      (7) Do dIS4B/Cav2null MNs indeed show an inward or outward current at -90 to -70 mV/-40 and -50 mV, or is this an analysis artifact?

      No, this is due to baseline fluctuations as typical for voltage clamp in central neurons with more than 6000 µm dendritic length and more than 4000 dendritic branches.

      (8) Loss of several presynaptic proteins, including Brp (Kittel et al., 2006), and RBP (Liu et al., 2011), induce changes in GluR field size (without apparent changes in miniature amplitude). The statement regarding the Cav2 isoform and possible effects on GluR number (p. 8) should be revised accordingly.

      We understand and have done two things. First, we measured the intensity of GluRIIA immunolabel in ΔI-IIA, ΔI-IIB, and controls and found no differences. Second, we reworded the statement. It now reads on page 9, lines 1-6: “It seems unlikely that presynaptic cac channel isoform type affects glutamate receptor types or numbers, because the amplitude of spontaneous miniature postsynaptic currents (mEPSCs, Fig. 4K) and the labeling intensity of postsynaptic GluRIIA receptors are not significantly different between controls, I-IIA, and I-IIB junctions (see suppl. Fig. 2, p = 0.48, ordinary one-way ANOVA, mean and SD intensity values are 61.0 ± 6.9 (control), 55.8 ± 8.5 (∆I-IIA), 61.1 ± 17.3 (∆I-IIB)). However, we cannot exclude altered GluRIIB numbers and have not quantified GluR receptor field sizes.”

      (9) The statement relating miniature frequency to RRP size is unclear (p. 8). Is there any evidence for a correlation between miniature frequency to RRP size? Could the authors please clarify?

      We agree that this statement requires caution. Although there is some published evidence for a correlation of RRP size and mini frequency (Neuron, 2009 61(3):412-24. doi: 10.1016/j.neuron.2008.12.029 and Journal of Neuroscience 44 (18) e1253232024; doi: 10.1523/JNEUROSCI.1253-23.2024), which we now refer to on page 9, it is not clear whether this is true for all synapses and how linear such a relationship may be. Therefore, we have revised the text on page 9, lines 6-9. It now reads: “Similarly, the frequency of miniature postsynaptic currents (mEPSCs) remains unaltered. Since mEPSCs frequency has been related to RRP size at some synapses (Pan et al., 2009; Ralowicz et al., 2024) this indicates unaltered RRP size upon I-IIB excision, but we have not directly measured RRP size.”

      (10) Please define the "strict top view" of synapses (p. 8).

      Top view is what this reviewer referred to as “planar view” in the public review points 6 and 7. In our responses to these public review points we now also define “strict top view”, see page 9, lines 17-19.

      (11) Two papers are cited regarding a linear relationship between calcium channel number and release probability (p. 15). Many more papers could be cited to demonstrate a supralinear relationship (e.g., Dodge & Rahaminoff, 1967; Weyhersmüller et al., 2011 doi: 10.1523/JNEUROSCI.6698-10.2011). The data of the present study were collected at an extracellular calcium concentration of 0.5 mM, whereas Meideiros et al. (2023) used 1.5 mM. The relationship between calcium and release is supra-linear around 0.5 mM extracellular calcium (Weyhersmüller et al. 2011). This should be discussed/the statements be revised. Also, the reference to Meideiros et al. (2023) should be included in the reference list.

      We have now updated the Medeiros reference (updated version of that paper appeared in eLife in 2024) in the text and reference list. We agree that the relationship of the calcium concentration and P<sub>r</sub> can also be non-linear and refer to this on page 16, lines 26-32, but the point we want to make is to relate defined changes in calcium channel number (not calcium influx) as assessed by multiple methods (CLSM intensity measures and sptPALM channel counting) to release probability. We now also clearly state that we measured at 0.5 mM external calcium (page 16, lines 27/28) whereas Medeiros et al. 2024 measured at 1.5 mM calcium (page 16, lines 31/32).

      (12) Figure 6: Quantal content does not have any units - please remove "n vesicles".

      We have revised this figure in response to reviewer 2 (comment 5) and quantal content is now expressed as percent baseline, thus without units (see revised figure 7).

      (13) Figure 6C should be auto-scaled from zero.

      This has been fixed by revising that figure in response to reviewer 2 (comment 5)

      (14) The data supporting the statement on impaired motor behavior and reduced vitality of adult IS4A should be either shown, or the statement should be removed (p. 13). Any hypotheses as to why IS4A is important for behavior and or viability?

      As suggested, we have removed that statement.

      (15) They do not provide any data supporting the statement that changes in PSC decay kinetics "counteract" the increase in PSC amplitude (p. 14). The sentence should be changed accordingly.

      We agree and have down toned. It now reads on page 16, lines 7-9: “During repetitive firing, the median increase of PSC amplitude by ~10 % is potentially counteracted by the significant decrease in PSC half amplitude width by ~25 %...”.

      (16) How do they explain the net locomotion speed increase in dI    -IIA larvae? Although the overall charge transfer is not affected during the stimulus protocols used, could the accelerated PSC decay affect PSP summation (I would actually expect a decrease in summation/slower speed)? Independent of the voltage-clamp data, is muscle input resistance changed in dI-IIA mutants?

      Muscle input resistance is not altered in I-II mutants. We refer to potential causes of the locomotion effects of I-IIA excision in the discussion. On page 16, lines 12 to 21 it reads: “there is no difference in charge transfer from the motoneuron axon terminal to the postsynaptic muscle cell between ∆I-IIA and control. Surprisingly, crawling is significantly affected by the removal of I-IIA, in that the animals show a significantly increased mean crawling speed but no significant change in the number of stops. Given that the presynaptic function at the NMJ is not strongly altered upon I-IIA excision, and that I-IIA likely mediates also Ca<sub>v</sub>2 functions outside presynaptic AZs (see above) and in other neuron types than motoneurons, and that the muscle calcium current is mediated by Ca<sub>v</sub>1>/i> and Ca<sub>v</sub>3, the effects of I-IIA excision of increasing crawling speed is unlikely caused by altered pre- or postsynaptic function at the NMJ. We judge it more likely that excision of I-IIA has multiple effects on sensory and pre-motor processing, but identification of these functions is beyond the scope of this study.”

    1. Author response:

      The following is the authors’ response to the previous reviews.

      Comments on the revised version:

      Concerns flagged about using CRISPR -guide RNA mediated knockdown of viral has yet to be addressed entirely. I understand that the authors could not get knock out despite attempts and hence they have guide RNA mediated knockdown strategy. However, I wondered if the authors looked at the levels of the downstream genes in this knockdown.

      We thank the reviewer for bringing this up since it is known that certain artifacts derived from this approach may be related with changes in expression of downstream genes. We run a qPCR of Rv0432 and Rv0433 and confirmed that no significant differences in expression of virR downstream genes were detected in the virR mutant or the complemented strains relative to WT. This is now indicated in the method section on Generation of the CRISPR mutants. The data is now presented as Supplementary Figure 13.

      Authors have used the virmut-Comp strain for some of the experiments. However, the materials and methods must describe how this strain was generated. Given the mutant is a CRISPR-guide RNA mediated knockdown. The CRISPR construct may have taken up the L5 loci. Did authors use episomal construct for complementation? If so, what is the expression level of virR in the complementation construct? What are the expression levels of downstream genes in mutant and complementation strains? This is important because the transcriptome analysis was redone by considering complementation strain. The complemented strain is written as virmut-C or virmut-Comp. This has to be consistent.

      We apologize for not having included the information about the generation of the complemented strain in our last version of the manuscript. We took the complementing vector from a previous paper on VirR (Rath et al., (2013) PNAS 110(49):E4790). This vector was constructed as follows: Complementation plasmids were cloned using Gateway® Cloning Technology (Invitrogen). E. coli strains expressing the following Gateway vectors were kindly provided by Dirk Schnappinger and Sabine Ehrt: pDO221A, pDO23A, pEN23A-linker1, pEN41A-TO2, pEN21A-Hsp60, pDE43-MEH. PCR was used to amplify the following target sequences from H37Rvgenomic DNA: coding sequence of Rv0431, coding sequence of Rv0431 with a FLAG tag either in its C-terminus or its N-terminus, and the predicted cytosolic sequence of Rv0431 with a FLAG tag in its new C-terminus. The primers used for PCR were designed such that the amplicons would be flanked with Gateway® cloning- specific attachment (att) sites. These PCR products were recombined into Gateway® donor vectors using bacteriophage-derived integrase and integration host factor, resulting in entry vectors. The recombination events are specific to the attB sites on the PCR products and to the attP sequences on the donor vectors, such that the orientation of the target sequence is maintained during the recombination reaction, also known as the BP reaction, for attB-attP recombination. Using the MultiSite Gateway® system, three DNA fragments, derived from each of three distinct entry vectors, can be simultaneously inserted into a final complementation vector called the destination vector in a specific order and orientation. Multisite recombination events are mediated by Integrase and Integrase Host Factor, in a process called the LR reaction (for the attL and attR sites in the entry and destination vectors). The Gateway® entry vectors thus generated were recombined with another entry vector containing either the Hsp60 promoter, an empty entry vector, and a complementation vector (episomal) to give rise to the final destination vector. The destination vector (episomal) was engineered to contain a hygromycin resistance cassette. These vectors were used to transform competent Rv0431-deficient Mtb. The transformation mixture was plated on 7H11 plates containing OADC and hygromycin (50 μg/ml). Colonies, typically observed 3-5 weeks later, were isolated and grown in 7H9 media and characterized.

      For simplicity, we have just referenced our previous paper to indicate that the complementing plasmid is the same used in that study.

      Regarding the virR expression levels in the WT, virR<sup>mut</sup> and complemented virR strains please see previous Figure 6 C.

      Recommendations for the authors:

      Reviewer #1 (Recommendations for the authors):

      The authors have revised the manuscript in light of previous reviews. The authors have addressed some of my concerns appropriately. However, the specific dataset remains unchanged and unclear.

      Fig 8G and H: In response to a comment on the mechanism of how VirR mediates EV release, the authors have added new data showing an increase in the abundance of deacetylated muropeptides in the mutant. This observation is linked to altered lysozyme activity or PG fragility. In my opinion, this is another indirect observation. More concerning is the complemented strain, which also showed a comparable increase in deacetylated muropeptides, indicating that the altered muropeptides could be unrelated to VirR.

      We must disagree here with the reviewer assessment about the fact that the abundance of deacetylated muropeptides is an indirect indication of PG fragility. We consider that this observation and quantitative fact is another additional evidence that indicate a more fragile PG. We believe that considering each of the supporting facts individually may be seen as indirect, but we would like that the reviewer take all the evidence together: (i) sensitivity to lysozyme; (ii) enlargement and altered physicochemical morphological characteristics including porosity or thickness; (iii) altered penetrance of FDAAs; and (iv) increased released of muropeptides. In this later fact, the complemented strain may not display the WT features, but this may be due to some artifacts derived from the complementation.

      Taking all together, we believe that the PG of virR<sup>mut</sup> is more fragile than that of the WT and the complemented strains based on a series of evidence. We hope the reviewer may consider this perspective when analyzing such a complex feature like PG fragility. So far, there is not a direct method to assess this condition.

      Lipid analyses are not comprehensive. The issue related to the need for more clarity of DIMA and DIMB still needs to be addressed. I understand that the authors do not have facilities to perform radioactive assays. However, they could have repeated the experiment to generate a better-quality image. Similarly, the newly generated SL-1, PAT, and DAT TLC could be of better quality. Bands still need to be resolved. The solvent front is irregular. The same is true for PIMs and DPG TLCs. With the evidence provided, the deregulation of cell wall lipids is incomplete.

      We agree with the reviewer that the quality of the TLC is not appropriate. We have no repeated the PDIM TLC (new Fig 7D). In addition, we have repeated the TLCs resolving sulfolipids in a 2D mode. For simplicity we just run the glycerol condition including the three strains. This is now part of a new Supplementary figure 8 B. For PIMs, we have a 1D and a 2D analysis that, after checking previous papers using similar approaches with no radioactivity, we consider that it has the desired quality to identify the indicated lipids.

      We hope this new data and repeated experiments satisfy the reviewer concerns.

      Thank you very much for your assessment and time to review this paper.

  6. Dec 2024
    1. Author response:

      The following is the authors’ response to the original reviews.

      eLife Assessment

      This valuable study reveals how a rhizobial effector protein cleaves and inhibits a key plant receptor for symbiosis signaling, while the host plant counters by phosphorylating the effector. The molecular evidence for the protein-protein interaction and modification is solid, though biological evidence directly linking effector cleavage to rhizobial infection is incomplete. With additional functional data, this work could have implications for understanding intricate plant-microbe dynamics during mutualistic interactions.

      Thank you for this positive comment. Our data strongly support the view that NFR5 cleavage by NopT impairs Nod factor signaling resulting in reduced rhizobial infection. However, other mechanisms may also have an effect on the symbiosis, as NopT targets other proteins in addition to NFR5. In our revised manuscript version, we discuss the possibility that negative NopT effects on symbiosis could be due to NopT-triggered immune responses. As mentioned in our point-by-point answers to the Reviewers, we included additional data into our manuscript. We would also like to point out that we are generally more cautious in our revised version in order to avoid over-interpreting the data obtained.

      Public Reviews:

      Reviewer #1 (Public Review):

      Bacterial effectors that interfere with the inner molecular workings of eukaryotic host cells are of great biological significance across disciplines. On the one hand they help us to understand the molecular strategies that bacteria use to manipulate host cells. On the other hand they can be used as research tools to reveal molecular details of the intricate workings of the host machinery that is relevant for the interaction/defence/symbiosis with bacteria. The authors investigate the function and biological impact of a rhizobial effector that interacts with and modifies, and curiously is modified by, legume receptors essential for symbiosis. The molecular analysis revealed a bacterial effector that cleaves a plant symbiosis signaling receptor to inhibit signaling and the host counterplay by phosphorylation via a receptor kinase. These findings have potential implications beyond bacterial interactions with plants.

      Thank you for highlighting the broad significance of rhizobial effectors in understanding legume-rhizobia interactions. We fully agree with your assessment and have expanded our Discussion (and Abstract) regarding the potential implications of our findings beyond bacterial interactions with plants. We mention the prospect of developing specific kinase-interacting proteases to fine-tune cellular signaling processes in general.

      Bao and colleagues investigated how rhizobial effector proteins can regulate the legume root nodule symbiosis. A rhizobial effector is described to directly modify symbiosis-related signaling proteins, altering the outcome of the symbiosis. Overall, the paper presents findings that will have a wide appeal beyond its primary field.

      Out of 15 identified effectors from Sinorhizobium fredii, they focus on the effector NopT, which exhibits proteolytic activity and may therefore cleave specific target proteins of the host plant. They focus on two Nod factor receptors of the legume Lotus japonicus, NFR1 and NFR5, both of which were previously found to be essential for the perception of rhizobial nod factor, and the induction of symbiotic responses such as bacterial infection thread formation in root hairs and root nodule development (Madsen et al., 2003, Nature; Tirichine et al., 2003; Nature). The authors present evidence for an interaction of NopT with NFR1 and NFR5. The paper aims to characterize the biochemical and functional consequences of these interactions and the phenotype that arises when the effector is mutated.

      Thank you for your positive feedback.  We have now emphasized the interdisciplinary significance of our work in the Introduction and Discussion of our revised manuscript. We highlight how the insights gained from our study can contribute to a better understanding of microbial interactions with eukaryotic hosts in general, and hope that our findings could benefit future research in the fields of pathogenesis, immunity, and symbiosis.

      We appreciate your detailed summary of our work, which is focused on NopT and its interaction with Nod factor receptors. To ensure that the readers can easily follow the rationale behind our work, we have included a more detailed explanation of how NopT was identified to target Nod factor receptors. In particular, we now better describe the test system (Nicotiana benthamiana cells co-expressing NFR1/NFR5 with a given effector of Sinorhizobium fredii NGR234). In addition, we provide now a more thorough background on the roles of NFR1 and NFR5 in symbiotic signaling and refer to the two Nature papers from 2003 on NFR1 and NFR5 (Madsen et al., 2003; Radutoiu et al., 2003).

      Evidence is presented that in vitro NopT can cleave NFR5 at its juxtamembrane region. NFR5 appears also to be cleaved in vivo. and NFR1 appears to inhibit the proteolytic activity of NopT by phosphorylating NopT. When NFR5 and NFR1 are ectopically over-expressed in leaves of the non-legume Nicotiana benthamiana, they induce cell death (Madsen et al., 2011, Plant Journal). Bao et al., found that this cell death response is inhibited by the coexpression of nopT. Mutation of nopT alters the outcome of rhizobial infection in L. japonicus. These conclusions are well supported by the data.

      We appreciate your recognition of the robustness of our conclusions. In the context of your comments, we made the following improvements to our manuscript:

      We included a more detailed description of the experimental conditions under which the cleavage of NFR5 by NopT was observed in vitro and in vivo. Furthermore, additional experiments were added to strengthen the evidence for NFR5 cleavage by NopT (Fig 3, S3, S6, and S14).

      We provided more comprehensive data on the phosphorylation of NopT by NFR1, including phosphorylation assays (Fig. 4) and mass spectrometry results (Fig. S7 and Table S1). These data provide additional information on the mechanism by which NFR1 inhibits the proteolytic activity of NopT.

      We expanded the discussion on the cell death response induced by ectopic expression of NFR1 and NFR5 in Nicotiana benthamiana. We also included further details from Madsen et al. (2011) to contextualize our findings within the known literature.

      We believe that these additions and clarifications have improved the significance and impact of our study.

      The authors present evidence supporting the interaction of NopT with NFR1 and NFR5. In particular, there is solid support for cleavage of NFR5 by NopT (Figure 3) and the identification of NopT phosphorylation sites that inhibit its proteolytic activity (Figure 4C). Cleavage of NFR5 upon expression in N. benthamiana (Figure 3A) requires appropriate controls (inactive mutant versions) that have been provided, since Agrobacterium as a closely rhizobia-related bacterium, might increase defense related proteolytic activity in the plant host cells.

      We appreciate your recognition of the importance of appropriate controls in our experimental design. In response to your comments, we revised our manuscript to ensure that the figures and legends provide a clear description of the controls used. We also included a more detailed description of our experimental design at several places. In particular, we have highlighted the use of the protease-dead version of NopT as a control (NopT<sup>C93S</sup>). Therefore, NFR5-GFP cleavage in N. benthamiana clearly depended on protease activity of NopT and not on Agrobacterium (Fig. 3A). In the revised text, we are now more cautious in our wording and don’t conclude at this stage that NopT proteolyzes NFR5. However, our subsequent experiments, including in vitro experiments, clearly show that NopT is able to proteolyze NFR5.

      We are convinced that these changes have improved the quality of our work.

      Key results from N. benthamiana appear consistent with data from recombinant protein expression in bacteria. For the analysis in the host legume L. japonicus transgenic hairy roots were included. To demonstrate that the cleavage of NFR5 occurs during the interaction in plant cells the authors build largely on western blots. Regardless of whether Nicotiana leaf cells or Lotus root cells are used as the test platform, the Western blots indicate that only a small proportion of NFR5 is cleaved when co-expressed with nopT, and most of the NFR5 persists in its full-length form (Figures 3A-D). It is not quite clear how the authors explain the loss of NFR5 function (loss of cell death, impact on symbiosis), as a vast excess of the tested target remains intact. It is also not clear why a large proportion of NFR5 is unaffected by the proteolytic activity of NopT. This is particularly interesting in Nicotiana in the absence of Nod factor that could trigger NFR1 kinase activity.

      Thank you for your comments regarding the cleavage of NFR5 by NopT and its functional implications. We acknowledge that our immunoblots indicate only a relatively small proportion of  the NFR5 cleavage product.  Possible explanations could be as follows:

      (1) The presence of full-length NFR5 does not preclude a significant impact of NopT on function of NFR5, as NopT is able to bind to NFR5. In other words, the NopT-NFR5 and NopT-NFR1 interactions at the plasmamembrane might influence the function of the NFR1/NFR5 receptor without proteolytic cleavage of NFR5. In fact, protease-dead NopT<sup>C93S</sup> expressed in NGR234Δ_nopT_ showed certain effects in L. japonicus (less infection foci were formed compared to NGR234Δ_nopT_ Fig. 5E).  In this context, it is worth mentioning that the non-acylated NopT<sup>C93S</sup> (Fig. 1B) and not<sub>USDA257</sub> (Fig. 6B) proteins were unable to suppress NFR1/NFR5-induced cell death in N. benthamina, but this could be explained by the lack of acylation and altered subcellular localization.

      (2) The cleaved NFR5 fraction, although small, may be sufficient to disrupt signaling pathways, leading to the observed phenotypic changes  (loss of cell death in N. benthamiana; altered infection in L. japonicus).

      (3) The used expression systems produce high levels of proteins in the cell. This may not reflect the natural situation in L. japonicus cells.

      (4) Cellular conditions could impair cleavage of NFR5 by NopT.  Expression of proteins in E. coli may partially result in formation of protein aggregates (inactive NopT; NFR5 resistant to proteolysis).

      (5) In N. benthamiana co-expressing NFR1/NFR5, the NFR1 kinase activity is constitutively active (i.e., does not require Nod factors), suggesting an altered protein conformation of the receptor complex, which may influence the proteolytic susceptibility of NFR5.

      (6) The proteolytic activity of NopT may be reduced by the interaction of NopT with other proteins such as NFR1, which phosphorylates NopT and inactivates its protease activity.

      In our revised manuscript version, we provide now quantitative data for the efficiency of NFR5 cleavage by NopT in different expression systems used (Supplemental Fig.  14).  We have also improved our Discussion in this context. Future research will be necessary to better understand loss of NFR5 function by NopT. 

      It is also difficult to evaluate how the ratios of cleaved and full-length protein change when different versions of NopT are present without a quantification of band strengths normalized to loading controls (Figure 3C, 3D, 3F). The same is true for the blots supporting NFR1 phosphorylation of NopT (Figure 4A).

      Thank you for pointing out this. Following your suggestions, we quantified the band intensities for cleaved and full-length NFR5 in our different expression systems (N. benthamiana, L. japonicus and E. coli). The protein bands were normalized to loading controls. The data are shown in the new Supplemental Fig. 14. Similarly, the bands of immunoblots supporting phosphorylation of NopT by NFR1 were quantified. The data on band intensities are shown in Fig.  4B of our revised manuscript. These improvements provide a clearer understanding of how the ratios of cleaved to full-length proteins change in different protein expression systems, and to which extent NopT was phosphorylated by NFR1.

      Nodule primordia and infection threads are still formed when L. japonicus plants are inoculated with ∆nopT mutant bacteria, but it is not clear if these primordia are infected or develop into fully functional nodules (Figure 5). A quantification of the ratio of infected and non-infected nodules and primordia would reveal whether NopT is only active at the transition from infection focus to thread or perhaps also later in the bacterial infection process of the developing root nodule.

      Thank you for highlighting this aspect of our study. In response to your comment, we have conducted additional inoculation experiments with L. japonicus plants inoculated with NGR234 and NGR234_ΔnopT_ mutant. The new data are shown in Fig 5A, 5E, and 5G. However, we could not find any uninfected nodules (empty) nodules when roots were inoculated with these strains and mention this observation in the Results section of our revised manuscript.

      Reviewer #2 (Public Review):

      Summary:

      This manuscript presents data demonstrating NopT's interaction with Nod Factor Receptors NFR1 and NFR5 and its impact on cell death inhibition and rhizobial infection. The identification of a truncated NopT variant in certain Sinorhizobium species adds an interesting dimension to the study. These data try to bridge the gaps between classical Nod-factor-dependent nodulation and T3SS NopT effector-dependent nodulation in legume-rhizobium symbiosis. Overall, the research provides interesting insights into the molecular mechanisms underlying symbiotic interactions between rhizobia and legumes.

      Strengths:

      The manuscript nicely demonstrates NopT's proteolytic cleavage of NFR5, regulated by NFR1 phosphorylation, promoting rhizobial infection in L. japonicus. Intriguingly, authors also identify a truncated NopT variant in certain Sinorhizobium species, maintaining NFR5 cleavage but lacking NFR1 interaction. These findings bridge the T3SS effector with the classical Nod-factor-dependent nodulation pathway, offering novel insights into symbiotic interactions.

      Weaknesses:

      (1) In the previous study, when transiently expressed NopT alone in Nicotiana tobacco plants, proteolytically active NopT elicited a rapid hypersensitive reaction. However, this phenotype was not observed when expressing the same NopT in Nicotiana benthamiana (Figure 1A). Conversely, cell death and a hypersensitive reaction were observed in Figure S8. This raises questions about the suitability of the exogenous expression system for studying NopT proteolysis specificity.

      We appreciate your attention to these plant-specific differences. Previous studies showed that NopT expressed in tobacco (N. tabacum) or in specific Arabidopsis ecotypes (with PBS1/RPS5 genes) causes rapid cell death (Dai et al. 2008; Khan et al. 2022). Khan et al. 2022 reported recently that cell death does not occur in N. benthamiana unless the leaves were transformed with PBS1/RPS5 constructs. Our data shown in Fig. S15 confirm these findings. As cell death (effector triggered immunity) is usually associated with induction of plant protease activities, we considered N. tabacum and A. thaliana plants as not suitable for testing NFR5 cleavage by NopT. In fact, no NopT/NFR5 experiments were not performed with these plants in our study.  In response to your comment, we now better describe the N. benthamiana expression system and cite the previous articles_. Furthermore,  We have revised the Discussion section to better emphasize effector-induced immunity in non-host plants and the negative effect of rhizobial effectors during symbiosis. Our revisions certainly provide a clearer understanding of the advantages and limitations of the _N.  benthamiana expression system.

      (2) NFR5 Loss-of-function mutants do not produce nodules in the presence of rhizobia in lotus roots, and overexpression of NFR1 and NFR5 produces spontaneous nodules. In this regard, if the direct proteolysis target of NopT is NFR5, one could expect the NGR234's infection will not be very successful because of the Native NopT's specific proteolysis function of NFR5 and NFR1. Conversely, in Figure 5, authors observed the different results.

      Thank you for this comment, which points out that we did not address this aspect precisely enough in the original manuscript version.  We improved our manuscript and now write that nfr1 and nfr5 mutants do not produce nodules (Madsen et al., 2003; Radutoiu et al., 2003) and that over-expression of either NFR1 or NFR5 can activate NF signaling, resulting in formation of spontaneous nodules in the absence of rhizobia (Ried et al., 2014). In fact, compared to the nopT knockout mutant NGR234_ΔnopT_, wildtype NGR234 (with NopT) is less successful in inducing infection foci in root hairs of L. japonicus (Fig. 5). With respect to formation of nodule primordia, we repeated our inoculation experiments with NGR234_ΔnopT_ and wildtype NGR234 and also included a nopT over-expressing NGR234 strain into the analysis. Our data clearly showed that nodule primordium formation was negatively affected by NopT. The new data are shown in Fig. 5 of our revised version. Our data show that NGR234's infection is not really successful, especially when NopT is over-expressed. This is consistent  with our observations that NopT targets Nod factor receptors in L. japonicus and inhibits NF signaling (NIN promoter-GUS experiments). Our findings indicate that NopT is an “Avr effector” for L. japonicus.  However, in other host plants of NGR234, NopT possesses a symbiosis-promoting role (Dai et al. 2008; Kambara et al. 2009). Such differences could be explained by different NopT targets in different plants (in addition to Nod factor receptors), which may influence the outcome of the infection process. Indeed, our work shows hat NopT can interact with various kinase-dead LysM domain receptors, suggesting a role of NopT in suppression or activation of plant immunity responses depending on the host plant. We discuss such alternative mechanisms in our revised manuscript version and emphasize the need for further investigation to elucidate the precise mechanisms underlying the observed infection phenotype and the role of NopT in modulating symbiotic signaling pathways. In this context, we would also like to mention the two new figures of our manuscript which are showing (i) the efficiency of NFR5 cleavage by NopT in different expression systems, (ii) the interaction between NopT<sup>C93S</sup> and His-SUMO-NFR5<sup>JM</sup>-GFP, and (iii) cleavage of His-SUMO-NFP<sup>JM</sup>-GFP by NopT (Supplementary Figs. S8 and S9).

      (3) In Figure 6E, the model illustrates how NopT digests NFR5 to regulate rhizobia infection. However, it raises the question of whether it is reasonable for NGR234 to produce an effector that restricts its own colonization in host plants.

      Thank you for mentioning this point. We are aware of the possible paradox that the broad-host-range strain NGR234 produces an effector that appears to restrict its infection of host plants. As mentioned in our answer to the previous comment, NopT could have additional functions beyond the regulation of Nod factor signaling. In our revised manuscript version, we have modified our text as follows:

      (1) We mention the potential evolutionary aspects of NopT-mediated regulation of rhizobial infection and discuss the possibility that interactions between NopT and Nod factor receptors may have evolved to fine-tune Nod factor signaling to avoid rhizobial hyperinfection in certain host legumes.

      (2) We also emphasize that the presence of NopT may confer selective advantages in other host plants than L. japonicus due to interactions with proteins related to plant immunity. Like other effectors, NopT could suppress activation of immune responses (suppression of PTI) or cause effector-triggered immunity (ETI) responses, thereby modulating rhizobial infection and nodule formation. Interactions between NopT and proteins related to the plant immune system may represent an important evolutionary driving force for host-specific nodulation and explain why the presence of NopT in NGR234 has a negative effect on symbiosis with L. japonicus but a positive one with other legumes.

      (4) The failure to generate stable transgenic plants expressing NopT in Lotus japonicus is surprising, considering the manuscript's claim that NopT specifically proteolyzes NFR5, a major player in the response to nodule symbiosis, without being essential for plant development.

      We also thank for this comment. We have revised the Discussion section of our manuscript and discuss now our failure to generate stable transgenic L. japonicus plants expressing NopT. We observed that the protease activity of NopT in aerial parts of L. japonicus had a negative effect on plant development, whereas NopT expression in hairy roots was possible. Such differences may be explained by different NopT substrates in roots and aerial parts of the plant. In this context, we also discuss our finding that NopT not only cleaves NFR5 but is also able to proteolyze other proteins of L. japonicus such as LjLYS11, suggesting that NopT not only suppresses Nod factor signaling, but may also interfere with signal transduction pathways related to plant immunity. We speculate that, depending on the host legume species, NopT could suppress PTI or induce ETI, thereby modulating rhizobial infection and nodule formation.

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      Overall the text and figure legends must be double-checked for correctness of scientific statements. The few listed here are just examples. There are more that are potentially damaging the perception by the readers and thus the value of the manuscript.

      The nopT mutant leads to more infections. In line 358 the statement: "...and the proteolysis of NFR5 are important for rhizobial infection", is wrong, as the infection works even better without it. It is, according to my interpretation of the results, important for the regulation of infection. Sounds a small difference, but it completely changes the meaning.

      We appreciate your thorough review and have taken the opportunity to correct this error. Following your suggestions, we carefully rephrased the whole text and figure legends to ensure that the scientific statements accurately reflect the findings of our study. We are convinced that these changed have increased the value of this study.

      In line 905 the authors state that NopTC indicates the truncated version of NopT after autocleavage by releasing about 50 a.a. at its N-terminus.

      They do not analyse this cleavage product to support this claim. So better rephrase.

      According to Dai et al. (2008), NopT expressed in E. coli is autocleaved. The N-terminal sequence GCCA obtained by Edman sequencing suggests that NopT was cleaved between M49 and G50.  We improved our manuscript and now write:

      (1) “A previous study has shown that NopT is autocleaved at its N-terminus to form a processed protein that lacks the first 49 amino acid residues (Dai et al., 2008)”

      (2) “However, NopT<sup>ΔN50</sup>, which is similar to autocleaved NopT, retained the ability to interact with NFR5 but not with NFR1 (Fig. S2D).”.

      In line 967: "Both NopT and NopTC after autocleavage exert proteolytic activities" This is confusing as it was suggested earlier that NopTc is a product of the autocleavage. There is no indication of another round of NopTc autocleavage or did I miss something?

      Thank you for bringing this inaccuracy to our attention. There is no second round of NopT autocleavage. We have corrected the text and write: “NopT and not<sup>C</sup> (autocleaved NopT) proteolytically cleave NFR5 at the juxtamembrane domain to release the intracellular domain of NFR5”

      Given the amount of work that went into the research, the presentation of the figures should be considerably improved. For example, in Figure 3F the mutant is not correctly annotated. In figure 5 the term infection foci and IT occur but it is not explained in the legend what these are, where they can be seen in the figure and how the researchers discriminated between the two events.

      In general, the labeling of the figure panels should be improved to facilitate the understanding. For example, in Figure 3 the panels switch between different host plant systems. The plant could be clarified for each panel to aid the reader. The asterisks are not in line with the signal that is supposed to be marked. And so on. I strongly advise to improve the figures.

      Thank you for your valuable suggestions. We acknowledge the importance of clear and informative figure presentation to enhance the understanding of our research findings. In response to your comments, we made a comprehensive revision of the figures to address the mentioned issues:

      (1) We corrected annotations of the mutant in Figure 3F to accurately represent the experimental conditions.

      (2) We revised the legend of Figure 5 and provide clear explanations of the terms "infection foci" and "IT" (infection threads) in the Methods section.

      (3) We improved the labeling of figure panels and improved the writing of the figure legend specifying the protein expression system (N. benthamiana, L. japonicus and E. coli, respectively). . We ensured that the asterisks indicating statistically significant results are properly aligned.

      Furthermore, we carefully reviewed each figure to enhance clarity and readability, including optimizing font size and line thickness. Captions and annotations were also revised.

      Figure 1

      • To verify that the lack of observed cell death is not linked to differential expression levels, an expression control Western blot is essential. In the expression control Western blot given in the supplemental materials (Supplemental fig. 1E), NFR5 is not visible in the first lane.

      We appreciate your comments on the control immunoblot which were made to verify the presence of NFR1, NFR5 and NopT in N. benthamiana.  However, as shown in Supplemental Fig. 1E, the intact NFR5 could not be immuno-detected when co-expressed with NFR1 and NopT. To ensure co-expression of NFR1/NFR5, A. tumefaciens carrying a binary vector with both NFR1 and NFR5 was used. In the revised version, we modified the figure legend accordingly and also included a detailed description of the procedure at lines 165-166

      • Labeling of NFR1/LjNFR1 should be kept consistent between the text and the figures. Currently, the text refers to both NFR1 and LjNFR1 and figures are labelled NFR1. The same is true for NFR5.

      Thank you for pointing out this inconsistency. We revised our manuscript and use now consistently NFR1 and NFR5 without a prefix to avoid any confusions.

      • A clearer description of how cell death was determined would be useful. In the selected pictures in panel D, leaves coexpressing nopT with Bax1 or Cerk1 appear very different from the pictures selected for NopM and AVr3a/R3a.

      We agree that a clearer description of our cell death experiments with N. benthamiana was necessary. We have re-worded the figure legend to provide more detailed information on the criteria used for assessing cell death. Additionally, we show now our images at higher resolution.

      • In panel D, the "Death/Total" ratio is only shown for leaf discs where nopT was coexpressed with the cell-death triggering proteins. Including the ratio for leaf discs where only the cell-death triggering protein (without nopT ) was expressed would make the figure more clear.

      Thank you for this suggestion. To provide a more comprehensive comparison, we included the "Cell death/Total" ratio for all leaf disc images shown in Fig. 1D. 

      Figure 2:

      • A: Split-YFP is not ideal as evidence for colocalization because of the chemical bond formed between the YFP fragments that may lead to artificial trapping/accumulation outside the main expression domains. Overall, the authors should revise if this figure aims to show colocalization or interaction. In the current text, both terms are used, but these are different interpretations.

      We appreciate your concern regarding the use of Split-YFP for colocalization analysis. We carefully reviewed the figure and corresponding text to ensure clarity in the interpretation of the results. The primary aim of this figure was to explore protein-protein interactions rather than strict colocalization. Protein-protein interactions have also been validated by other experiments of our work. We have revised the text accordingly and no longer emphasize on “co-localization”.

      • Given the focus on proteolytic activity in this paper, all blots need to be clearly labeled with size markers, and it would be good to include a supplemental figure with all other bands produced in the Western blot, regardless of their size. Without this, the results in panel 2D seem inconsistent with results presented in figure 3A, since NFR5 does not appear to be cleaved in the Western blot in 2D, but 3A shows cleavage when the same proteins (with different tags) are coexpressed in the same system.

      Thank you for bringing up this point. We ensured that all immunoblots are clearly labeled with size markers in our revised manuscript. We also carefully checked the consistency of the results presented in Figures 2D and Figure 3A and included appropriate clarifications in the revised manuscript. In Figure 2D, we show the bands at around 75 kD  (multi-bands would be detected below, including cleaved NFR5 by NopT, but also other non-specific bands).

      Figure 3:

      • In panel E, NopTC93S cannot cleave His-Sumo-NFR5JM-GFP, but it would be interesting to also show if NopTC93S can bind the NFR5JM fragment. It would also be useful to see this experiment done with the JM of NFP.

      Thank you for the suggestion. We agree that investigating the binding of NopT<sup>C93S</sup> to the NFR5<sup>JM</sup> fragment provides valuable insights into the interaction between NopT and NFR5. In our revised version, we show in the new Supplemental Fig. S4 that NopT interacts with NFR5JM and cleaves NFP<sup>JM</sup>. The Results section has been modified accordingly.

      • The panels in this figure require better labeling. In many panels, asterisks are misplaced relative to the bands they should highlight, and not all blots have size markers or loading controls.

      Thank you for bringing this to our attention. We carefully reviewed the labeling of all panels in Figure 3 to ensure accuracy and clarity. We ensured that asterisks are correctly placed in the figures. We also included size markers and loading controls to improve the quality of the shown immunoblots.

      • Since there is no clear evidence in this figure that the smear in the blot in panel C is phosphorylated NopT, it is recommended to provide a less interpretative label on the blot, and explain the label in the text.

      We appreciate your suggestion regarding the labeling of the blot in panel C of Fig. 3. We revised the label and provided a less interpretative designation in Fig. 3C. We also rephrased the figure legend and the text in the Results section as recommended.

      Figure 4

      • In B, a brief introduction in the text to the function of the Zn-phostag would make the figure easier to understand for more readers.

      Thank you for the suggestion. We agree and have provided a brief explanation in the Results section: “On such gels, a Zn<sup>2+</sup>-Phos-tag bound phosphorylated protein migrates slower than its unbound nonphosphorylated form. Furthermore, we have included the reference (Kato & Sakamoto, 2019) into the Methods section.

      Figure 5:

      • Change "Scar bar" to "Scale bar" in the figure captions

      Thank you for spotting that typo. We have corrected it.

      • Correct the references to the figures in the text

      We carefully reviewed the Figure 5 and made corresponding corrections to improve the quality of our manuscript Please check line 394-451.

      • It should be clarified what was quantified as "infection foci" (C, F, G)

      We revised the legend of Figure 5 and provide now explanations of the terms "infection foci" and "IT" (infection threads) in the Methods section.  Please check line 399-451.

      • It is recommended to use pictures that are from the same region of the plant root (the susceptible zone). The pictures in panel A appear to be from different regions, since the density of root hairs is different.

      Thank you for bringing this to our attention. We ensured that the images selected for panel A were from the same region of the plant root to guarantee consistency and accuracy of the comparison.

      • Panel G should be labeled so it is clearer that nopT is being expressed in L. japonicus transgenic roots.

      We have labeled this panel more clearly to help the reader understand that nopT was expressed in transgenic L. japonicus roots.

      • Panel F is missing statistical tests for ITs

      We apologize and have included the results of our statistical tests for ITs.

      Figure 6:

      • The model presented in panel E misrepresents the role of NFR5 according to the results in the paper. From the evidence presented, it is not clear if the observed rhizobial infection phenotype is due to reduced abundance of full-length NFR5, or if the cleaved NFR5 fragment is suppressing infection. Additionally, S. fredii should not be drawn so close to the plasma membrane, since the bacteria are located outside the cell wall when the T3SS is active.

      We appreciate your comment which helps us to improve the interpretation of our results. We agree that the model should accurately reflect the uncertainties regarding the role of NFR5. We revised the model (positioning of S. fredii etc.) and write in the Discussion:

      “NopT impairs the function of the NFR1/NFR5 receptor complex. Cleavage of NFR5 by NopT reduces its protein levels. Possible inhibitory effects of NFR5 cleavage products on NF signaling are unknown but cannot be excluded.”

      Reviewer #2 (Recommendations For The Authors):

      (1) Some minor weaknesses need addressing: In Figure 5A, the root hair density in the two images appears significantly different. Are these images representative of each treatment?

      We appreciate your attention to detail and the importance of ensuring that the images in Figure 5A are representative. We carefully reviewed our image selection process and confirm that the shown images are indeed representative of each treatment group. In our revised version, we show additional images and also improved the text in the figure legend. Furthermore, we performed additional GUS staining tests and the new data are shown in Fig 5A abd 5B.

      (2) Additionally, please ensure consistency in the format of genotype names throughout the manuscript. For instance, in Line 897, "Italy" should be used in place of "N. benthamiana."

      We thank you for pointing out the format of genotype names and corrected our manuscript as requested.

    1. Author response:

      The following is the authors’ response to the previous reviews.

      Public Reviews:

      Reviewer #1 (Public Review): 

      Summary: 

      The authors introduced their previous paper with the concise statement that "the relationships between lineage-specific attributes and genotypic differences of tumors are not understood" (Chen et al., JEM 2019, PMID: 30737256). For example, it is not clear why combined loss of RB1 and TP53 is required for tumorigenesis in SCLC or other aggressive neuroendocrine (NE) cancers, or why the oncogenic mutations in KRAS or EGFR that drive NSCLC tumorigenesis are found so infrequently in SCLC. This is the main question addressed by the previous and current papers. 

      One approach to this question is to identify a discrete set of genetic/biochemical manipulations that are sufficient to transform non-malignant human cells into SCLC-like tumors. One group reported the transformation of primary human bronchial epithelial cells into NE tumors through a complex lentiviral cocktail involving the inactivation of pRB and p53 and activation of AKT, cMYC, and BCL2 (PARCB) (Park et al., Science 2018, PMID: 30287662). The cocktail previously reported by Chen and colleagues to transform human pluripotent stem-cell (hPSC)-derived lung progenitors (LPs) into NE xenografts was more concise: DAPT to inactivate NOTCH signaling combined with shRNAs against RB1 and TP53. However, the resulting RP xenografts lacked important characteristics of SCLC. Unlike SCLC, these tumors proliferated slowly and did not metastasize, and although small subpopulations expressed MYC or MYCL, none expressed NEUROD1. 

      MYC is frequently amplified or expressed at high levels in SCLC, and here, the authors have tested whether inducible expression of MYC could increase the resemblance of their hPSC-derived NE tumors to SCLC. These RPM cells (or RPM T58A with stabilized cMYC) engrafted more consistently and grew more rapidly than RP cells, and unlike RP cells, formed liver metastases when injected into the renal capsule. Gene expression analyses revealed that RPM tumor subpopulations expressed NEUROD1, ASCL1, and/or YAP1. 

      The hPSC-derived RPM model is a major advance over the previous RP model. This may become a powerful tool for understanding SCLC tumorigenesis and progression and for discovering gene dependencies and molecular targets for novel therapies. However, the specific role of cMYC in this model needs to be clarified. 

      cMYC can drive proliferation, tumorigenesis, or apoptosis in a variety of lineages depending on concurrent mutations. For example, in the Park et al., study, normal human prostate cells could be reprogrammed to form adenocarcinoma-like tumors by activation of cMYC and AKT alone, without manipulation of TP53 or RB1. In their previous manuscript, the authors carefully showed the role of each molecular manipulation in NE tumorigenesis. DAPT was required for NE differentiation of LPs to PNECs, shRB1 was required for expansion of the PNECs, and shTP53 was required for xenograft formation. cMYC expression could influence each of these steps, and importantly, could render some steps dispensable. For example, shRB1 was previously necessary to expand the DAPT-induced PNECs, as neither shTP53 nor activation of KRAS or EGFR had no effect on this population, but perhaps cMYC overexpression could expand PNECs even in the presence of pRB, or even induce LPs to become PNECs without DAPT. Similarly, both shRB1 and shTP53 were necessary for xenograft formation, but maybe not if cMYC is overexpressed. If a molecular hallmark of SCLC, such as loss of RB1 or TP53, has become dispensable with the addition of cMYC, this information is critically important in interpreting this as a model of SCLC tumorigenesis.  

      The reviewer’s suggestion may be possible; indeed, in a recent report from our group (Gardner EE, et al., Science 2024) we have shown, using genetically engineered mouse modeling coupled with lineage tracing, that the cMyc oncogene can selectively expand Ascl1+ PNECs in the lung.

      We agree with the reviewer that not having a better understanding of the individual components necessary and/or sufficient to transform hESC-derived LPs is an important shortcoming of this current work. However, we would like to stress three important points about the comments:  1) tumors were reviewed and the histological diagnoses were certified by a practicing pulmonary pathologist at WCM (our co-author, C. Zhang); 2 )the observed  transcriptional programs were consistent with primary human SCLC; and 3) RB1-proficient SCLC is now recognized as a rare presentation of SCLC (Febrese-Aldana CA, et al., Clin. Can. Res. 2022. PMID: 35792876).

      To interpret the role of cMYC expression in hPSC-derived RPM tumors, we need to know what this manipulation does without manipulation of pRB, p53, or NOTCH, alone or in combination. Seven relevant combinations should be presented in this manuscript: (1) cMYC alone in LPs, (2) cMYC + DAPT, (3) cMYC + shRB1, (4) cMYC + DAPT + shRB1, (5) cMYC + shTP53, (6) cMYC + DAPT + shTP53, and (7) cMYC + shRB1 + shTP53. Wildtype cMYC is sufficient; further exploration with the T58A mutant would not be necessary. 

      We respectfully disagree that an interrogation of the differences between the phenotypes produced by wildtype and Myc(T58A) would not be informative. (Our view is confirmed by the second reviewer; see below.)    It is well established that Myc gene or protein dosage can have profound effects on in vivo phenotypes (Murphy DJ, et al., Cancer Cell 2008. PMID: 19061836). The “RPM” model of variant SCLC developed by Trudy Oliver’s lab relied on the conditional T58A point mutant of cMyc, originally made by Rob Wechsler-Reya. While we do not discuss the differences between Myc and Myc(T58A), it is nonetheless important to present our results with both the WT and mutant MYC constructs, as we are aware of others actively investigating differences between them in GEMM models of SCLC tumor development.

      We agree with the reviewer about the virtues of trying to identify the effects of individual gene manipulations; indeed our original paper (Chen et al., J. Expt. Med. 2019), describing the RUES2derived model of SCLC did just that, carefully dissecting events required to transform LPs towards a SCLC-like state. The central  purpose of the current study was to determine the effects of adding cMyc on the behavior of weakly tumorigenic SCLC-like cells cMyc.  Presenting data with these two alleles to seek effects of different doses of MYC protein seems reasonable.

      This reviewer considers that there should be a presentation of the effects of these combinations on LP differentiation to PNECs, expansion of PNECs as well as other lung cells, xenograft formation and histology, and xenograft growth rate and capacity for metastasis. If this could be clarified experimentally, and the results discussed in the context of other similar approaches such as the Park et al., paper, this study would be a major addition to the field.  

      Reviewer #2 (Public Review): 

      Summary: 

      Chen et al use human embryonic stem cells (ESCs) to determine the impact of wildtype MYC and a point mutant stable form of MYC (MYC-T58A) in the transformation of induced pulmonary neuroendocrine cells (PNEC) in the context of RB1/P53 (RP) loss (tumor suppressors that are nearly universally lost in small cell lung cancer (SCLC)). Upon transplant into immune-deficient mice, they find that RP-MYC and RP-MYC-T58A cells grow more rapidly, and are more likely to be metastatic when transplanted into the kidney capsule, than RP controls. Through single-cell RNA sequencing and immunostaining approaches, they find that these RPM tumors and their metastases express NEUROD1, which is a transcription factor whose expression marks a distinct molecular state of SCLC. While MYC is already known to promote aggressive NEUROD1+ SCLC in other models, these data demonstrate its capacity in a human setting that provides a rationale for further use of the ESC-based model going forward. Overall, these findings provide a minor advance over the previous characterization of this ESC-based model of SCLC published in Chen et al, J Exp Med, 2019. 

      We consider the findings more than a “minor” advance in the development of the model, since any useful model for SCLC would need to form aggressive and metastatic tumors.

      The major conclusion of the paper is generally well supported, but some minor conclusions are inadequate and require important controls and more careful analysis. 

      Strengths:

      (1) Both MYC and MYC-T58A yield similar results when RP-MYC and RP-MYCT58A PNEC ESCs are injected subcutaneously, or into the renal capsule, of immune-deficient mice, leading to the conclusion that MYC promotes faster growth and more metastases than RP controls. 

      (2) Consistent with numerous prior studies in mice with a neuroendocrine (NE) cell of origin (Mollaoglu et al, Cancer Cell, 2017; Ireland et al, Cancer Cell, 2020; Olsen et al, Genes Dev, 2021), MYC appears sufficient in the context of RB/P53 loss to induce the NEUROD1 state. Prior studies also show that MYC can convert human ASCL1+ neuroendocrine SCLC cell lines to a NEUROD1 state (Patel et al, Sci Advances, 2021); this study for the first time demonstrates that RB/P53/MYC from a human neuroendocrine cell of origin is sufficient to transform a NE state to aggressive NEUROD1+ SCLC. This finding provides a solid rationale for using the human ESC system to better understand the function of human oncogenes and tumor suppressors from a neuroendocrine origin. 

      Weaknesses:

      (1) There is a major concern about the conclusion that MYC "yields a larger neuroendocrine compartment" related to Figures 4C and 4G, which is inadequately supported and likely inaccurate. There is overwhelming published data that while MYC can promote NEUROD1, it also tends to correlate with reduced ASCL1 and reduced NE fate (Mollaoglu et al, Cancer Cell, 2017; Zhang et al, TLCR, 2018; Ireland et al, Cancer Cell, 2020; Patel et al, Sci Advances, 2021). Most importantly, there is a lack of in vivo RP tumor controls to make the proper comparison to judge MYC's impact on neuroendocrine identity. RPM tumors are largely neuroendocrine compared to in vitro conditions, but since RP control tumors (in vivo) are missing, it is impossible to determine whether MYC promotes more or less neuroendocrine fate than RP controls. It is not appropriate to compare RPM tumors to in vitro RP cells when it comes to cell fate. Upon inspection of the sample identity in S1B, the fibroblast and basal-like cells appear to only grow in vitro and are not well represented in vivo; it is, therefore, unclear whether these are transformed or even lack RB/P53 or express MYC. Indeed, a close inspection of Figure S1B shows that RPM tumor cells have little ASCL1 expression, consistent with lower NE fate than expected in control RP tumors. 

      We would like to clarify two points related to the conclusions that we draw about MYC’s ability to promote an increase in the neuroendocrine fraction in hESC-derived cultures:  1) The comparisons in Figures 4C were made between cells isolated in culture following the standard 50 day differentiation protocol, where, following generation of LPs around day 25, MYC was added to the other factors previously shown to enrich for a PNEC phenotype (shRB1, shTP53, and DAPT). Therefore, the argument that MYC increased the frequency of “neuroendocrine cells” (which we define by a gene expression signature) is a reasonable conclusion in the system we are using; and 2) following injection of these cells into immunocompromised mice, an ASCL1-low / NEUROD1-high presentation is noted (Supplemental Figures 1F-G). In the few metastases that we were able use to sequence bulk RNA, there is an even more pronounced increase in expression of NEUROD1 with a decrease in ASCL1.

      Some confusion may have arisen from our previous characterization of neuroendocrine (NE) cells using either ASCL1 or NEUROD1 as markers. To clarify, we have now designated cells positive for ASCL1 as classical NE cells and those positive for NEUROD1 as the NE variant. According to this revised classification, our findings indicate that MYC expression leads to an increase in the NEUROD1+ NE variant and a decrease in ASCL1+ classical NE cells. This adjustment has been reflected on the results section titled, “Inoculation of the renal capsule facilitates metastasis of the RUES2-derived RPM tumors” of the manuscript.  

      From the limited samples in hand, we compared the expression of ASCL1 and NEUROD1 in the weakly tumorigenic hESC RP cells after successful primary engraftment into immunocompromised mice. As expected, the RP tumors were distinguished by the lack of expression of NEUROD1, compared to levels observed in the RPM tumors.

      In addition, since MYC appears to require Notch signaling to induce  NE fate (cf Ireland et al), the presence of DAPT in culture could enrich for NE fate despite MYC's presence. It's important to clarify in the legend of Fig 4A which samples are used in the scRNA-seq data and whether they were derived from in vitro or in vivo conditions (as such, Supplementary Figure S1B should be provided in the main figure). Given their conclusion is confusing and challenges robustly supported data in other models, it is critical to resolve this issue properly. I suspect when properly resolved, MYC actually consistently does reduce NE fate compared to RP controls, even though tumors are still relatively NE compared to completely distinct cellular identities such as fibroblasts.

      We have clarified the source of tumor sequencing data and the platform (single cell or bulk) in Figure 4 and Supplemental Figure 1. To reiterate – the RNA sequencing results from paired metastatic and primary tumors from the RPM model are derived from bulk RNA;  the single cell RNA data in RP or RPM datasets are from cells in culture.  These distinctions are clarified in the legend to Supplemental Figure 1.

      (2) The rigor of the conclusions in Figure 1 would be strengthened by comparing an equivalent number of RP animals in the renal capsule assay, which is n = 6 compared to n = 11-14 in the MYC conditions.

      As we did not perform a power calculation to determine a sample size required to draw a level of statistical significance from our conclusions, this comment is not entirely accurate. Our statistical rigor was limited by the availability of samples from the RP tumor model.

      (3) Statistical analysis is not provided for Figures 2A-2B, and while the results are compelling, may be strengthened by additional samples due to the variability observed. 

      We acknowledge that the cohorts are relatively small but we have added statistical comparisons in Figure 2B. 

      (4a) Related to Figure 3, primary tumors and liver metastases from RPM or RPM-T58A-expressing cells express NEUROD1 by immunohistochemistry (IHC) but the putative negative controls (RP) are not shown, and there is no assessment of variability from tumor to tumor, ie, this is not quantified across multiple animals. 

      The results of H&E and IF staining for ASCL1, NEUROD1, CGRP, and CD56 in negative control (RP tumors) are presented in the updated Figure 3F-G.

      (4b) Relatedly, MYC has been shown to be able to push cells beyond NEUROD1 to a double-negative or YAP1+ state (Mollaoglu et al, Cancer Cell, 2017; Ireland et al, Cancer Cell, 2020), but the authors do not assess subtype markers by IHC. They do show subtype markers by mRNA levels in Fig 4B, and since there is expression of ASCL1, and potentially expression of YAP1 and POU2F3, it would be valuable to examine the protein levels by IHC in control RP vs. RPM samples.

      YAP1 positive SCLC is still somewhat controversial, so it is not clear what value staining for YAP1 offers beyond showing the well-established markers, ASCL1 and NEUROD1.  

      (5) Given that MYC has been shown to function distinctly from MYCL in SCLC models, it would have raised the impact and value of the study if MYC was compared to MYCL or MYCL fusions in this context since generally, SCLC expresses a MYC family member. However, it is quite possible that the control RP cells do express MYCL, and as such, it would be useful to show. 

      We now include Supplemental Figure S2 to illustrate four important points raised by this reviewer and others:  1) expression of MYC family members in the merged dataset (RP and RPM) is low or undetectable in the basal/fibroblast cultures; 2) MYC does have a weak correlation with EGFP in the neuroendocrine cluster when either WT MYC or T58A MYC is overexpressed; 3) MYCL and MYCN are detectable, but at low levels compared to CMYC; and 4) Expression of  ASCL1 is anticorrelated with MYC expression across the merged single cell datasets using RP and RPM models.

      Reviewer #3 (Public Review): 

      Summary: 

      The authors continue their study of the experimental model of small cell lung cancer (SCLC) they created from human embryonic stem cells (hESCs) using a protocol for differentiating the hESCs into pulmonary lineages followed by NOTCH signaling inactivation with DAPT, and then knockdown of TP53 and RB1 (RP models) with DOX inducible shRNAs. To this published model, they now add DOX-controlled activation of expression of a MYC or T58A MYC transgenes (RPM and RPMT58A models) and study the impact of this on xenograft tumor growth and metastases. Their major findings are that the addition of MYC increased dramatically subcutaneous tumor growth and also the growth of tumors implanted into the renal capsule. In addition, they only found liver and occasional lung metastases with renal capsule implantation. Molecular studies including scRNAseq showed that tumor lines with MYC or T58A MYC led surprisingly to more neuroendocrine differentiation, and (not surprisingly) that MYC expression was most highly correlated with NEUROD1 expression. Of interest, many of the hESCs with RPM/RPMT58A expressed ASCL1. Of note, even in the renal capsule RPM/RPMT58A models only 6/12 and 4/9 mice developed metastases (mainly liver with one lung metastasis) and a few mice of each type did not even develop a renal sub capsule tumor. The authors start their Discussion by concluding: " In this report, we show that the addition of an efficiently expressed transgene encoding normal or mutant human cMYC can convert weakly tumorigenic human PNEC cells, derived from a human ESC line and depleted of tumor suppressors RB1 and TP53, into highly malignant, metastatic SCLC-like cancers after implantation into the renal capsule of immunodeficient mice.". 

      Strengths: 

      The in vivo study of a human preclinical model of SCLC demonstrates the important role of c-Myc in the development of a malignant phenotype and metastases. Also the role of c-Myc in selecting for expression of NEUROD1 lineage oncogene expression. 

      Weaknesses: 

      There are no data on results from an orthotopic (pulmonary) implantation on generation of metastases; no comparative study of other myc family members (MYCL, MYCN); no indication of analyses of other common metastatic sites found in SCLC (e.g. brain, adrenal gland, lymph nodes, bone marrow); no studies of response to standard platin-etoposide doublet chemotherapy; no data on the status of NEUROD1 and ASCL1 expression in the individual metastatic lesions they identified. 

      We have acknowledged from the outset that our study has significant limitations, as noted by this reviewer, and we explained in our initial letter of response why we need to present this limited, but still consequential, story at this time. 

      In particular, while we have attempted orthotopic transplantations of RPM tumor cells into NSG mice (by tail vein or intra-pulmonary injection, or intra-tracheal instillation of tumor cells), these methods were not successful in colonizing the lung. Additionally, we have compared the efficacy of platinum/etoposide to that of removing DOX in established RPM subcutaneous tumors, but we chose not to include these data as we lacked a chemotherapy responsive tumor model, and thus could not say with confidence that the chemotherapeutic agants were active and that the RPM models were truly resistant to standard SCLC chemotherapy. In a discussion about other metastatic sites, we have now included the following text: 

      “In animals administered DOX, histological examinations showed that approximately half developed metastases in distant organs, including the liver or lung (Figure 1D). No metastases were observed in the bone, brain, or lymph nodes. For a more detailed assessment, future studies could employ more sensitive imaging methods, such as luciferase imaging.”

      Recommendations for the authors:

      Reviewer #2 (Recommendations For The Authors): 

      Technical points related to Major Weakness #1: 

      For Figure 4: Cells were enriched for EGFP-high cells only, under the hypothesis that cells with lower EGFP may have silenced expression of the integrated vector. Since EGFP is expressed only in the shRB1 construct, selection for high EGFP may inadvertently alter/exclude heterogeneity within the transformed population for the other transgenes (shP53, shMYC/MYC-T58A). Can authors include data to show the expression of MYC/MYC T58A in EGFP-high v -med v-low cells? MYC levels may alter the NEdifferentiation status of tumor cells. 

      Please now refer to Supplemental Figure S2.

      Related to the appropriateness of the methods for Figure 4C, the authors state, "We performed differential cluster abundance analysis after accounting for the fraction of cells that were EGFP+". If only EGFP+ cells were accounted for in the analysis for 4C, the majority of RP cells in the "Neuroendocrine differentiated" cluster would not be included in the analysis (according to EGFP expression in Fig S1A-B), and therefore inappropriately reduce NE identity compared to RPM samples that have higher levels of EGFP. 

      There is no consideration or analysis of cell cycling/proliferation until after the conclusion is stated. Yet, increased proliferation of MYC-high vs MYC-low cultures would enhance selection for more tumors (termed "NE-diff") than non-tumors (basal/fibroblast) in 2D cultures. 

      The expression of MYC itself isn't assessed for this analysis but assumed, and whether higher levels of MYC/MYC-T58A may be present in EGFP+ tumor cells that are in the NE-low populations isn't clear. Can MYC-T58A/HA also be included in the reference genome? 

      We did not include an HA tag in our reference transcriptome. For [some] answers to this and other related questions, please refer to Supplemental Figure S2.

      Reviewer #3 (Recommendations For The Authors): 

      (1) The experiments are all technically well done and clearly presented and represent a logical extension exploring the role of c-Myc in the hESC experimental model system. 

      We appreciate this supportive comment!

      (2) It is of great interest that both the initial RP model only forms "benign" tumors and that with the addition of a strong oncogene like c-myc, where expression is known to be associated with a very bad prognosis in SCLC, that while one gets tumor formation there are still occasional mice both for subcutaneous and renal capsule test sites that don't get tumors even with the injection of 500,000 RPM/RPMT58A cells. In addition, of the mice that do form tumors, only ~50% exhibit metastases from the renal sub-capsule site. The authors need to comment on this further in their Discussion. To me, this illustrates both how incredibly resistant/difficult it is to form metastases, thus indicating the need for other pathways to be activated to achieve such spread, and also represents an opportunity for further functional genomic tests using their preclinical model to systematically attack this problem. Obvious candidate genes are those recently identified in genetically engineered mouse models (GEMMs) related to neuronal behavior. In addition, we already know that full-fledged patient-derived SCLC when injected subcutaneously into immune-deprived mice don't exhibit metastases - thus, while the hESC RPM result is not surprising, it indicates to me the power of their model (logs less complicated genetically than a patient SCLC) to sort through a mechanism that would allow metastases to develop from subcutaneous sites. The authors can point these things out in their Discussion section to provide a "roadmap" for future research. 

      Although we remain mindful of the relatively small cohorts we have studied, the thrust of Reviewer #3’s comments is now included in the Discussion. And there is, of course, a lot more to do, and it has taken several years already to get to this point. Additional information about the prolonged gestation of this project and about the difficulties of doing more in the near future was described in our initial response to reviewers/Editor, included near the start of this letter.    

      (3) I will state the obvious that this paper would be much more valuable if they had compared and contrasted at least one of the myc family members (MYCL or MYCN) with the CMYC findings whatever the results would be. Most SCLC patients develop metastases, and most of their tumors don't express high levels of CMYC (and often use MYCL). In any event, as the authors Discuss, this will be an important next stage to test.

      We have acknowledged and explained the limitations of the work in several ways. Further, we were unaware of the relationship between metastases and the expression of MYC and MYCL1 noted by the reviewer; we will look for confirmation of this association in any future studies, although we have not encountered it in current literature.

      (4) Their assays for metastases involved looking for anatomically "gross" lesions. While that is fine, particularly given that the "gross" lesions they show in figures are actually pretty small, we still need to know if they performed straightforward autopsies on mice and looked for other well-known sites of metastases in SCLC patients besides liver and lung - namely lymph nodes, adrenal, bone marrow, and brain. I would guess these would probably not show metastatic growth but with the current report, we don't know if these were looked for or not. Again, while this could be a "negative" result, the paper's value would be increased by these simple data. Let's assume no metastases are seen, then the authors could further strengthen the case for the value of their hESC model in systematically exploring with functional genomics the requirements to achieve metastases to these other sites.

      We have included descriptions of what we found and didn’t find at other potential sites of metastasis in the results section, with the following sentences: 

      “In animals administered DOX, histological examinations showed that approximately half developed metastases in distant organs, including the liver or lung (Figure 1D). No metastases were observed in the bone, brain, or lymph nodes. For a more detailed assessment, future studies could employ more sensitive imaging methods, such as luciferase imaging.”

      (5) Related to this, we have no idea if the mice that developed liver metastases (or the one mouse with lung metastasis) had more than one metastatic site. They will know this and should report it. Again, my guess is that these were isolated metastases in each mouse. Again, they can indicate the value of their model in searching for programs that would increase the number of the various organs. 

      We appreciate the suggestion. We observed that one of the mice developed metastatic tumors in both the liver and lungs. This information has been incorporated into the Results section.

      (6) While renal capsule implantation for testing growth and metastatic behavior is reasonable and based on substantial literature using this site for implantation of patient tumor specimens, what would have increased the value of the paper is knowing the results from orthotopic (lung implantation). Whatever the results were (they occurred or did not occur) they will be important to know. I understand the "future experiments" argument, but in reading the manuscript this jumped out at me as an obvious thing for the authors to try. 

      We conducted orthotopic implantation several ways, including via intra-tracheal instillation of 0.5 million RP or RPM cells in PBS per mouse. However, none of the subjects (0/5 mice) developed tumor-like growths and the number of animals used was small. Further, this outcome could be attributed to biological or physical factors. For instance, the conducting airway is coated with secretory cells producing protective mucins and may not have retained the 0.5 million cells. This is one example that may have hindered effective colonization. Future adjustments, such as increasing the number of cells, embedding them in Matrigel, or damaging the airway to denude secretory cells and trigger regeneration might alter the outcomes. These ideas might guide future work to strengthen the utility of the models.

      (7) Another obvious piece of data that would have improved the value of this manuscript would be to know whether the RPM tumors responded to platin-etoposide chemotherapy. Such data was not presented in their first RP hESC notch inhibition paper (which we now know generated what the authors call "benign" tumors). While I realize chemotherapy responses represent other types of experiments, as the authors point out one of the main reasons they developed their new human model was for therapy testing. Two papers in and we are all still asking - does their model respond or not respond dramatically to platin-etoposide therapy? Whatever the results are they are a vital next step in considering the use of their model. 

      Please see the comments above regarding our decision not to include data from a clinical trial that lacked appropriate controls.

      (8) The finding of RPM cells that expressed NEUROD1, ASCL1, or both was interesting. From the way the data were presented, I don't have a clear idea which of these lineage oncogenes the metastatic lesions from ~11 different mice expressed. Whatever the result is it would be useful to know - all NEUROD1, some ASCL1, some mixed etc.

      Based on the bulk RNA-sequencing of a few metastatic sites (Figure 4H), what we can demonstrate is that all sites were NEUROD1 and expressed low or no detectable  ASCL1.

      (9) While several H&E histologic images were presented, even when I enlarged them to 400% I couldn't clearly see most of them. For future reference, I think it would be important to have several high-quality images of the RP, RPM, RPMT58A subcutaneous tumors, sub-renal capsule tumors, and liver and lung metastatic lesions. If there is heterogeneity in the primary tumors or the metastases it would be important to show this. The quality of the images they have in the pdf file is suboptimal. If they have already provided higher-quality images - great. If not, I think in the long run as people come back to this paper, it will help both the field and the authors to have really great images of their tumors and metastases. 

      We have attempted to improve the quality of the embedded images. Digital resolution is a tradeoff with data size – higher resolution images are always available upon request, but may not be suitable  for generation of figures in a manuscript viewed on-line.

    1. Reviewer #1 (Public review):

      The aim of this paper is to describe a novel method for genetic labelling of animals or cell populations, using a system of DNA/RNA barcodes.

      Strengths:

      • The author's attempt at providing a straightforward method for multiplexing Drosophila samples prior to scRNA-seq is commendable. The perspective of being able to load multiple samples on a 10X Chromium without antibody labelling is appealing.<br /> • The authors are generally honest about potential issues in their method, and areas that would benefit from future improvement.<br /> • The article reads well. Graphs and figures are clear and easy to understand.

      Weaknesses:

      • The usefulness of TaG-EM for phototaxis, egg laying or fecundity experiments is questionable. The behaviours presented here are all easily quantifiable, either manually or using automated image-based quantification, even when they include a relatively large number of groups and replicates. Despite their claims (e.g., L311-313), the authors do not present any real evidence about the cost- or time-effectiveness of their method in comparison to existing quantification methods.<br /> • Behavioural assays presented in this article have clear outcomes, with large effect sizes, and therefore do not really challenge the efficiency of TaG-EM. By showing a T-maze in Fig 1B, the authors suggest that their method could be used to quantify more complex behaviours. Not exploring this possibility in this manuscript seems like a missed opportunity.<br /> • Experiments in Figs S3 and S6 suggest that some tags have a detrimental effect on certain behaviours or on GFP expression. Whereas the authors rightly acknowledge these issues, they do not investigate their causes. Unfortunately, this question the overall suitability of TaG-EM, as other barcodes may also affect certain aspects of the animal's physiology or behaviour. Revising barcode design will be crucial to make sure that sequences with potential regulatory function are excluded.<br /> • For their single-cell experiments, the authors have used the 10X Genomics method, which relies on sequencing just a short segment of each transcript (usually 50-250bp - unknown for this study as read length information was not provided) to enable its identification, with the matching paired-end read providing cell barcode and UMI information (Macosko et al., 2015). With average fragment length after tagmentation usually ranging from 300-700bp, a large number of GFP reads will likely not include the 14bp TaG-EM barcode. When a given cell barcode is not associated with any TaG-EM barcode, then demultiplexing is impossible. This is a major problem, which is particularly visible in Figs 5 and S13. In 5F, BC4 is only detected in a couple of dozen cells, even though the Jon99Ciii marker of enterocytes is present in a much larger population (Fig 5C). Therefore, in this particular case, TaG-EM fails to detect most of the GFP-expressing cells. Similarly, in S13, most cells should express one of the four barcodes, however many of them (maybe up to half - this should be quantified) do not. Therefore, the claim (L277-278) that "the pan-midgut driver were broadly distributed across the cell clusters" is misleading. Moreover, the hypothesis that "low expressing driver lines may result in particularly sparse labelling" (L331-333) is at least partially wrong, as Fig S13 shows that the same Gal4 driver can lead to very different levels of barcode coverage.<br /> • Comparisons between TaG-EM and other, simpler methods for labelling individual cell populations are missing. For example, how would TaG-EM compare with expression of different fluorescent reporters, or a strategy based on the brainbow/flybow principle?<br /> • FACS data is missing throughout the paper. The authors should include data from their comparative flow cytometry experiment of TaG-EM cells with or without additional hexameric GFP, as well as FSC/SSC and fluorescence scatter plots for the FACS steps that they performed prior to scRNA-seq, at least in supplementary figures.<br /> • The authors should show the whole data described in L229, including the cluster that they chose to delete. At least, they should provide more information about how many cells were removed. In any case, the fact that their data still contains a large number of debris and dead cells despite sorting out PI negative cells with FACS and filtering low abundance barcodes with Cellranger is concerning.

      Overall, although a method for genetic tagging cell populations prior to multiplexing in single-cell experiments would be extremely useful, the method presented here is inadequate. However, despite all the weaknesses listed above, the idea of barcodes expressed specifically in cells of interest deserves more consideration. If the authors manage to improve their design to resolve the major issues and demonstrate the benefits of their method more clearly, then TaG-EM could become an interesting option for certain applications.

      Comments on revisions:

      The authors have addressed many important points, providing reassurances about the initial weaknesses of their work. Although the TaG-EM is unlikely to have a significant influence on the field due to its limited benefits, the results are now sound and provide the reader with an unbiased view of the possibilities and limitations of the method.

    2. Reviewer #2 (Public review):

      The authors developed the TaG-EM system to address challenges in multiplexing Drosophila samples for behavioral and transcriptomic studies. This system integrates DNA barcodes upstream of the polyadenylation site in a UAS-GFP construct, enabling pooled behavioral measurements and cell type tracking in scRNA-seq experiments. The revised manuscript expands on the utility of TaG-EM by demonstrating its application to complex assays, such as larval gut motility, and provides a refined analysis of its limitations and cost-effectiveness.

      Strengths

      (1) Novelty and Scope: The study demonstrates the potential for TaG-EM to streamline multiplexing in both behavioral and transcriptomic contexts. The additional application to labor-intensive larval gut motility assays highlights its scalability and practical utility.

      (2) Data Quality and Clarity: Figures and supplemental data are mostly clear and significantly enhanced in the revised manuscript. The addition of Supplemental Figures 18-21 addresses initial concerns about scRNA-seq data and driver characterization.

      (3) Cost-Effectiveness Analysis: New analyses of labor and cost savings (e.g., Supplemental Figure 8) provide a practical perspective.

      (4) Improvements in Barcode Detection and Analysis: Enhanced enrichment protocols (Supplemental Figures 18-19) demonstrate progress in addressing limitations of barcode detection and increase the detection rate of labeled cells.

      Weaknesses

      (1) Barcode Detection Efficiency: While improvements are noted, the low barcode detection rate (~37% in optimized conditions) limits the method's scalability in some applications, such as single-cell sequencing experiments with complex cell populations.

      (2) Sparse Labeling: Sparse labeling of cell populations, particularly in scRNA-seq assays, remains a concern. Variability in driver strength and regional expression introduces inconsistencies in labeling density.

      (3) Behavioral Applications: The utility of TaG-EM in quantifying more complex behaviors remains underexplored, limiting the generalizability of the method beyond simpler assays like phototaxis and oviposition.

      (4) Driver Line Characterization: While improvements in driver line characterization were made, variability in expression patterns and sparse labeling emphasize the need for further refinement of constructs and systematic backcrossing to standardize the genetic background.

    1. typedef struct node* Address;typedef struct node { ElType info; Address next; } Node;

      Oke, kita sederhanakan ya! 😊

      Kenapa ADT List Linear Pakai Tag (tNode):

      • Karena ada pointer ke dirinya sendiri!
      • Di list linear, next itu adalah pointer yang menunjuk ke struct yang sama (struct tNode).
      • Compiler butuh nama/tag (tNode) untuk ngerti kalau next menunjuk ke dirinya sendiri.

      Contoh: c typedef struct tNode { ElType info; // Data di node Address next; // Pointer ke struct tNode lain } Node; Kalau tanpa tag, compiler bingung karena belum selesai baca tipe struct-nya.


      Kenapa ADT Stack Nggak Butuh Tag:

      • Karena nggak ada pointer ke dirinya sendiri.
      • Stack cuma punya array (buffer) dan variabel biasa (idxTop), nggak ada elemen yang menunjuk ke struct Stack.
      • Jadi, tag nggak diperlukan.

      Contoh: c typedef struct { ElType buffer[CAPACITY]; // Array penyimpan elemen int idxTop; // Penunjuk elemen teratas } Stack;


      Perbedaannya:

      • List Linear: Pakai pointer ke struct yang sama → butuh tag.
      • Stack: Nggak pakai pointer ke dirinya sendiri → nggak butuh tag.

      Udah lebih jelas, kan? 😄

    Annotators

    1. Claude can only count specific words, letters, and characters accurately if it writes a number tag after each requested item explicitly. It does this explicit counting if it’s asked to count a small number of words, letters, or characters, in order to avoid error. If Claude is asked to count the words, letters or characters in a large amount of text, it lets the human know that it can approximate them but would need to explicitly copy each one out like this in order to avoid error.

      It is very funny that they added this to respond to how shit these systems are at this, as though, well, now we've covered the One Problem it has, good job all!

    1. Author response:

      We would like to extend our sincere thanks to you and reviewers at eLife for their thoughtful handling of our manuscript and their valuable feedback, which will greatly improve our study.

      We are committed to performing the additional experiments as recommended by the reviewers. However, we would like to clarify our study's focus. 

      The novelty of our study lies in the highlights of our manuscript:

      • The formation of HIV-induced CPSF6 puncta is critical for restoring HIV-1 nuclear reverse transcription (RT).

      • CPSF6 protein lacking the FG peptide cannot bind to the viral core, thereby failing to form HIVinduced CPSF6 puncta.

      • The FG peptide, rather than low-complexity regions (LCRs) or the mixed charge domains (MCDs) of the CPSF6 protein, drives the formation of HIV-induced CPSF6 puncta.

      • HIV-induced CPSF6 puncta form individually and later fuse with nuclear speckles (NS) via the intrinsically disordered region (IDR) of SRRM2.

      By focusing on these processes, we believe our study provides a critical perspective on the molecular interactions that mediate the formation of HIV-induced CPSF6 puncta and broadens the understanding of how HIV manipulates host nuclear architecture.

      Public Reviews: 

      Reviewer #1 (Public review): 

      In recent years, our understanding of the nuclear steps of the HIV-1 life cycle has made significant advances. It has emerged that HIV-1 completes reverse transcription in the nucleus and that the host factor CPSF6 forms condensates around the viral capsid. The precise function of these CPSF6 condensates is under investigation, but it is clear that the HIV-1 capsid protein is required for their formation. This study by Tomasini et al. investigates the genesis of the CPSF6 condensates induced by HIV-1 capsid, what other co-factors may be required, and their relationship with nuclear speckels (NS). The authors show that disruption of the condensates by the drug PF74, added post-nuclear entry, blocks HIV-1 infection, which supports their functional role. They generated CPSF6 KO THP-1 cell lines, in which they expressed exogenous CPSF6 constructs to map by microscopy and pull down assays of the regions critical for the formation of condensates. This approach revealed that the LCR region of CPSF6 is required for capsid binding but not for condensates whereas the FG region is essential for both. Using SON and SRRM2 as markers of NS, the authors show that CPSF6 condensates precede their merging with NS but that depletion of SRRM2, or SRRM2 lacking the IDR domain, delays the genesis of condensates, which are also smaller. 

      The study is interesting and well conducted and defines some characteristics of the CPSF6-HIV-1 condensates. Their results on the NS are valuable. The data presented are convincing. 

      I have two main concerns. Firstly, the functional outcome of the various protein mutants and KOs is not evaluated. Although Figure 1 shows that disruption of the CPSF6 puncta by PF74 impairs HIV-1 infection, it is not clear if HIV-1 infection is at all affected by expression of the mutant CPSF6 forms (and SRRM2 mutants) or KO/KD of the various host factors. The cell lines are available, so it should be possible to measure HIV-1 infection and reverse transcription. Secondly, the authors have not assessed if the effects observed on the NS impact HIV-1 gene expression, which would be interesting to know given that NS are sites of highly active gene transcription. With the reagents at hand, it should be possible to investigate this too. 

      We thank the reviewer for her/his valuable feedback on our manuscript. We are pleased to see her/his appreciation of our results, and we will do our utmost to address the highlighted points to further improve our work.

      Reviewer #2 (Public review): 

      Summary: 

      HIV-1 infection induces CPSF6 aggregates in the nucleus that contain the viral protein CA. The study of the functions and composition of these nuclear aggregates have raised considerable interest in the field, and they have emerged as sites in which reverse transcription is completed and in the proximity of which viral DNA becomes integrated. In this work, the authors have mutated several regions of the CPSF6 protein to identify the domains important for nuclear aggregation, in addition to the alreadyknown FG region; they have characterized the kinetics of fusion between CPSF6 aggregates and SC35 nuclear speckles and have determined the role of two nuclear speckle components in this process (SRRM2, SUN2). 

      Strengths: 

      The work examines systematically the domains of CPSF6 of importance for nuclear aggregate formation in an elegant manner in which these mutants complement an otherwise CPSF6-KO cell line. In addition, this work evidences a novel role for the protein SRRM2 in HIV-induced aggregate formation, overall advancing our comprehension of the components required for their formation and regulation. 

      Weaknesses: 

      Some of the results presented in this manuscript, in particular the kinetics of fusion between CPSF6aggregates and SC35 speckles have been published before (PMID: 32665593; 32997983). 

      The observations of the different effects of CPSF6 mutants, as well as SRRM2/SUN2 silencing experiments are not complemented by infection data which would have linked morphological changes in nuclear aggregates to function during viral infection. More importantly, these functional data could have helped stratify otherwise similar morphological appearances in CPSF6 aggregates. 

      Overall, the results could be presented in a more concise and ordered manner to help focus the attention of the reader on the most important issues. Most of the figures extend to 3-4 different pages and some information could be clearly either aggregated or moved to supplementary data. 

      First, we thank the reviewer for her/his appreciation of our study and to give to us the opportunity to better explain our results and to improve our manuscript. We appreciate the reviewer’s positive feedback on our study, and we will do our best to address her/his concerns. In the meantime, we would like to clarify the focus of our study. Our research does not aim to demonstrate an association between CPSF6 condensates (we use the term "condensates" rather than "aggregates," as aggregates are generally non-dynamic (Alberti & Hyman, 2021; Banani et al., 2017), and our work specifically examines the dynamic behavior of CPSF6 during infection, as shown in Scoca et al., JMCB 2022) and SC35 nuclear speckles. This association has already been established in previous studies, as noted in the manuscript.

      About the point highlighted by the reviewer: "Kinetics of fusion between CPSF6-aggregates and SC35 speckles have been published before (PMID: 32665593; 32997983)."

      Our study differs from prior work PMID 32665593 because we utilize a full-length HIV genome and we did not follow the integrase (IN) fluorescence in trans and its association with CPSF6 but we specifically assess if CPSF6 clusters form in the nucleus independently of NS factors and next to fuse with them. In the current study we evaluated the dynamics of formation of CPSF6/NS puncta, which it has not been explored before. Given this focus, we believe that our work offers a novel perspective on the molecular interactions that facilitate HIV / CPSF6-NS fusion.

      For better clarity, we would like to specify that our study focuses on the role of SON, a scaffold factor of nuclear speckles, rather than SUN2 (SUN domain-containing protein 2), which is a component of the LINC (Linker of Nucleoskeleton and Cytoskeleton) complex.

      As suggested by the reviewer, we will keep key information in the main figure and move additional details to the supplementary material.

      Reviewer #3 (Public review): 

      In this study, the authors investigate the requirements for the formation of CPSF6 puncta induced by HIV-1 under a high multiplicity of infection conditions. Not surprisingly, they observe that mutation of the Phe-Gly (FG) repeat responsible for CPSF6 binding to the incoming HIV-1 capsid abrogates CPSF6 punctum formation. Perhaps more interestingly, they show that the removal of other domains of CPSF6, including the mixed-charge domain (MCD), does not affect the formation of HIV-1-induced CPSF6 puncta. The authors also present data suggesting that CPSF6 puncta form individual before fusing with nuclear speckles (NSs) and that the fusion of CPSF6 puncta to NSs requires the intrinsically disordered region (IDR) of the NS component SRRM2. While the study presents some interesting findings, there are some technical issues that need to be addressed and the amount of new information is somewhat limited. Also, the authors' finding that deletion of the CPSF6 MCD does not affect the formation of HIV-1-induced CPSF6 puncta contradicts recent findings of Jang et al. (doi.org/10.1093/nar/gkae769). 

      We thank the reviewer for her/his thoughtful feedback and the opportunity to elaborate on why our findings provide a distinct perspective compared to those of Jang et al. (doi.org/10.1093/nar/gkae769), while aligning with the results of Rohlfes et al. (doi.org/10.1101/2024.06.20.599834).

      One potential reason for the differences between our findings and those of Jang et al. could be the choice of experimental systems. Jang et al. conducted their study in HEK293T cells with CPSF6 knockouts, as described in Sowd et al., 2016 (doi.org/10.1073/pnas.1524213113). In contrast, our work focused on macrophage-like THP-1 cells, which share closer characteristics with HIV-1’s natural target cells. 

      Our approach utilized a complete CPSF6 knockout in THP-1 cells, enabling us to reintroduce untagged versions of CPSF6, such as wild-type and deletion mutants, to avoid potential artifacts from tagging. Jang et al. employed HA-tagged CPSF6 constructs, which may lead to subtle differences in experimental outcomes due to the presence of the tag.

      Finally, our investigation into the IDR of SRRM2 relied on CRISPR-PAINT to generate targeted deletions directly in the endogenous gene (Lester et al., 2021, DOI: 10.1016/j.neuron.2021.03.026). This approach provided a native context for studying SRRM2’s role.

      We will incorporate these clarifications into the discussion section of the revised manuscript.

    1. I haven't researched where the color-coding thing started, though I suspect content creators/influencers online in the last decades as a means of making their content "pretty" rather than necessarily functional.

      Historically commonplaces were based on huge varieties of topics/subject headings, so colors and symbols were not frequently used. Most who needed greater organization or search capabilities indexed their commonplaces. One of the most popular means was detailed by philosopher John Locke in 1685. Here's some pointers to his work in this area in my own digital commonplace using Hypothesis: https://hypothes.is/users/chrisaldrich?q=tag%3A%22commonplace+books%22+tag%3A%22John+Locke%22


      reply to u/_cold_one at https://old.reddit.com/r/commonplacebook/comments/1hhavye/20_topics_colour_coding/

    1. Reviewer #1 (Public Review):

      Summary

      The authors asked if parabrachial CGRP neurons were only necessary for a threat alarm to promote freezing or were necessary for a threat alarm to promote a wider range of defensive behaviors, most prominently flight.

      Major Strengths of Methods and Results

      The authors performed careful single-unit recording and applied rigorous methodologies to optogenetically tag CGRP neurons within the PBN. Careful analyses show that single-units and the wider CGRP neuron population increases firing to a range of unconditioned stimuli. The optogenetic stimulation of experiment 2 was comparatively simpler but achieved its aim of determining the consequence of activating CGRP neurons in the absence of other stimuli. Experiment 3 used a very clever behavioral approach to reveal a setting in which both cue-evoked freezing and flight could be observed. This was done by having the unconditioned stimulus be a "robot" traveling along a circular path at a given speed. Subsequent cue presentation elicited mild flight in controls and optogenetic activation of CGRP neurons significantly boosted this flight response. This demonstrated for the first time that CGRP neuron activation does more than promote freezing. The authors conclude by demonstrating that bidirectional modulation of CGRP neuron activity bidirectionally affects freezing in a traditional fear conditioning setting and affects both freezing and flight in a setting in which the robot served as the unconditioned stimulus. Altogether, this is a very strong set of experiments that greatly expand the role of parabrachial CGRP neurons in threat alarm.

      Weaknesses

      In all of their conditioning studies the authors did not include a control cue. For example, a sound presented the same number of times but unrelated to US (shock or robot) presentation. This does not detract from their behavioral findings. However, it means the authors do not know if the observed behavior is a consequence of pairing. Or is a behavior that would be observed to any cue played in the setting? This is particularly important for the experiments using the robot US.

      The authors make claims about the contribution of CGRP neurons to freezing and fleeing behavior, however, all of the optogenetic manipulations are centered on the US presentation period. Presently, the experiments show a role for these neurons in processing aversive outcomes but show little role for these neurons in cue responding or behavior organizing. Claims of contributions to behavior should be substantiated by manipulations targeting the cue period.

      Appraisal

      The authors achieved their aims and have revealed a much greater role for parabrachial CGRP neurons in threat alarm.

      Discussion

      Understanding neural circuits for threat requires us (as a field) to examine diverse threat settings and behavioral outcomes. A commendable and rigorous aspect of this manuscript was the authors decision to use a new behavioral paradigm and measure multiple behavioral outcomes. Indeed, this manuscript would not have been nearly as impactful had they not done that. This novel behavior was combined with excellent recording and optogenetic manipulations - a standard the field should aspire to. Studies like this are the only way that we as a field will map complete neural circuits for threat.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank reviewers for their comments and constructive criticisms of our study. We have implemented corrections* that were suggested for the manuscript, and we have also clarified any concerns that were raised in our responses below. *

      *Reviewer #1 *

      Overall technology development is good though as they claim that they are first is not true as it has been used earlier by https://doi.org/10.1128/msphere.00160-22. Hence may be that they have used to decipher the cell cycle.

      The cited paper used FUCCI in the host cells and not in the parasites themselves. Our study thus reports the first FUCCI model in a unicellular *eukaryote. *

      • *

      The manuscript is extremely dense and at times very difficult to read and to be clear if they are focussing on the technology or cell cycle. The technology may be a better part of manuscript but the dissection of cell cycle is not very novel and at times very confusing to follow. Many of these aspects has been dissected out previously from their own group and many group in Toxoplasma and Plasmodium and it is quite known about that the cell cycle in Apicomplexa is very complex.

      We adapted FUCCI to the Toxoplasma model to help dissect the organization of its cell cycle, which as the reviewer noted, is highly complex. While overlaps between some phases were anticipated based on prior data, these overlaps had not been measured. We were able to determine the extent of these overlaps in the post-G1 period and describe the organization of the non-conventional cell cycle of T. gondii.

      Another aspect that most FUCCI use Geminin and CDT1 factors and since Geminin is not present it would have been better to validate that with CDT1 that is present in Apicomplexa and may be more relevant than PCNA1.

      Unfortunately, the Toxoplasma ortholog of CDT1 (TgiRD1) cannot be used as a FUCCI marker for the reasons stated in lines 116-117; the expression of TgiRD1 is not limited to a specific cell cycle phase (Hawkins et al., 2024). PCNA1 can be (and has been) used as a FUCCI marker, but it was not considered an ideal marker in mammalian cells due to its relatively low expression levels. However, Toxoplasma PCNA1 is highly abundant in tachyzoites, and its expression correlates with the period of DNA replication. Furthermore, Plasmodium ortholog of PCNA1 had been used as a DNA replication sensor in the recent studies (35353560). *Altogether, it validates PCNA1 as an appropriate S-phase FUCCI probe. *

      The first part of the manuscript only deals with first to identify the function and localisation of PCNA1 and then develop FUCCI technology and then go on to study cell cycle. So the focus of the manuscript is not clear. It seems three different results are just assembled together in one manuscript with out clear focus. In order to get clear focus the authors should clear set out the focus as to why they developed FUCCCI and how they decipher either replication, budding, apical or basal complex, centrosome or cytokinesis as well to be used for drug discovery The way it is organised it is not flowing well and confuses the reader who may not be aware of different compartment of Toxoplasma cell or not a molecular parasitologist.

      We believe the reviewer has described the logic of our study. Our goal was to dissect the cell cycle. Consequently, we adapted a suitable technology, FUCCI. We described the relevant experiments that allowed us to produce a new molecular tool for an apicomplexan model, and illustrated how we used this tool to better understand the complicated processes of its cell division. Therefore, we organized our study accordingly and included our goal, plans, results, and conclusions that support the success of adopted technology and establishment of the cell cycle organization. We hope this brief explanation can provide some clarification for the reviewer.

      Some of the conclusion on the that Replication starts at centromere region is not novel and has been studied previously.

      We agree that the centromeric start of DNA replication is not a novel feature, which is stated in the text. This result was shown to demonstrate that Toxoplasma replicates its DNA according to the rules* conserved across eukaryotes. *

      The manuscript needs revising by writing precisely eliminating too much literature reference in the result section with clear focus. Some of these references can be elaborated in the introduction and discussion to keep the focus.

      We examined the results section, and as much as we wanted to comply with this reviewer, we found no references that could be eliminated or transferred to the introduction. We believe that to aid the reader, some foundational knowledge needs to be presented together with obtained results to support those findings.

      • *

      Some points with respect to figures: Generally with image panels, arrows don't stand out well

      We* have adjusted the images.

      *

      Fig1: no scale bars and the green arrow do not stand out. So may be to make white.

      *The scale bar can be found in the bottom right image, which applies to every image in the panel. We changed the color of the arrows. *

      Fig 2E: state the time point in the fig without IAA treatment (-IAA)

      The requested information was added to the figure legend.

      Fig4: no bell shaped curve

      We rephrased the description. The” bell-shape” analogy applies to the temporal dynamics of DNA replication, which starts with a single aggregate, expands to numerous replication foci, and is reduced to a few aggregates at the end of replication. We attempted to quantify aggregates, but their irregular shape makes this task impossible. Our statement is supported by steady-state images and real-time microscopy of the DNA replication included in the manuscript.

      Fig 5D: it isn't obvious what the numbers on the right hand side of the graph mean. If it is size, there should be a unit given

      We provided an explanation in the figure legend*.

      *

      Figure 6 - how do they determine that the tachyzoites have progressed through 61% of S phase? Make this clearer here.

      *We examined only DNA replicating parasites (S-phase) and determined the fraction of BCC0-positive (39%) and BCC0-negative (61%) tachyzoites. Quantifications can be found in Table S4, in the S-C worksheet. *

      • *

      Fig7: it a strange way of ordering the figure as FigE is after Fig F hence no logical order. Thank you, we have corrected the order of these panels*. *

      Fig 8H is not mentioned in the text

      *Thank you, we referenced the wrong panel. Fig. 8H is now included in the text. *

      Figure 9 is nice and useful but the arrows could be made proportional of time spent in each cell cycle phase. They're a little off in the conventional cell cycle at the minute

      • *These schematics are intended to illustrate the dramatic difference in cell cycle organization rather than to directly describe cell cycle organization, the latter of which can be found in Figure 6.

      Some comment on the text in the manuscript: Line 137: describing the expression pattern: the following papers first described the expression pattern of PCNA1 and 2 can be cited in the result. https://doi.org/10.1016/j.molbiopara.2005.03.020 We added the reference.

      Line 154: Provide schematic for AID HA cloning and confirmation.

      The schematics and PCR confirmations* can be found in the supplemental figure S2.

      *

      Line 157: Fig 2 after 4 h treatment FACS analysis shows more than 1 and less than 2n genomic content. Does this study have any -IAA treated control for 4h and 7h to compare as what should the standard genomic content to be there at this time point of development. At 4 h of development can the authors provide any statistical analysis with their 3 experiments to prove their point that the replication is actually stalled. Downregulation of TgPCNA1 as shown is western blot is still basal protein left to carry the genomic replication in 7 mins. Can authors also state that TgPCNA 2 which is although non-essential but has no redundant role in the replication machinery.

      The -IAA control is indicated as 0h and is shown in blue. The statistical analysis of three independent experiments showing the increase of the S-phase population is included in Table S3. The Fig. 2 WB shows over 99% TgPCNA1 degradation, and the residual >1% would be insufficient to carry out full DNA replication. This residual signal is likely due to PCNA1 remaining in complex, which would resist *proteolysis. Unfortunately, we do not feel comfortable to make the final statement suggested. We believe that the lack of TgPCNA2 complementation with yeast PCNA1 (Guerini et al, 2005) is insufficient to draw the conclusion that TgPCNA2 plays a non-redundant role in Toxoplasma replication machinery. *

      Line 178 : typing error "that that

      Thank you, this has been corrected*.

      *

      Line 179: states the role of TgPCNA 1 in DNA1 replication, however line 159 and 160 states the TgPCNA1 deficient can fulfil DNA replication. Can author confirm this contrast in the results. Results trying to illustrate the same fact TgFUCCIs or TgPCNA1ng that TgPCNA1 first aggregates at centromeres and then distributed on many replication forks and disappears late during cytokinesis. The part of the result can be merged.

      We apologize for the *confusion. We rephrased our statements and supported them by corresponding references. Although it may seem repetitive, but it was our intention to emphasize a consistent spatial-temporal expression of TgPCNA1-HA and TgPCNA1-NG. *

      Line 189: Typing error, should say "such as nucleus", currently as is missing

      Thank you, this has *been corrected.

      *

      Line 346-349: basically explaining the same thing twice.

      We apologize for the confusion, the first sentence describes compartments where MORN1 is located. The second sentence describes how MORN1 localization changes during cell cycle progression, information which is used later in our quantitative IFA of cell cycle phases*. *

      • *

      Line 347 - immunfluorescent should be immunofluorescence

      Thank you, this has been corrected*.

      *

      Line 395-399: does this study has any non-inhibited (-IAA control) at 4h and 7 h. for fig 7C & 7G. Can the authors provide any statistical analysis for the significance with their 3 experiments.

      The untreated control (7h mock) is shown as 0h treatment (first bar in each panel). The figure also shows the results of the statistical analysis (t-test, numbers above) that can also be found in Table* S7.

      *

      Line 415: Why the authors have not used the TgFUUCI sc lines which expresses the TgPCNAng and IMCmch both. This could have helped to understand the real time dynamics of DNA replication and budding initiation (cytokenesis), rather then fixing and staining with TgIMC.

      *The recent study by Gubbels lab identified the earliest known budding marker BCC0. Unfortunately, BCC0 is a low abundant factor and cannot be used in FUCCI. IMC3 emerges in the midst of budding when the daughter conoid and polar rings are assembled and thus does not signify either the beginning or the end of cytokinesis. We added IMC3 as a supporting budding marker, while our primary focus remains on the DNA replication marker PCNA1. *

      Overall good technology development as FUCCI but the rest of the manuscript is extremely dense and the focus of the study is not clear after technology part. The complexity of the cell cycle is known and hence not much novelty here and extremely descriptive and hard read. Science can be simplified.

      The reviewer agrees the apicomplexan cell cycle is highly complex, and the field has worked diligently to piece together what we can about it, which contributes to the density of the manuscript. We hope that the targeted audience will find it thoughtful, and we strove to provide sufficient information for those outside our field. We also respectfully disagree that our study offers little novelty; while it is known how complex the apicomplexan cell cycle is, there is still much to uncover. While overlapping cell cycle phases exist in other eukaryotes, there were no such studies that showed the degree of these overlaps across the entire T. gondii cell cycle. We believe there are valuable insights to be gained from the identification of the composite cell cycle phase, which in turn could help draw attention to other understudied features of the cell cycle in non-conventional eukaryotes*. *

      *Reviewer #2 *

      1. It is not always clear where apical and basal ends of the parasite are. E.g. in Fig 3F are the two parasites on the right facing down with their apical end? In Fig 4 it is even harder to see. Might be helpful to turn these images with their apical end up to make comparative interpretation of figures easier. In the text it mentions that PCNA1 concludes at the 'proximal' end of the nucleus (or with the nucleus proximal, which is not clear either??). Please define clearly where the proximal site is, as it is not clear in the figures or in the movie (the 'last focus' marker in Fig 4D??). Thank you for the suggestion. We rotated images in Fig. 3 and marked the parasite ends in Fig. 4. We also indicated parasites’ polarity in the movies.

      Synchrony of replication cycle. Tight synchronization depends on the retention of the cytoplasmic bridge, as mentioned by the authors. In larger vacuoles, it is very conceivable not all parasites are connected with each other (notably in large cysts with bradyzoites), which could lead to loss of tight synchrony. The results section states "One plausible explanation is that the rosette split shortens the communication path between tachyzoites". This is somewhat cryptic language: does a 'rosette split' imply the rupture of the cytoplasmic bridge? This statement should be clarified. Another factor could be centrosome maturation, with the mother centrosome ready sooner than the daughter, which is a model proposed in schizogony, where the nuclear cycles in a shared cytoplasm are even more asynchronous/independent.

      Yes, by ‘rosette split’, we refer to the break of the connection, or a cytoplasmic bridge. The model based on centrosome maturation is interesting, however, it does not explain the synchronization of a vacuole of 16, unless centrosome age resets at that point*. *

      Centrosome duplication. This has been documented to occur at the basal side of the nucleus (the whole nucleus rotates for centrosome duplication). The images as depicted in Fig 6 do not seem to indicate this event, possibly because it is not easy to track apical and basal end of the cell (#1 above). Please comment, as this could be an additional spatial cue to the specific stage of the cycle.

      This is a very interesting suggestion, thank you. Indeed, the centrosome often duplicates away from the apical end (disconnects from the Golgi), sometimes on the side or the basal end, but quickly rotates back to the apical position to reconnect with co-segregating organelles. Centrosome traveling is an interesting feature, and it is possible that this reorientation back to the apical end signifies budding initiation. We will explore this hypothesis in future studies.

      • Specific experimental issues that are easily addressable.

      • The term "Apicomplexan" should be spelled with a lower case "apicomplexan", which is not consistently applied throughout the manuscript. Thank you, we have corrected the spelling*. *

      * 2. Line 567 the term used in 2008 was "tightly knit" not "closely woven". We wanted to avoid the exact citation and rephrased the title of the review.

      *

      *Reviewer #3 *

      -The authors choose to describe PCNA1 and IMC3 as FUCCI markers. The efficiency of this system in mammalian cells is based on the proof that the markers are regulated through a rapid proteolysis process. However, the data available for these markers point toward a transcriptional regulation of these markers (Toxodb and (1)). In contrast, the authors do not provide any data indicating that these proteins are true FUCCI markers. Consequently, they should not use the term FUCCI throughout the paper unless they prove that the cell cycle expression depends on proteolysis. For example, the authors could express these genes with a promoter that is not cell cycle regulated.

      PCNA1 was one of the original FUCCI markers for mammalian cells, later replaced by the more abundant geminin. PCNA1 ubiquitination is well supported across all eukaryotes, and we believe there is much data to support this same turnover mechanism acts to regulate PCNA1 in Toxoplasma. Transcriptional profiles show that TgPCNA1 mRNA is constantly present in cells, never dropping below 80%, making this mRNA is among the most abundant in the cell. It also indicates that proteolysis, rather than halted transcription, controls TgPCNA1 protein levels, since TgPCNA1 protein expression drops to nearly undetectable levels in early G1 and budding (Fig. 1). In addition, TgPCNA1 is highly conserved in structure (Fig. S1) and in function (TgPCNA1 interactome, Fig. 1). The TgPCNA1 Ub sites were detected in global ubiquitome analyses (ToxoDB), supporting the fact that TgPCNA1 protein abundance is regulated by ubiquitin-dependent degradation. Furthermore, PCNA1 as a FUCCI marker in model eukaryotes was not tested for proteolysis because it was unquestionable that PCNA1 is regulated by proteolysis. In addition, Plasmodium ortholog of PCNA1 had been used as a DNA replication sensor in the recent studies (35353560), which validates PCNA1 as an appropriate S-phase FUCCI probe. The modern FUCCI probes are fragments of CDT1 and Geminin mimicking the spatiotemporal expression of the corresponding cell cycle regulators. The transcriptional profile of TgIMC3 is also largely unchanged across the cell cycle, which heavily implies that proteolysis control*s its dynamic protein expression. Therefore, we believe that the term FUCCI applies to TgPCNA1 and TgIMC3. *

      -The authors show that the localization of PCNA1 change during the cell cycle and indicate that the PCNA1 aggregates observed are replication forks. They do not provide data supporting this. They should co-localize these aggregates with other markers such as ORC, MCM proteins or DNA polymerase to better characterize these aggregates. There are number of techniques that could be used to localize the origin(s) of replication. Similarly, ExM should be used to characterize the colocalization between PCNA1 aggregates and the centromeres. As such, the images provided are of poor quality and do not support the author conclusions. The few PCNA1 aggregates toward the end of the S phase are also not characterized. Are they telomeres?

      Although this is an important point, such detailed analyses of the DNA replication machinery is out of the scope of the current study and will be examined in a follow-up study. Data that suggest the aggregates correspond to replication forks include proteomics analyses of chromatin-bound PCNA1 that identified replisome components such as the MCM, high conservation of TgPCNA1 sequence and structure (Fig. S1), and its conserved interactions (Fig. 1). Recent studies used Plasmodium ortholog of PCNA1 to trace DNA replication dynamics during schizogony (35353560), *Therefore, we doubt that TgPCNA1 would perform functions outside of its role as a DNA replication factor, which has been extensively studied in other eukaryotes. *

      • The authors characterized the proteins associated with PCNA1. All the proteins found to potentially interact are chromatin-bound and are not naturally found in other localization (2). It is unclear why the authors insist on the fact that there are two PCNA1 complexes (one chromatin-bound and one non-chromatin bound). More concerning is the lack of verification of this dataset through reciprocal IP for example.

      The PCNA IP was used to confirm its conserved function as a DNA replication factor; similarly to what was observed in other eukaryotes, we detected PCNA in both a chromatin-bound and unbound state. PCNA1 is produced in late G1 (diffuse nuclear stain) but is engaged in the replisome only upon DNA replication initiation (aggregated form). Rather than characterize the function of the highly conserved PCNA1, our primary goal was to determine the Toxoplasma cell cycle organization, which explains our choice of the experimental design.

      • Quantification of some of the phenotypes is lacking. For example, the DNA content analysis are shown but the change in number are not. Similarly, there is no quantification of the PCNA1 mutant phenotypes observed by ExM. Quantification of the bell shape observed by video-microscopy in figure 4 should also be provided.

      The quantifications supporting the main claims of our study are included in the five supplemental Tables S3-S8, including DNA content and microscopy analysis of the phenotype. *The U-ExM microscopy has been solely used to visualize details of the phenotype. *

      • The PCNA1 mutant phenotypes are not sufficiently explored by ExM. What happen to the mitotic spindle? What happens to kinetochore (CenH3 is a centromere protein and does not represent kinetochores)? Many markers for these structures have been described, see (3).

      The primary goal of our study was to examine and map out the organization of the tachyzoite cell cycle. PCNA1 deficiency was used to demonstrate that Toxoplasma PCNA1 is a conserv*ed DNA replication factor and can be used as an S-phase marker in FUCCI. Thus, we focused on the mutant-induced changes in the dynamics of DNA replication (DNA content) and arrest prior to mitosis (unresolved centrocone). *

      • TgPCNA1NG strain has a number of concerns. The localization to the daughter cells conoids seems artificial since not observed in the HA-AID mutant and the expression pattern seems different as well than the previous mutant suggesting the mNG tag is affecting the localization and expression dynamics. Did the authors explore other fluorescent proteins to verify that these discrepancies where not due to this tag ?

      The conoidal PCNA1 accumulation was detected only with NeonGreen-tagged PCNA1. We also built and examined tdTomato- and mCherry-tagged versions and detected minor accumulations in the conoid of tdTomato-tagged PCNA1, but not with the mCherry-tagged variant. We believe these aggregations could be attributed to the partially degraded PCNA1-NeonGreen having an affinity to conoidal proteins, thus producing this unexpected signal. Although not included in the manuscript, our quantifications, based on both PCNA1-HA and PCNA1-NeonGreen, showed similar cell cycle organization (G1, S and budding phases) of tachyzoites. The FUCCI probe is an indicator of the cell cycle phase. It does not have to be a functional protein. As we mentioned before, many FUCCI probes are fragments of the factors that mimic the spatiotemporal expression of the corresponding cell cycle regulators.

      -Cytokinesis seems to be only defined by the presence of IMC3. The marker appears early during the budding process and it is not normally considered as a cytokinesis marker. The author should the text to reflect this.

      We agree with the reviewer that IMC3 is not a true budding marker, which is why we used BCC0 in our quantifications. IMC3 is proven to broadly define the mid-budding stage, making it a convenient supplemental marker. We are currently exploring and testing alternative and additional FUCCI markers. It is not an easy task, since these markers are required to have high expression levels and to be localized into large organelles. For instance, BCC0 was eliminated due to low abundance.

      • Throughout the manuscript, the authors seems to ignore an essential characteristic of the tachyzoite cell cycle: the nuclear cycle and the budding cycle are independently regulated. It is therefore normal they overlap as it has been shown by the authors themselves in previous studies. This should be better described and discussed in the paper to understand the peculiarities of the parasite cell cycle.

      We apologize for the confusion, but the tachyzoite cell cycle does not contain a nuclear cycle, it consists of a single budding cycle. The nuclear cycle is only a feature in multinuclear cell cycles such as schizogony and endopolygeny. This is the main reason why the overlap between phases is so surprising.

      • l196: "The surface of the growing buds": could the authors rephrase?

      We rephrased the statement.

      -L217: proximal end of the nucleus rather than "parasite ".

      *We clarified the statement. It is, in fact, the shift of the nucleus to the proximal end of the parasite.

      *

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This is a manuscript from Batra et al. entitled "A FUCCI sensor reveals complex cell cycle organization of Toxoplasma endodyogeny ". It describes the characterization of PCNA1 as cell cycle marker in the parasite Toxoplasma gondii. Tachyzoite endodyogeny is a simplified division process that is crucial for the proliferation of the parasite. Some studies have used fluorescent markers to describe the segregation of organelles and the nuclear division during endodyogeny but the production of more tools to dissect the cell cycle and better characterize mutants is timely. Most of the experiments are based on characterization of PCNA1 mutant and the use of a strain expressing a PCNA1-mNG construct. Unfortunately, there are a number of concerns in this study that need to be addressed.

      Major concerns:

      • The authors choose to describe PCNA1 and IMC3 as FUCCI markers. The efficiency of this system in mammalian cells is based on the proof that the markers are regulated through a rapid proteolysis process. However, the data available for these markers point toward a transcriptional regulation of these markers (Toxodb and (1)). In contrast, the authors do not provide any data indicating that these proteins are true FUCCI markers. Consequently, they should not use the term FUCCI throughout the paper unless they prove that the cell cycle expression depends on proteolysis. For example, the authors could express these genes with a promoter that is not cell cycle regulated.
      • The authors show that the localization of PCNA1 change during the cell cycle and indicate that the PCNA1 aggregates observed are replication forks. They do not provide data supporting this. They should co-localize these aggregates with other markers such as ORC, MCM proteins or DNA polymerase to better characterize these aggregates. There are number of techniques that could be used to localize the origin(s) of replication. Similarly, ExM should be used to characterize the colocalization between PCNA1 aggregates and the centromeres. As such, the images provided are of poor quality and do not support the author conclusions. The few PCNA1 aggregates toward the end of the S phase are also not characterized. Are they telomeres?
      • The authors characterized the proteins associated with PCNA1. All the proteins found to potentially interact are chromatin-bound and are not naturally found in other localization (2). It is unclear why the authors insist on the fact that there are two PCNA1 complexes (one chromatin-bound and one non-chromatin bound). More concerning is the lack of verification of this dataset through reciprocal IP for example.
      • Quantification of some of the phenotypes is lacking. For example, the DNA content analysis are shown but the change in number are not. Similarly, there is no quantification of the PCNA1 mutant phenotypes observed by ExM. Quantification of the bell shape observed by video-microscopy in figure 4 should also be provided.
      • The PCNA1 mutant phenotypes are not sufficiently explored by ExM. What happen to the mitotic spindle? What happens to kinetochore (CenH3 is a centromere protein and does not represent kinetochores)? Many markers for these structures have been described, see (3).
      • TgPCNA1NG strain has a number of concerns. The localization to the daughter cells conoids seems artificial since not observed in the HA-AID mutant and the expression pattern seems different as well than the previous mutant suggesting the mNG tag is affecting the localization and expression dynamics. Did the authors explore other fluorescent proteins to verify that these discrepancies where not due to this tag ? -Cytokinesis seems to be only defined by the presence of IMC3. The marker appears early during the budding process and it is not normally considered as a cytokinesis marker. The author should the text to reflect this.
      • Throughout the manuscript, the authors seems to ignore an essential characteristic of the tachyzoite cell cycle: the nuclear cycle and the budding cycle are independently regulated. It is therefore normal they overlap as it has been shown by the authors themselves in previous studies. This should be better described and discussed in the paper to understand the peculiarities of the parasite cell cycle.

      Minor

      • l196: "The surface of the growing buds": could the authors rephrase?
      • L217: proximal end of the nucleus rather than "parasite ".

      • Behnke,M.S., Wootton,J.C., Lehmann,M.M., Radke,J.B., Lucas,O., Nawas,J., Sibley,L.D. and White,M.W. (2010) Coordinated progression through two subtranscriptomes underlies the tachyzoite cycle of Toxoplasma gondii. PloS One, 5, e12354.

      • Barylyuk,K., Koreny,L., Ke,H., Butterworth,S., Crook,O.M., Lassadi,I., Gupta,V., Tromer,E., Mourier,T., Stevens,T.J., et al. (2020) A Comprehensive Subcellular Atlas of the Toxoplasma Proteome via hyperLOPIT Provides Spatial Context for Protein Functions. Cell Host Microbe, 28, 752-766.e9.
      • L,B., N,D.S.P., Ec,T., D,S.-F. and M,B. (2022) Composition and organization of kinetochores show plasticity in apicomplexan chromosome segregation. J. Cell Biol., 221.

      Significance

      This study provides the characterization of a new cell cycle marker to decipher the tachyzoite cell cycle of the apicomplexan parasite Toxoplasma gondii. A better understanding of the cell cycle is needed to prevent the proliferation of this parasite. This study builds on previous works characterizing organellar segregation in T. gondii. It provides data about the overlap of each cell cycle phase and the synchronicity of the cell cycle in a single vacuole. However, it is limited by the use of a single marker and more data are needed to support the conclusions of this study. This study can be of interest to a broad audience.

    1. If I tag you in this post, that means that some time since 2005 (2005!), when I created this Thought called Viz Posse, I added you to a long list of cool humans interested in maps,

      long list of cool humans interested in hypermaps

    1. Author response:

      The following is the authors’ response to the original reviews.

      Reviewer #1 (Public Review): 

      Though the Norrin protein is structurally unrelated to the Wnt ligands, it can activate the Wnt/βcatenin pathway by binding to the canonical Wnt receptors Fzd4 and Lrp5/6, as well as the tetraspanin Tspan12 co-receptor. Understanding the biochemical mechanisms by which Norrin engages Tspan12 to initiate signaling is important, as this pathway plays an important role in regulating retinal angiogenesis and maintaining the blood-retina-barrier. Numerous mutations in this signaling pathway have also been found in human patients with ocular diseases. The overarching goal of the study is to define the biochemical mechanisms by which Tspan12 mediates Norrin signaling. Using purified Tspan12 reconstituted in lipid nanodiscs, the authors conducted detailed binding experiments to document the direct, high-affinity interactions between purified Tspan12 and Norrin. To further model this binding event, they used AlphaFold to dock Norrin and Tspan12 and identified four putative binding sites. They went on to validate these sites through mutagenesis experiments. Using the information obtained from the AlphaFold modeling and through additional binding competition experiments, it was further demonstrated that Tspan12 and Fzd4 can bind Norrin simultaneously, but Tspan12 binding to Norrin is competitive with other known co-receptors, such as HSPGs and Lrp5/6. Collectively, the authors proposed that the main function of Tspan12 is to capture low concentrations of Norrin at the early stage of signaling, and then "hand over" Norrin to Fzd4 and Lrp5/6 for further signal propagation. Overall, the study is comprehensive and compelling, and the conclusions are well supported by the experimental and modeling data. 

      Strengths: 

      • Biochemical reconstitution of Tspan12 and Fzd4 in lipid nanodiscs is an elegant approach for testing the direct binding interaction between Norrin and its co-receptors. The proteins used for the study seem to be of high purity and quality. 

      • The various binding experiments presented throughout the study were carried out rigorously. In particular, BLI allows accurate measurement of equilibrium binding constants as well as on and off rates. 

      • It is nice to see that the authors followed up on their AlphaFold modeling with an extensive series of mutagenesis studies to experimentally validate the potential binding sites. This adds credence to the AlphaFold models. 

      • Table S1 is a further testament to the rigor of the study. 

      • Overall, the study is comprehensive and compelling, and the conclusions are well supported by the experimental and modeling data. 

      Suggestions for improvement: 

      • It would be helpful to show Coomassie-stained gels of the key mutant Norrin and Tspan12 proteins presented in Figures 2E and 2F. 

      We have included Stain-Free SDS-PAGE gels from the purification of the Norrin and Tspan12 mutants in a new Figure S4.

      • Many Norrin and Tspan12 mutations have been identified in human patients with FEVR. It would be interesting to comment on whether any of the mutations might affect the NorrinTspan12 binding sites described in this study. 

      Thank you for this suggestion. We have inspected human mutation databases gnomAD, ClinVar, and HGMD for known mutations in the predicted Tspan12-Norrin binding interface and their occurrence in human patients with FEVR or Norrie disease.

      While a number of Tspan12 residues that we predict to interact with Norrin are impacted by rare mutations in humans (e.g., L169M, E170V, E173K, D175N, E196G, S199C, as found in the gnomAD database), these alleles are of unknown clinical significance (as found in ClinVar or HGMD databases). It is possible that mutations that slightly weaken the Norrin-Tspan12 interface may not produce a strong phenotype, especially given the avidity we expect from this system. By our examination, the missense variants of clinical significance that have been found in the Tspan12 LEL would be expected to destabilize the protein (i.e., mutations to or from cysteine or proline, or mutations to residues involved in packing interactions within the LEL fold), and therefore these mutations may produce a disease phenotype by impacting Tspan12 protein expression levels.  

      Several Norrin mutations that are associated with Norrie disease, FEVR, or other diseases of the retinal vasculature have been found in the predicted Tspan12 binding site. For example, Norrin mutations at positions L103 (L103Q, L103V), K104 (K104N, K104Q), and A105 (A105T, A105P, A105E, A105S, A105T, A105V) have been found in patients, all of which may disrupt binding to Tspan12. However, the deleterious effect of K104 mutations on Norrin-stimulated signaling could also be explained by a weakened Norrin-Fzd4 binding interface. Norrin mutations at R115 (R115L and R115Q), as well as R121 (R121L, R121G, R121Q, and R121W) have also been found in patients with various diseases of the retinal vasculature. Additionally, the Norrin mutation T119P has been found in patients with Norrie disease, but we would expect this mutation to destabilize Norrin in addition to disrupting the Tspan12 binding site. 

      While we commented briefly on mutations R115L and R121W in the original draft (page 5, paragraphs 4 and 1, respectively), we have updated the manuscript with more comments on disease-associated mutations to the predicted Tspan12 binding site on Norrin (page 5, first partial paragraph; page 9, first partial paragraph). 

      • Some of the negative conclusions (e.g. the lack of involvement of Tspan12 in the formation of the Norrin-Lrp5/6-Fzd4-Dvl signaling complex) can be difficult to interpret. There are many possible reasons as to why certain biological effects are not recapitulated in a reconstitution experiment. For instance, the recombinant proteins used in the experiment may not be presented in the correct configurations, and certain biochemical modifications, such as phosphorylation, may also be missing. 

      We agree that different Tspan12 and Fzd4 stoichiometries, lipid compositions, and posttranslational modifications could impact the results of our study, and that it is important to mention these possibilities. We have added these caveats to the discussion section (page 10, last paragraph).  

      Reviewer #2 (Public Review): 

      This is an interesting study of high quality with important and novel findings. Bruguera et al. report a biochemical and structural analysis of the Tspan12 co-receptor for norrin. Major findings are that Norrin directly binds Tspan12 with high affinity (this is consistent with a report on BioRxiv: Antibody Display of cell surface receptor Tetraspanin12 and SARS-CoV-2 spike protein) and a predicted structure of Tspan12 alone or in complex with Norrin. The

      Norrin/Tspan12 binding interface is largely verified by mutational analysis. An interaction of the Tspan12 large extracellular loop (LEL) with Fzd4 cannot be detected and interactions of fulllength Tspan12 and Fzd4 cannot be tested using nano-disc based BLI, however, Fzd4/Tspan12 heterodimers can be purified and inserted into nanodiscs when aided by split GFP tags. An analysis of a potential composite binding site of a Fzd4/Tspan12 complex is somewhat inconclusive, as no major increase in affinity is detected for the complex compared to the individual components. A caveat to this data is that affinity measurements were performed for complexes with approximately 1 molecule Tspan12 and FZD4 per nanodisc, while the composite binding site could potentially be formed only in higher order complexes, e.g., 2:2 Fzd4/Tspan12 complexes. Interestingly, the authors find that the Norrin/Tspan12 binding site and the Norrin/Lrp6 binding site partially overlap and that the Lrp6 ectodomain competes with Tspan12 for Norrin binding. This result leads the authors to propose a model according to which Tspan12 captures Norrin and then has to "hand it off" to allow for Fzd4/Lrp6 formation. By increasing the local concentration of Norrin, Tspan12 would enhance the formation of the Fzd4/Lrp5 or Fzd4/Lrp6 complex. 

      Thank you for pointing out the BioRxiv report showing Norrin-Tspan12 LEL binding. We have cited this in the introduction of our revised manuscript (page 2, paragraph 3).

      The experiments based on membrane proteins inserted into nano-discs and the structure prediction using AlphaFold yield important new insights into a protein complex that has critical roles in normal CNS vascular biology, retinal vascular disease, and is a target for therapeutic intervention. However, it remains unclear how Norrin would be "handed off" from Tspan12 or Tspan12/Fzd4 complexes to Fzd4/Lrp6 complexes, as the relatively high affinity of Norrin to Fzd4/Tspan12 dimers likely does not favor the "handing off" to Fzd4/Lrp6 complexes. 

      While the Fzd4-Tspan12 interaction is strong, our data suggest that Fzd4 and Tspan12 bind Norrin with negative cooperativity, suggesting that Fzd4 binding may enhance Norrin-Tspan12 dissociation to facilitate handoff. This model is based on 1) the dissociation of Norrin from beadbound Tspan12 in the presence of saturating Fzd4 CRD (Figure 3D), and 2) a weaker measured affinity of Norrin-Tspan12LEL in the presence of saturating Fzd4 CRD (Figure 3F). We have now added wording to emphasize this in the discussion section (page 9, end of first full paragraph).

      However, as you note, the Norrin-Tspan12 affinity that we measured in the presence of Fzd CRD (tens of nM) is still much stronger than the known Norrin-LRP6 affinity (0.5-1µM), which predicts that the efficiency of this handoff may be low. We have now commented on this in the discussion section and mentioned an alternative model in which Tspan12 presents the second Norrin protomer to LRP5/6 for signaling, instead of dissociating (page 9, paragraph 2). However, the handoff efficiency could also be impacted by other factors such as the relative abundance and surface distribution of Tspan12, Fzd4, LRP6 and HSPGs.  

      Areas that would benefit from further experiments, or a discussion, include: 

      -  The authors test a potential composite binding site of Fzd4/Tspan12 heterodimers for norrin using nanodiscs that contain on average about 1 molecule Fzd4 and 1 molecule Tspan12. The Fzd4/Tspan12 heterodimer is co-inserted into the nanodiscs supported by split-GFP tags on Fzd4 and Tspan12. The authors find no major increase in affinity, although they find changes to the Hill slope, reflecting better binding of norrin at low norrin concentrations. In 293F cells overexpressing Fzd4 and Tspan12 (which may result in a different stoichiometry) they find more pronounced effects of norrin binding to Fzd4/Tspan12. This raises the possibility that the formation of a composite binding requires Fzd4/Tspan12 complexes of higher order, for example, 2:2 Fzd4/Tspan12 complexes, where the composite binding site may involve residues of each Fzd4 and Tspan12 molecule in the complex. This could be tested in nanodiscs in which Fzd4 and Tspan12 are inserted at higher concentrations or using Fzd4 and Tspan12 that contain additional tags for oligomerization. 

      It is quite possible that Tspan12 and Fzd4 cluster into complexes with a stoichiometry greater than 1:1 in cells (this is supported by e.g., BRET experiments in (Ke et al., 2013)), and we mention in the discussion that that receptor clustering may be an additional mechanism by which Tspan12 exerts its function (page 10, paragraph 4). We would be quite interested to know the stoichiometry of Fzd4 and Tspan12 complexes in cells at endogenous expression levels, both in the presence and absence of Norrin, and to biochemically characterize these putative larger complexes in the future. We have amended the discussion to mention the caveat that our reconstitution experiments do not test higher-stoichiometry Fzd4/Tspan12 complexes (page 10, last paragraph).

      - While Tspan12 LEL does not bind to Fzd4, the successful reconstitution of GFP from Tspan12 and Fzd4 tagged with split GFP components provides evidence for Fzd4/Tspan12 complex formation. As a negative control, e.g., Fzd5, or Tspan11 with split GFP tags (Fzd5/Tspan12 or Fzd4/Tspan11) would clarify if FZD4/Tspan12 heterodimers are an artefact of the split GFP system. 

      The split-GFP system allows us to co-purify receptors that do not normally co-localize (for example, as we have shown with Fzd4 and LRP6 in the absence of ligand (Bruguera et al., 2022)) so we do not mean to claim that it provides evidence for Fzd4/Tspan12 complex formation. In fact, we were unable to co-purify co-expressed Fzd4 and Tspan12 unless they were tethered with the split GFP system, and separately-purified Fzd4 and Tspan12 did not incorporate into nanodiscs together unless they were tethered by split GFP. Based on these experiments, we expect that the purported Fzd4-Tspan12 interaction that others have found by co-IP or co-localization is easily disrupted by detergent, may require a specific lipid, and/or may not be direct.

      To clarify this point, we have noted in the results section that without the split GFP tags, Tspan12 and Fzd4 did not co-purify or co-reconstitute into nanodiscs, and that co-reconstitution was enabled by the split GFP system (page 6, first full paragraph).   

      - Fzd4/Tspan12 heterodimers stabilized by split GFP may be locked into an unfavorable orientation that does not allow for the formation of a composite binding site of FZD4 and Tspan12, this is another caveat for the interpretation that Fzd4/Tspan12 do not form a composite binding site. This is not discussed. 

      While the split GFP does enforce a Fzd4/Tspan12 dimer, the split GFP is removed by protease cleavage during the final step of the purification process, after the dimer is contained in a nanodisc. This should allow Fzd4 and Tspan12 to freely adopt any pose and to diffuse within the confines of the nanodisc lipid bilayer. However, it has been shown that the phospholipid bilayer in small nanodiscs is not as fluid as the physiological plasma membrane, and although we used the slightly larger belt protein (MSP1E3D1, 13 nm diameter nanodiscs), perhaps the receptors are indeed locked in some unfavorable state for this reason. Additionally, the nanodiscs are planar, so if the formation of a composite binding site requires membrane curvature, this would not be recapitulated in our system. We have cited these caveats in the discussion section (page 10, last paragraph).  

      - Mutations that affect the affinity of norrin/fzd4 are not used to further test if Fzd4 and Tspan12 form a composite binding site. Norrin R41E or Fzd4 M105V were previously reported to reduce norrin/frizzled4 interactions and signaling, and both interaction and signaling were restored by Tspan12 (Lai et al. 2017). Whether a Fzd4/Tspan12 heterodimer has increased affinity for Norrin R41E was not tested. Similarly, affinity of FZD4 M105V vs a Fzd4 M105V/Tspan12 heterodimer were not tested. 

      Since the high affinity of Norrin for both Fzd4 and Tspan12 may have obscured any enhancement of Norrin affinity for Fzd4/Tspan12 compared to either receptor alone, we did consider weakening Fzd-Norrin affinity to sensitize this experiment, inspired by the experiments you mention in (Lai et al., 2017). However, we suspected that the slight increase in Norrin affinity for the Fzd4/Tspan12 dimer compared to Fzd4 alone was driven mainly by increased avidity that enhanced binding of low Norrin concentrations, and this avidity effect would likely confound the interpretation of any experiment monitoring 2:2 complex formation. Additionally, on the basis that soluble Fzd4 extracellular domain and Tspan12 bind Norrin with negative cooperativity (Figures 3D and 3F), we concluded that this composite binding site was unlikely.

      - An important conclusion of the study is that Tspan12 or Lrp6 binding to Norrin is mutually exclusive. This could be corroborated by an experiment in which LRP5/6 is inserted into nanodiscs for BLI binding tests with Norrin, or Tspan12 LEL, or a combination of both. Soluble LRP6 may remove norrin from equilibrium binding/unbinding to Tspan12, therefore presenting LRP6 in a non-soluble form may yield different results. 

      We agree that testing this conclusion in an orthogonal experiment would be a valuable addition to this study. We have now performed a similar experiment to the one you described, but with Norrin immobilized on biosensors, and with LRP6 in detergent competing with Tspan12 LEL for Norrin binding (Figure S12, discussed on page 8, first full paragraph). The results of this experiment show that biosensor-immobilized Norrin will bind LRP6, and that soluble Tspan12 inhibits LRP6 binding in a concentration-dependent manner. The LRP6 construct we use (residues 20-1439) includes the transmembrane domain but has a truncated C terminus, since LRP6 constructs containing the full C terminus tend to aggregate during purification. We chose to immobilize Norrin to make the experiment as interpretable as possible, since immobilizing LRP6 and competing Norrin off with the LEL could result in an increase in signal (from the LEL binding the second available Norrin protomer) as well as a decrease (from Norrin being competed off of the immobilized LRP6). We conducted the experiment in detergent (DDM) instead of nanodiscs to be able to test higher concentrations of LRP6.

      - The authors use LRP6 instead of LRP5 for their experiments. Tspan12 is less effective in increasing the Norrin/Fzd4/Lrp6 signaling amplitude compared to Norrin/Fzd4/Lrp5 signaling, and human genetic evidence (FEVR) implicates LRP5, not LRP6, in Norrin/Frizzled4 signaling. The authors find that Norrin binding to LRP6 and Tspan12 is mutually exclusive, however this may not be the case for Lrp5. 

      This is an important point which we have now addressed in the text (page 8, end of first full paragraph). LRP5 is indeed the receptor implicated in FEVR and expressed in the relevant tissues for Tspan12/Norrin signaling. Unfortunately, LRP5 expresses poorly and we are unable to purify sufficient quantities to perform these experiments. However, LRP5 and LRP6 both transduce Tspan12-enhanced Norrin signaling in TOPFLASH assays (as you mention and as shown by (Zhou and Nathans, 2014)), bind Norrin, and are highly similar (they share 71% sequence identity overall and 73% sequence identity in the extracellular domain), so we expect their Norrin-binding sites to be conserved.

      - The biochemical data are largely not correlated with functional data. The authors suggest that the Norrin R115L FEVR mutation could be due to reduced norrin binding to tspan12, but do not test if Tspan12-mediated enhancement of the norrin signaling amplitude is reduced by the R115L mutation. Similarly, the impressive restoration of binding by charge reversal mutations in site 3 is not corroborated in signaling assays. 

      We agree that testing the impact of Norrin mutations in cell-based signaling assays would be an informative way to further test our model. However, the Norrin mutants we tested generated poor TopFlash signals in all conditions tested. This may be due to general protein instability, weakened affinity for LRP, or weaker interactions with HSPGs. Whatever the cause, the low signal made it challenging to conclusively say whether the Norrin mutations affected Tspan12mediated signaling enhancement.

      When expressed for purification, Tspan12 mutants generally expressed poorly compared to WT Tspan12, so we were concerned that differences in protein stability or trafficking would lead to lower cell-surface levels of mutant Tspan12 relative to WT in TopFlash signaling assays, which would confound interpretation of mutant Tspan’s ability to enhance Norrin signaling.

      Because of these challenges, follow-up experiments to investigate the signaling capabilities of Norrin and Tspan12 mutants were not informative and we have not included them in the revised manuscript.

      Reviewer #3 (Public Review): 

      Brugeuera et al present an impressive series of biochemical experiments that address the question of how Tspan12 acts to promote signaling by Norrin, a highly divergent TGF-beta family member that serves as a ligand for Fzd4 and Lrp5/6 to promote canonical Wnt signaling during CNS (and especially retinal) vascular development. The present study is distinguished from those of the past 15 years by its quantitative precision and its high-quality analyses of concentration dependencies, its use of well-characterized nano-disc-incorporated membrane proteins and various soluble binding partners, and its use of structure prediction (by AlphaFold) to guide experiments. The authors start by measuring the binding affinity of Norrin to Tspan12 in nanodiscs (~10 nM), and they then model this interaction with AlphaFold and test the predicted interface with various charge and size swap mutations. The test suggests that the prediction is approximately correct, but in one region (site 1) the experimental data do not support the model. [As noted by the authors, a failure of swap mutations to support a docking model is open to various interpretations. As AlphFold docking predictions come increasingly into common use, the compendium of mutational tests and their interpretations will become an important object of study.] Next, the authors show that Tspan12 and Fzd4 can simultaneously bind Norrin, with modest negative cooperativity, and that together they enhance Norrin capture by cells expressing both Tspan12 and Fzd4 compared to Fzd4 alone, an effect that is most pronounced at low Norrin concentration. Similarly, at low Norrin concentration (~1 nM), signaling is substantially enhanced by Tspan12. By contrast, the authors show that LRP6 competes with Tspan12 for Norrin binding, implying a hand-off of Norrin from a Tspan12+Fzd4+Norrin complex to a LRP5/6+Fzd4+Norrin complex. Thanks to the authors' careful dose-response analyses, they observed that Norrin-induced signaling and Tspan12 enhancement of signaling both have bell-shaped dose-response curves, with strong inhibition at higher levels of Norrin or Tspan12. The implication is that the signaling system has been built for optimal detection of low concentrations of Norrin (most likely the situation in vivo), and that excess Tspan12 can titrate Norrin at the expense of LRP5/6 binding (i.e., reduction in the formation of the LRP5/6+Fzd4+Norrin signaling complex). In the view of this reviewer, the present work represents a foundational advance in understanding Norrin signaling and the role of Tspan12. It will also serve as an important point of comparison for thinking about signaling complexes in other ligand-receptor systems. 

      Recommendations for the authors: 

      Reviewer #2 (Recommendations For The Authors):   

      - In Figure 5F high concentrations of transfected Tspan12 plasmid inhibit signaling, which the authors interpret to support the model that Tspan12/Norrin binding prevents Norrin/LRP6/FZD4 complex formation. Alternatively, the cells do not tolerate the expression of the tetraspanin at high levels, for example, due to misfolding and aggregate formation. To distinguish these possibilities: Do high levels of Tspan12 overexpression also inhibit signaling induced by Wnt3a and appropriate Frizzled receptors, even though Tspan12 has no influence on Wnt/LRP6 binding? 

      We thank the reviewer for suggesting this important control experiment. We have added the Wnt-simulated TOPFLASH values to the figure in 5F for all conditions. In repeating this experiment, we noticed that high levels of transfected Tspan12 may decrease cell viability and therefore have adjusted the range of transfected Tspan12 in the new Figure 5F (discussed on page 8, second full paragraph). Under this new protocol, both Norrin- and Wnt-stimulated signaling were inhibited by the highest amount of transfected Tspan12. However, Norrinstimulated signaling is inhibited by lower amounts of transfected Tspan12 than Wnt-stimulated signaling, and to a greater extent, supporting our proposed model that Tspan12 competes with LRP for Norrin binding.

      - Is Tspan12 with c-terminal rho-tag (the form incorporated into nanodiscs) also used for functional luciferase assays, or was untagged Tspan12 used for the luciferase assays in Fig 4D and 5F? Does the c-terminal tag interfere with Tspan12-mediated enhancement of Norrin signaling? 

      For the luciferase assays included in this manuscript, wildtype, full-length, untagged Tspan12 is used. We have clarified this in our methods section. When we tested the wildtype vs Cterminally rho1D4-tagged version of Tspan12 in TOPFLASH assays, we saw that the enhancement of Norrin signaling by Tspan12-1D4 was weaker than enhancement by untagged Tspan12. This is consistent with the finding reported in Cell Reports (Lai et al., 2017) that a chimeric Tspan12 receptor with its C-terminus replaced with that of Tspan11 was still capable of enhancing Norrin signaling, though to a lesser extent than WT Tspan12. The deficiency of signaling by our rho1D4-tagged Tspan12 could be due to a difference in receptor expression level or trafficking, but in the absence of a reliable antibody against Tspan12, we were unable to assess the expression levels or localization of the untagged Tspan12 to compare it to the rho1D4-tagged version. (For binding experiments, we reasoned that the C-terminal tag should not affect Tspan12’s ability to bind Norrin extracellularly, especially as we found that purified fulllength Tspan12 and Tspan12∆C (residues 1-252) bound Norrin equally well; we have added this comparison to table S1.)  

      Reviewer #3 (Recommendations For The Authors): 

      Minor comments. 

      Based on the Fzd4-Dvl binding experiment, the authors might state explicitly the possibility that Tspan12's relevance is entirely accounted for by extracellular ligand capture. 

      We have stated this possibility explicitly in the discussion section (page 9, last paragraph). 

      Page 4, 3rd paragraph. I suggest "To experimentally test this structural prediction..." rather than "validate". 

      Thank you for this suggestion; we have replaced this wording. 

      This next item is optional, but I hope that the authors will consider it. This manuscript provides an opportunity for the authors to be more expansive in their thinking, and to put their work into the larger context of ligand+receptor+accessory protein interactions. The authors describe the Wnt7a/7b-Gpr124-RECK system and the role of HSPs in Norrin and Wnt signaling, but perhaps they can also comment on non-Wnt ligand-receptor systems where accessory proteins are found. They might add a figure (or supplemental figure) with a schematic showing the roles of HSP and Gpr124-RECK, and some non-Wnt ligand-receptor systems. This would help to make the present work more widely influential.

      Thank you for this suggestion. We have added a figure (Figure 6, discussed on page 10, paragraphs 2 and 3) and expanded our discussion to include other co-receptor systems. We have specifically focused on co-receptors that both capture ligands and interact with their primary receptor(s), thus delivering ligands to their receptors, as we have proposed for Tspan12. Within Wnt signaling, other co-receptor systems with this mechanism are RECK/Gpr124 (for Wnt7a/b) and Glypican-3. We found it interesting that this mechanism is also shared by several growth factor pathways with cystine knot ligands (like Norrin), so we have illustrated and mentioned three of these examples.

    1. Reviewer #1 (Public review):

      Summary:

      Wang et al. identify Hamlet, a PR-containing transcription factor, as a master regulator of reproductive development in Drosophila. Specifically, the fusion between the gonad and genital disc is necessary for the development of continuous testes and seminal vesicle tissue essential for fertility. To do this, the authors generate novel Hamlet null mutants by CRISPR/Cas9 gene editing and characterize the morphological, physiological, and gene expression changes of the mutants using immunofluorescence, RNA-seq, cut-tag, and in-situ analysis. Thus, Hamlet is discovered to regulate a unique expression program, which includes Wnt2 and Tl, that is necessary for testis development and fertility.

      Strengths:

      This is a rigorous and comprehensive study that identifies the Hamlet-dependent gene expression program mediating reproductive development in Drosophila. The Hamlet transcription targets are further characterized by Gal4/UAS-RNAi confirming their role in reproductive development. Finally, the study points to a role for Wnt2 and Tl as well as other Hamlet transcriptionally regulated genes in epithelial tissue fusion.

      Weaknesses:

      The image resolution and presentation of figures is a major issue in this study. As a non-expert, it is nearly impossible to see the morphological changes as described in the results. Quantification of all cell biological phenotypes is also lacking therefore reducing the impact of this study to those familiar with tissue fusion events in Drosophila development.

    2. Reviewer #2 (Public review):

      Strengths:

      Wang and colleagues successfully uncovered an important function of the Drosophila PRDM16/PRDM3 homolog Hamlet (Ham) - a PR domain-containing transcription factor with known roles in the nervous system in Drosophila. To do so, they generated and analyzed new mutants lacking the PR domain, and also employed diverse preexisting tools. In doing so, they made a fascinating discovery: They found that PR-domain containing isoforms of ham are crucial in the intriguing development of the fly genital tract. Wang and colleagues found three distinct roles of Ham: (1) specifying the position of the testis terminal epithelium within the testis, (2) allowing normal shaping and growth of the anlagen of the seminal vesicles and paragonia and (3) enabling the crucial epithelial fusion between the seminal vesicle and the testis terminal epithelium. The mutant blocks fusion even if the parts are positioned correctly. The last finding is especially important, as there are few models allowing one to dissect the molecular underpinnings of heterotypic epithelial fusion in development. Their data suggest that they found a master regulator of this collective cell behavior. Further, they identified some of the cell biological players downstream of Ham, like for example E-Cadherin and Crumbs. In a holistic approach, they performed RNAseq and intersected them with the CUT&TAG-method, to find a comprehensive list of downstream factors directly regulated by Ham. Their function in the fusion process was validated by a tissue-specific RNAi screen. Meticulously, Wang and colleagues performed multiplexed in situ hybridization and analyzed different mutants, to gain a first understanding of the most important downstream pathways they characterized, which are Wnt2 and Toll.

      This study pioneers a completely new system. It is a model for exploring a process crucial in morphogenesis across animal species, yet not well understood. Wang and colleagues not only identified a crucial regulator of heterotypic epithelial fusion but took on the considerable effort of meticulously pinning down functionally important downstream effectors by using many state-of-the-art methods. This is especially impressive, as the dissection of pupal genital discs before epithelial fusion is a time-consuming and difficult task. This promising work will be the foundation future studies build on, to further elucidate how this epithelial fusion works, for example on a cell biological and biomechanical level.

      Weaknesses:

      The developing testis-genital disc system has many moving parts. Myotube migration was previously shown to be crucial for testis shape. This means, that there is the potential of non-tissue autonomous defects upon knockdown of genes in the genital disc or the terminal epithelium, affecting myotube behavior which in turn affects fusion, as myotubes might create the first "bridge" bringing the epithelia together. The authors clearly showed that their driver tools do not cause expression in myoblasts/myotubes, but this does not exclude non-tissue autonomous defects in their RNAi screen. Nevertheless, this is outside the scope of this work.

      However, one point that could be addressed in this study: the RNAseq and CUT&TAG experiments would profit from adding principal component analyses, elucidating similarities and differences of the diverse biological and technical replicates.

    3. Author response:

      Thank you for reviewing our manuscript and providing constructive feedback. We are grateful that you recognize the importance of our work and find the evidences presented compelling. We will revise our manuscripts in accordance with reviewers’ recommendations. Below is our plan.

      (1) As recommended by Reviewer 1, we will improve the image resolution and presentation in the figures, by adjusting dark colors into brighter ones, including single-channel images, and incorporating schematic illustrations to dipict morphological changes.

      (2) Following the suggestions of reviewer 2, we will provide explanations and speculative insights into potential non-tissue autonomous effects.

      (3) As suggested by reviewer 2, we will perform principal component analyses on our RNA-seq and Cut&Tag data. 

      (2) Once we have addressed all the major and minor points raised by the reviewers, we will provide a detailed point-to-point response and submit the revised version of the manuscript.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript by Bindu et al. created an AAV-based tool (GEARAOCS) to perform in vivo genome editing of mouse astrocytes. The authors engineered a versatile AAV vector that allows for gene deletion through NHNJ, site-specific knock-in by HDR, and gene trap. By utilizing this tool, the authors deleted Sparcl1 virally in subsets of astrocytes and showed that thalamocortical synapses in cortical layer IV are indeed reduced during a critical period of ocular dominance plasticity and in adulthood, whereas there is no change in excitatory synapse number in cortical layer II/III. Furthermore, the authors made a VAMP2 gene-trap AAV vector and showed that astrocyte-derived VAMP2 is required for the maintenance of both excitatory and inhibitory synapses.

      Strengths:

      This AAV-based tool is versatile for astrocytic gene manipulation in vivo. The work is innovative and exciting, given the paucity of tools available to probe astrocytes in vivo.

      Weaknesses:

      Several important considerations need to be made for the validation and usage of this tool, including:

      Major points:

      (1) Efficiency and specificity of spCas9-sgRNA mediated gene knockout in astrocytes. In Figure 3, the authors utilized Sparcl1 gene deletion as the proof-of-principle experiment. The readout for Sparcl1 KO efficiency is solely the immunoreactivity using an antibody raised against Sparcl1. As the method is based on NHEJ, the indels can be diverse and can occur in one allele or two. For the tool and proof-of-principle experiment, it will be important to know the percentage of editing near the PAM site, as well as the actual sequences of indels. This can be done by single-cell PCR of edited astrocytes, similar to the published work (Ye... Chen, Nature Biotechnology 2019).

      (2) Along the same line, the authors showed that GEARBOCS TagIn of Sparcl1 resulted in 12.49% efficiency based on the immunohistochemistry of mCherry tag. It is understandable that the knock-in efficiency is much reduced as compared to gene knockout. However, it remains unclear if those 12.49% knock-in cells represent sequence-correct ones, as spCas9-mediated HDR is also an error-prone process, and it may accidentally alter nucleotides near the PAM site without causing the frameshift. The author will need to consider the related evidence or make comments in the discussion.

      (3) What are the efficiencies of Sparcl1 GEARBOCS GeneTrap (Figure 3V) and Vamp2 GeneTrap and HA TagIn (Figure 5)?

      Minor points:

      (1) Figure 3H-J. The authors only showed the representative images of Sparcl1 KO. Please consider including the control (without gRNA), given that there are still many Sparcl1+ signals in Figure 3I (likely because of its expression in other cell types?).

      (2) In figure 3Q-T, it appears that some Cas9-EGFP+ astrocytes (Q) do not express Sparcl1 (R). Is Sparcl1 expressed in subsets of astrocytes? Does Cas9-EGFP or Sparcl1-TagIn alter Sparcl1 endogenous expression?

      (3) On Page 8, for the explanation of the design of the GEARBOCS construct, the authors have made a self-citation (#43). That was a BioRxiv paper that is being reviewed currently.

      (4) For Figures 4 and 6, the graphs seem to be made in R with the x-axis labeled as "Condition". The y-axis labels are too small to read properly, especially in print. It would be better to make the graphs clearer like Figure 2 and Figure 3.

      (5) On Page 13, "Figures 3V-Y" were referred to. However, there are no Figures 3W, X, and Y.

      (6) There are a few typos in the manuscript, including line 900 "immunofluorescence microscopy images of a Cas9-EGFP-positive astrocytes (green)".

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2024-02465

      Corresponding author(s): Saravanan, Palani

      1. General Statements

      We would like to thank the Review Commons Team for handling our manuscript and the Reviewers for their constructive feedback and suggestions. In our revised manuscript, we have addressed and incorporated all the major suggestions of the reviewers, and we have also added new significant data on the role of Tropomyosin in regulation of endocytosis through its control over actin monomer pool maintenance and actin network homeostasis. We believe that with all these additions, our study has significantly gained in quality, strength of conclusions made, and scope for future work.

      2. Point-by-point description of the revisions

      Reviewer #1

      Evidence, reproducibility and clarity

      There are 2 Major issues -

      Having an -ala-ser- linker between the GFP and tropomyosin mimics acetylation. This is not the case, and more likely the this linker acts as a spacer that allows tropomyosin polymers to form on the actin, and without it there is steric hindrance. A similar result would be seen with a simple flexible uncharged linker. It has been shown in a number of labs that the GFP itself masks the effect of the charge on the amino terminal methionine. This is consistent with NMR, crystallographic and cryo structural studies. Biochemical studies should be presented to demonstrate that the impact of a linker for the conclusions stated to be made, which provide the basis of a major part of this study.

      Response: We would like to clarify that all mNG-Tpm constructs used in our study contain a 40 amino-acid (aa) flexible linker between the N-terminal mNG fluorescent protein and the Tpm protein as per our earlier published study (Hatano et al., 2022). During initial optimization, we have also experimented with linker length and the 40aa-linker length works optimally for clear visualization of Tpm onto actin cable structures in budding yeast, fission yeast (both S. pombe and S. japonicus), and mammalian cells (Hatano et al., 2022). These constructs have also been used since in other studies (Wirshing et al., 2023; Wirshing and Goode, 2024) and currently represents the best possible strategy to visualize Tpm isoforms in live cells. In our study, we characterized these proteins for functionality and found that both mNG-Tpm1 and mNG-Tpm2 were functional and can rescue the synthetic lethality observed in Dtpm1Dtpm2 cells. During our study, we observed that mNG-Tpm1 expression from a single-copy integration vector did not restore full length actin cables in Dtpm1 cells (Fig. 1B, 1C). We hypothesized that this could be a result of reduced binding affinity of the tagged tropomyosin due to lack of normal N-terminal acetylation which stabilizes the N-terminus. The 40aa linker is unstructured and may not be able to neutralize the charge on the N-terminal Methionine, thus, we tried to insert -Ala-Ser- dipeptide which has been routinely used in vitro biochemical studies to stabilize the N-terminal helix and impart a similar effect as the N-terminal acetylation (Alioto et al., 2016; Palani et al., 2019; Christensen et al., 2017) by restoring normal binding affinity of Tpm to F-actin (Monteiro et al., 1994; Greenfield et al., 1994). We observed that addition of the -Ala-Ser- dipeptide to mNG-Tpm fusion, indeed, restored full length actin cables when expressed in Dtpm1 cells, performing significantly better in our in vivo experiments (Fig. 1B, 1C). We agree with the reviewer that the -AS- dipeptide addition may not mimic N-terminal acetylation structurally but as per previous studies, it may stabilize the N-terminus of Tpm and allow normal head-to-tail dimer formation (Greenfield et al., 1994; Monteiro et al., 1994; Frye et al., 2010). We have discussed this in our new Discussion section (Lines 350-372). Since, the addition of -AS- dipeptide was referred to as "acetyl-mimic (am)" in a previous study (Alioto et al., 2016), we continued to use the same nomenclature in our study. Now as per your suggestions and to be more accurate, we have renamed "mNG-amTpm" constructs as "mNG-ASTpm" throughout the study to not confuse or claim that -AS- addition mimics acetylation. In any case, we have not seen any other ill effect of -AS- dipeptide introduction in addition to our 40 amino acid linker suggesting that it can also be considered part of the linker. Although, we agree with the reviewer that biochemical characterization of the effect of linker would be important to determine, we strongly believe that it is currently outside the scope of this study and should be taken up for future work with these proteins. Our study has majorly aimed to understand the functionality and utility of these mNG-Tpm fusion proteins for cell biological experiments in vivo, which was not done earlier in any other model system.

      My major issue however is making the conclusions stated here, using an amino-terminal fluorescent protein tag that s likely to impact any type of isoform selection at the end of the actin polymer. Carboxyl terminal tagging may have a reduced effect, but modifying the ends of the tropomyosin, which are integral in stabilising end to end interactions with itself on the actin filament, never mind any section systems that may/maynot be present in the cell, is not appropriate.

      Response: __ We agree with the reviewer that N-terminal tagging of tropomyosin may have effects on its function, but these constructs represent the only fluorescently tagged functional tropomyosin constructs available currently while C-terminal fusions are either non-functional (we were unable to construct strains with endogenous Tpm1 gene fused C-terminally to GFP) or do not localize clearly to actin structures (See __Figure R1 showing endogenous C-terminally tagged Tpm2-yeGFP that shows almost no localization to actin cables). To our knowledge, our study represents a first effort to understand the question of spatial sorting of Tpm isoforms, Tpm1 and Tpm2, in S. cerevisiae and any future developments with better visualization strategies for Tpm isoforms without compromising native N-terminal modifications and function will help improve our understanding of these proteins in vivo. We have also discussed these possibilities in our new Discussion section (Lines 391-396).

      Significance

      This paper explores the role of formin in determining the localisation of different tropomyosins to different actin polymers and cellular locations within budding yeast. Previous studies have indicated a role for the actin nucleating proteins in recruiting different forms of tropomyosin within fission yeast. In mammalian cells there is variation in the role of formins in affiecting tropomyosin localisation - variation between cell type. There is also evidence that other actin binding proteins, and tropomyosin abundance play roles in regulating the tropomyosin-actin association according to cell type. Biochemical studies have previously been undertaken using budding yeast and fission yeast that the core actin polymerisation domain of formins do not interact with tropomyosin directly. The significance of this study, given the above, and the concerns raised is not clear to this reviewer.

      Response: __Our study explores multiple facets of Tropomyosin (Tpm) biology. The lack of functional tagged Tpm has been a major bottleneck in understanding Tpm isoform diversity and function across eukaryotes. In our study, we characterize the first functional tagged Tpm proteins (Fig. 1, Fig. S1) and use them to answer long-standing questions about localization and spatial sorting of Tpm isoforms in the model organism S. cerevisiae (Fig. 2, Fig. 3, Fig. S2, Fig. S3). We also discover that the dual Tpm isoforms, Tpm1 and Tpm2, are functionally redundant for actin cable organization and function, while having gained divergent functions in Retrograde Actin Cable Flow (RACF) (Fig. 4, Fig. 5A-D, Fig. S4, Fig. S5, Fig. S6). We have now added new data on role of global Tpm levels controlling endocytosis via maintenance of normal linear-to-branched actin network homeostasis in S. cerevisiae (Fig. 5E-G)__. We respectfully differ with the reviewer on their assessment of our study and request the reviewer to read our revised manuscript which discusses the significance, limitations, and future perspectives of our study in detail.

      Reviewer #2

      Evidence, reproducibility and clarity

      This manuscript by Dhar, Bagyashree, Palani and colleagues examines the function of the two tropomyosins, Tpm1 and Tpm2, in the budding yeast S. cerevisiae. Previous work had shown that deletion of tpm1 and tpm2 causes synthetic lethality, indicating overlapping function, but also proposed that the two tropomyosins have distinct functions, based on the observation that strong overexpression of Tpm2 causes defects in bud placement and fails to rescue tpm1∆ phenotypes (Drees et al, JCB 1995). The manuscript first describes very functional mNeonGreen tagged version of Tpm1 and Tpm2, where an alanine-serine dipeptide is inserted before the first methionine to mimic acetylation. It then proposes that the Tpm1 and Tpm2 exhibit indistinguishable localization and that low level overexpression (?) of Tpm2 can replace Tpm1 for stabilization of actin cables and cell polarization, suggesting almost completely redundant functions. They also propose on specific function of Tpm2 in regulating retrograde actin cable flow.

      Overall, the data are very clean, well presented and quantified, but in several places are not fully convincing of the claims. Because the claims that Tpm1 and Tpm2 have largely overlapping function and localization are in contradiction to previous publication in S. cerevisiae and also different from data published in other organisms, it is important to consolidate them. There are fairly simple experiments that should be done to consolidate the claims of indistinguishable localization, and levels of expression, for which the authors have excellent reagents at their disposal.

      1. Functionality of the acetyl-mimic tagged tropomyosin constructs: The overall very good functionality of the tagged Tpm constructs is convincing, but the authors should be more accurate in their description, as their data show that they are not perfectly functional. For instance, the use of "completely functional" in the discussion is excessive. In the results, the statement that mNG-Tpm1 expression restores normal growth (page 3, line 69) is inaccurate. Fig S1C shows that tpm1∆ cells expressing mNG-Tpm1 grow more slowly than WT cells. (The next part of the same sentence, stating it only partially restores length of actin cables should cite only Fig S1E, not S1F.) Similarly, the growth curve in Fig S1C suggests that mNG-amTpm1, while better than mNG-Tpm1 does not fully restore the growth defect observed in tpm1∆ (in contrast to what is stated on p. 4 line 81). A more stringent test of functionality would be to probe whether mNG-amTpm1 can rescue the synthetic lethality of the tpm1∆ tpm2∆ double mutant, which would also allow to test the functionality of mNG-amTpm2.

      __Response: __We would like to thank the reviewer for his feedback and suggestions. Based on the suggestions, we have now more accurately described the growth rescue observed by expression of mNG-ASTpm1 in Dtpm1 cells in the revised text. We have also removed the use of "completely functional" to describe mNG-Tpm functionality and corrected any errors in Figure citations in the revised manuscript.

      As per reviewers' suggestion, we have now tested rescue of synthetic lethality of Dtpm1Dtpm2 cells by expression of all mNG-Tpm variants and we find that all of them are capable of restoring the viability of Dtpm1Dtpm2 cells when expressed under their native promoters via a high-copy plasmid (pRS425) (Fig. S1E) but only mNG-Tpm1 and mNG-ASTpm1 restored viability of Dtpm1Dtpm2 cells when expressed under their native promoters via an integration plasmid (pRS305) (Fig. S1F). These results clearly suggest that while both mNG-Tpm1 and mNG-Tpm2 constructs are functional, Tpm1 tolerates the presence of the N-terminal fluorescent tag better than Tpm2. These observations now enhance our understanding of the functionality of these mNG-Tpm fusion proteins and will be a useful resource for their usage and experimental design in future studies in vivo.


      It would also be nice to comment on whether the mNG-amTpm constructs really mimicking acetylation. Given the Ala-Ser peptide ahead of the starting Met is linked N-terminally to mNG, it is not immediately clear it will have the same effect as a free acetyl group decorating the N-terminal Met.

      Response: __We agree with the reviewer's observation and for the sake of clarity and accuracy, we have now renamed "mNG-amTpm" with "mNG-ASTpm". The use of -AS- dipeptide is very routine in studies with Tpm (Alioto et al., 2016; Palani et al., 2019; Christensen et al., 2017) and its addition restores normal binding affinities to Tpm proteins purified from E. coli (Monteiro et al., 1994). We agree with the reviewer that the -AS- dipeptide addition may not mimic N-terminal acetylation structurally but as per previous studies, it may help neutralize the impact of a freely protonated Met on the alpha-helical structure and stabilize the N-terminus helix of Tpm and allow normal head-to-tail dimer formation (Monteiro et al., 1994; Frye et al., 2010; Greenfield et al., 1994). Consistent with this, we also observe a highly significant improvement in actin cable length when expressing mNG-ASTpm as compared to mNG-Tpm in Dtpm1 cells, suggesting an improvement in function probably due to increased binding affinity (Fig. 1B, 1C). We have also discussed this in our answer to Question 1 of Reviewer 1 and the revised manuscript (Lines 350-372)__.

      __ Localization of Tpm1 and Tpm2:__Given the claimed full functionality of mNG-amTpm constructs and the conclusion from this section of the paper that relative local concentrations may be the major factor in determining tropomyosin localization to actin filament networks, I am concerned that the analysis of localization was done in strains expressing the mNG-amTpm construct in addition to the endogenous untagged genes. (This is not expressly stated in the manuscript, but it is my understanding from reading the strain list.) This means that there is a roughly two-fold overexpression of either tropomyosin, which may affect localization. A comparison of localization in strains where the tagged copy is the sole Tpm1 (respectively Tpm2) source would be much more conclusive. This is important as the results are making a claim in opposition to previous work and observation in other organisms.

      Response: __We thank the reviewer for this observation and their suggestions. We agree that relative concentrations of functional Tpm1 and Tpm2 in cells may influence the extent of their localizations. As per the reviewer's suggestion, we have now conducted our quantitative analysis in cells lacking endogenous Tpm1 and only expressing mNG-ASTpm1 from an integrated plasmid copy at the leu2 locus and the data is presented in new __Figure S3. We compared Tpm-bound cable length (Fig. S3A, S3B) __and Tpm-bound cable number (Fig. S3A, S3C) along with actin cable length (Fig. S3D, S3E) and actin cable number (Fig. S3D, S3F) in wildtype, Dbnr1, and Dbni1 cells. Our analysis revealed that mNG-ASTpm1 localized to actin cable structures in wildtype, Dbnr1, and Dbni1 cells and the decrease observed in Tpm-bound cable length and number upon loss of either Bnr1 or Bni1, was accompanied by a corresponding decrease in actin cable length and number upon loss of either Bnr1 or Bni1. Thus, this analysis reached the same conclusion as our earlier analysis (Fig. 2) that mNG-ASTpm1 does not show preference between Bnr1 and Bni1-made actin cables. mNG-ASTpm2 did not restore functionality, when expressed as single integrated copy, in Dtpm1Dtpm2 cells (new results in __Fig. S1E, S1F, S5A) thus, we could not conduct a similar analysis for mNG-ASTpm2. This suggests that use of mNG-ASTpm2 would be more meaningful in the presence of endogenous Tpm2 as previously done in Fig. 2D-F.

      We have now also performed additional yeast mating experiments with cells lacking bnr1 gene and expressing either mNG-ASTpm1 or mNG-ASTpm2 and the data is shown in new Figure 3. From these observations, we observe that both mNG-ASTpm1 and mNG-ASTpm2 localize to the mating fusion focus in a Bnr1-independent manner (Fig. 3B, 3D) and suggests that they bind to Bni1-made actin cables that are involved in polarized growth of the mating projection. These results also add strength to our conclusion that Tpm1 and Tpm2 localize to actin cables irrespective of which formin nucleates them. Overall, these new results highlight and reiterate our model of formin-isoform independent binding of Tpm1 and Tpm2 in S. cerevisiae.

      In fact, although the authors conclude that the tropomyosins do not exhibit preference for certain actin structures, in the images shown in Fig 2A and 2D, there seems to be a clear bias for Tpm1 to decorate cables preferentially in the bud, while Tpm2 appears to decorate them more in the mother cell. Is that a bias of these chosen images, or does this reflect a more general trend? A quantification of relative fluorescence levels in bud/mother may be indicative.

      Response: __We thank the reviewer for pointing this out. Our data and analysis do not suggest that Tpm1 and Tpm2 show any preference for decoration of cables in either mother or bud compartment. As per the reviewer's suggestion, we have now quantified the ratio of mean mNG fluorescence in the bud to the mother (Bud/Mother) and the data is shown in __Figure. S2G. The bud-to-mother ratio was similar for mNG-ASTpm1 and mNG-ASTpm2 in wildtype cells, and the ratio increased in Dbnr1 cells and decreased in Dbni1 cells for both mNG-ASTpm1 and mNG-ASTpm2 (Fig. S2G). __This is consistent with the decreased actin cable signal in the mother compartment in Dbnr1 cells and decreased actin cable signal in the bud compartment in Dbni1 cells (Fig. S2A-D). Thus, our new analysis shows that both mNG-ASTpm1 and mNG-ASTpm2 have similar changes in their concentration (mean fluorescence) upon loss of either formins Bnr1 and Bni1 and show similar ratios in wildtype cells as well, suggesting no preference for binding to actin cables in either bud or mother compartment. The preference inferred by the reviewer seems to be a bias of the current representative images and thus, we have replaced the images in __Fig. 2A, 2D to more accurately represent the population.

      The difficulty in preserving mNG-amTpm after fixation means that authors could not quantify relative Tpm/actin cable directly in single fixed cells. Did they try to label actin cables with Lifeact instead of using phalloidin, and thus perform the analysis in live cells?

      __Response: __We did not use LifeAct for our analysis as LifeAct is known to cause expression-dependent artefacts in cells (Courtemanche et al., 2016; Flores et al., 2019; Xu and Du, 2021) and it also competes with proteins that regulate normal cable organization like cofilin. Use of LifeAct would necessitate standardization of expression to avoid such artefacts in vivo. Also, phalloidin staining provides the best staining of actin cables and allows for better quantitative results in our experiments. The use of LifeAct along with mNG-Tpm would also require optimization with a red fluorescent protein which usually tend to have lower brightness and photostability. However, during the revision of our study, a new study from Prof. Goode's lab has developed and optimized expression of new LifeAct-3xmNeonGreen constructs for use in S. cerevisiae (Wirshing and Goode, 2024). Thus, a similar strategy of using tandem copies of bright and photostable red fluorescent proteins can be explored for use in combination with mNG-Tpm in the future studies.

      __ Complementation of tpm1∆ by Tpm2:__

      I am confused about the quantification of Tpm2 expression by RT-PCR shown in Fig S3F. This figure shows that tpm2 mRNA expression levels are identical in cells with an empty plasmid or with a tpm2-encoding plasmid. In both strains (which lack tpm1), as well as in the WT control, one tpm2 copy is in the genome, but only one strain has a second tpm2 copy expressed from a centromeric plasmid, yet the results of the RT-PCR are not significantly different. (If anything, the levels are lower in the tpm2 plasmid-containing strain.) The methods state that the primers were chosen in the gene, so likely do not distinguish the genomic from the plasmid allele. However, the text claims a 1-fold increase in expression, and functional experiments show a near-complete rescue of the tpm1∆ phenotype. This is surprising and confusing and should be resolved to understand whether higher levels of Tpm2 are really the cause of the observed phenotypic rescue.

      The authors could for instance probe for protein levels. I believe they have specific nanobodies against tropomyosin. If not, they could use expression of functional mNG-amTpm2 to rescue tpm1∆. Here, the expression of the protein can be directly visualized.

      Response: __We thank the reviewer for pointing this out. We would like to clarify that in our RT-qPCR experiments, the primers were chosen within the Tpm1 and Tpm2 gene and do not distinguish between transcripts from endogenous or plasmid copy. We have now mentioned this in the Materials and Methods section of the revised manuscript. So, they represent a relative estimate of the total mRNA of these genes present in cells. We were consistently able to detect ~19 fold increase in Tpm2 total mRNA levels as compared to wildtype and ∆tpm1 cells (Fig. S4D) when tpm2 was expressed from a high-copy plasmid (pRS425). This increase in Tpm2 mRNA levels was accompanied by a rescue in growth (Fig. S4A) and actin cable organization (Fig. S4B) of ∆tpm1 cells containing pRS425-ptpm2TPM2. When tpm2 was expressed from a low-copy number centromeric plasmid (pRS316), we detected a ~2 fold increase in Tpm2 transcript levels when using the tpm1 promoter and no significant change was detected when using tpm2 promoter (Fig. S4E)__. We have made sure that these results are accurately described in the revised manuscript.

      As per the reviewer's suggestion, we have now conducted a more extensive analysis to ascertain the expression levels of Tpm2 in our experiments and the data is now presented in new Figure S5. We used mNG-ASTpm1 and mNG-ASTpm2 to rescue growth of ∆tpm1 (Fig. S5A) and correlated growth rescue with protein levels using quantified fluorescence intensity (Fig. S5B, S5C) and western blotting (anti-mNG) (Fig. S5D, S5E). We find that ∆tpm1 cells containing pRS425-ptpm1mNG-ASTpm1 had the highest protein level followed by pRS425-ptpm2 mNG-ASTpm2, pRS305-ptpm1mNG-ASTpm1, and the least protein levels were found in pRS305-ptpm2 mNG-ASTpm2 containing ∆tpm1 cells in both fluorescence intensity and western blotting quantifications (Fig. S5C, S5E). Surprisingly, we were not able to detect any protein levels in ∆tpm1 cells containing pRS305-ptpm2 mNG-ASTpm2 with western blotting (Fig. S5D) which was also accompanied by a lack of growth rescue (Fig. S5A). This most likely due to weak expression from the native Tpm2 promoter which is consistent with previous literature (Drees et al., 1995). Taken together, this data clearly shows that the rescue observed in ∆tpm1 cells is caused due to increased expression of mNG-ASTpm2 in cells and supports our conclusion that increase in Tpm2 expression leads to restoration of normal growth and actin cables in ∆tpm1 cells.

      __ Specific function of Tpm2:__

      The data about the retrograde actin flow is interpreted as a specific function of Tpm2, but there is no evidence that Tpm1 does not also share this function. To reach this conclusion one would have to investigate retrograde actin flow in tpm1∆ (difficult as cables are weak) or for instance test whether Tpm1 expression restores normal retrograde flow to tpm2∆ cells.

      Response: __We agree with the reviewer and as per the reviewer's suggestion, we have performed another experiment which include wildtype, ∆tpm2 cells containing empty pRS316 vector or pRS316-ptpm2TPM1 or pRS316-ptpm1TPM1. We find that RACF rate increased in ∆tpm2 cells as compared to wildtype and was restored to wildtype levels by exogenous expression of Tpm2 but not Tpm1 (Fig. S6E, S6F). Since, actin cables were not detectable in ∆tpm1 cells, we measured RACF rates in ∆tpm1 cells expressing Tpm1 or Tpm2 from a plasmid copy, which restored actin cables as shown previously in __Fig. 5A-C. We observed that RACF rates were similar to wildtype in ∆tpm1 cells expressing either Tpm1 or Tpm2 (Fig. S6E, S6F), suggesting that Tpm1 is not involved in RACF regulation. Taken together, these results suggest a specific role for Tpm2, but not Tpm1, in RACF regulation in S. cerevisiae, consistent with previous literature (Huckaba et al., 2006).

      Minor comments: __1.__The growth of tpm1∆ with empty plasmid in Fig S3A is strangely strong (different from other figures).

      Response: __ We thank the reviewer for pointing this out. We have now repeated the drop test multiple times (__Fig. R2), but we see similar growth rates as the drop test already presented in Fig. S4A. __At this point, it would be difficult to ascertain the basis of this difference observed at 23{degree sign}C and 30{degree sign}C, but a recent study that links leucine levels to actin cable stability (Sing et al., 2022) might explain the faster growth of these ∆tpm1 cells containing a leu2 gene carrying high-copy plasmid. However, there is no effect on growth rate at 37{degree sign}C which is consistent with other spot assays shown in __Fig. S1D, S4F, S5A.


      Significance

      I am a cell biologist with expertise in both yeast and actin cytoskeleton.

      The question of how tropomyosin localizes to specific actin networks is still open and a current avenue of study. Studies in other organisms have shown that different tropomyosin isoforms, or their acetylated vs non-acetylated versions, localize to distinct actin structures. Proposed mechanisms include competition with other ABPs and preference imposed by the formin nucleator. The current study re-examines the function and localization of the two tropomyosin proteins from the budding yeast and reaches the conclusion that they co-decorate all formin-assembled structures and also share most functions, leading to the simple conclusion that the more important contribution of Tpm1 is simply linked to its higher expression. Once consolidated, the study will appeal to researchers working on the actin cytoskeleton.

      We thank the reviewer for their positive assessment of our work and the constructive feedback that has greatly improved the quality of our study. After addressing the points raised by the reviewer, we believe that our study has significantly gained in consolidating the major conclusions of our work.

      **Referees cross-commenting**

      Having read the other reviewers' comments, I do agree with reviewer 1 that it is not clear whether the Ala-Ser linker really mimics acetylation. I am less convinced than reviewer 3 that the key conclusions of the study are well supported, notably the issue of Tpm2 expression levels is not convincing to me.

      Response: __We acknowledge the reviewer's point about the effect of Ala-Ser dipeptide and would request the reviewer to refer to our response to Reviewer 1 (Question 1) for a more detailed discussion on this. We have also extensively addressed the question of Tpm2 expression levels as suggested by the reviewer (new data in __Figure S5) which has further strengthened the conclusions of our study.

      __Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary:__ The study presents the first fully functional fluorescently tagged Tpm proteins, enabling detailed probing of Tpm isoform localization and functions in live cells. The authors created a modified fusion protein, mNG-amTpm, which mimicked native N-terminal acetylation and restored both normal growth and full-length actin cables in yeast cells lacking native Tpm proteins, demonstrating the constructs' full functionality. They also show that Tpm1 and Tpm2 do not have a preference for actin cables nucleated by different formins (Bnr1 and Bni1). Contrary to previous reports, the study found that overexpressing Tpm2 in Δtpm1 cells could restore growth rates and actin cable formation. Furthermore, it is shown that despite its evolutionary divergence, Tpm2 retains actin-protective functions and can compensate for the loss of Tpm1, contributing to cellular robustness.

      Major and Minor Comments: 1. The key conclusions of this paper are convincing. However, I suggest that more detail be provided regarding the image analysis used in this study. Specifically, since threshold settings can impact the quality of the generated data and, therefore, its interpretation, it would be useful to see a representative example of the quantification methods used for actin cable length/number (as in refs. 80 and 81) and mitochondria morphology. These could be presented as Supplemental Figures. Additionally, it would help to interpret the results if the authors could be more specific about the statistical tests that were used.

      Response: __We agree with the reviewer's suggestions and have now updated our Materials and Methods section to describe the image analysis pipelines used in more detail. We have also added examples of quantification procedure for actin cable length/number and mitochondrial morphology as an additional Supplementary __Figure S7. Briefly, the following pipelines were used:

      • Actin cable length and number analysis: This was done exactly as mentioned in McInally et al., 2021, McInally et al., 2022. Actin cables were manually traced in Fiji as shown in __ S7A__, and then the traces files for each cell were run through a Python script (adapted from McInally et al., 2022) that outputs mean actin cable length and number per cell.
      • Mitochondria morphology: Mitochondria Analyzer plug-in in Fiji was used to segment out the mitochondrial fragments. The parameters used for 2D segmentation of mitochondria were first optimized using "2D Threshold Optimize" to find the most accurate segmentation and then the same parameters were run on all images. After segmentation of the mitochondrial network, measurements of fragment number were done using "Analyze Particles" function in Fiji. An example of the overall process is shown in __ S7B.__ As per the reviewer's suggestion, we have now included the description of the statistical test used in the Figure Legends of each Figure in the revised manuscript. We have used One-Way Anova with Tukey's Multiple Comparison test, Kruskal-Wallis test with Dunn's Multiple Comparisons, and Unpaired Two-tailed t-test using the in-built functions in GraphPad Prism (v.6.04).

      **Referees cross-commenting**

      I agree with both reviewers 1 and 2 regarding the issues with the Ala-Ser acetylation mimic and Tpm2 expression levels, respectively. I think the authors should be more careful in how they frame the results, but I consider that these issues do not invalidate the main conclusions of this study.

      Response: __We acknowledge the reviewer's concern about the Ala-Ser dipeptide and would request them to refer our earlier discussion on this in response to Reviewer 1 (Question 1) and Reviewer 2 (Question 2). We would also request the reviewer to refer to our answer to Reviewer 2 (Question 6) where we have extensively addressed the question of Tpm2 expression levels and their effect on rescue of Dtpm1 cells. This data is now presented as new __Figure S5 in our revised manuscript.

      Reviewer#3 (Significance (Required)):

      The finding that Tpm2 can compensate for the loss of Tpm1, restoring actin cable organization and normal growth rates, challenges previous assumptions about the non-redundant functions of these isoforms in Saccharomyces cerevisiae (ref. 16). It also supports a concentration-dependent and formin-independent localization of Tpm isoforms to actin cables in this species. The development of fully functional fluorescently tagged Tpm proteins is a significant methodological advancement. This advancement overcomes previous visualization challenges and allows for accurate in vivo studies of Tpm function and regulation in S. cerevisiae.

      The findings will be of particular interest to researchers in the field of cellular and molecular biology who study actin cytoskeleton dynamics. Additionally, it will be relevant for those utilizing advanced microscopy and live-cell imaging techniques.

      As a researcher, my experience lies in cytoskeleton dynamics and protein interactions, though I do not have specific experience related to tropomyosin. I use different yeast species as models and routinely employ live-cell imaging as a tool.

      We thank the reviewer for their positive outlook and assessment of our study. We have incorporated all their suggestions, and we are confident that the revised manuscript has significantly improved in quality due to these additions.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      There are 2 Major issues:

      1. Having an -ala-ser- linker between the GFP and tropomyosin mimics acetylation. This is not the case, and more likely the this linker acts as a spacer that allows tropomyosin polymers to form on the actin, and without it there is steric hindrance. A similar result would be seen with a simple flexible uncharged linker. It has been shown in a number of labs that the GFP itself masks the effect of the charge on the amino terminal methionine. This is consistent with NMR, crystallographic and cryo structural studies. Biochemical studies should be presented to demonstrate that the impact of a linker for the conclusions stated to be made, which provide the basis of a major part of this study.
      2. My major issue however is making the conclusions stated here, using an amino-terminal fluorescent protein tag that s likely to impact any type of isoform selection at the end of the actin polymer. Carboxyl terminal tagging may have a reduced effect, but modifying the ends of the tropomyosin, which are integral in stabilising end to end interactions with itself on the actin filament, never mind any section systems that may/maynot be present in the cell, is not appropriate.

      Significance

      This paper explores the role of formin in determining the localisation of different tropomyosins to different actin polymers and cellular locations within budding yeast. Previous studies have indicated a role for the actin nucleating proteins in recruiting different forms of tropomyosin within fission yeast. In mammalian cells there is variation in the role of formins in affiecting tropomyosin localisation - variation between cell type. There is also evidence that other actin binding proteins, and tropomyosin abundance play roles in regulating the tropomyosin-actin association according to cell type. Biochemical studies have previously been undertaken using budding yeast and fission yeast that the core actin polymerisation domain of formins do not interact with tropomyosin directly.

      The significance of this study, given the above, and the concerns raised is not clear to this reviewer.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public Review):

      This manuscript by Bai et al concerns the expression of Scleraxis (Scx) by muscle satellite cells (SCs) and the role of that gene in regenerative myogenesis. The authors report the expression of this gene associated with tendon development in satellite cells. Genetic deletion of Scx in SCs impairs muscle regeneration, and the authors provide evidence that SCs deficient in Scx are impaired in terms of population growth and cellular differentiation. Overall, this report provides evidence of the role of this gene, unexpectedly, in SC function and adult regenerative myogenesis.

      We appreciate the comments and thank her/him for the support.

      There are a few minor points of concern.

      (1) From the data in Figure 1, it appears that all of the SCs, assessed both in vitro and in vivo, express Scx. The authors refer to a scRNA-seq dataset from their lab and one report from mdx mouse muscle that also reveals this unexpected gene expression pattern. Has this been observed in many other scRNA-seq datasets? If not, it would be important to discuss potential explanations as to why this has not been reported previously.

      Thanks for this question regarding data in Fig.1. We did initially use immunofluorescence staining of Pax7 and GFP on muscle sections and primary myoblast cultures prepared from Tg-ScxGFP mice to conclude that Scx was expressed in satellite cells (SCs). In addition to the cited mdx RNA-seq data, we have included a re-analysis of a published scRNA-seq data set in Fig.2E (Dell'Orso et al., Development, 2019), and our own scRNA-seq data (Fig.S5D, F). We have now re-examined an additional scRNA-seq data set of TA muscles at various regeneration time points (De Micheli et al., Cell Rep. 2020), in which Scx expression was detected in MuSC progenitors and mature muscle cells. We have added the De Micheli et al. reference and the re-analysis of that scRNA-seq data set for Scx expression as an additional panel in Fig. 2E, with accompanying text (p. 7, ln. 4-6). Thus, our immunostaining results are consistent with scRNA-seq data from our and two other independent scRNA-seq data sets.

      We think that Scx expression in the adult myogenic lineage was not previously reported mainly because its expression level was low, and might be dismissed as spurious detection. Additionally, detecting such low expression levels requires sophisticated detection methods with high capture efficiency. Previous studies have noted limitations in transcript capture or transcription factor dropout in 10x Genomics-based datasets (Lambert et al., Cell, 2018; Pokhilko et al., Genome Res., 2021). The most likely and straightforward reason is that Scx was simply not a focus in prior studies amid so many other genes of interest. We have now added this last explanation in the text (p.7, ln. 8-9), following the re-analyses of Scx expression in published scRNA-seq data sets.

      (2) A major point of the paper, as illustrated in Fig. 3, is that Scx-neg SCs fail to produce normal myofibers and renewed SCs following injury/regeneration. They mention in the text that there was no increased PCD by Caspase staining at 5 DPI. A failure of cell survival during the process of SC activation, proliferation, and cell fate determination (differentiation versus self-renewal) would explain most of the in vivo data. As such, this conclusion would seem to warrant a more detailed analysis in terms of at least one or two other time points and an independent method for detecting dead/dying cells (the in vitro data in Fig. 4F is also based on an assessment of activated Caspase to assess cell death). The in vitro data presented later in Fig. S4G, H do suggest an increase in cell loss during proliferative expansion of Scx-neg SCs. To what extent does cell loss (by whatever mechanism of cell death) explain both the in vivo findings of impaired regeneration and even the in vitro studies showing slower population expansion in the absence of Scx?

      We appreciate these constructive suggestions. Based on the number of available control and cKO animals, we were limited to one additional time point at 3 dpi to assess PCD by TUNEL in vivo. We were disappointed again to find no appreciable levels of PCD at 3 dpi by TUNEL (new Fig.S4I), thus no quantifications were included. We also re-did the in vitro experiment using purified SCs and monitored PCD by staining for cleaved Caspase-3 using a validated tube of antibodies (positive staining after 6 h of treatment by 1 mM staurosporine of control and ScxcKO cells; included as new Fig. S4J and legend). We were pleased to find an increase of cleaved Caspase3 stained cells, i.e. PCD, of Scx-cKO SCs at day 4 in culture, compared to that of the control. We have now replaced the old Fig. 4F with new Fig.4F and 4G to document PCD. We also provided new text/legend for these new data (p.10. ln. 2-10; new legend for Fig. 4F and 4G).

      (3) I'm not sure I understand the description of the data or the conclusions in the section titled "Basement membrane-myofiber interaction in control and Scx cKO mice". Is there something specific to the regeneration from Scx-neg myogenic progenitors, or would these findings be expected in any experimental condition in which myogenesis was significantly delayed, with much smaller fibers in the experimental group at 5 DPI?

      We very much appreciate this comment. We agree that there is unlikely anything specific about the regeneration from Scx-negative myogenic progenitors. Unfilled or empty ghost fibers (basement membrane remnant) are expected due to small fiber and poor regeneration in the ScxcKO mice at 5 dpi. We have removed the subtitle and changed the content to an expected consequence rather than something special (p. 8, ln. 19-22).

      (4) The data presented in Fig. 4B showing differences in the purity of SC populations isolated by FACS depending on the reporter used are interesting and important for the field. The authors offer the explanation of exosomal transfer of Tdt from SCs to non-SCs. The data are consistent with this explanation, but no data are presented to support this. Are there any other explanations that the authors have considered and that could be readily tested?

      Thanks for highlighting this phenomenon. We struggled with the SC purity issue for a long time. The project started with using the R26RtdT reporter for tdT’s paraformaldehyde  resistant strong fluorescence (fixation) to aid visualization in vivo. Later, when we used the tdT signal to purify SCs by FACS, we found that only 80% sorted tdT+ cells are Pax7+. We then switched to the R26RYFP reporter, from which we achieved much higher purity (95%) of SCs (Pax7+) by FACS. As such, we also repeated and confirmed many in vivo experimental results using the R26RYFP reporter (included in the manuscript). Due to the low purity of tdT+SCs by FACS, we discontinued that mouse colony after we confirmed the superior utility of the R26RYFP reporter for SC isolation.

      We sincerely apologize for not being able to conduct further testable experiments on this intriguing phenomenon. However, this issue has since been addressed and published by Murach et al., iScience, (2021). Like our experience, they found non-satellite mononuclear cells with tdT fluorescence after TMX treatment when SCs were isolated via FACS. To determine this was not due to off-target recombination or a technical artifact from tissue processing, they conducted extensive analyses. They found that the tdT+ mononuclear cells included fibrogenic cells (fibroblasts and FAPs), immune cells/macrophages, and endothelial cells. Additionally, they confirmed the significant potential of extracellular vesicle (EV)-mediated cargo transfer, which facilitates the transfer of full-length tdT transcript from lineage-marked Pax7+ cells to those mononuclear cells. We have modified the text to emphasize and acknowledge their contribution to this important point, and explained the difference between YFP and tdT reporter alleles in more detail (p.9, ln. 11-17).

      (5) The Cut&Run data of Fig. 6 certainly provide evidence of direct Scx targets, especially since the authors used a novel knock-in strain for analyses. The enrichment of E-box motifs provides support for the 207 intersecting genes (scRNA-seq and Cut&Run) being direct targets. However, the rationale elaborated in the final paragraph of the Results section proposing how 4 of these genes account for the phenotypes on the Scx-neg cells and tissues is just speculation, however reasonable. These are not data, and these considerations would be more appropriate in the Discussion in the absence of any validation studies.

      We agree with this comment and have moved speculations into the Discussion (p. 15, ln. 4-15, and from p. 18, ln. 4 to p. 19, ln. 4).

      Reviewer #2 (Public Review):

      Summary:

      Scx is a well-established marker for tenocytes, but the expression in myogenic-lineage cells was unexplored. In this study, the authors performed lineage-trace and scRNA-seq analyses and demonstrated that Scx is expressed in activated SCs. Further, the authors showed that Scx is essential for muscle regeneration using conditional KO mice and identified the target genes of Scx in myogenic cells, which differ from those of tendons.

      Strengths:

      Sometimes, lineage-trace experiments cause mis-expression and do not reflect the endogenous expression of the target gene. In this study, the authors carefully analyzed the unexpected expression of Scx in myogenic cells using some mouse lines and scRNA-seq data.

      We appreciate the comments and thank her/him for noting the strengths of our manuscript.

      Weaknesses:

      Scx protein expression has not been verified.

      We are aware of this weakness. We had previously used Western blotting (WB) using cultured SCs from control and ScxcKO mice, but did not detect endogenous Scx protein even in the control. In response to this comment, we have re-done several WB experiments using new lysates from control and ScxcKO SCs and two commercial antibodies: anti-Scx antibody 1 from Abcam (ab58655) and anti-Scx antibody 2 from Invitrogen (PA5-23943). These antibodies have been reported to detect endogenous Scx protein in tendon cells in Spang et al., BMC Musculoskelet Disord (2016) and  Bochon et al., Int J Stem Cells (2021). Despite our best efforts, we were not able to detect a reliable Scx band. We have also conducted immunofluorescence using these two antibodies. Still, we failed to detect a difference of staining signals between control and cKO SCs using these antibodies. Lastly, we conducted immunofluorescence using the ScxTy1 myoblasts and we did not find the staining signal coinciding with the Ty1 signal (by double staining). We have been very frustrated by not knowing what caused this technical difficulty in our hands. Given that these were negative data, we did not include them. However, we do hope that the combined data from scRNA-seq, ScxCreERT2 lineage-tracing, Tg-ScxGFP expression, and ScxTy1 knock-in together are deemed sufficient to make up for the deficiency of data for endogenous Scx protein in regenerative myogenic cells.

      Response to Recommendations for the Authors:

      Reviewer #1 (Recommendations For The Authors):

      p. 8: The text refers to Fig. 3I, but this should be Fig. 3H.

      We apologize for the confusion. Please note that by keeping all 14 dpi data in the same row, we placed Fig.3I at an unconventional/unexpected position, i.e., next to 3D &3E, and above 3F-H. We were aware that this unconventional placement could cause confusion, and it did. With that said, we have now re-arranged the subfigures (same data content) so that the updated Fig.3 contains subfigures in the expected and proper spatial order. We double-checked the figure referral in the text (p. 8, ln. 16-17) and the text is correct – just that the original Fig.3I should have been at the original Fig.3H position and that is now corrected.

      Reviewer #2 (Recommendations For The Authors):

      (1) Given that Scx binds to the E-box and regulates gene expression, it is of interest to know the relevance between MyoD and Scx. If possible, the reviewer recommends to include some discussions.

      Thanks for the comment. MyoD1 is a well-known transcript factor regulating myogenesis, whereas Scx is primarily studied in tenocytes and other connective tissues. We agree that our new findings deserve a discussion regarding the relevance between MyoD1 and Scx.  We have added a description of their differences in the discussion and two new references (p.19, ln. 7-17).

      (2) Considering that Scx is a transcriptional factor, it is interesting that Scx-GFP was not detected in the nuclei of regenerated myofibers. Could the subcellular localization of Scx-GFP provide some insights into the function of Scx as a transcription factor during muscle regeneration?

      Tg-ScxGFP is a transgenic line generated by random insertion into the genome (Pryce et al., 2007; cited). The plasmid used for transgenesis was constructed by replacing most of Scx’s first exon with GFP, and including ~ 9Kb flanking regulatory sequences. As such, the ScxGFP is not a fusion gene, but rather that the GFP expression is regulated by Scx promoter and enhancer(s). This GFP reporter lacks a nuclear localization signal (NLS), hence it is mainly detected in the cytoplasm; some nuclear signal is detected, presumably due to GFP’s small size permitting passive diffusion into the nucleus. Thus, the GFP signal is used as a reporter for Scx expression, but GFP subcellular localization does not provide insight into Scx function per se. Conversely, ScxTy1/Ty1 is a knock-in allele created by fusing a triple-Ty1 tag (3XTy1) to the C-terminus of Scx, and we observed that Ty1 is located in the nucleus by the immunofluorescent staining. We used the Ty1 epitope to carry out CUT&RUN experiments to gain insight to the function of Scx as a transcription factor.

      (3) Fig1D The number of arrows in the Merge image is not matched with others. In addition, the star mark in the Pax7 image is likely an error.

      Apologies. We have now corrected these errors in the revised Fig.1D.

      (4) FigS1A Is there only one myofiber shown in the dashed line in this image? It is unclear why only this myofiber is surrounded by the dashed line.

      The dashed line encircles a single fiber because it was not visible in the provided image. However, there are 3 fibers in this image. Because we did not immuno-stain for myofibers here, we circled one fiber for illustration. For clarity, we brightened the background (of the entire original images) so the background signals from myofiber boundaries are discernable without outlines.

      (5) FigS1B There was no overlapped DAPI staining in the Myogenin+ cell. DAPI-staining should be present in Myogenin+ cells because myogenin is located in the nucleus.

      Fig.S1B is immuno-staining for MyoD , and we marked one MyoD+DAPI+GFP+ cell/nucleus. Fig.S1C is immune-staining for Myogenin, and we also marked one (cell/nucleus) that is triple positive.

      (6) The position of the asterisk for the ScxGFP in FigS1D is misaligned. In addition, the position is not matched with Fig1C. Because all myofibers are Scx-positive, it is strange that only one myofiber has an asterisk. The reviewer suggests removing the mark.

      Thank you for pointing out these errors. We have now corrected the misalignment and removed the unnecessary asterisk.

    1. I hate broccoli, chain saws, patchouli, bra- clasps that draw dents in your back, roadblocks, men in black kneesocks, sandals and shorts

      this list personalizes hatred to the speaker

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to Reviewers

      We thank all three reviewers for their time and engagement, for their generally supportive comments, and for raising some important concerns. We are pleased to submit a significantly revised manuscript where we tried to accommodate all suggested changes and extensions. Importantly, we have included additional experiments that support the relevance of FACT for the overall stability of the inner kinetochore. Below is a detailed point-to-point response. Changes to the manuscript relative to the original submission have been highlighted at the end of this response.


      __Reviewer #1 (Evidence, reproducibility and clarity (Required)): __

      Summary: The authors investigated molecular interactions between CCAN and FACT complexes. They revealed contact domains in FACT and the cognate subcomplexes of CCAN by in vitro reconstitution from recombinant proteins followed by SEC and pull-down assay.

      They also revealed a couple of potential means to control interactions between FACT and the CCAN. They conclude that phosphorylation of FACT by CK2 is essential for binding to the CCAN; and CENP-A nucleosomes or DNA prevent CCAN from interacting with FACT.

      Major comments:

      The authors show that phosphorylation of FACT is essential for interaction with CCAN.

      They argue that this phosphorylation is partly catalysed by CK2.

      My concerns are:

      -1- The authors assume that the sites phosphorylated in insect cell are also phosphorylated in human cells. However, it is not demonstrated which residues are phosphorylated in human cells and whether they match those from insect cells. Whether phosphorylation of recombinant proteins in insect cells is physiologically relevant to mammalian is uncertain. Kinetochore components are not very well conserved evolutionarily, thus their regulation may be different.

      We thank the reviewer for these remarks, which we answer together with point 2 below.

      -2- They identify several residues which are phosphorylated by CK2 in vitro. However, these are not necessarily the same sites as those phosphorylated in insect cells or more importantly in human cells. The in vitro phosphorylation by CK2 did not restore binding affinity in full, suggesting phosphorylation at other sites may be critical for interaction with CCAN. Further evidence is required to support the claim that those sites are phosphorylated in vivo and important for integrity of kinetochores in mitosis.

      Our analysis of FACT phosphorylation represents a relatively small part of a very data-rich paper, and was not meant to be exhaustive. Nonetheless, the reviewer's comments are important and well received. We agree that we have no definitive evidence that the same sites are phosphorylated in insect cells, in vitro, and in human cells. However, it is quite remarkable, and supports specificity, that the interaction with FACT, lost after dephosphorylation in vitro, is restored with CK2 and not with three additional mitotic kinases (CDK1, Aurora B, and PLK1 - Figure S8D). We also note that S437, S444 and S667 of SSRP1, which were phosphorylated by CK2 in vitro, were also detected as phosphorylated sites on recombinant FACT purified from insect cells (Table S1). So collectively, while we agree with the reviewer that the analysis of FACT phosphorylation is not complete, it does significantly add to the manuscript and more generally to the FACT field.

      Minor comments:

      Figure 1H

      I am confused with 4 stars shown at the top of the right plot. If the 4 stars are meant to show a significant difference, then the statement in the text (line 123) is not correct.

      "SSRP1 localization was also largely unaffected ..."

      Similar discrepancies are found in Figures 3H (line 212), Figures S2 (line 122), S5I (line 197), and S6I (line209). Figure S6H is not referred to anywhere.

      There is no description for the numbers at the top. Are they mean values? Do red bars represent S.D.?

      We thank the reviewer for these comments. In this revised version of the manuscript, we have substantially improved the quantification and statistical analysis. The main problem with the previous automated analysis is that the non-circular shape of the CREST-staining led to inconsistencies with the statistical analysis and the statement. In contrast, the same analysis works well when the CENP-C signal was used for KT identification (e.g. in Figure 3), as CENP-C staining yields well separated circular signals ideally suited for our automated identification of individual KTs and subsequent retrieval of fluorescence intensities. We have therefore modified our analysis macro for all experiments where CREST was used as a reference. We used Othsu-thresholding of the DAPI signal for generating a segmentation mask per each cell. Then, integrated cell intensities were calculated for each fluorescence channel based on the DAPI reference mask. With these adjustments, the statistical analyses (Figures 1, S2, S3) support the claim presented. We have updated the Methods and Results sections to reflect the revised analysis.

      The numbers on top of the graphs are median values, bars represent interquartile ranges. We have now included the description in figure legends.

      We appreciate your feedback, which prompted us to clarify and enhance the rigor of our approach.

      We are now referring to Fig. S6H in the text.

      Figure 1D

      There is no description of R* to the right of gels.

      We have added a description of R* to the relevant figure legend.

      Figure S2

      A 4 hour nocodazole treatment is too short to drive all cells into mitosis. Is the data taken from mitotic cells only?

      Yes, the data are taken only from the mitotic population. We have now clarified this in the figure legend.

      Reviewer #1 (Significance (Required)):

      The interaction of FACT with kinetochore components has been known for several years. However how FACT contributes to architecture or function of kinetochore is not very well understood. How the FACT complex, which is known for its established role as a histone chaperone, is involved in kinetochore assembly/architecture will attract interest in several fields of basic research including epigenetics, mitosis, structural biology.

      We are grateful to the reviewer for this supportive statement that recognizes the broad potential interest of the manuscript.

      Identification of CCAN subunits that interact with FACT is important for future analysis to understand the kinetochore function of FACT. The authors identified OPQRU and CHIKM subcomplex in addition to TW as FACT-interacting domains. These subcomplexes are geographically scattered in a 3D model of CCAN holocomplex. Stoichiometry of CCAN and FACT might be informative whether a single or multiple FACT binds to the multiple sites of CCAN. The authors do not address whether these multiple sites are occupied simultaneously, separately or sequentially.

      We thank the reviewer for raising this point. As mentioned in the discussion, we have not yet been able to perform a structural analysis of the FACT/CCAN complex to determine its stoichiometry. However, we have now added a newexperiment (Figure S1B,C) where we quantified in-gel tryptophan fluorescence after analytical size-exclusion chromatography. This strongly suggests that FACT and CCAN form a complex with a 1:1 stoichiometry. Nevertheless, we cannot comment on which sites are occupied.

      The statement at the end of Abstract (lines 23-25) is a speculative hypothesis without evidence for "a pool of CCAN that is not stably integrated into chromatin", "chaperoning CCAN", and "stabilisation of CCAN".

      We agree with the reviewer that this is speculative, and have therefore modified the Abstract to clearly indicate this point.

      __Reviewer #2 (Evidence, reproducibility and clarity (Required)): __

      FACT is a histone chaperone and is involved in various events on chromatin such as transcription and replication. In addition, FACT interacts with various kinetochore components, suggesting potential functions at the kinetochore. However, it is largely unclear how FACT functions in the kinetochore. Authors of this MS took the biochemical approach to understand roles of FACT in the kinetochore.

      Authors demonstrated that FACT forms a complex with the constitutive centromere associated network (CCAN), which contains 16 subunits on centromeric chromatin, using multiple binding sites. They also showed that casein kinase II (CK2) phosphorylated FACT and dephosphorylated FACT did not bind to CCAN. Furthermore, they displayed that DNA addition disrupt the stable FACT-CCAN complex.

      Overall, while authors have done solid and high-quality biochemical analyses (these are elegant), it is still unclear how FACT plays its roles in the kinetochore. Simple knockout or knockdown study on FACT might be complicated, because FACT has multi-functions. If authors can identify specific regions of FACT for interaction with CCAN, they would put specific mutations into FACT to analyze phenotype. Although they did not reach a high-resolution structure for the FACT-CCAN complex, they can utilize AlphaFold and test specific interaction regions, biochemically. Then, using such information, significance of FACT-CCAN interaction might be testable in cells. Such a kind of study would be expected. In summary, biochemical parts are beautiful, but the paper did not address significance of FACT-CCAN interaction.

      We thank the reviewer for praising the biochemical work in our manuscript. The reviewer, however, also underscored the limits of our functional analysis. The reviewer proposes generating separation-of-function mutants in a minimal kinetochore-binding region. Indeed, we have identified the minimal domain for the interaction of FACT with kinetochores. However, this information is insufficient for a reliable functional analysis at this stage, as the region we identified encompasses the AIDs and the phosphorylation-rich region, both of which have been previously shown to be important for transcription and other functions. Furthermore, any suitable mutant should be tested in cells devoid of endogenous FACT, raising the concern that the resulting phenotype may be indirect.

      Nonetheless, as we wanted to provide at least an initial answer to the reviewer's concern, we enriched the manuscript by adding experiments in a recently published cell line (K562-SSRP1-dTAG) where FACT levels can be controlled with a small molecule (Žumer et al. Mol Cell., 2024) and that the authors generously shared with us. In this line, which grows in suspension and that we had to adapt to grow on a substrate for imaging, we were able to deplete FACT while cells were arrested in mitosis. We are glad to report that we found a significant reduction in the kinetochore levels of CENP-TW after this treatment, which is consistent with other conclusions from our study. These experiments add an initial functional characterization of the interaction of FACT with kinetochores, and extend the significance of the manuscript. We refer to these results again below in response to specific point 5.

      Specific point

      Authors showed nice mitotic localization of FACT. Can they observe this localization by a usual IF? Using GFP fusion, do they observe kinetochore localization like IF experiments?

      The localization of FACT was observed using pre-extraction and fixation followed by antibody staining. We have now added a panel demonstrating mitotic localization of GFP-SSRP1 at the kinetochore in transiently transfected RPE-1 cells (Fig. S2A).

      On page 7, authors tested CENP-C binding to FACT and they conclude that C-teminal region of CENP-C preferentially binds to FACT. However, they used N-terminal region of CENP-C (2-545) for CCAN-FACT complex formation in entire MS. therefore, this is complicated, and story on CENP-C N-terminal region can be removed from this MS.

      We were only able to purify full-length CENP-C with tags at the N- and C-terminus, including an MBP tag with a stabilizing effect. At the time of our first successful purification of full-length CENP-C, we had already established the solid phase assay using MBPFACT as a bait on amylose beads and CENP-C2-545HIKM as one of the preys. As we cannot obtain stable full-length CENP-C without MBP, this form of CENP-C is incompatible with our pull-down assay. Nevertheless, CENP-C2-545 still has low affinity for FACT, influencing the FACT/CCAN interaction independent of the PEST-rich region. We, therefore, opted for keeping this information in the manuscript.

      On page 9, authors suddenly focus on N-terminal tails of CENP-Q and CENP-U. Why did they focus on this region. They should explain this. If they perform a structural prediction, they should describe this point.

      Thanks for raising this point. We focused on the N-terminal tails of CENP-QU because they are known interaction hubs. We have now added a sentence to introduce this concept and citing the appropriate literature.

      I agree the fact that FACT phosphorylation is required for FACT-CCAN interaction. They may explain how the phosphorylation contributes to stable FACT-CCAN interaction.

      We have added a sentence explaining that FACT is known to mimic DNA, and negative charges due to phosphorylation could drive this effect. A more detailed mechanistic understanding will require identifying specific phosphorylation sites required for the interaction.

      Readers really want to know phenotype, if FACT-CCAN interaction was compromised without disruption pf CCAN assembly in cells. Although I agree that FACT has some functions in the kinetochore, it is still unclear what FACT does in the kinetochore.

      We wholeheartedly agree with the reviewer. As depletion of FACT by RNAi required 48 h, an unreasonably long time for this multifunctional protein. We therefore turned to engineering RPE-1 cells for rapid degradation of SSRP1. While these attempts were unsucessful, earlier this year, Žumer et al. Mol Cell., 2024 reported generating a K562-SSRP1-dTAG cell line growing in suspension. As already reported, this cell line now allowed to demonstrate a significant effect on the kinetochore stability of CENP-TW upon mitotic depletion of FACT.

      Reviewer #2 (Significance (Required)):

      As mentioned above, biochemical parts are beautiful, but the paper did not address significance of FACT-CCAN interaction.

      We thank the reviewer for this positive assessment. In this revision, we have obtained initial evidence that FACT contributes to kinetochore stability.

      __Reviewer #3 (Evidence, reproducibility and clarity (Required)): __

      Main findings:

      The major findings of this paper are:

      Detailed dissection of CCAN subunit interactions and requirements to bind the FACT complex using in vitro reconstituted components Binding of FACT and nucleosomes to CENP-C are mutually exclusive FACT phosphorylation by CK2 enhances interaction with CCAN FACT localization in mitosis depends on the CCAN CCAN binding to FACT is outcompeted by DNA and CENP-A nucleosomes The claims and conclusions of the paper are supported by the data and do not require additional experiments. All experiments include biological replicates and appropriate controls.

      We are thankful to the reviewer for this very positive assessment of our work.

      Minor comments

      Intro: • Line 81: In humans [...], here it is worth mentioning that in Drosophila, FACT subunits have been shown to interact directly with the CENP-A assembly factor CAL1 (Ref 61). This paper is perfunctorily cited once in the context of its implication of FACT in CENP-A deposition, but it merits more consideration when setting up the foundational context for the present work.

      We have extended the Introduction and discuss the specified paper more thoroughly.

      Figure 1:

      1F: Add insets.

      Done.

      1G and all other figures containing IFs: Avoid red/green color scheme (red-green colorblindness is fairly common, affecting about 8% of men).

      Done.

      1E: Please add a table summarizing interactions.

      We have included this table as Fig. S1E.

      Results: • It's fine to direct readers to previous work in which you reconstituted the CCAN, but the text should mention how proteins are exogenously expressed and purified (as done for FACT in line 247).

      Done.

      Line 113: FACT has been shown to localize to the mitotic kinetochore also in Drosophila (Ref 61).

      We have included this information now.

      Line 132: The authors should cite work from the Drosophila system as well when they mention centromere transcriptional activity in mitosis (e.g. https://doi.org/10.1083/jcb.201404097; https://doi.org/10.1083/jcb.201611087; and Ref 61).

      We have added these citations.

      Figure 2F: The authors could use a line to mark the region interacting with FACT and that interacting with CENP-A to help summarize the data in this diagram.

      Done.

      Figure 4: Highlight constructs n.2 (FACT^TRUNC) since these are sufficient for interaction (e.g., use a box around them).

      Done.

      Line 276: "CCAN decodes CENP-A^NCP..." What do the authors mean by "decodes"? This whole sentence would benefit from clearer language.

      We thank the reviewer for this suggestion and have aimed for clearer language.

      Figure 6: There's a lot of information in these experiments that would benefit from two schematics, one showing the mechanism of FACT + CCAN binding with DNA and one with CENP-A nucleosomes.

      Done.

      Discussion: The authors discuss FACT localization at kinetochores in mitosis. In Drosophila Schneider cells, FACT is observed enriched at the centromeres in both mitosis and interphase (Ref 61). The authors mention their inability to detect FACT in interphase in the discussion, but I did not find this mentioned in the results. The authors state that FACT "redistributes to the entire chromosome" upon entry into interphase. They cite Figure 1F in reference to this statement, but the staining in the early G1 panel is difficult to interpret with the low signal/noise scaling of CENP-C and the lack of zoom insets. Their protocol uses a pre-extraction step with Triton prior to fixation. Apparently, this was not enough to reveal FACT in interphase, but better images and a brief description are warranted.

      We have now added a staining of SSRP1 in interphase in the panel.

      It is unlikely that FACT would change its localization pattern in mitosis. A more likely possibility is that in mitosis FACT is not redistributed, but rather more tightly bound (and thus less easily extracted by Triton treatment) at kinetochores, while along the arms FACT is more readily removed by extraction because at this time transcription is repressed and FACT is likely less engaged in transcription-mediated histone destabilization.

      We thank the reviewer for these remarks and have updated the Discussion.

      Given the well-known function of FACT in transcription and the many studies linking transcription to centromere maintenance, including with the involvement of FACT, the model that "the localization of FACT at the kinetochore coincides with active centromeric transcription in mitosis and interphase" is very tempting. A speculative model would go a long way to help the reader visualize all these complex aspects of FACT's interactions and possible functions.

      We agree with the reviewer that such a model is tempting. However, we also feel that it would be rather speculative at this stage and we feel that the manuscript does not provide sufficient data to support the model.

      Reviewer #3 (Significance (Required)):

      The strongest aspect of the study is the detailed characterization of protein-protein interactions, as well as competition with DNA and CENP-A nucleosomes. The siRNA experiments in cells complement this largely in vitro study. However, a limitation of the study is that it does not shed light on what FACT might be doing at the centromere. Additionally, it does not sufficiently provide context for these findings in relation to previous studies that have demonstrated the roles of FACT at the centromere in budding yeast, fission yeast, and Drosophila. Nonetheless, this study provides valuable insights into the details of FACT interactions at the kinetochore and will be of interest to readers interested in centromeres and kinetochore. I am a centromere biologist with molecular and cell biology expertise.

      We are very grateful to the reviewer for his/her support.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public review):

      (1) The technology requires a halo-tagged derivation of the active compound, and the linked position will have a huge impact on the potential "target hits" of the molecules. Given the fact that most of the active molecules lack of structure-activity relationship information, it is very challenging to identify the optimal position of the halo tag linkage.

      We appreciate your insightful comment. While finding the optimal position to attach a chemical linker to a small molecule of interest is indeed a challenging but necessary step, this is a common difficulty across all target-ID methods, except for those that are modification-free, as we described in Discussion. However, modification-free approaches such as DARTS, CETSA, and TPP have their own limitations, such as low sensitivity and a high false-positive rate. Additionally, DARTS and SPROX are limited to use with cell lysates. Please refer to the introduction in our manuscript for more details on these approaches. On the other hand, synthesizing HTL derivatives is relatively straightforward compared to other modifications, and we provide helpful guidelines for chemical linker design, provided the optimal chemical moiety has been identified, which is crucial for target identification. We selected dasatinib and HCQ/CQ as model compounds because previous studies offered insights into their derivative synthesis. Our data also show that DH5 retains strong kinase inhibitory activity (Figure 4—figure supplement 2), and DC661-H1 demonstrates potent inhibition of autophagy (Figure 6—figure supplement 1). For novel compounds, conducting a thorough structure-activity relationship (SAR) study is essential to determine the optimal position for HTL derivative synthesis.

      (2) Although POST-IT works in zebrafish embryos, there is still a long way to go for the broad application of the technology in other animal models.

      Thank you for your constructive comment. Yes, there is still a long way to go in developing the POST-IT system for broader applications in other animal models, especially in mice. However, we hope that our study provides valuable insights and inspiration to scientists and experts for applying the POST-IT system in various models. We are also committed to further improving its applicability.

      (3) The authors identified SEPHS2 as a new potential target of dasatinib and further validated the direct binding of dasatinib with this protein. However, considering the super strong activity of dasatinib against c-Src (sub nanomolar IC50 value), it is hard to conclude the contribution of SEPHS2 binding (micromolar potency) to its antitumor activity.

      Thank you for your insightful comment. We agree that the anticancer activity of dasatinib primarily results from inhibiting tyrosine kinases such as SRC and ABL. However, SEPHS2 contains an “opal" termination codon, UGA, at the 60th amino acid residue, which codes for selenocysteine. Due to the technical challenge of expressing selenoproteins in E. coli, we mutated it to cysteine for expression in E. coli to avoid premature translation termination, as described in the Materials and Methods section. Although the purified recombinant SEPHS2 shows a Kd of about 10 µM for dasatinib, the binding affinity to endogenous SEPHS2 may be higher since selenocysteine is larger and more electronegative than cysteine. This presents an interesting area for future investigation. Furthermore, our study of dasatinib’s binding to SEPHS2 could help facilitate the development of new SEPHS2 inhibitors, potentially targeting the active site of SEPHS2.

      Reviewer #3 (Public review):

      (1) Target Specificity: It is crucial for the authors to differentiate between the primary targets of the POST-IT system and those identified as side effects. This distinction is essential for assessing the specificity and utility of the technology.

      Thank you for your insightful comment. Drugs inevitably bind to various proteins with differing affinities, which can contribute to both side effects and beneficial outcomes. Typically, the primary targets exhibit high affinities. In this manuscript, we ranked the identified protein targets of DH5 based on affinity from mass spectrometry and p-values (Fig. 5A), and for DC661-H1, we used the SILAC ratio (Fig. 6A). We also individually assessed many drug-protein binding affinities using the MST assay, as well as in vitro and in cellulo assays, demonstrating their specificity. Moreover, we believe it is essential to identify as many protein targets as possible at physiological drug concentrations to better understand the drug’s side effects. Of course, further investigation is required to assess the roles and effects of these target proteins.

      (2) In Vivo Target Identification: The manuscript lacks detailed clarity on which specific targets were successfully identified in the in vivo experiments. Expanding on this information would provide a clearer view of the system's effectiveness and scope in complex biological settings.

      Thank you for your insightful comment regarding in vivo target identification. In this manuscript, we utilized a cell line as the primary method for in vivo target identification and validation after optimizing our system in test tubes. We successfully validated many of the targets identified using our POST-IT system (Figure 6—figure supplement 3). To demonstrate the proof of principle for in vivo application, we employed zebrafish embryos as an in vivo model, showing that endogenous SRC can be effectively pulled down by DH5 treatment (Fig. 7). While we could have explored the entire proteome to identify endogenous target proteins in zebrafish that bind to DH5 or dasatinib, we felt this would extend beyond our original scope, given that we have already demonstrated POST-IT’s ability to identify target proteins for dasatinib. Specific target identification and validation are crucial when using zebrafish for drug discovery. Additionally, we acknowledge that drugs likely interact with a range of protein targets in living organisms and may undergo metabolism and interactions within the circulatory system, which we address in our discussion.

      (3) Reproducibility and Scalability: Discussion on the reproducibility of the POST-IT system across various experimental setups and biological models, as well as its scalability for larger-scale drug discovery programs, would be beneficial.

      Thank you for the suggestion. While our system has shown  high reproducibility in our experiments, further improving both reproducibility and scalability would be advantageous. One potential approach to address this is through the generation of stable-expressing cell lines and transgenic zebrafish lines, which we have discussed in the revised manuscript. Establishing stable cell lines with robust POST-IT expression could enhance scalability for drug discovery applications.

      (4) Quantitative Analysis: A more detailed quantitative analysis of the protein interactions identified by POST-IT, including statistical significance and comparative data against other technologies, would enhance the manuscript.

      Thank you for your suggestion. In our assessment of drug-protein affinity, we included Kd values as quantitative measures using MST assays. The protein targets of dasatinib identified through mass spectrometry are also accompanied by p-values for quantitative analysis (Fig. 5A), and the detailed procedures are described in the Material and methods section. While it is challenging to provide direct comparative data against other technologies, our system successfully identified many known target proteins for dasatinib, as well as SEPHS2 and VPS37C as new targets for dasatinib and for HCQ/CQ, respectively, which were not detected by other methods.

      (5) Technological Limitations: The authors should discuss any limitations or potential pitfalls of the POST-IT system, which would be crucial for future users and for guiding subsequent improvements.

      Thank you for your insightful suggestion We agree that clearly defining the technological limitations is important. Therefore, we have expanded our original discussion on the limitations of our POST-IT system (Discussion section, paragraph 6).

      (6) Long-Term Stability and Activity: Information on the long-term stability and activity of the POST-IT components in different biological environments would ensure the reliability of the system in prolonged experiments.

      Yes, this is an important question. We did not notice any stability or toxicity issues with Halo-PafA and Pup substrates in HEK293T cells or zebrafish, which is an important factor for stable cell lines and transgenic zebrafish lines. However, HTL derivatives of the drug could be toxic or unstable due to the nature of the drug or its metabolism, which needs to be taken into account when designing experiments, and we have included this in the Discussion.

      (7) Comparison with Existing Technologies: A detailed comparison with existing proximity tagging and target identification technologies would help position POST-IT within the current landscape, highlighting its unique advantages and potential drawbacks.

      We appreciate your valuable feedback and agree that such comparisons are crucial. We have included a detailed overview and comparison of existing proximity-tagging systems and their related target identification technologies in the Introduction (lines 78-100) and Discussion (lines 391-412), highlighting their respective pros and cons. Additionally, we have expanded the discussion to further compare these technologies with our POST-IT system, addressing its advantages and limitations (lines 378-390, lines 448-467). We hope this provides sufficient context and information to effectively position POST-IT among the landscape of proximity-tagging target identification technologies.

      (8) Concerns Regarding Overexposed Bands: Several figures in the manuscript, specifically Figure 3A, 3B, 3C, 3F, 3G, Figure 4D, and the second panels in Figure 7C as well as some figures in the supplementary file, exhibit overexposed bands.

      We appreciate your astute observation regarding the overexposed bands and apologize for any confusion. The “overexposed” bands represent the unpupylated proteins, while the bands above them correspond to the pupylated proteins. We intended to clearly show both pupylated and unpupylated bands, although the latter are generally much weaker. We are currently working on further improving our POST-IT system to enhance pupylation efficiency.

      (9) Innovation Concern: There is a previous paper describing a similar approach: Liu Q, Zheng J, Sun W, Huo Y, Zhang L, Hao P, Wang H, Zhuang M. A proximity-tagging system to identify membrane protein-protein interactions. Nat Methods. 2018 Sep;15(9):715-722. doi: 10.1038/s41592-018-0100-5. Epub 2018 Aug 13. PMID: 30104635. It is crucial to explicitly address the novel aspects of POST-IT in contrast to this earlier work.

      Thank you for bringing this to our attention. Proximity-tagging systems like BioID, TurboID, NEDDylator, and PafA (Lui Q et al., Nat Methods 2018) were initially developed to study protein-protein interactions or identify protein interactomes, as these applications are of broader interest and generally easier to implement. However, applying proximity-tagging systems for small molecule target identification requires significant optimization. As described in the introduction (lines 78-100), target protein identification systems have since been developed using TurboID and NEDDylator (Tao AJ et al., Nat Commun 2023; Hill ZB et al., J Am Chem Soc 2016). It is conceivable that a PafA-based proximity-tagging system could also be adapted for target-ID, and other groups may pursue this approach in the future. Although the PafA-Pup system shows great promise for target-ID applications, extensive optimization was needed to enable its use for this purpose. Finally, we demonstrate that POST-IT offers distinct advantages over other proximity-tagging-based target-ID systems. For more details, please refer to the introduction and discussion sections.

      Recommendations for the authors:

      Reviewer #2 (Recommendations for the authors):

      (1) Figure 1- Figure Supplement 1A: The Pup substrate "HB-Pup" is mentioned, but the main text or figure legend provides no introduction or description.

      We appreciate your astute observation. We have added a description in the main text and figure legend as follows: “…and used HB-Pup as a control, which contains 6´His and BCCP at the N terminus of Pup” in the main text (line 142) and “HB, TS, and SBP refer to 6´His and BCCP, twin-STII (Strep-tag II), and streptavidin binding peptide, respectively.” in the Figure 1-figure supplement 1A.

      (2) Figure 1 - Figure Supplement 3B: The authors used TS-sPupK61R as a substrate but did not explain why. The main text mentions that mutating sPup alone did not affect polypupylation, raising the question of why TS-sPupK61R was used in this figure. Furthermore, while the authors state that polypupylation becomes evident after 1 hour of incubation (more pronounced after 2 or 3 hours), the reactions here were conducted for only 30 minutes.

      Thank you for your question. Figure 1 - Figure Supplement 3B was conducted to test self-pupylation levels in the different Halo-PafA derivatives. For this purpose, we could use any Pup substrate such as SBP-sPup and SBPK4R-sPupK61R, instead of Ts-sPup and TS-sPupK61R, as they do not show any differences in pupylation activity. We chose Ts-sPup and TS-sPupK61R simply because any Pup substrates could be used for this purpose. Similarly, we did not need to incubate the reaction for a longer time to detect polypupylation, as our intention was to test “self-pupylation”. We demonstrated in Figure 1 – figure supplement 2 that polypupylation is dependent on the number or position of lysine residues in Pup substrate or tags. The results clearly showed that self-pupylation was almost completely abolished by the Halo8KR mutation. To clarify this, we added the following description in lines 168-169: “Ts-sPup and TS-sPupK61R were chosen as sPup substrates for this experiment, although any Pup substrates could have been used. The levels of self-pupylation were assessed.”

      (3) Line 156: The statement that "the TS-tag completely abolished polypupylation in TS-sPup" is inaccurate. Using TSK8R-sPupK61R as the substrate, several bands appear, which likely represent Halo-PafA with varying degrees of polypupylation. Some bands also appear to correspond to those seen when using TS-sPup as a substrate. The authors should clarify how they distinguish between multipupylation and polypupylation in this case.

      We sincerely appreciate your insight into clarifying the distinction between multipupylation and polypupylation. Polypupylation refers to the addition of a new Pup onto a previously linked Pup on the target protein, akin to polyubiquitination. In contrast, multipupylation involves multiple single pupylations at different positions on the target proteins. Since pupylation occurs exclusively at lysine residues in tag-Pup substrates, mutating all lysine residues to arginine, as in TSK48R-sPupK61R, prevents the mutant tag-Pup from linking to another Pup. This means that only single pupylation can proceed with this type of mutant Pup substrate. If multiple pupylated bands are observed with this mutant substrate, it indicates “multipupylation” rather than “polypupylation”, as shown in Figure 1-figure supplement 2D. The same applies to the pupylation bands in Figure 1-figure supplement 2E and F, as sSBP-sPupK61R and SBPK4R-sPupK61R lack lysine residues. By comparing these multipupylation bands, it is also possible to distinguish them from polypupylation bands, which are marked by yellow arrows. However, after 2-3 pupylation bands, higher-order bands become increasingly difficult to distinguish.

      To clarify the mutation in the TS-tag, we revised the sentence in line 156 from “However, further mutations within the TS-tag completely abolished polypupylation in TS-sPup” to “However, further mutations of two lysine residues within the TS-tag, creating TSK8R-sPupK61R, completely abolished polypupylation in TS-sPup”. Additionally, we have inserted sentences in line 152 to define polypupylation and multipupylation, as described here.

      (4) Line 160: Similar to the above concern about line 156, the claim that SBPK4R and sSBP completely prevented polypupylation is unconvincing and requires more supporting evidence.

      Thank you for raising this concern. As mentioned above, both SBPK4R and sSBP lack lysine residues required for pupylation. As a result, these mutants can only undergo multiple single pupylations on the lysine residues of the target protein, which leads to “multipupylation”. In Figure 1-figure supplement 2E and F, pupylation bands by sSBP-sPupK61R or SBPK4R-sPupK61R do not display doublet bands (one from multipupylation and the other from polypupylation), as seen with SBP-sPup, marked by yellow arrows. Notably, Halo-PafA containing polypupylated branches migrates more slowly than one with an equal number of multipupylation events. To clarify this point, we have added the phrase “as shown in sSBP-sPupK61R and SBP4KR-sPupK61R” at the end of the sentence in line 160.

      (5) Lines 176-177: The authors claim that PafAS126A exhibited reduced polypupylation compared to PafA, but given that PafAS126A may reduce depupylase activity, how could it reduce polypupylation levels? Moreover, it is hard to find any data supporting this conclusion in Figure 1 - Figure Supplement 3B.

      We appreciate your insightful comment. At this point, we do not fully understand how the mutation that reduces depupylase activity also decreases polypupylation. It is possible that PafAS126A has a lower preference for pupylated Pup as a prey, which is required for polypupylation, since depupylase activity depends on recognizing pupylated Pup as a prey to remove it. Nonetheless, Halo-PafAS126A shows reduced levels of higher molecular weight bands compared to Halo-PafA, as shown in Figure 1-figure supplement 3B, while exhibiting increased pupylation in lower molecular weight bands, which represent either multipupylation or low-degree polypupylation. Since higher molecular weight bands (> 150 kD) are likely due to polypupylation, this result suggests reduced polypupylation and increased multipupylation in Halo-PafAS126A. To clarify this in the main text, we have added the following description in line 177: “as evidenced by the decreased levels of high molecular weight bands and an increase in low molecular weight bands”

      (6) POST-IT system in cellulo validation: The system was developed using the Halo-tag, yet the in-cell validation uses FRB and FKBP instead, without explaining this switch. This inconsistency makes the logic of the experiment unclear.

      We appreciate your insightful comment. The interaction between rapamycin and FRB or FKBP is known to be highly specific and robust, making this system useful in various biological contexts. Due to this property, rapamycin can induce interaction between two proteins when one is fused with FRB and the other with FKBP. Before testing or optimizing the POST-IT system in cells, we hypothesized that using the rapamycin-induced interaction between FRB and FKBP could introduce pupylation of the target protein, provided that PafA is fused with FRB or FKBP and the target protein is fused with the other. The results demonstrate that PafA can introduce pupylation of the target protein in a proximity-dependent manner via this chemically induced interaction. To further clarify this in the main text, we modified the original sentence in lines 214-216 as follows: “To mimic drug-target interaction-induced pupylation in live cells and assess the potential of PafA as a proximity-tagging system for target-ID, we incorporated the rapamycin-induced interaction between FRB and FKBP into our PL system, as this interaction between a small molecule and a protein is known to be highly specific and robust (Figure 3—figure supplement 1A).”

      (7) Line 209: The authors decided to use the SBP-tag for further studies due to better performance, but in Figure 3 - Figure supplement 1, they still used the unintroduced HB-Pup as the substrate, which is confusing and lacks explanation.

      Thank you for raising your question. The SBP-tag is not superior to the TS-tag in terms of pupylation activity. However, the TSK8R mutant cannot bind to Strep-Tactin beads, while the SBP mutants, SBPK4R and sSBP, can bind to streptavidin. Therefore, we chose the SBP-tag instead of the TS-tag for further studies as a Pup substrate in POST-IT system, as we needed to pull down the target proteins. HB-Pup is consistently used as a control throughout various experiments, as it is the original Pup substrate. In Figure 3-figure supplement 1B and C, HB-Pup was used to test chemically induced pupylation by PafA. In these cases, it was not so critical which Pup substrate was chosen. Furthermore, we compared HB-Pup and different SBP-sPup substrates in Figure 3-figure supplement 1D, where HB-Pup was used as a control or for comparison. Although pupylation bands with HB-Pup appear more robust, this substrate contains multiple lysine residues, leading to high levels of polypupylation. To make it clear, we modified the sentence in line 209 to “Therefore, we decided to use the SBP-tag as a Pup substrate in the POST-IT system for further studies.”.

      (8) Line 220: Both SBP-sPup and SBPK4R-sPupK61R are described as exhibiting efficient pupylation, but the data show mostly self-pupylation and little to no pupylation of the target protein.

      Thank you for your concern. However, pupylation of the target protein is actually quite substantial, as the intensities of the free form and pupylated proteins are relatively similar, as shown in the upper panel of Figure 3-figure supplement 1D. Self-pupylation is always much higher than target pupylation, because PafA constantly pupylates itself, whereas pupylation of the target protein occurs only through interaction. Furthermore, V5-FRB-mKate2-PafA contains many lysine residues, which increases the levels of self-pupylation.

      (9) Lines 222-224: The authors chose SBPK4R-sPupK61R to avoid polypupylation, although SBP-sPup did not cause detectable polypupylation. Neither substrate caused pupylation of the target protein, so the rationale behind this choice is unclear.

      Thank you for raising your question. Similar to the above comment (#8), please refer to the pupylation bands of the target protein, as shown in the upper panel of Figure 3-figure supplement 1D. The pupylation band of the target protein is quite remarkable, as the intensities of the free form and pupylated proteins are comparable. Additionally, there are no multiple pupylation bands in either case, except for one additional weak multipupylation band, indicating no polypupylation by SBP-sPup, which does not have K-to-R mutations. Of course, SBPK4R-sPupK61R can only undergo single pupylation, as it does not contain lysine residues. Although we did not observe polypupylation by SBP-sPup in this experimental condition, it is possible that SBP-sPup may cause polypupylation under different experimental conditions or with other target proteins. Since SBPK4R-sPupK61R exhibits comparable pupylation of the target protein at least in this experiment setting as SBP-sPup, we selected SBPK4R-sPupK61R as the Pup substrate for POST-IT system to avoid any potential polypupylation that could be caused by SBP-sPup in other cases. We believe that polypupylation can introduce bias into the analysis and hinder the comprehensive discovery of additional target proteins for small molecules.

      (10) Line 224: The authors conclude that rapamycin greatly reduced self-pupylation, but the supporting data are unclear.

      Thank you for your constructive comments on our manuscript. Please refer to the lower panel of Figure 3-figure supplement 1D. When using either SBPK4R-sPupK61R or SBP-sPup, rapamycin treatment results in reduced levels of self-pupylation compared to the no-treatment control. However, we did not observe this reduction with HB-Pup and do not know the reason. To clarify this in the main text, we added the following description to the end of the sentence: “when using either SBPK4R-sPupK61R or SBP-sPup, as shown in the lower panel of Figure 3—figure supplement 1D”

      (11) Line 234: The authors selected an 18-amino acid linker, but given that linkers longer than 10 amino acids enhance labeling, this choice should be explained.

      Thank you for raising your question. In fact, a linker of 10 amino acids (aa) or longer is likely to behave similarly. We chose an 18 aa linker instead of a 40 aa linker primarily for the convenience of cloning and to reduce the potential for DNA sequence recombination associated with longer repeats. Additionally, a longer, flexible linker may behave like an intrinsically disordered protein (Harmon et al., 2017), which can lead to unwanted protein-protein interactions or phase separation. To elaborate on this, we added the following sentences after the sentence in line 233-235: “We chose the 18-amino acid linker instead of the 40-amino acid linker for easier cloning and to lower the risk of DNA recombination from longer repeats. Additionally, a longer, flexible linker may behave like an intrinsically disordered protein (Harmon et al., 2017), an unwanted feature for target-ID.”

      (12) S126A and K172R mutations: The authors claim that these mutations additively enhanced pupylation under cellular conditions, but in Figure 3B, the band intensities appear similar for the wild-type and mutant versions.

      Thank you for raising your concern. Although a single pupylation band appears similar among the three different Halo-PafA proteins, multipupylation bands are slightly but noticeably increased by the S126A and K172R mutations compared to Halo8KR-PafA. Since we used SBPK4R-sPupK61R as a Pup substrate, all higher molecular weight bands result from multipupylation rather than polypupylation. This illustrates why it is preferable to use SBPK4R-sPupK61R over SBP-sPup, as the pupylation bands with SBP-sPup are mixtures of poly- and multipupylation, making it difficult to assess levels of target labeling. To clarify this in the main text, we added the following description after the sentence in line 236: “as the higher molecular weight multipupylation bands are slightly but noticeably increased with these mutations compared to Halo8KR-PafA”

      (13) Line 263: The authors selected DH5 for further experiments due to its efficiency, but the data suggest that the performance of DH1 to DH5 is similar.

      We appreciate your question about the different dasatinib HTL derivatives. However, our data clearly show that DH2-5 derivatives bind significantly more effectively to Halo-PafA in vitro and in live cells compared to DH1 (Figure 4A and B). Additionally, the DH2-5 derivatives result in dramatically increased pupylation of the target protein in vitro and noticeable enhancement in live cells (Figure 4C and D). Among DH2 to DH5, there is no obvious difference in binding to Halo-PafA or pupylation of the target protein. Therefore, we chose DH5, as we believe that the longer linker in DH5 may facilitate the binding of a more diverse range of target proteins to dasatinib, enabling the discovery of additional target proteins.

      (14) Line 309: The authors introduce HCQ and CQ as important drugs but then investigate the mechanism using DC661 without introducing or justifying the choice of this compound.

      Thank you for your point. We explained the reason to choose DC661, a dimer form of CQ, instead of CQ for the synthesis of an HTL derivative in line 310. “assuming that a dimer would enhance binding affinity as previously described.” As the dimer forms of a drug or a small molecule such as testosterone dimers, estrogen dimers, and numerous anticancer drug dimers have been often developed to enhance drug effects (Paquin A et., Molecules 2021). Similarly, dimer forms of HCQ/CQ have been introduced and shown to be more potent (Hrycyna CA et al., ACS Chem Biol 2014; Rebecca VW et al., Cancer Discovery 2019). We expected that using a dimer form might offer higher probability to identify target proteins for HCQ/CQ.

      (15) The authors suggest that multipupylation levels were enhanced but do not explain whether this might benefit the system or introduce other issues. Clarifying this point would provide valuable insight for potential users of this system.

      Thank you for your thoughtful suggestion. Polypupylation likely leads to biased enrichment of a limited set of target proteins, and its levels may not correlate with the binding affinity of target proteins to the small molecule of interest, features that can negatively impact target-ID. In contrast, multipupylation may be correlated with binding affinity or interaction frequency, as we observed increased levels of multipupylation with higher Pup concentrations and longer incubation times. This suggests that target proteins with multiple lysines in proximity to PafA can be sequentially pupylated, starting with the most accessible lysine. However, if a target protein has only one accessible lysine, pupylation will occur only once, regardless of the protein’s affinity to the small molecule. In summary, while polypupylation may be a drawback for target-ID, multipupylation could be useful for both target-ID and understanding binding mode. To elaborate on this, we added the following additional explanation after the sentence in line 152: “, whereas multipupylation is more likely correlated with binding affinity or interaction frequency.”

      (16) The author should address whether the Halotag ligand modification of the drug alters the binding properties between the drug and targets. That may be causing artifact binding of the drug and other proteins.

      Thank you for your insightful comment. Yes, it is true that chemical modifications of the small molecule of interest, such as linker derivatization (e.g., HTL) or photo-affinity labeling, generally lead to reduced activity or affinity compared to the original molecule. Synthesizing a derivative is a common challenge across all target-ID methods, except for modification-free approaches, as we mentioned in the Discussion. However, modification-free methods like DARTS, CETSA, and TPP have their own limitations, including low sensitivity or high false positive rates. Identifying the optimal position for chemical modification on the small molecule of interest is critical. We chose dasatinib and HCQ/CQ as model compounds, because previous studies provided insights into their derivative synthesis. In addition, our data show that DH5 retains robust kinase inhibitory activity (Figure 4-figure supplement 2), and DC661-H1 exhibits potent autophagy inhibition (Figure 6-figure supplement 1). For novel compounds, a thorough structure-activity relationship study is essential to identify the optimal position for HTL derivative synthesis.

      (17) The author stated there is no observable toxicity in zebrafish without providing a detailed analysis or enough data. Further analysis of the expression of Halo-PafA and its substrate sPup influence on toxicity or side effects to the living cells or animals would be needed. It is important for in vivo applications.

      Thank you for your constructive suggestion. We have now included additional experimental data in Figure 7-figure supplement 1, showing no toxicity in zebrafish embryos expressing the POST-IT system. We assessed toxicity in two ways: by injecting the POST-IT DNA plasmid into one-cell-stage embryos for acute expression, and by using embryos from transgenic zebrafish expressing POST-IT under a heat-shock inducible promoter. Neither the injection nor the heat-shock activation of POST-IT expression resulted in any noticeable toxicity.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Reviewer #1 (Public Review):

      This study provides compelling evidence that RAR, rather than its obligate dimerization partner RXR, is functionally limiting for chromatin binding. This manuscript provides a paradigm for how to dissect the complicated regulatory networks formed by dimerizing transcription factor families.

      Dahal and colleagues use advanced SMT techniques to revisit the role of RXR in DNA-binding of the type-2 nuclear receptor (T2NR) RAR. The dominant consensus model for regulated DNA binding of T2NRs posits that they compete for a limited pool of RXR to form an obligate T2NR-RXR dimer. Using advanced SMT and proximity-assisted photoactivation technologies, Dahal et al. now test the effect of manipulating the endogenous pool size of RAR and RXR on heterodimerization and DNA-binding in live U2OS cells. Surprisingly, it turns out that RAR, rather than RXR, is functionally limiting for heterodimerization and chromatin binding. By inference, the relative pool size of various T2NRs expressed in a given cell, rather than RXR, is likely to determine chromatin binding and transcriptional output.

      The conclusions of this study are well supported by the experimental results and provide unexpected novel insights into the functioning of the clinically important class of T2NR TFs. Moreover, the presented results show how the use of novel technologies can put long-standing theories on how transcription factors work upside down. This manuscript provides a paradigm for how to further dissect the complicated regulatory networks formed by T2NRs or other dimerizing TFs. I found this to be a complete story that does not require additional experimental work. However, I do have some suggestions for the authors to consider.

      Reviewer #1 (Recommendations For The Authors):

      (1) Does the increased chromatin binding measured when the RAR levels are increased reflect a higher occupancy of a similar set of loci, or are additional loci bound? The authors could discuss this issue in the context of the published literature. Obviously, this could be addressed experimentally by ChIP-seq or a similar analysis, but this would extend beyond the main topic of this manuscript.

      We attempted to explore this experimentally using ChIP-seq with multiple RAR- and RXR-specific antibodies. Unfortunately, our results were inconclusive, as the antibody enrichment relative to the IgG control was insufficient for reliable interpretation. Specifically, our ChIP-seq enrichment levels were only around 1.5fold, while the accepted standard for meaningful ChIP enrichment is typically at least 2-fold. Due to these technical limitations, we decided to defer these experiments for now.

      However, we agree with the reviewer that understanding whether the increased chromatin binding of RAR reflects higher occupancy at the same set of loci or binding to additional loci is a key question. In similar experiments involving the transcription factor TFEB (Esbin et al., 2024, Genes Dev, doi: 10.1101/gad.351633.124) where an increase in the SMT bound fraction occurred, both scenarios—higher occupancy at known loci and binding to additional loci in ChIP-seq was observed. So, addressing this intriguing possibility in future studies focused on RAR and RXR would be interesting.

      (2) The results presented suggest convincingly that endogenous RXR is normally in excess to its binding partners (in U2OS cells). This point could be strengthened further by reducing RXR levels, e.g., by knocking out 1 allele or the use of shRNAs (although the latter method might be too hard to control). Overexpression of another T2NR might also help determine the buffer capacity of RXR.

      We appreciate the reviewers’ acknowledgment that our results convincingly demonstrate that endogenous RXR is typically in excess relative to its binding partners in U2OS cells. We agree that this conclusion could be further reinforced by experiments such as overexpression of another T2NR to test RXR's buffering capacity. We are actively pursuing follow-up experiments involving overexpression of additional T2NRs to address this question in more detail. These studies are ongoing, and we plan to explore the buffer capacity of RXR more extensively in a future manuscript.

      (3) The ~10% difference in fbound of RAR and RXR (in Figs 1 and 2), while they should be 1:1 dimers, is explained by invoking the expression of RXR isoforms. Can the authors be more specific concerning the nature of these isoforms?

      We have provided detailed information about different T2NRs expressed in U2OS cells according to the Expression Atlas and the Human Protein Atlas Database in Supplementary Table S1. Table S1 specifically shows that both isoforms of RXRα and RXRβ are expressed in U2OS cells. Additionally, the caption of Table S1 explicitly notes the presence of isoform RXRβ in U2OS cells. In the main text, we reference Table S1 when discussing the 10% difference in fbound between RARα and RXRα, and we have now suggested that the expression of RXRβ likely accounts for the observed discrepancy.

      Reviewer #2 (Public Review):

      Summary:

      In the manuscript "Surprising Features of Nuclear Receptor Interaction Networks Revealed by Live Cell Single Molecule Imaging", Dahal et al combine fast single molecule tracking (SMT) with proximity-assisted photoactivation (PAPA) to study the interaction between RARa and RXRa. The prevalent model in the nuclear receptor field suggests that type II nuclear receptors compete for a limiting pool of their partner RXRa. Contrary to this, the authors find that over-expression of RARa but not RXRa increases the fraction of RXRa molecules bound to chromatin, which leads them to conclude that the limiting factor is the abundance of RARa and not RXRa. The authors also perform experiments with a known RARa agonist, all trans retinoic acid (atRA) which has little effect on the bound fraction. Using PAPA, they show that chromatin binding increases upon dimerization of RARa and RXRa.

      Strengths:

      In my view, the biggest strength of this study is the use of endogenously tagged RARa and RXRa cell lines. As the authors point out, most previous studies used either in vitro assays or over-expression. I commend the authors on the generation of single-cell clones of knock-in RARa-Halo and Halo-RXRa. The authors then carefully measure the abundance of each protein using FACS, which is very helpful when comparing across conditions. The manuscript is generally well written and figures are easy to follow. The consistent color-scheme used throughout the manuscript is very helpful.

      Weaknesses:

      (1) Agonist treatment:

      The authors test the effect of all trans retinoic acid (atRA) on the bound fraction of RARa and RXRa and find that "These results are consistent with the classic model in which dimerization and chromatin binding of T2NRs are ligand independent." However, all the agonist treatments are done in media containing FBS. FBS is not chemically defined and has been found to have between 10 and 50 nM atRA (see references in PMID 32359651 for example). The addition of 1 nM or 100 nM atRA is unlikely to result in a strong effect since the medium already contains comparable or higher levels of agonist. To test their hypothesis of ligand-independent dimerization, the authors should deplete the media of atRA by growing the cells in a medium containing charcoal-stripped FBS for at least 24 hours before adding agonist.

      We acknowledge the reviewer's concern regarding the presence of atRA in FBS and agree that it may introduce baseline levels of agonist. However, in our experiments, both the 1 nM and 100 nM atRA treatments resulted in observable changes in RAR expression levels (Figure S3C). Additionally, the luciferase assays demonstrated that 100 nM atRA significantly increased retinoic acid-responsive promoter activity (Figure S1C). Given these clear responses to atRA, we believe the observed lack of effect on the chromatin-bound fraction cannot be attributed to the presence of comparable or higher levels of atRA in the FBS, as the reviewer suggests. Moreover, since our results align with the established literature and do not impact the core findings of our study, we decided not to pursue the suggested experiments with charcoal-stripped FBS in this manuscript.  

      (2) Photobleaching and its effect on bound fraction measurements:

      The authors discard the first 500 to 1000 frames due to the high localization density in the initial frames. This will preferentially discard bound molecules that will bleach in the initial frames of the movie and lead to an over-estimation of the unbound fraction.

      For experiments with over-expression of RAR-Halo and Halo-RXR, the authors state that the cells were pre-bleached and that these frames were used to calculate the mean intensity of the nuclei. When pre-bleaching, bound molecules will preferentially bleach before the diffusing population. This will again lead to an over-representation of the unbound fraction since this is the population that will remain relatively unaffected by the pre-bleaching. Indeed, the bound fraction for over-expressed RARa and RXRa is significantly lower than that for the corresponding knock in lines. To confirm whether this is a biological result, I suggest that the authors either reduce the amount of dye they use so that this pre-bleaching is not necessary or use the direct reactivation strategy they use for their PAPA experiments to eliminate the pre-bleaching step.

      As for the measurement of the nuclear intensity, since the authors have access to multiple HaloTag dyes, they can saturate the HaloTagged proteins with a high concentration of JF646 or JFX650 to measure the mean intensity of the protein while still using the PA-JFX549 for SMT. Together, these will eliminate the need to prebleach or discard any frames.

      The Janelia Fluor dyes used in our experiments are known for their high photostability (Grimm et al., 2021, JACS Au, doi: 10.1021/jacsau.1c00006). During the initial 80 ms imaging to calculate the mean nuclear intensity, the laser power was kept at very low intensity (~3%) for a brief duration (~10 seconds), in contrast to the high-intensity (~100%) used during the tracking experiments, which span around 3 minutes. This low-power illumination does not induce significant photobleaching but merely puts the dyes in a temporary dark state. Therefore, this pre-bleaching step closely resembles the direct reactivation strategy employed in our PAPA experiments.

      To further address the reviewer's concern, we performed a frame cut-off analysis for our SMT movies of endogenous RARα-Halo and over-expressed RARα-Halo (Figure S9B). The analysis shows no significant change in the bound fraction of either endogenous or over-expressed RARα-Halo when discarding the initial 1000 frames. Based on these results, we conclude that the pre-bleaching does not lead to an overestimation of the unbound fraction, and that our experimental approach is robust.

      (3) Heterogeneous expression of the SNAP fusion proteins:

      The cell lines expressing SNAP tagged transgenes shown in Fig S6 have very heterogeneous expression of the SNAP proteins. While the bulk measurements done by Western blotting are useful, while doing single-cell experiments (especially with small numbers - ~20 - of cells), it is important to control for expression levels. Since these transgenic stable lines were not FACS sorted, it would be helpful for the reader to know the spread in the distribution of mean intensities of the SNAP proteins for the cells that the SMT data are presented for. This step is crucial while claiming the absence of an effect upon over-expression and can easily be done with a SNAPTag ligand such as SF650 using the procedure outlined for the over-expressed HaloTag proteins.

      We agree with the reviewer that there is heterogeneity in SNAP protein expression across the transgenic lines. In response to the reviewer’s suggestion, we performed the proposed experiment to assess the distribution of mean intensities for two key experimental conditions: Halo-RXRα with overexpressed RARα-SNAP and HaloRXRα with overexpressed RARαRR-SNAP. These results again confirm that the increase in chromatin-bound fraction of Halo-RXRα is observed only in the presence of RARα capable of heterodimerizing with RXRα, supporting our main conclusion (Figure S9).

      For these experiments, we followed the same labelling procedure described in the methods section for tracking endogenous Halo-tagged proteins alongside transgenic SNAP proteins. As shown in Figure S9, for ~ 70 cell nuclei, the distribution of mean intensities is similar for both conditions, with the bound fraction of Halo-RXRα significantly increasing in the presence of RARα-SNAP compared to RARαRR-SNAP. This analysis underscores that the observed effects are indeed due to the functional differences between the two RARα variants rather than variability in expression levels.

      (4) Definition of bound molecules:

      The authors state that molecules with a diffusion coefficient less than 0.15 um2/s are considered bound and those between 1-15 um2/s are considered unbound. Clarification is needed on how this threshold was determined. In previous publications using saSPT, the authors have used a cutoff of 0.1 um2/s (for example, PMID 36066004, 36322456). Do the results rely on a specific cutoff? A diffusion coefficient by itself is only a useful measure of normal diffusion. Bound molecules are unlikely to be undergoing Brownian motion, but the state array method implemented here does not seem to account for non-normal diffusive modes. How valid is this assumption here?

      We acknowledge the inconsistency in the diffusion coefficient thresholds for defining the chromatin-bound fraction used across our group’s publications. The choice of threshold or cutoff (0.1 µm²/s vs 0.15 µm²/s) is largely arbitrary and does not significantly impact the results. To validate this, we tested the effect of different cutoffs on fbound (%) for endogenously expressed Halo-tagged RARα and RXRα (Figure S10). As shown in Figure S10, there was no substantial difference in fbound (%) calculated using a 0.1 µm²/s versus 0.15 µm²/s cutoff (e.g., RARα clone c156: 47±1% vs 49±1%; RXRα clone D6: 34±1% vs 35±1%). 

      Since we have consistently applied the 0.15 µm²/s cutoff throughout this manuscript across all experimental conditions, the comparative analysis of fbound (%) remains valid. While we agree that a Brownian diffusion model may not fully capture the motion of bound molecules, our state array model accounts for localization error, which likely incorporates some of the chromatin motion features. Moreover, the distinction between bound (<0.15 µm²/s) and unbound (1-15 µm²/s) populations is sufficiently large that using a normal diffusion model is reasonable for our analysis.

      (5) Movies:

      Since this is an imaging manuscript, I request the authors to provide representative movies for all the presented conditions. This is an essential component for a reader to evaluate the data and for them to benchmark their own images if they are to try to reproduce these findings.

      We have now included representative movies for all the SMT experimental conditions presented in the manuscript. Please see data availability section of the manuscript.

      (6) Definition of an ROI:

      The authors state that "ROI of random size but with maximum possible area was selected to fit into the interior of the nuclei" while imaging. However, the readout speed of the Andor iXon Ultra 897 depends on the size of the defined ROI. If the ROI was variable for every movie, how do the authors ensure the same sampling rate?

      We used the frame transfer mode on the Andor iXon Ultra 897 camera for our acquisitions, which allows for fast frame rate measurements without altering the exposure time between frames. Additionally, we verified the metadata of all our movies to ensure a consistent frame interval of 7.4 ms across all conditions. This confirms that the sampling rate was maintained uniformly, despite the variability in ROI size. 

      Reviewer #2 (Recommendations For The Authors):

      (1) 'Hoechst' is mis-spelled.

      We have now corrected this typo in the manuscript.

      (2) Cos7 appears in several places throughout the text. I assume this is a typo. If so, please correct it. If not, please explain if some experiments were done in Cos7 cells and kindly provide a justification for that.

      The use of Cos7 cells is intentional and not a typo. Cos7 cells have been previously utilized in studies investigating the interaction between T2NRs (Kliewer et al., 1992, Nature, doi: 10.1038/355446a0). In our study, due to technical issues with antibodies for coIP in U2OS cells, we initially used Cos7 cells for control experiments to verify that Halo-tagging of RARα and RXRα did not disrupt their interaction, by transiently expressing the constructs in Cos7 cells. Following these control experiments, we confirmed the direct interaction of endogenously expressed RAR and RXR in U2OS cells with their respective binding partners using the SMT-PAPA assay. Since these results confirmed that Halo-tagging did not interfere with RAR-RXR interactions, we chose not to repeat the coIP experiments in U2OS cells.

      Reviewer #3 (Public Review):

      Summary:

      This study aims to investigate the stoichiometric effect between core factors and partners forming the heterodimeric transcription factor network in living cells at endogenous expression levels. Using state-of-the-art single-molecule analysis techniques, the authors tracked individual RARα and RXRα molecules labeled by HALO-tag knock-in. They discovered an asymmetric response to the overexpression of counter-partners. Specifically, the fact that an increase in RARα did not lead to an increase in RXRα chromatin binding is incompatible with the previous competitive core model. Furthermore, by using a technique that visualizes only molecules proximal to partners, they directly linked transcription factor heterodimerization to chromatin binding.

      Strengths:

      The carefully designed experiments, from knock-in cell constructions to singlemolecule imaging analysis, strengthen the evidence of the stoichiometric perturbation response of endogenous proteins. The novel finding that RXR, previously thought to be a target of competition among partners, is in excess provides new insight into key factors in dimerization network regulation. By combining the cutting-edge single-molecule imaging analysis with the technique for detecting interactions developed by the authors' group, they have directly illustrated the relationship between the physical interactions of dimeric transcription factors and chromatin binding. This has enabled interaction analysis in live cells that was challenging in single-molecule imaging, proving it is a powerful tool for studying endogenous proteins.

      Weaknesses:

      As the authors have mentioned, they have not investigated the effects of other T2NRs or RXR isoforms. These invisible factors leave room for interpretation regarding the origin of chromatin binding of endogenous proteins (Recommendations 4). In the PAPA experiments, overexpressed factors are visualized, but changes in chromatin binding of endogenous proteins due to interactions with the overexpressed proteins have not been investigated. This might be tested by reversing the fluorescent ligands for the Sender and Receiver. Additionally, the PAPA experiments are likely to be strengthened by control experiments (Recommendations 5).

      We agree that this would be an interesting experiment. However, there are three technical challenges that complicate its implementation: First, as demonstrated in our original PAPA paper, dark state formation is less efficient when dyes are conjugated to Halo compared to SNAPf, making the reverse configuration less optimal. Second, SNAPf-tagged proteins have slower labeling kinetics than Halotagged proteins, often resulting in under-labeling of SNAPf. Third, our SNAPf transgenes were integrated polyclonally. Since background PAPA scales with the concentration of the sender-labeled protein, variable concentrations of the senderlabeled SNAPf proteins would introduce significant variability, complicating the interpretation of the background PAPA signal. Due to these concerns, we believe that performing reciprocal measurements with reversed fluorescent ligands may not yield reliable results. 

      Reviewer #3 (Recommendations For The Authors):

      (1) The term "Surprising features" in the title is ambiguous and may force readers to search for what it specifically refers to. Including a word that evokes specific features might be helpful.

      Our findings contradict previous work, which suggested that chromatin binding of T2NRs is regulated by competition for a limited pool of RXR. In contrast, we found that RAR expression can limit RXR chromatin binding, but not the other way around, which challenges the existing model. This unexpected result is what we refer to as a "surprising feature" in our title, and we believe it accurately reflects the novel insights our study provides. We also think that this is clearly conveyed in our manuscript abstract, supporting the use of "Surprising features" in the title. 

      (2) p.3, line 11 - The threshold of 0.15 μm2s-1 seems to be a crucial value directly linked to the value of fbound. What is the rationale for choosing this specific value? If consistent conclusions can be obtained using threshold values that are similar but different, it would strengthen the robustness of the results.

      Please refer to our response to Reviewer #2’s Public Review point 4. The threshold choice is arbitrary and doesn’t affect the overall conclusions. To test this, we compared fbound (%) values calculated using both 0.1 μm²s-1 and 0.15 μm²s-1 cutoffs. For example, with endogenously expressed Halo-tagged RARα (clone c156), we observed fbound values of 47±1% vs 49±1%, and for RXRα (clone D6), 34±1% vs 35±1%, respectively (Figure S10). Since we have consistently applied the 0.15 μm²s-1 cutoff across all experimental conditions in this manuscript, the comparisons of fbound (%) between different conditions are robust and valid.

      (3) p.4, line 13 - "the fbound of endogenous RARα-Halo (47{plus minus}1%) was largely unchanged upon expression of SNAP (47{plus minus}1%)" part of the sentence is not surprising. It would make more sense if it were expressed as "the fbound of endogenous RARα-Halo (47{plus minus}1%) was largely unchanged upon expression of RXRα-SNAP (49{plus minus}1%), consistent with the control SNAP (47{plus minus}1%).".

      We understand how the original phrasing may be confusing to the readers and have restructured the sentence as suggested by the reviewer for clarity.

      (4) p.6, line 26 - The discussion that "most chromatin binding of endogenous RXRα in U2OS cells depends on heterodimerization partners other than RARα" seems to contradict the top right figure in Figure 4. If that's the case, the binding partner for the bound red molecule might be yellow rather than blue. Given a decrease in the number of RARα molecules with an unchanged binding ratio, the total number of binding molecules has decreased. Could it be interpreted that the potential reduction in RXRα chromatin binding, accompanying the decrease in binding RARα, is compensated for by other partners?

      We agree with the reviewer that both the yellow and blue molecules in Figure 4 represent T2NRs that can heterodimerize with RXR. For simplicity, we chose to omit the depiction of RXR dimerization with other T2NRs (represented in yellow) in Figure 4. We have now included a note in the figure caption to clarify this. We plan to follow up on the buffer capacity of RXR with other T2NRs in a separate manuscript and will discuss this aspect in more detail once we have data from those experiments.

      (5) Fig. 3 - I expected that DR localizations always appear more frequently than PAPA localizations by the difference in the number of distal molecules. Why does the linear line for SNAP-RXRα in Fig. 3 B have a slope exceeding 1? Also, although the sublinearity is attributed to binding saturation, is there any possibility that this sublinearity originates from the PAPA system like the saturation of PAPA reactivation? Control samples like Halo-SNAPf-3xNLS might address these concerns.

      The number of DR and PAPA localizations depends on the arbitrarily chosen intensity and duration of green and violet light pulses. For any given protein pair, different experimental settings can result in PAPA localizations being greater than, less than, or equal to the number of DR localizations. Therefore, the informative metric is not the absolute number of DR and PAPA localizations, but rather how the ratio of PAPA to DR localizations changes between different conditions—such as between interacting pairs and non-interacting controls.

      Regarding the sublinearity, we agree that it is essential to consider whether the observed sublinearity might stem from saturation of the PAPA signal. We know of two ways in which this could occur:

      First, PAPA can be saturated as the duration of the green light pulse increases and dark-state complexes are depleted. However, this cannot explain the nonlinearity that we observe, because the duration of the green light pulse is constant, and thus the probability that a given complex is reactivated by PAPA is also constant. Likewise, holding the violet pulse duration constant yields a constant probability that a given molecule is reactivated by DR. PAPA localizations are expected to scale linearly with the number of complexes, while DR localizations are expected to scale linearly with the total number of molecules. Sublinear scaling of PAPA localizations with DR localizations thus implies that the number of complexes scales sublinearly with the total concentration of the protein.

      Second, saturation could occur if PAPA localizations are undercounted compared to DR localizations. While this is a valid concern, we consider it unlikely in this case because 1) our localization density is below the level at which our tracking algorithm typically undercounts localizations, and 2) we observe sublinearity for RXR → RAR PAPA even though the number of PAPA localizations is lower than the DR localizations; undercounting due to excessive localization density would be expected to introduce the opposite bias in this case.

      (6) Fig. 4 - The differences between A, B, and C on the right side of the model are subtle, making it difficult to discern where to see. Emphasizing the difference in molecule numbers or grouping free molecules at the top might help clarify these distinctions.

      We appreciate the reviewer’s feedback. In response, we have revised Figure 4 by grouping the free molecules on the top right side for panels A, B and C, as suggested.

      (7) While the main results are obtained through single-molecule imaging, no singlemolecule fluorescence images or trajectory plots are provided. Even just for representative conditions, these could serve as a guide for readers trying to reproduce the experiments with different custom-build microscope setups. Also, considering data availability, depositing the source data might be necessary, at least for the diffusion spectra.

      We have now included representative movies for all the presented SMT conditions as source data. Please see data availability section of the manuscript.

      (8) Tick lines are not visible on many of the graph axes. 

      We have revised the figures to ensure that the tick lines are now clearly visible on all graph axes.

      (9) Inconsistencies in the formatting are present in the methods, such as "hrs" vs. "hours", spacing between numbers and units, and "MgCl2". "u" should be "μ" and "x" should be "×". 

      We have corrected the formatting errors.

      (10) Table S4, rows 16 and 17 - Are "RAR"s typos for "RXR"s? 

      We have corrected this in the manuscript.

      (11) p.10~12 - Are three "Hoestch"s typos for "Hoechst"s? 

      This is now corrected in the manuscript.

      (12) p.11, line 17 - According to the referenced paper, the abbreviation should be "HILO" in all capital letters, not "HiLO". 

      This is now corrected in the manuscript.

      (13) "%" on p.3, line 18, and "." on p.6, line 27 are missing. 

      This missing “%”  and “.” are now added.

    2. Reviewer #3 (Public review):

      Summary:

      This study aims to investigate the stoichiometric effect between core factors and partners forming the heterodimeric transcription factor network in living cells at endogenous expression levels. Using state-of-the-art single-molecule analysis techniques, the authors tracked individual RARα and RXRα molecules labeled by HALO-tag knock-in. They discovered an asymmetric response to the overexpression of counter-partners. Specifically, the fact that an increase in RARα did not lead to an increase in RXRα chromatin binding is incompatible with the previous competitive core model. Furthermore, by using a technique that visualizes only molecules proximal to partners, they directly linked transcription factor heterodimerization to chromatin binding.

      Strengths:

      The carefully designed experiments, from knock-in cell constructions to single-molecule imaging analysis, strengthen the evidence of the stoichiometric perturbation response of endogenous proteins. The novel finding that RXR, previously thought to be a target of competition among partners, is in excess provides new insight into key factors in dimerization network regulation. By combining the cutting-edge single-molecule imaging analysis with the technique for detecting interactions developed by the authors' group, they have directly illustrated the relationship between the physical interactions of dimeric transcription factors and chromatin binding. This has enabled interaction analysis in live cells that was challenging in single-molecule imaging, proving it is a powerful tool for studying endogenous proteins.

      Weaknesses:

      None noted.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Exploiting synthetic lethality based on functional correlations has the potential to significantly improve the survival of cancer patients by reducing resistance to targeted therapies and increasing anti-tumour efficacy when combined with other treatment modalities. Schreuder et al., aim to identifying novel vulnerabilities of patient-derived mutations that could improve patient stratification based on a specific genetic background. Precisely, they established a model system to perform a genome-wide CRISPR-Cas9 KO screen to identify genomic vulnerabilities of BRCA1 variants with reported hypomorphic phenotypes, namely BRCA1 R1699Q and BRCA1 I26A in engineered RPE1 hTERT cells with AID tag. Using this system the authors were able to confirm known synthetic lethal genes reported in literature (e.g. APEX2, PARP1, POLQ) comparing cells with acute BRCA loss and BRCA1 deficiency. Moreover, the screen identified two genes, CSA and GPX4 that were not previously described as synthetic lethal with BRCA1 loss. What is potentially interesting, but marginally explored, is the identification of a unique synthetic vulnerability of cells expressing BRCA1 R1699Q mutant and NDE1 gene encoding for a dynamic scaffold protein essential in neocortical neurogenesis and heterochromatin patterning by H4K20me3, whose loss of function results in nuclear architecture aberrations and DNA double-strand breaks (Chomiak et al., iScience 2022). Accordingly, cells ablated of NDE1 and expressing BRCA1 R1699Q mutant show less proliferation of cells expressing either BRCA1 WT or BRCA1-depleted. Furthermore, cells lacking NDE1 show increased genomic instability by means of increased micronuclei and anaphase bridges compared to BRCA1 proficient and BRCA1 R1699Q mutant.

      Major comments:

      1. The authors claim that cells expressing BRCA1-I26A are largely HR-proficient, based on a milder effect on Olaparib sensitivity compared to cells expressing BRCA1-R1699A (Fig. 1C). However, I26A mutant cells are defective in RAD51 IRIF (Fig. 1B), indicative of an HR defect. Recently it has been shown that BRCA1 RING mutations that do not impact BARD1 binding, including I26A, render BRCA1 unable to accumulate to DNA damage sites and unable to form RAD51 foci when such mutation is combined with mutations that disable RAP80-BRCA1 interaction (Sherker et al., 2021). How do the authors explain this discrepancy with the literature?
      2. The reduction in survival following CSA depletion in BRCA1-proficient vs. -deficient cells is only 20% (Figure 2 and S2B). In my opinion, such a minor difference is not supporting the notion of a SL interaction between BRCA1 and CSA. To substantiate CSA as synthetic lethal hit, I would recommend the authors comparing the effect of CSA loss to that of EXO1 or BLM loss, both genes recently identified by the same group as SL partners of BRCA1 using the same experimental screening set up (van de Kooij et al, 2024). Moreover, validation data for GPX4 is missing.
      3. Similar to the minor effect observed for CSA, DOT1L and OTUD5 depletions caused rather mild and/or divergent phenotypes between the two sgRNAs used (Figure 4B), rather arguing against robust SL interactions between those genes and BRCA1 deficiency that could be therapeutically exploited.
      4. To strengthen their conclusion in Figure 4C the authors should perform complementation experiments with NDE1 WT and, ideally, with NDE1 mutant(s). On a related note, are NDE1 knock-out cells expressing BRCA1-R1699A more sensitive to PARPi?
      5. Graphs shown in Fig. 1A-C, Fig. 4B, S2D, S3B, S3E and S3F are lacking proper statistical analysis of the differences. Some experiments have only been repeated twice (e.g. Figure 1C), precluding running statistical tests.

      Minor comments:

      1. The authors should include representative images for results shown in Fig.1 A-C
      2. The authors should add immunoblots for BRCA1 in Fig. S2C to indicate successful BRCA1 cDNA complementation in HCC1937 cells.
      3. Most numbers in the Venn diagram shown in Figure 3A cannot be read when printed.
      4. In the western blots shown in Supplemental Figure 1A, the electrophoretic mobility of BRCA1 variants expressed in RPE1 is quite variable. Could the authors indicate in the Figure (e.g. with arrowheads) which bands represent endogenous and which transgenic BRCA1. Moreover, in BRCA-wt complemented cells there are two bands following auxin/DOX addition, whereas there is one band observed in cells expressing BRCA1 hypomorphic variants
      5. Line 229 please correct "BRCA1-proficient" to "BRCA1-depleted".

      Significance

      General assessment:

      This manuscript starts with an attractive hypothesis, which is the generation of a cellular system to study patient-derived hypomorphic BRCA1 missense mutations rather than using BRCA1 knockout cells. Performing CRISPR/Cas9-mediated genome-wide synthetic lethal screens in this system allowed uncovering genetic vulnerabilities of cells expressing BRCA1-R1699A, a pathogenic mutant identified in several cancer patients. The data are of good quality and the manuscript is coherent and generally well written (few typos). However, some data describe mainly negative results (e.g. BRCA1-I26A mutant) or weak phenotypes while other more interesting aspects are not rigorously exploited (e.g. NDE1 SL) and therefore need to be interpreted with more caution and extended by additional experiments.

      Advance:

      BRCA1-R1699Q is classified as a pathogenic variant despite its low penetrance and intermediate cancer risk in breast and ovarian cancer compared to other variants. A recent case report highlighted the unique clinical outcome of a patient with the BRCA1 R1699Q variant, suggesting that this variant may differ from others in terms of cancer risk and drug response (Saito et al., Cancer Treatment and Research Communications 2022). These findings underscore the need for further studies to confirm these observations and to elucidate the specific mechanisms underlying the response to platinum agents and PARP inhibitors in patients with the BRCA1 R1699Q variant. The manuscript proposed by the authors has the potential to help understanding how BRCA1 missense mutations can contribute to determine treatment sensitivity and pave the way to patient stratification.

      Audience:

      This manuscript is suitable for a specialized, basic research audience.

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. Point-by-point description of the revisions

      • *Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The authors present the use of previously identified biosensors in a single-molecule concentration regime to address lipid effector recruitment. Using controlled and careful single-cell based analysis, the study investigates how expression of the commonly used PIP3 sensor based on Akt-PH domain interferes with the native detection of PIP3. Predominantly live-cell fluorescence microscopy coupled to image analysis drives their studies.

      Conceptually, this manuscript carefully and quantitatively describes the influence of lipid biosensor overexpression and presents a means to overcome the inherent and long-recognized problems therein. This solution, namely employing low expression of the lipid biosensor, should be generally applicable. The work is of general interest to cell biologists focused on answering questions at membranes and organelles, including especially those interested in lipid-mediated signaling transductions.

      Reviewer 1 Major:

      #1.1 The terminology "single molecule biosensor" is not really appropriate. A protein is not "single-molecule". An enzyme does not "single molecule". Better is biosensors at single-molecule expression levels. In most cases, this should be changed. Single-molecule vs single-cell vs. bulk measurements are often poorly defined in quantifications and conflating these does not help the case, which is already supported by generally clear data.

      We appreciate the reviewer’s thoughtful critique of our grammatically incorrect use of jargon; we saw this as soon as they mentioned it! We have amended the manuscript where appropriate as detailed:

      • Title is now changed to “Lipid Biosensors Expressed at Single Molecule Levels Mitigates Inhibition of Endogenous Effector Proteins”
      • Last paragraph of the introduction on __ 2__ now reads “As well as alleviating inhibition of PI3K signaling, biosensors expressed at these low levels show improved dynamic range and report more accurate kinetics than their over-expressed counterparts."
      • The title of the results section on __ 6__ is now: Mitigating PIP3 competition using biosensors expressed at single molecule levels
      • Last paragraph of the results section on 6 now reads: “this showed that when expressed at single molecule levels, the biosensor has substantially better dynamic range”. #1.2 Figure 1D-F, images not as clearly describing quantitation as one would hope. Untransfected cells in 1E should demonstrate more translocated Akt-pS473 than transfected, but it is difficult for this reviewer to find. Consider inset images in addition to the wider field. Consider also moving the "negative" data of Fig 1B-C to Supplement.

      We regret not making this figure easier to interpret; we have substantially updated the figure, as comprehensively detailed in our point-by-point response to reviewer 2’s point 2.3. To specifically address this reviewer’s concerns:

      The older figure used non-confocal, low-resolution images that were used for quantification. Such an approach was employed to enable fluorescence from the entire cellular volume to be captured, which produces more robust quantification. However, to the reviewer’s point, it is not possible to see the translocation of PH-AKT1 nor translocated AKT-pS473 in these images. Fortunately, we had in parallel captured high resolution confocal images for some experiments. These are now shown in Fig 1D-E, which clearly shows translocated AKT-pS473 and PH-AKT-EGFP

      #1.3 The cell line being used is not clearly specified after the initial development of the NG1 followed by CRISPRed NG2 onto Akt. For example, for the Figure 3C experiments, the text states "complete ablation of endogenous AKT1-NG2" but this information is not apparent from the figure legend or figure. Throughout the cell line used and the aspects transfected need to be made explicitly clear.

      We are grateful to the reviewer for highlighting this ambiguity. We have now defined the gene-edited cells used throughout as “AKT1-NG2 cells” and expressly used this term when referring to experiments in figures 2-5.

      #1.4 Fig. 5 shows single cells. It is therefore unclear if broken promoters have resulted in decreased expression. This point is important because the expression plasmids should be made publicly available, and for their use to be understood properly, this must be clarified. The details of the plasmids are unclear. Perhaps listed in the table? - unclear. This aspect would be important for the field to effectively use the reagents.

      Thank you for drawing our attention to the lack of adequate detail here. We have now updated the results text to expressly reference Morita et al., 2022 where the origins of the truncated CMV promoters are detailed. We have also updated the plasmids table 1 to add pertinent details for these constructs: *pCMVd3 plasmids are based on the pEGFP-C1 backbone, with the CMV promoter truncated to remove 18 of the 26 putative transcription factor binding sites in the human Cytomegalovirus Major Intermediate Enhancer/Promoter (pCMV∆3 as described in Morita et al., 2012). The full sequences will be deposited with the plasmids on Addgene.

      We did not perform a formal comparison of full vs truncated promoters. Our only observation is that the truncated promoters greatly help in increasing the number of expressing cells presenting single-molecule resolvable expression levels (though the approach can still work with full promoters).

      #1.5 This manuscript speculates several times that with more abundant PIs like PI45P2, the observed saturation effect is probably not happening. This should be removed. While the back of envelope calculations may reflect an ideal scenario, the heterogeneity of distribution and multiple key cellular structures involved would seem to corral increased PI45P2 levels in certain regions. These factors amid multivalency and electrostatic mechanisms of lipid effector recruitment (e.g. MARCKS) suggest that speculation may be too strong. Moreover, Maib et al JCB 2024 demonstrated PI4P probe overexpression could directly mask the ability to detect PI4P post-fixation - not fully, but partially. Repeating the titration experiments of this manuscript for multiple PIs is entirely beyond the scope of reasonable, and hence, such experiments are not requested, in favor of adopting more conscientious speculation.

      The reviewer’s point is well taken. Whilst we still believe the overall argument for lipids is sounds (for example, PS or cholesterol are far too abundant for any expressed, stoichiometric binding protein to bind the majority of the population) even abundant phosphoinositides like PI4P and PI(4,5)P2 are an edge case. We have therefore undated the first paragraph of the introduction on __p. 1 __to be less explicit: One of the most prominent is the fact that lipid engagement by a biosensor occludes the lipid’s headgroup, blocking its interaction with proteins that mediate biological function. It follows that large fractions of lipid may be effectively outcompeted by the biosensor, inhibiting the associated physiology. We have argued that, in most cases, this is unlikely because the total number of lipid molecules outnumbers expressed biosensors by one to two orders of magnitude (Wills et al., 2018). However, for less abundant lipids, total molecule copy numbers may be in the order of tens to hundreds of thousands, making competition by biosensors a real possibility.

      We also removed the explicit discussion of PI(4,5)P2 from the introduction, and focus now solely on the PI3K lipids.

      Reviewer 1 Minor:

      1.6 Schematics throughout need simplification, enabling their enlargement.

      We have now enlarged the size of all schematics

      #1.7 Numerous spelling (Fig. 4 schemas) and capitalizations need fixing.

      Thank you for drawing our attention to these. We have thoroughly proof-read the figure panels and corrected errors.

      #1.8 Pg 1 Famous is not appropriate wording

      We respectfully beg to differ with the reviewer here. We believe it is perfectly accurate to state that PIP3 is a second messenger molecule that is known about by many people; we see this as the dictionary definition of the word “famous”.

      #1.9 Fig. 1A statistical testing of microscopy quantifications absent (generally, throughout) and should be included.

      This was indeed an oversight on our part. We have now added appropriate multiple comparisons tests to the data presented in figures 1F, 3F, 4C, 4F and 5C.

      #1.10 Fig.1. In a transient transfection, the protein expression is not uniform. Please explain how you normalized the quantification.

      We hope this is now clarified by the expanded “Image Analysis” part of the methods section on pp. 10-11 (relevant sentence is underlined): For immunofluorescence, we identified individual cells by auto thresholding the DAPI channel using the “Huang” method, followed by the Watershed function to segment bunched cells that appeared to touch. We then used the Voronoi function to generate boundary lines for the segmentation of the cells. To identify cytoplasm, auto thresholding of the CellMask channel using the “Huang” function was employed, with the cells segmented by adding the nuclear Voronoi boundaries. The “analyze particles” function was then used to identify individual cellular ROIs that were greater than 10 µm2 and were not touching the image periphery. These ROIs were used to measure the raw 12-bit intensity of the EGFP and AKT-pS473 channels. A cutoff of EGFP > 100 was used to define EGFP-positive cells, since this value was greater than the mean ± 3 standard deviations of the non-transfected cells’ EGFP intensity. Background intensity of AKT-pS473 was estimated from control cells subject to immunofluorescence in the absence of AKT-pS473 antibody; this value was subtracted from the measured values of all other conditions.

      #1.11 Fig. 1D. EGFP expression levels increased with EGF stimulation. How is this possible?

      There appeared to be a difference due to the presence of 5 strongly expressing cells in the chosen field in the original field for the EGF stimulated, EGFP cells. However, this arose just by chance. The new set of high-resolution images in the new figure 1 were selected to be more representative.

      #1.12 Fig. 1D. The images have pS473 whereas the y-axis label on box plots has p473. Can these box plots be labelled separately for consistency?

      Thank you. This has now been corrected in the revised Figure 1.

      #1.13 Fig.1. T308 phosphorylation is mentioned in Figure 1, but only pS473 data is shown.

      Both T308 and S473 phosphorylation are indicative of AKT activation. However, antibodies suitable for immunofluorescence are only available for pS473, hence why our experiments are restricted to this moiety.

      #1.14 Fig.1 legend. 'Over-expression of PH-AKT is hypothesised to outcompete the endogenous AKT's PH domain'. Why do you need to state a hypothesis in the legend?

      We included this statement for the benefit of the casual reader – i.e. one who looks at the pictures, but doesn’t read the main text!

      #1.15 Fig.1E You stated that the PH-AKT R25C-EGFP is stimulated by EGF addition. However, the GFP signal looks the same in both unstimulated and stimulated. Could you please clarify? Are you sure that the stimulation worked?

      We have clarified the second paragraph of the results section “Inhibition of AKT activation by PIP3 biosensor”__on __p. 4 as follows: In the non PIP3 binding PH-AKT1R25C-EGFP positive cells, we still observed an increase in pS473 intensity.

      The revised figure 1 images also show that PH-AKT1R25C does not translocate to the membrane with EGF stimulation.

      #1.16 You mention...that the AKT enzyme is activated by PDK1 and TORC2, which phosphorylate at residues T308 and S473, respectively. Phosphorylation is also known to occur on T450 at c-tail. Does this phosphorylation also contribute to its activation?

      Yes and no. Threonine 450 phosphorylation is thought to occur co-translationally and is important for AKT stability (see Truebestein et al as cited in the manuscript). It is not really relevant in the context for T308 and S473, which are phosphorylated acutely to activate the protein.

      #1.17 Fig. 1 scale bar in all images equivalent?

      We have now added scale bars to panels in both figure 1D and E to clarify.

      __#1.18 __Pg. 1 paragraph 1 "we have argued..." vs. paragraph 3"...consider that an..." feels like arguing with themselves.

      We believe the re-write we have done in response to major point #1.5 clarifies this point also.

      #1.19 Pg. 1 para 3 what is RFC score - must explain

      We have now defined this more clearly in third __paragraph of the __introduction on p. 1: PH domain containing PIP3effector proteins can be predicted based on sequence comparison to known PIP3 effectors vs non effectors using a recursive functional classification matrix for each amino acid (Park et al., 2008).

      #1.20 Discussion of numbers of PIP3 vs. effectors etc may not be appropriate for the introduction, as the points made by these calculations are already made in the previous paragraphs. May fit better in pg 6 Mitigating PIP3 titration... with an accompanying schematic.

      Respectfully, we prefer to keep this discussion of molecular concentrations, as this adds details and specifics to the pathway that is core to the paper.

      #1.21 Pg 2 "a neonGreen" not well defined, needs accurate description.

      We have clarified this in the sentence in the first paragraph of the results section “Genomic tagging of AKT1…” __on __p. 4, which includes the citation to the full description of the tag: To that end, we used gene editing to incorporate a bright, photostable neonGreen fluorescent protein to the C-terminus of AKT1 via gene editing using a split fluorescent protein approach (Kamiyama et al., 2016).

      #1.22 Fig 2C should give a unstimulated trajectory of puncta/100 um2 to compare with the stimulated

      Unfortunately, we did not record a full 5.5-minute video-rate time-lapse with unstimulated cells. However, we do not believe this control is essential for this experiment, since this example data is included to illustrate (1) the problem of photobleaching, which is clear in the 30-s pre-stimulus and (2) the variability in the raw molecule counts.

      #1.23 Fig 2C and F and G should be systematized for easier comparison. E.g. min vs seconds, 0 timepoint of EGF/rapa addition

      We have made the adjustment to figure 2C to be consistent with 2F and G:

      #1.24 Pg 5 "...and calibrated them..." unclear what is being calibrated, as the text later states that the histograms are fit to monomer/dimer/multimer model resulting in 98.1% in monomer. Minor point.

      We have clarified this point in the second paragraph of the results section “__Genomic tagging of AKT1…” __on __p. 4 __as follows: We analyzed the intensity of these spots and compared them to intensity distributions from a known monomeric protein localized to the plasma membrane (PM) and expressed at single molecule levels

      #1.25 Explain why baselines in Fig2CFG are different

      We did not comment on figure 2C; it is a single cell measurement, as opposed to the mean of 20 cells reported in F. However, we do now clarify the difference between figure 2F and G as the very end of the “Genomic tagging of AKT1…” results section on p 4: Notably, baseline AKT-NG2 localization increased from ~5 to ~15 per 100 µm2 in iSH2 cells, perhaps because the iSH2 construct does not contain the inhibitory SH2 domains of p85 regulatory subunits, producing higher basal PI3K activity.

      #1.26 Fig. 2 has quantification with images; Fig. 3 has it separate. Make consistent.

      We sometimes combine images with quantification, and other times separate the panel containing graphs. This is done deliberately, depending on whether the reader is directed to both together, or whether we consider the data separately in the results section.

      #1.27 Fig. 3B comes before images? Where are the images? Also, y-axis = Intensity (a.u.). Is intensity just full image field? Or per cell? All very unclear.

      We have modified both the graph y-axis label and the figure legend to clarify: (C) TIRF imaging of AKT1-NG2 cells from (B) stimulated with 10 ng/ml EGF

      #1.28 Fig. 3C missing images

      We believe the reviewer is referring to the mCherry channel for the “0 ng cDNA” condition. These images are missing because they do not exist. Since these cells were transfected with pUC19, there was no mCherry fluorescence to image.

      #1.29 Fig 3 C needs brightness/contrast adjusted as images are nearly entirely black (zero values).

      We believe the addition of insets addresses this concern. To the reviewer’s specific suggestion, we found that further increases in the brightness and contrast will bring up the camera noise, but this then occludes the signal from single molecules, such as those found after EGF stimulation of the 0 ng condition.

      #1.30 Fig 3C needs scale bar systemization

      We believe that the incorporation of scaled 6 µm insets addresses this point.

      #1.31 Fig 4 needs 4 panels A-D

      We have now added these individual panel labels to figure 4.

      #1.32 Pg 6 5-OH phosphatases needs reference

      We have added a citation to Trésaugues at the very end of the “Sequestration of PIP3 by lipid biosensors” results section on p. 6, which describes the activity of the whole 5-OH phosphatase activity against PIP3, not just the SHIP phosphatases.

      #1.33 Fig 5B, make images bigger

      Again, we trust that the addition of insets to all single molecule images has addressed this point.

      Reviewer 1 Referees cross-commenting**

      I have read the other reviews and find them entirely reasonable. My impression is we landed on similar general content that needs work, none of which is out of line. The importance and care taken in the author's work is uniformly lauded.

      We agree. At the risk of restoring to alliteration, we have been delighted to receive a trio of clear, concise and consistent comments on the manuscript! We believe it is now much improved.

      Reviewer #1 (Significance (Required)):

      This manuscript clearly and reasonably demonstrates that the commonly used PIP3 sensor can be titrated to low concentrations, at which it does not interfere with Akt translocation and activation. This work is a good technical reference for the field. Signal transduction and membrane biologists should be especially interested in the data. The reviewer/s have core expertise in phosphoinositides, protein biochemistry, cell biology, and membrane biophysics.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The authors characterize the inhibition of lipid second messenger mediated cell signaling through lipid biosensors that outcompete endogenous effector proteins. This is a very important study that as it quantitatively assesses an issue that many people suspected to exit, yet never properly characterized. This paper is therefore as much a service to the community as a research study in its own right and should be published without undue delay. I am glad that the authors decided to carry out this study & really appreciate their work.

      I do however, have a number of suggestions that I think will make the manuscript stronger and can be readily implemented, mostly by reformulating and/or re-analysis of exiting datasets. I've structured my comments by the datasets in the respective figures to follow the logic of the paper.

      Reviewer 2 Major:

      #2.1 Throughout the manuscript, statistical tests are missing, e.g. in figures 1C-F. This must be amended in the revised version. The authors are making a very quantitative point about buffering, data should be treated accordingly.

      We have now added appropriate multiple comparisons tests to figures 1F, 3F, 4C, 4F and 5C.

      #2.2 I do not think that "PIP3 titration" is the best term to describe the observed effect. "Titration" usually implies the controlled modulation of a concentration, e. g. in analytical chemistry. I think either "competitive binding of PIP3" or "buffering of free PIP3" are more adequate.

      This point is well taken. We have now replaced the word “titration” throughout, replacing it with either “competitive binding” or “sequestration”.

      #2.3 Specific comments: Figure 1

      #2.3a Why are data in 1D-Ff shown as median, with interquartile ranges and 10-90 percentile distance when everything else in the paper is mean +/- se? There might be a good reason for it, but I did not find it mentioned everywhere

      For consistency’s sake, we have changed figure 1F to show a bar graph, though as noted in the figure legend: Graphs show medians ± 95% confidence interval of the median from 82-160 cells pooled from three experiments (medians are reported since the data are not normally distributed).

      #2.3b The authors should test, whether the difference between the +EGF conditions in 1D (EGFP) and 1F (PH-AktR25C-EGFP) is indeed statistically significant. If this observation holds up, what does it mean? Is the mutant still competing with endogenous Akt despite the much-reduced binding affinity? The authors should discuss.

      We have re-analyzed the data in figure 1, with the quantitative data presented in figure 1F combined with statistical analysis. The new data shows no significant effect of the PH-AKT1R25C mutant in either resting or EGF stimulated condition

      There results are also described in the__ second paragraph__ of the first results section on pp. 3-4: This analysis showed that the R25C mutant had no substantial effect on pS473 levels, whereas wild-type PH-AKT greatly inhibited pS473 staining in EGF-stimulated cells as well as reducing basal levels in serum starved cells (Fig. 1F).

      #2.3c How were biosensor/GFP positive cells chosen? Did the authors choose a defined fluorescence intensity cut-off? I think that a pure manual selection is problematic from a methodological point of view as this may introduce biases. Since the authors use Fiji, they can also simply use the "Analyze particles" function, which allows to automatically segment cells from a thresholded image. By choosing the same threshold for all images, it would be ensured that all images are treated exactly the same way.

      We had initially opted for manual outlining of cells since automatic segmentation of irregularly-shaped HEK293a cells is imperfect. However, we agree with André that this opens the possibility of bias. We have therefore re-run the analysis with an automated segmentation and thresholding approach, as suggested. This is detailed in the__ second paragraph__ of the first results section on pp. 3-4: In parallel, we imaged cells with a low resolution 0.75 NA air objective to capture fluorescence from the cells’ entire volume, then quantified these images using an automatically determined threshold for GFP-positive cells (see Materials and Methods). This analysis showed that the R25C mutant had no substantial effect on pS473 levels, whereas wild-type PH-AKT greatly inhibited pS473 staining in EGF-stimulated cells as well as reducing basal levels in serum starved cells (Fig. 1F).

      Further detail is provided in the first paragraph of the “Image analysis” subsection of the methods on pp. 10-11: For immunofluorescence, we identified individual cells by auto thresholding the DAPI channel using the “Huang” method, followed by the Watershed function to segment bunched cells that appeared to touch. We then used the Voronoi function to generate boundary lines for the segmentation of the cells’ cytoplasm. To identify cytoplasm, auto thresholding of the CellMask channel using the “Huang” function was employed, with the images segmented by adding the nuclear Voronoi boundaries. The “analyze particles” function was then used to identify individual cellular ROIs that were greater than 10 µm2 and were not touching the image periphery. These ROIs were used to measure the raw 12-bit intensity of the EGFP and AKT-pS473 channels. A cutoff of EGFP > 100 was used to define EGFP-positive cells, since this value was greater than the mean ± 3 standard deviations of the untransfected cells’ EGFP intensity. Background intensity of AKT-pS473 was estimated from control cells subject to immunofluorescence with the AKT-pS473 antibody omitted; this value was subtracted from the measured values of all other conditions.

      #2.3d I am missing a statement in the methods section that all images were acquired using the same settings.

      This was indeed an important oversight on our part – thanks for spotting the omission of this crucial detail. This is now included at the end of the “Immunofluorescence” section of the Methods on pp. 9-10: Identical laser excitation power, scan speeds and photomultiplier gains were used across experiments to enable direct comparison.

      #2.3e I recommend that the authors include a single cell correlation plot of EGFP fluorescence intensity vs AktpS473 intensity in Figure 1 D-F. This should be rather informative & make the concentration dependence clear.

      We did not observe a strong correlation between PH-AKT1-EGFP intensity and pS473 staining, likely driven by both the imprecision of the cell segmentation and the fact that very low concentrations of PH domain effectively inhibit endogenous AKT1 (as we show in the later figures with the more precise, live cell AKT-NG2 recruitment experiments: see response to #2.5).

      #2.3f I further recommend that the authors look at alterations of baseline Akt activity in the presence of the biosensor. In the images it looks like there might be an effect, but this is then lost in the analysis due to the normalization.

      As covered in our response to #2.3b, there is indeed an inhibition of baseline pS473 in PH-AKT1-EGFP expressing cells, now explicitly quantified and documented in results.

      #2.3g Please include zoomed image insets in Fig. 1D-F, in the current magnification one needs to zoom in quite a bit to see the effect in the raw data. It is a clear effect, but having a zoomed version would make for much easier reading.

      We now include high-resolution confocal images instead of low power, low NA volumes as shown in the last version of the manuscript, which we believe addresses this point and also reviewer #1.2.

      2.3h Up to the authors: I wonder whether it is possible to extract an IC50 value for the competitive inhibition of Akt by the respective biosensors. The transient expression gives the authors access to a wide range of expression levels at the single cell level, which could be quantified by counterstaining with a EGFP-nanobody at a different color (since the EGFP fluorophore went through the fixation process, it is likely unsuitable for quantification) and microscope calibration. Activity could be quantified as the ratio of observed and expected Akt-pS473 fluorescence (derived from the mean FI per cell from the EGFP control). This is not strictly necessary, but would be a beautiful quantitative experiment, give an easy-to-understand number & make the paper much stronger.

      This is a great suggestion, but does not produce precise enough data to work out, as we detail in response to #2.3e. From our data in new figure 3F and figure 5, it seems we have not explored the appropriate expression range to see intermediate levels of inhibition necessary to estimate IC50. This would be a cool experiment though!

      __#2.4 __Specific comments: Figure 2. Overall, compelling data. However, 25 molecules/100 um^2 at maximal recruitment feels low. Assuming a total cell surface area of appr. 2000 um^2 per cell and taking a baseline of 5 molecules/100 um^2 into account, this would mean that only about 400 copies of Akt are recruited in response to a pretty robust stimulus. Is it possible that the association reaction of the split GFP is not complete under these conditions? I think that a direct measurement of intracellular endogenous Akt concentration is required to put these numbers into context.

      This is an excellent point that we had missed. We now specifically address this point in the third paragraph of the “Genomic tagging of AKT…” section on p. 4: __Accumulation of AKT-NG2 was ~25 molecules per 100 µm2, which assuming a surface area of ~1,500 µm2 per cell corresponds to ~375 molecules total. It should be noted that tagging likely only occurred at a single allele in each cell, and the population still exhibited expression of non-edited AKT1 (__Fig. 2B). Given that HEK293 are known to be pseudotriploid (Bylund et al., 2004), the true number of AKT1 molecules would be at least 1,125. However, given an estimated total copy number of 23,000 AKT1 in these cells (Cho et al., 2022), this is still only about 5%. However, we do not interpret these raw numbers due to uncertainties in the efficiency of NG2 complementation under these conditions, as well as potential for reduced expression from the edited allele.

      We also removed the specific comment on molecule density from the abstract.

      #2.5 Specific comments: Figure 3 I think that the classification by plasmid dose does not make a lot of sense, as the resulting expression levels are rather similar. I suggest to pool all traces and calculate mean curves by actual expression levels using a binning approach (e.g. 0-50 au, 50-100 au and so on in raw intensity from Figure 3b). If there is an effect in the realized concentration regime, this should pick it up.

      This is an excellent suggestion, and we have done just that: thank you! The data is now included as a new panel Fig. 3F. The result is described in the results section, “Sequestration of PIP3 by lipid biosensors”, end of the first paragraph on pp. 4-6: To observe the concentration-dependence of AKT1-PH-mCherry inhibition, we pooled the single cell data from these experiments and split transfected cells into cohorts based on raw expression level (excitation and gain were consistent between experiments, allowing direct comparison). This analysis showed profound inhibition of AKT1-NG2 recruitment at all expression levels, with a slightly reduced effect only visible in the lowest expressing cohort (Fig. 2F).

      #2.6 Specific comments: Figure 5 These are very interesting data, in particular with regard to the underlying PIP3 dynamics. I agree with the conclusion of the authors that shielding of PIP3 from degradation is the likely culprit. What I would like to see here is actual kinetic fits - and different terms. On- and off-rate imply biosensor binding, but these are likely rather fast and not on the minute-timescale. The detected processes are much more likely to reflect production and degradation of PIP3 and that should be reflected in the terminology. For the fit: I think that a simple rate law for subsequent reactions ([PIP3]=C(e^-k1t-e^k2t)) will give good results and yield effective rate constants for PIP3 generation and degradation. This implies the quasi-steady state assumption for biosensor binding and implies that [PIP3] is proportional to the biosensor bound [PIP3], but these are reasonable assumptions to make.

      The is an excellent suggestion, which we have added. Specifically, fits are now present on Figs. 5G and 5I; we describe these in the last paragraph of results on p. 8: Normalizing data from both expression modes to their maximum response (Fig. 5G) and fitting kinetic profiles for cooperative synthesis and degradation reactionsrevealed the rate of synthesis is remarkably similar: 1.09 min–1 (95% C.I. 1.02-1.17) for single molecule expression vs 1.02 min-1 (95% C.I. 0.98-1.06) for over-expression. On the other hand, degradation slowed with over expression from 0.34 min–1 (95% C.I. 0.24-0.58) to 0.13 min–1 (95% C.I. 0.12-0.15). This is expected, since synthesis of PIP3molecules would not be prevented by biosensor. On the other hand, PIP3 degradation could be slowed by the over-expressed biosensor competing with PTEN and 5-OH phosphatases that degrade PIP3. An even more exaggerated result is achieved with the cPHx1 PI(3,4)P2 biosensor; this shows an increase in fold-change over baseline of 600% for single molecule expression levels, compared to only 100% in over-expressed cells (Fig. 5H). Again, the degradation rate of the signal is substantially slowed by the over-expressed sensor, reducing from 0.27 min–1 (95% C.I. 0.22-0.39) to 0.16 min–1 (95% C.I. 0.14-0.19), whereas synthesis remains only minorly impacted, changing from 0.61 min–1 (95% C.I. 0.57-0.64) to 0.54 min–1 (95% C.I. 0.52-0.56) with over-expression (Fig. 5I). Collectively, these data show that single molecule based PI3K biosensors show improved dynamic range and kinetic fidelity compared to the same sensors over-expressed.

      Details of the fits are given in a new methods section on p. 11:

      Fitting of reaction kinetics

      Curve fitting was performed in Graphpad Prism 9 or later. For the data presented in Figs. 5G and 5I, both synthesis and degradation phases displayed clear “s” shaped profiles not well fit by simple first order kinetics. Since activation of the PI3K pathway involves many multiplicative interactions between adapters and allosteric activation of the enzymes themselves, we assumed cooperativity and fit reactions with the two phase reaction as follows:

      Where Ft denotes ∆Ft/∆FMAX, nsyn and ndeg are the Hill coefficients of the respective synthesis and degradation reactions, and the rate constants for the reactions are derived from ksyn = 1/τsyn and kdeg = 1/τdeg.

      André Nadler

      Reviewer #2 (Significance (Required)):

      This is an important paper, analyses the effects of over-expressed lipid biosensors on cell signalling in some detail and will be of significant interest to a broad readership.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      This is essentially a methods paper in which the authors provide a detailed and highly quantitative analysis of the potentially deleterious effects of expressing phosphoinositide-binding domains as biosensors. Specifically, they study the effects on PIP3 signalling, using biosensors that are widely used in the field.

      They show that the most-commonly used method of expressing PIP3 biosensors using transient transfection with viral promotors has clear deleterious effects on downstream signalling due to out-competing the endogenous effectors. Importantly, they also describe a new approach to overcome this by developing new plasmids and methodology to express these reporters at low levels.

      Reviewer 3 Major comments:

      The work in this paper is thorough and very nicely done. I particularly appreciate the efforts to quantitate or estimate actual numbers and densities of molecules, which significantly strengthen their arguments. The data are excellent and strongly support all their conclusions. I would therefore be happy to see this work published in its current form.

      Reviewer 3 Minor comments:

      I only have some minor and optional suggestions for improvement.

      #3.1 In figure 1D-F they show that PH-Atk-EGFP expression can suppress downstream Akt activation by quantifying P-Akt signal my microscopy. In these panels they say tgey selectively measure this in GFP-expressing cells, but it is not clear how they define which cells are expressing GFP - was a threshold used? Also, it would be nice to also measure both PH-Akt-GFP and P-Akt staining by flow cytometry to look for a correlation. Is there a threshold of biosensor expression that blocks downstream signalling, or is there a linear relationship? This might help specifically measure how much biosensor is too much.

      This is an important comment, also raised by reviewer 2. We provide a detailed explanation and outline revisions that address this in our response to reviewer #2.3c; essentially, we replaced the analysis with an automated segmentation and quantification, estimating GFP-positive cells from a fraction of non transfected cells. We have not performed a FACS analysis, but as we note in our response to #2.3e __and #2.3h, the correlation between EGFP and pAKT staining is imprecise in these experiments. The new __Fig. 3C does address this point for AKT1-NG2 recruitment, as described in our response to #2.5.

      #3.2 Some of their microscopy images (e.g. Fig 1D-F, Fig 5) are very small and would benefit from a zoom box - especially when they are trying to demonstrate single molecule detection.

      This is a fair point raised by all of the reviewers in one form or another. We have added zoomed insets to all of the single molecule images in Figs 2-5, and added higher magnification, confocal section images to Fig. 1.

      Reviewer #3 (Significance (Required)):

      This is both a methods paper and cautionary tale for cell biologists working in this field. Whilst everyone who uses these probes should be aware of the potential risk of biosensors titrating our effectors, this is often not sufficiently acknowledged. This paper is a very nice and clear demonstration of these risks, exemplified with probably the most highly-used biosensor and key downstream signalling pathway.

      Whilst the concepts presented are not especially novel, this paper nonetheless makes an important contribution to the community and hopefully will make others more cautious in how they use these biosensors.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      The work from Petazzi et al. aimed at identifying novel factors supporting the differentiation of human hematopoietic progenitors from induced pluripotent stem cells (iPSCs). The authors developed an inducible CRISPR-mediated activation strategy (iCRISPRa) to test the impact of newly identified candidate factors on the generation of hematopoietic progenitors in vitro. They first compared previously published transcriptomic data of iPSCderived hemato-endothelial populations with cells isolated ex vivo from the aorta-gonadmesonephros (AGM) region of the human embryo and they identified 9 transcription factors expressed in the aortic hemogenic endothelium that were poorly expressed in the in vitro differentiated cells. They then tested the activation of these candidate factors in an iPSCbased culture system supporting the differentiation of hematopoietic progenitors in vitro. They found that the IGF binding protein 2 (IGFBP2) was the most upregulated gene in arterial endothelium after activation and they demonstrated that IGFBP2 promotes the generation of functional hematopoietic progenitors in vitro.

      Strengths:

      The authors developed an extremely useful doxycycline-inducible system to activate the expression of specific candidate genes in human iPSC. This approach allows us to simultaneously test the impact of 9 different transcription factors on in vitro differentiation of hematopoietic cells, and the system appears to be very versatile and applicable to a broad variety of studies.

      The system was extensively validated for the expression of 1 transcription factor (RUNX1) in both HeLa cells and human iPSC, and a detailed characterization of this test experiment was provided.

      The authors exhaustively demonstrated the role of IGFBP2 in promoting the generation of functional hematopoietic progenitors in vitro from iPSCs. Even though the use of IGFBP2interacting proteins IGF1 and IGF2 have been previously reported in human iPSC-derived hematopoietic differentiation in vitro (Ditadi and Sturgeon, Methods 2016; Ng et al., Nature Biotechnology 2016), and IGFBP-2 itself has been shown to promote adult HSC expansion ex vivo (Zhang et al., Blood 2008), its role on supporting in vitro hematopoiesis was demonstrated here for the first time.

      Weaknesses:

      Although the authors performed a very thorough characterization of the system in proof-ofprinciple experiments activating a single transcription factor, the data provided when 9 independent factors were used is not sufficient to fully validate the experimental strategy. Indeed, in the current version of the manuscript, it is not clear whether the results presented in both the scRNAseq analysis and the functional assays are the consequence of the simultaneous activation of all 9 TF or just a subset of them. This is essential to establish whether all the proposed factors play a role during embryonic hematopoiesis, and a more complete analysis of the scRNAseq dataset could help clarify this aspect.

      Similarly, the data presented in the manuscript are not sufficient to clarify at what stage of the endothelial-to-hematopoietic transition (EHT) the TF activation has an impact. Indeed, even though the overall increase of functional hematopoietic progenitors is fully demonstrated, the assays proposed in the manuscript do not clarify whether this is due to a specific effect at the endothelial level or to an increased proliferation rate of the generated hematopoietic progenitors. Similar conclusions can be applied to the functional validation of IGFBP2 in vitro.

      The overall conclusions are sometimes vague and not always supported by the data. For instance, the authors state that the CRISPR activation strategy resulted in transcriptional remodeling and a steer in cell identity, but they do not specify which cell types are involved and at what level of the EHT process this is happening. In the discussion, the authors also claim that they provided evidence to support that RUNX1T1 could regulate IGFBP2 expression. However, this is exclusively based on the enrichment of RUNX1T1 gRNA in cells expressing higher levels of IGFBP2 and it does not demonstrate any direct or indirect association of the two factors.

      We thank the reviewer for the positive comments about the importance of our work and have now addressed the points raised as weaknesses by performing additional analysis and experiments, adding a new schematic of the mechanism, and rewording our claims.

      We have clarified the different effects mediated by the activation and the IGFBP2 addition in a summary section at the end of the results and added Figure 6, showing this in visual form. We have also clearly stated the limitations related to the correlation between RUNX1T1 and IGFBP2 in the discussion and toned down our claims regarding this throughout the entire paper. We have also reworded the text to clarify the specific cell types identified in the sequencing data that we refer to.

      Reviewer #2 (Public Review):

      To enable robust production of hematopoietic progenitors in-vitro, Petazzi et al examined the role of transcription factors in the arterial hemogenic endothelium. They use IGFBP2 as a candidate gene to increase the directed differentiation of iPSCs into hematopoietic progenitors. They have established a novel induced-CRISPR mediated activation strategy to drive the expression of multiple endogenous transcription factors and show enhanced production of hematopoietic progenitors through expansion of the arterial endothelial cells. Further, upregulation of IGFBP2 in the arterial cells facilitates the metabolic switch from glycolysis to oxidative phosphorylation, inducing hematopoietic differentiation. While the overall study and resources generated are good, assertions in the manuscript are not entirely supported by the experimental data and some claims need further experimental validation.

      We thank the reviewer for the positive comments, and we have provided new data and analysis to make sure that all our assertations are clearly supported and also reworded those where limitations were identified by the reviewers.

      Recommendations for the authors:

      Reviewing Editor (Recommendations For The Authors):

      The assessment could change from "incomplete" to "solid" if the authors: i) improve data analysis (for both scRNAseq and functional assays) by providing additional information that could strengthen their conclusions, as suggested in the specific comments by both reviewers; ii) either provide new functional evidence supporting their mechanistic conclusion or alternatively tone down the claims that are not fully supported by data and acknowledge the limitations raised by reviewers in the discussion; (iii) the issue of paracrine signaling to expand only hematopoietic progenitors needs to be addressed.

      We have now improved the data analysis and provided additional functional tests to strengthen our conclusions and toned down those that were identified by the reviewers as not supported enough and included a discussion on these limitations. We have also reworded the section about the paracrine signaling throughout the paper.

      Reviewer #1 (Recommendations For The Authors):

      Figure 1 contains exclusively published data. It might be more appropriate to use it as a supplementary figure or as part of a more exhaustive figure (maybe combining Figures 1 and 2 together?).

      Figure 1 contained novel bioinformatic analyses that represent the base of our research and it has a different content and focus to figure 2, which is already a large figure. We therefore believe it is better to keep it as a separate figure, containing a new panel now too. 

      It seems there is an issue with Figure S3 labelling:

      • In line 112, Figure S2A-B does not display genomic PCR and sequencing results;

      • In line 123, Figure S3D-E does not show viability and proliferation data;

      • In line 127, Figure S3G does not show mCherry expression in response to DOX;

      We apologies for the confusion with the numbers, we have now correctly labelled the figures.

      It would be more informative to include gates and frequency on flow cytometry plots in Figure S3, to be able to evaluate the extent of the reduction in mCherry expression.

      We have now included the gating and frequency of mCherry-expressing cells in Supplementary Figure 3D.

      It is not clear from the text and figures whether the SB treatment was maintained throughout the hematopoietic differentiation protocol (line 122):

      • If so, it would be important to confirm that HDAC treatment does not affect EHT cultures

      • If not, can the authors provide some evidence that transgene silencing is not occurring during hematopoietic differentiation?

      We have clarified that we decided to treat the cells with SB exclusively in maintenance condihons because HDACs have been shown to be essenhal for the EHT (lines 138-142). We have now also included addihonal data showing the high expression of the mCherry tag reporhng the iSAM expression on day 8 (Supplementary Figure 4F).

      Can the authors provide a simple diagram summarizing the experimental strategy for each differentiation experiment in the respective supplementary figure? For instance, at what stage of the protocol was DOX added in Figure 3? Or at what stage IGFBP2 was added in Figure 5? It would be a very useful addition to the interpretation of the results.

      We have now included three schemahcs for all the experiments in the manuscript in supplementary figure 4 A-C.

      In Figure 3, the authors should provide more detailed information about the data filtering of the scRNAseq experiment, and more specifically:

      • How many cells were included in the analysis for each library after QC and filtering?

      • How "cells in which the gRNAs expression was detected" were selected? Do they include only cells showing expression of gRNAs for all 9 TF?

      This informahon is now included in the method sechon lines 773-781; the detailed code is available on the GitHub link provided in the same sechon. We have filtered the cells expressing one gRNA for the non-targehng gRNA (iSAM_NT) control and more than one for the iSAM_AGM sample. 

      In Figure 3A, it is not clear whether the expression of the 9 factors is consistently detected in all cells or just a subset of them, and the heatmap in Figure 3A does not provide this information. It would be more accurate to provide expression on a per-cell basis, for instance, as a violin plot displaying single dots representing each cell. 

      We have now included this violin plot in Supplementary Figure 4G as requested. However, this visualisation is difficult to interpret because some of the target genes’ expression seems variable in both experimental and control conditions. We had envisaged that this could have been the case and so this is why we had included the three different controls.  For this reason we chose to show the normalised expression which takes all the different variables into account (Figure 3A). 

      In Figure 3B-C, it seems that clusters EHT1 and EHT2 do not express endothelial markers anymore. Are these fully differentiated hematopoietic cells rather than cells undergoing EHT? In general, it would be quite important to provide evidence of expressed marker genes characterizing each cluster (eg. heatmap summarizing top DEG in the supplementary figure?). 

      We have now provided a spreadsheet containing the clusters’ markers that we used in

      Supplementary Table 1) a heatmap in Figure 3E. Furthermor,e we have now edited Figure 3C to include Pan Endothelial markers (PECAM1 and CDH5). These data show that the EHT1 and EHT2 cluster both express endothelial markers but are progressively downregulated as expected during endothelial to hematopoietic transition. We have also included and discussed this in the manuscript lines 192-195 and a schematic for the mechanism in Figure 6.

      In Figure 3E, displaying the proportion of clusters within each sample/library would be a more accurate way of comparing the cell types present in each library (removing potential bias introduced by loading different numbers of cells in each sample).

      We have now included the requested data in Supplementary Figure 4I and it confirms again the expansion of arterial cells in the activated cells.    

      In Figure 3G, by plating 20,000 total CD34+, the assay does not account for potential differences in sample composition. It is then hard to discriminate between the increased number of progenitors in the input or an enhanced ability of HE to undergo EHT. This is an important aspect to consider to precisely identify at what level the activation of the 9 factors is acting. A proper quantification of flow cytometry data summarizing the % of progenitors, arterial cells, etc. would be useful to interpret these results.

      Lines 204-205 reworded. We are very much aware of the fact that the CD34+ cell population consists of a range of cells across the EHT process and this is precisely why we carried out this single cell sequencing analyses.  We purposely tested the effect of the observed changes in composition by colony assays

      In Figure 3G, it seems that NT cells w/o DOX have very little CFU potential (if any). Can the authors provide an explanation for this?

      We think that the limited CFU potential is due to the extensive genetic manipulation and selection that the cells underwent for the derivation of all the iSAM lines but this did not impede us from observing an effect of gene activation on CFU numbers. This is one of the primary reasons that we then validated our overall findings using the parental iPSC line in control condition and with the addition of IGFBP2. We show that the parental iPSC line gives rise to hematopoietic progenitor, both immunophenotypically (Figure 4D) and functionally, at expected levels (Figure 4B left column).

      Figure 4A shows an upregulation of IGFBP2 in arterial cells as a result of TF activation. However, from the data presented here, it is not possible to evaluate whether this is specific to the arterial cluster, or it is a common effect shared by all cell types regardless of their identity. 

      Data has now been included in Supplementary Figure 4H, which shows that all the cells show an increase in IGFBP2, but arterial cells show the highest increase. We have now edited the text to reflect this, in lines 228-230.

      In Figure 5A-B only a minority of arterial cells express RUNX1 in response to IGFBP2 treatment. Is this sufficient to explain the very significant increase in the generation of functional hematopoietic progenitors described in Figure 4? Quantification and statistical analysis of RUNX1 upregulation would strengthen this conclusion.

      We have now provided the statistical analysis showing significant upregulation of RUNX1 upon IGFBP2 addition. The p values are now provided in the figure 5 legend.

      In Figure 5 the authors conclude that IGFBP2 remodels the metabolic profile of endothelial cells. However, it is not clear which cell types and clusters were included in the analysis of Figure 5C-G. Is the switch from Glycolysis to Oxidative Phosphorylation specific to endothelial cells? Or it is a more general effect on the entire culture, including hematopoietic cells? 

      We based this conclusion on the fact that the single-cell RNAseq allows to verify that the metabolic differences are obtained in the endothelial cells. Given that we sorted the adherent cells, the majority of these are endothelial cells as shown in Figure 5A. The Seahorse pipeline includes a number of washing steps resulting in the analyses being performed on the adherent compartment which we know consists primarily of endothelial cells. We cannot exclude some contamination from non-endothelial cells but we highlight to this reviewer that the initial observation of the metabolic changes was identified in endothelial cells in the single cell sequencing data. Taken together, we believe that this implies that metabolic changes are specific to this population. We have clarified this in the line 317.

      In the discussion, the authors conclude that they "provide evidence to support the hypothesis that RUNX1T1 could regulate IGFBP2 expression". To further support this conclusion, the authors could provide a correlation analysis of the expression of the two genes in the cell type of interest. 

      Following the observation of the IGFBP2 high expression across clusters, we have now reworded this sentence in lines 382-385  We have tried to perform the correlation analysis but we believe this not to be appropriate due to the detection level of the gRNA, we have now included this as a limitation point in the discussion lines 416-427, and also toned down the conclusion we did draw about RUNX1T1 throughout the whole manuscript.

      As mentioned by the authors, IGFBP2 binds IGF1 and IGF2 modulating their function. Both IGF1 (http://dx.doi.org/10.1016/j.ymeth.2015.10.001) and IGF2 (doi:10.1038/nbt.3702) have been used in iPSC differentiation into definitive hematopoietic cells. It would be relevant to discuss/reference this in the discussion.

      We have now included the suggested reference in the section where we discuss the role of IGFBP2 in binding IGF1 and IGF2.

      Reviewer #2 (Recommendations For The Authors):

      (1) Figure 1 compares the transcriptome of human AGM and in-vitro derived hemogenic endothelial cells (HECs). It is not clear why only the genes downregulated in the latter were chosen. Are there any significantly upregulated genes, knockdown/knockout which could also serve a similar purpose? Single-cell transcriptome database analysis is very preliminary. A detailed panel with differences in cluster properties of HECs between the two systems should be provided. A heatmap of all differentially expressed genes between the two samples must be generated, along with a logical explanation for choosing the given set of genes. 

      We have now included another panel in figure 1 to better clarify the logic behind the strategy used to identify our target genes (Figure 1A).

      (2) Figure 2 - a panel describing the workflow of gRNA design and targeting for the 9 candidate genes, along with lentiviral packaging and transduction would make it easier to follow. 

      We have now included three schematics for all the experiments in the manuscript in supplementary figure 4 A-C. 

      (3) Figure 3- to assess the effect of arterial cell expansion on the emergence of hematopoietic progenitors, CD34+ Dll4+ cells should be sorted for OP9 co-culture assay.

      Using only CD34+ cells does not answer the question raised. Also, the CFU assay performed does not fully support the claim of enhanced hematopoietic differentiation since only CFU-E and CFU-GM colonies are increased in Dox-treated samples, with no effect on other colony types. OP9 co-culture assay with these cells would be required to strengthen this claim. 

      We wanted to clarify that the effect on the methylcellulose coming from the activated cells was not limited to CFU-E, as the reviewer reported; instead, it also affected CFU-GM and CFU-M. 

      We have now performed additional experiments where we sorted the CD34+ compartment into DLL4- and DLL4+ in Supplementary Figure 5D-E, which we discussed in lines 250-258. 

      (4) In Figure 3F, there appears to be a lot of variation in the DLL4% fold change values for

      DOX treated iSAM_AGM sample, which weakens the claim of increased arterial expansion.

      Can the authors explain the probable reason? It is suggested that the two other controls (iSAM_+DOX and iSAM_-DOX) should be included in this analysis. It is imperative to also show % populations rather than just fold change to gain confidence.

      We agree that there is a lot of variability. That is because differentiation happens in 3D in embryoid bodies, which contain many different cell types that differentiate in different proportions across independent experiments. We have now included the raw data in Supplementary Figure 4 D, with additional statistical analysis to show the expansion of arterial cells including also the suggested additional controls.

      (5) How does activation of these target genes cause increased arterialization? Is the emergence of non-HE populations suppressed? Or is it specific to the HE? The data on this should be clarified and also discussed. ANTO/Lesley text

      We have provided additional data clarifying the connection between increased arterialisation and hemogenic potential. We showed that the activation induces increased arterialisation and that IGFBP2 acts by supporting the acquisition of hemogenic potential. We have discussed this in lines 326-348 and provided a new figure to explain this in detail (figure 6)

      (6) Considering that IGFBP2 was chosen from the activated target gene(s) cluster, can the authors explain why the reduced CFU-M phenomenon observed in Figure 3G does not appear in the MethoCult assay for IGFBP2 treated cells (Figure 4B)?

      The difference could be explained by the fact that in Figure 3G, the cells underwent activation of multiple genes, while in Figure 4B, they were only exposed to IGFBP2. Our results show that IGFBP2 could at least partially explain the phenotype that we see with the activation, but we believe that during the activation experiments, there might be other signals available that might not be induced by IGFBP2 alone. We have also added a summary section and a figure to clarify the different mechanisms of action of the gene activation and IGFBP2.

      (7) Figure 4- while the experiments conducted support the role of IGFBP2 in increasing hematopoietic output, there is no experimental evidence to prove its function through paracrine signalling in HECs. The authors need to provide some evidence of how IGFBP2 supplementation specifically expands only the hematopoietic progenitors. Experimental strategies involving specifically targeting IGFBP2 in hemogenic/arterial endothelial cells are required to prove its cell type specific function. Additionally, assessing the in vivo functional potential of the hematopoietic cells generated in the presence of IGFBP2, by bone-marrow transplantation of CD34+ CD43+ cells, is essential. 

      The role of IGFBP2 in the context of HSC production and expansion was not the topic of our research, and we have not claimed that IGFBP2  affects the long-term repopulating capacity of HSPCs. Therefore, we believe that the requested experiments are not required to support the specific claims that we do make. We have now provided more experiments and bioinformatic analysis that support the role of IGFBP2 in inducing the progression of EHT from arterial cells to hemogenic endothelium, and to avoid misunderstandings, we have toned down our claims by editing the text regarding its paracrine effect s. 

      (8) Figure 4C-D -It is recommended to plot % populations along with fold change value. As this is a key finding, it is important to perform flow cytometry for additional hematopoietic markers- CD144, CD235a and CD41a to demonstrate whether this strategy can also expand erythroid-megakaryocyte progenitors. Telma

      Figure 4C already shows the percentage values; we have now added the percentage for Figure 4D in SF5C. We have also performed additional analysis as requested and added the data obtained to Supplementary Figure 5D.

      (9) In Figure 5, analysis showing the frequency of cells constituting different clusters, between untreated and IGFBP2-treated samples in the single-cell transcriptome analysis is essential. Additional experiments are required to validate the function of IGFBP2 through modulation of metabolic activity. Inhibition of oxidative phosphorylation in the IGFBP2treated cells should reduce the hematopoietic output. Authors should consider doing these experiments to provide a stronger mechanistic insight into IGFBP2-mediated regulation of hematopoietic emergence.

      We have now included the requested cluster composition in Supplementary Figure 5F. We decided not to include further tests on the metabolic profile of IGFBP2 as we already discussed in other papers that showed, using selective inhibitors, that the EHT coincides with a glycol to OxPhos switch. 

      (10) It is very striking to see that IGFBP2 supplementation changes the transcriptional profile of developing hematopoietic cells by increasing transcription of OXPHOS-related genes with concomitant reduction of glycolytic signatures, particularly at Day 13. However, the mitochondrial ATP rate measurements do not seem convincing. The bioenergetic profiles show that when mitochondrial inhibitors are added, both groups exhibit decreased OCR values and, on the other hand, higher ECAR. This indicates that both groups have the capability to utilize OXPHOS or glycolysis and may only differ in their basal respiration rates.

      Differences in proliferation rate can cause basal respiration to change. There is no information on how the bioenergetic profile was normalized (cell no./protein amount). Given that IGFBP2 has been shown to increase proliferation, it is very likely that the cells treated with IGFBP2 proliferated faster and therefore have higher OCR. The data needs to be normalized appropriately to negate this possibility.

      We have previously tested whether IGFBP2 causes an increase in proliferation by analysing the cell cycle of cells treated with it, as we initially thought this could be a mechanism of action. We have now provided the quantification of the cell cycle in the cells treated with IGFBP2, showing no effect was observed in cell cycle Supplementary Figure 4E. Following this analysis, we decided to plate the same number of cells and test their density under the microscope before running the experiment; each experiment was done in triplicate for each condition. We have now added this info to the method sections lines 806-813.  We did not comment on the basal difference, which we agree might be due to several factors, but we only compared the difference in response to the inhibitors, which isn’t affected by the basal level but exclusively by their D values. We have also included the formulas used to calculate the ATP production rate.

      Overall, it appears that IGFBP2 does not seem to primarily cause metabolic changes, but simply accelerates the metabolic dependency on OXPHOS. Hence, the term 'metabolic remodelling' must be avoided unless IGFBP2 depletion/loss of function analysis is shown.

      We thank the reviewer for suggesting how to interpret the data about the dependency on OXPHOS. We have now changed the conclusions and claims about the effect of IGFBP2. We have also included a cell cycle analysis of the hematopoietic cells derived upon IGFBP2 addition to show that they don’t show differences in proliferation that could cause the increase in colony formation we observed. Regarding the assay, we have plated the same number of cells for each group to make sure we were comparing the same number of cells, which we also assessed in the microscope before the test, and we eliminated the suspension cells during the washes that preceded the measurement. The review is correct in indicating that there is a basal difference in the value of OCR and ECAR where the IGFBP2 is lower at the start and not higher, which would not conceal higher proliferation. Finally, the ATP production rate is calculated on the variation of OCR and ECAR upon the addition of inhibitors, which normalizes for the basal differences.

    1. Temps Forts de la Vidéo "Peut on être adultes avec nos ados"

      Voici les temps forts de la vidéo avec une description des sujets abordés :

      • Introduction (0:00-3:00): Présentation de Cynthia Fleury, philosophe et psychanalyste, et du thème de la conférence : "Peut-on être adulte avec nos adolescents ?"
      • Statistiques sur la santé mentale des adolescents (3:00-7:00): Présentation des chiffres de Santé France sur la dégradation de la santé mentale des adolescents, notamment depuis la Covid-19. Discussion sur la conscientisation accrue de la santé mentale et les obstacles à la consultation d'un professionnel.
      • Clinique de l'adolescence (7:00-9:00): Exploration des transformations physiologiques et psychiques de l'adolescence, incluant la puberté, le développement cognitif et la construction de l'identité.
      • Le concept de "care" (9:00-14:00): Analyse du "care" comme élément central de l'individuation et de la construction d'un sujet en relation avec le monde. Discussion des travaux de Winnicott, Gilligan et Tronto sur l'éthique du "care".
      • Définition d'un adulte (14:00-23:00): Réflexion sur la définition d'un adulte selon le Larousse et proposition d'une dialectique pour le développement d'un sujet basée sur l'imagination vraie, le "pretium doloris" (prix de la douleur) et la "vis comica" (force comique).
      • L'adolescence comme expérience d'un "corps mutant" (23:00-28:00): Discussion du texte de Jean-Pierre Benoît, "L'adolescence, un excès de corps," et exploration des défis posés par les transformations corporelles et la découverte de la sexualité.
      • L'adolescence comme découverte de la vie comme "maladie chronique" (28:00-35:00): Analogie entre l'expérience de la maladie chronique et l'adolescence, toutes deux impliquant des ruptures biographiques, des atteintes à l'image de soi et des remises en question des projets de vie.
      • Déconnexion des adolescents et conduites à risque (35:00-38:00): Analyse de la déconnexion croissante des adolescents par rapport à la réalité du monde adulte et des conduites à risque comme moyen de se réapproprier son corps et son existence.
      • L'impact du Covid-19 (38:00-42:00): Discussion sur l'impact profond du confinement et de la pandémie sur la santé mentale des adolescents et des adultes, et sur la perte de chances pour les plus jeunes.
      • L'importance du lien (42:00-44:00): Recommandations pour maintenir le lien avec les adolescents, en utilisant la verbalisation, le non-verbal et le partage d'expériences communes.
      • Conclusion (44:00-46:00): Dernière question sur les activités offertes aux MNA pour vivre une vie d'adolescent et discussion sur la nécessité d'inclure le risque dans le processus de soin.

      ● Adolescence: Ce tag est essentiel car la vidéo explore de nombreux aspects de l'adolescence, tels que les transformations physiques et psychiques, la construction de l'identité, les conduites à risque et la relation aux adultes. ● Éducation: La vidéo aborde la question de l'éducation des adolescents, notamment le rôle des parents et la nécessité d'une autorité bienveillante. ● Santé Mentale: Les statistiques sur la santé mentale des adolescents et l'impact du Covid-19 occupent une part importante de la vidéo, justifiant ce tag. ● Philosophie: La vidéo s'appuie sur des concepts philosophiques pour analyser l'adolescence et la relation adulte-adolescent, notamment les travaux de Kant, Nietzsche et Ricker. ● Psychanalyse: Les théories psychanalytiques, en particulier celles de Winnicott, Anna Freud et Ronald Laing, sont utilisées pour comprendre le développement de l'adolescent. Concepts Clés: ● "Care": Ce concept central est analysé en profondeur, notamment à travers les travaux de Winnicott, Gilligan et Tronto. ● Individuation: La vidéo explore le processus d'individuation de l'adolescent, en lien avec le concept de "care". ● Rupture Biographique: Ce concept est utilisé pour illustrer les transformations profondes que traverse l'adolescent, en lien avec l'expérience de la maladie chronique. ● Corps Mutant: La vidéo s'intéresse à l'importance du corps dans l'expérience adolescente et aux défis posés par ses transformations. ● Conduites à Risque: Les conduites à risque, telles que la scarification et les tentatives de suicide, sont abordées dans la vidéo comme des manifestations de la quête d'identité et de la confrontation au réel. Autres Tags Pertinents: ● Parents ● Enfance ● Développement Personnel ● Psychologie ● Sociologie ● Communication ● Relation Adulte-Enfant ● Autorité ● Bienveillance ● Écrans ● Réseaux Sociaux ● Pandémie ● Confinement

  7. Nov 2024
    1. reply to u/Pawps4895 at https://old.reddit.com/r/typewriters/comments/1h1dcil/help_ink_ribbon_not_moving/

      That ghosting effect you're seeing may be down to your typing technique. Computer keyboard typing technique is different than typewriter technique. If you're pressing hard and/or bottoming the keys out, you may not be getting your fingers out of the way and causing the key to double strike while you're lifting your finger up.

      Instead, type as if they keys are hot lava. Strike and release them as quickly as possible and that ghosting should clear up. For more on technique, try: https://hypothes.is/users/chrisaldrich?q=tag%3A%22typing+technique%22

      If that isn't the issue, is that ghosting happening on all the keys or just a few? Cleaning things out certainly couldn't hurt: https://boffosocko.com/2024/08/09/on-colloquial-advice-for-degreasing-cleaning-and-oiling-manual-typewriters/

    1. Reviewer #2 (Public review):

      In this study, Kavaklıoğlu et al. investigated and presented evidence for a role for domesticated transposon protein L1TD1 in enabling its ancestral relative, L1 ORF1p, to retrotranspose in HAP1 human tumor cells. The authors provided insight into the molecular function of L1TD1 and shed some clarifying light on previous studies that showed somewhat contradictory outcomes surrounding L1TD1 expression. Here, L1TD1 expression was correlated with L1 activation in a hypomethylation dependent manner, due to DNMT1 deletion in HAP1 cell line. The authors then identified L1TD1 associated RNAs using RIP-Seq, which display a disconnect between transcript and protein abundance (via Tandem Mass Tag multiplex mass spectrometry analysis). The one exception was for L1TD1 itself, is consistent with a model in which the RNA transcripts associated with L1TD1 are not directly regulated at the translation level. Instead, the authors found L1TD1 protein associated with L1-RNPs and this interaction is associated with increased L1 retrotransposition, at least in the contexts of HAP1 cells. Overall, these results support a model in which L1TD1 is restrained by DNA methylation, but in the absence of this repressive mark, L1TD1 is expression, and collaborates with L1 ORF1p (either directly or through interaction with L1 RNA, which remains unclear based on current results), leads to enhances L1 retrotransposition. These results establish feasibility of this relationship existing in vivo in either development or disease, or both.

      Comments on revised version:

      In general, the authors did an acceptable job addressing the major concerns throughout the manuscript. This revision is much clearer and has improved in terms of logical progression.

    1. Reviewer #1 (Public review):

      Summary<br /> Roseman et al. use a new inhibitor of the maintenance DNA methyltransferase DNMT1 to probe the role of methylation on binding of the CTCF protein, which is known to be involved chromatin loop formation. As previous reported, and as expected based on our knowledge that CTCF binding is methylation-sensitive, the authors find that loss of methylation leads to additional CTCF binding sites and increased loop formation. By comparing novel loops with the binding of the pre-mRNA splicing factor SON, which localizes to the nuclear speckle compartment, they propose that these reactivated loops localize to near speckles. This behavior is dependent on CTCF whereas degradation of two speckle proteins does not affect CTCF binding or loop formation. The authors propose a model in which DNA methylation controls the association of genome regions with speckles via CTCF-mediated insulation.

      Strengths<br /> The strengths of the study are 1) the use of a new, specific DNMT1 inhibitor and 2) the observation that genes whose expression is sensitive to DNMT1 inhibition and dependent on CTCF (cluster 2) show higher association with SON than genes which are sensitive to DNMT1 inhibition but are CTCF insensitive, is in line with the authors' general model.

      Weaknesses<br /> There are a number of significant weaknesses that as a whole undermine many of the key conclusions, including the overall mechanistic model of a direct regulatory role of DNA methylation on CTCF-mediated speckle association of chromatin loops.

      (1) The authors frequently make quasi-quantitative statements but do not actually provide the quantitative data, which they actually all have in hand. To give a few examples: "reactivated CTCF sites were largely methylated (p. 4/5), "many CTCF binding motifs enriched..." (p.5), "a large subset of reactivated peaks..."(p.5), "increase in strength upon DNMT1 inhibition" (p.5); "a greater total number....." (p.7). These statements are all made based on actual numbers and the authors should mention the numbers in the text to give an impression of the extent of these changes (see below) and to clarify what the qualitative terms like "largely", "many", "large", and "increase" mean. This is an issue throughout the manuscript and not limited to the above examples.<br /> Related to this issue, many of the comparisons which the authors interpret to show differences in behavior seem quite minor. For example, visual inspection suggests that the difference in loop strength shown in figure 1E is something like from 0 to 0.1 for K562 cells and a little less for KCT116 cells. What is a positive control here to give a sense of whether these minor changes are relevant. Another example is on p. 7, where the authors claim that CTCF partners of reactivated peaks tend to engage in a "greater number" of looping partners, but inspection of Figure 2A shows a very minor difference from maybe 7 to 7.5 partners. While a Mann-Whitney test may call this difference significant and give a significant P value, likely due to high sample number, it is questionable that this is a biologically relevant difference.

      (2) The data to support the central claim of localization of reactivated loops to speckles is not overly convincing. The overlap with SON Cut&Tag (figure 2F) is partial at best and although it is better with the publicly available TSA-seq data, the latter is less sensitive than Cut&Tag and more difficult to interpret. It would be helpful to validate these data with FISH experiments to directly demonstrate and measure the association of loops with speckles (see below).

      (3) It is not clear that the authors have indeed disrupted speckles from cells by degrading SON and SRRM2. Speckles contain a large number of proteins and considering their phase separated nature stronger evidence for their complete removal is needed. Note that the data published in ref 58 suffers from the same caveat.

      (4) The authors ascribe a direct regulatory role to DNA methylation in controlling the association of some CTCF-mediated loops to speckles (p. 20). However, an active regulatory role of speckle association has not been demonstrated and the observed data are equally explainable by a more parsimonious model in which DNA methylation regulates gene expression via looping and that the association with speckles is merely an indirect bystander effect of the activated genes because we know that active genes are generally associated with speckles. The proposed mechanism of a regulatory role of DNA methylation in controlling speckle association is not convincingly demonstrated by the data. As a consequence, the title of the paper is also misleading.

      (5) As a minor point, the authors imply on p. 15 that ablation of speckles leads to misregulation of genes by altering transcription. This is not shown as the authors only measure RNA abundance, which may be affected by depletion of constitutive splicing factors, but not transcription. The authors would need to show direct effects on transcription.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      In the work: "Endosomal sorting protein SNX4 limits synaptic vesicle docking and release" Josse Poppinga and collaborators addressed the synaptic function of Sortin-Nexin 4 (SNX4). Employing a newly developed in vitro KO model, with live imaging experiments, electrophysiological recordings, and ultrastructural analysis, the authors evaluate modifications in synaptic morphology and function upon loss of SNX4. The data demonstrate increased neurotransmitter release and alteration in synapse ultrastructure with a higher number of docked vesicles and shorter AZ. The evaluation of the presynaptic function of SNX4 is of relevance and tackles an open and yet unresolved question in the field of presynaptic physiology.

      Strengths:

      The sequential characterization of the cellular model is nicely conducted and the different techniques employed are appropriate for the morpho-functional analysis of the synaptic phenotype and the derived conclusions on SNX4 function at presynaptic site. The authors succeeded in presenting a novel in vitro model that resulted in chronical deletion of SNX4 in neurons. A convincing sequence of experimental techniques is applied to the model to unravel the role of SNX4, whose functions in neuronal cells and at synapses are largely unknown. The understanding of the role of endosomal sorting at the presynaptic site is relevant and of high interest in the field of synaptic physiology and in the pathophysiology of the many described synaptopathies that broadly result in loss of synaptic fidelity and quality control at release sites.

      We thank the reviewer for their positive evaluation of our manuscript.

      Weaknesses:

      The flow of the data presentation is mostly descriptive with several consistent morphological and functional modifications upon SNX loss. The paper would benefit from a wider characterization that would allow us to address the physiological roles of SNX4 at the synaptic site and speculate on the underlying molecular mechanisms. In addition, due to the described role of SNX4 in autophagy and the high interest in the regulation of synaptic autophagy in the field of synaptic physiology, an initial evaluation of the autophagy phenotype in the neuronal SNX4KO model is important, and not to be only restricted to the discussion section.

      We thank the reviewer for their suggestions and agree that broader characterization would help us speculate on the underlying mechanism. To address this, we have conducted additional independent experiments investigating the role of SNX4 in neuronal autophagy, as suggested by this reviewer. These experiments are now included in the main figures and are no longer limited to the discussion section. Please see the detailed responses to this reviewer's recommendations below.

      Reviewer #2 (Public Review):

      Summary:

      SNX4 is thought to mediate recycling from endosomes back to the plasma membrane in cells. In this study, the authors demonstrate the increases in the amounts of transmitter release and the number of docked vesicles by combining genetics, electrophysiology, and EM. They failed to find evidence for its role in synaptic vesicle cycling and endocytosis, which may be intuitively closer to the endosome function.

      Strengths:

      The electrophysiological data and EM data are in principle, convincing, though there are several issues in the study.

      We thank the reviewer for their positive evaluation of our manuscript.

      Weaknesses:

      It is unclear why the increase in the amounts of transmitter release and docked vesicles happened in the SNX4 KO mice. In other words, it is unclear how the endosomal sorting proteins in the end regulate or are connected to presynaptic, particularly the active zone function.

      We thank the reviewer for their suggestions and agree that further characterization would help to understand how endosomal sorting proteins regulate presynaptic neurotransmission. We have now added extra data on electrophysiological recordings clarifying SNX4’s role in the synapse. Please see the detailed responses to this reviewer's recommendations below.

      Reviewer #3 (Public Review):

      Summary:

      The study aims to determine whether the endosomal protein SNX4 performs a role in neurotransmitter release and synaptic vesicle recycling. The authors exploited a newly generated conditional knockout mouse to allow them to interrogate the SNX4 function. A series of basic parameters were assessed, with an observed impact on neurotransmitter release and active zone morphology. The work is interesting, however as things currently stand, the work is descriptive with little mechanistic insight. There are a number of places where the data appear to be a little preliminary, and some of the conclusions require further validation.

      Strengths:

      The strengths of the work are the state-of-the-art methods to monitor presynaptic function.

      We thank the reviewers for their positive evaluation of our manuscript.

      Weaknesses:

      The weaknesses are the fact that the work is largely descriptive, with no mechanistic insight into the role of SNX4. Further weaknesses are the absence of controls in some experiments and the design of specific experiments.

      We thank the reviewer for their suggestions and agree that addition of extra control groups and experiments would strengthen interpretation of the observed phenotype. To address this, we have now performed experiments to investigate the miniature excitatory postsynaptic currents and added extra control groups such as overexpression of SNX4 on control background. In addition, we assessed SNX4-mediated neuronal autophagy as a potential molecular mechanism by which SNX4 affects synaptic output. Please see the detailed responses to this reviewers’ recommendations below.

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      (1) The characterization of the neurite outgrowth presented in Figure 1 is a necessary starting point for the characterization of the model and the interpretation of the following data. Being the analysis conducted at 21 DIV, a significant portion of the neurite tree is out of the analyzed field. Adding sholl analysis will better indicate the complexity of the that appears to be influenced by SNX4 loss in the representative images shown in Figure 1f.

      We fully agree and have now performed a Sholl analysis of dendrite branches to investigate dendritic complexity. (Figure 1(i), page 2-3, line 86-88). SNX4 depletion does not affect dendrite length or dendrite branching.

      (2) Analogously, the characterization of synapse number is of relevance for the interpretation of the data. For a better flow of the data, Figure 4 might be presented as Figure 2 (without the repetition of panel h in Figure 1). An explanation of how VAMP2 puncta are processed is necessary in the method section. A double labelling with a postsynaptic marker would allow trafficking organelles to be distinguished from mature synaptic contacts. Indeed, the analysis of VAMP2 intensity along neurite in mature 21DIV neurons should reveal peaks in the intensity profile that represent synaptic contacts. For unexplained reasons, the profile is rather flat in the two experimental groups. Focusing on axonal branches will surely result in a peaked profile for VAMP2 labelling.

      We fully agree that the characterization of synapses is relevant for the interpretation of the data. We have now added a section in our Material and Methods how the VAMP2 puncta are processed (p14 line 517-520). Instead of labeling mature synapses using double labeling of VAMP2 and PSD95, we analyzed the number of active synapses in live neurons using SypHy (Fig. 3g). The reviewer is correct that the VAMP2 data presented in Fig 1I and Fig 4 is part of the same dataset and we have clarified this in the figure legend. In Fig 1I only the total number of VAMP2 puncta is plotted as a marker for synapse number, while in Fig 4 we assess VAMP2 as potential SNX4 sorting cargo (Ma et al., 2017). Because of these different aims, we prefer to keep the figures separate. The analysis of VAMP2 intensity along the distance of the soma is a Sholl analysis (Fig. 4d), represents the average VAMP2 intensity over distance from the soma of 35-41 neurons per group. In contrast to a line scan of a single neurite, this average profile lacks the peaks of individual synapses.

      (3) Miniature excitatory postsynaptic currents recordings would strengthen the synaptic characterization and complement the electrophysiological recordings shown in Figure 2. Analyzing frequency and amplitude parameters would complement the data on the number of synaptic connections defined by the pre and postsynaptic colocalization puncta as suggested above and may support the data shown in Figure 3 g that suggests a decreased number of active synapses in SNX4-KO cells.

      We fully agree that the characterization of miniature excitatory postsynaptic currents would strengthen the synaptic characterization and complement the other electrophysiological data. Therefore, we have now added additional experiments showing the mEPSCs (Fig. 2k-m, page 4) in SNX4 cKO neurons versus control. This data shows that the amplitude and frequency of spontaneous miniature EPSCs (mEPSCs) were not affected upon SNX4 depletion, consistent with a normal first evoked EPSC and RRP estimate. Furthermore, these data suggest that it is unlikely that the observed increase in neurotransmission is due to post-synaptic effects.

      (4) Recordings on the first evoked response shown in Figure 2 b and quantified in Figures c and d suggest that SNX4 overexpression per se exerts some effect on the Amplitude and the Charge of the first evoked response. This is also evident in the supplementary Figure 2 with lower frequency trains. An additional experimental group, namely control+SNX4 is needed for the correct interpretation of the observed phenotype. The possibility that SNX4 per se exerts an effect on evoked transmission could be discussed in terms of putative mechanisms and interactions.

      We thank the reviewer for their suggestion and agree that an additional experimental group (control + SNX4) would strengthen interpretation of the observed phenotype. We have now added a new experimental condition with overexpression of SNX4 on a control background (Supplementary Fig. 3, page 20). This data shows that the amplitude and charge of the first evoked response were not affected in control + SNX4 neurons compared to control, and no differences were detected in the response to the 40 Hz stimulation train (Supplementary Fig. 3a-e).  Together, these data suggest that SNX4 overexpression in itself does not affect the neurotransmission protocols studied in SNX4 cKO experiments.

      (5) To correctly interpret the SyPhy experiments and exclude an effect of SNX silencing on SV recycling, it is suggested to repeat the experiments shown in Figure 3 in the absence and in the presence of bafilomycin. Indeed, the quantifications shown in Figure 3 d and f do not represent "release fraction" as stated (lines 139/140) but they rather refer to an average difference between release fraction and recovered fraction. With the use of bafilomycin, the comparison of the deltaFmax/deltaFNH4Cl with and without bafilomycin would enable the release fraction to be correctly evaluated and compared.

      We appreciate the reviewer’s suggestion and agree on the importance of considering the impact of SV recycling when evaluating the released fraction. We agree that the presence of bafilomycin is critical to isolate the released component during stimulation. We have now rephrased this conclusion. To assess synaptic recycling in these assays, bafilomycin in not critically required and we show by multiple independent experiments, including SypHy and FM64 dye assays, that SV recycling is either not affected or the effect is too small to be detected by these methods.

      (6) In the ultrastructural analysis, additional quantifications are needed to exclude the accumulation of endosome-like structures. It is not clear if, in the evaluation of total SV number (Figure 5e), the authors counted all vesicles or vesicles < 50nm. This has to be explained and additional quantification of # of SV < 50nm and # SV > 50nm is informative, taking into account the endosomal nature of SNX4. Indeed, although the average size of SV is not changed (fig. 5 d), the density of "bigger vesicle" may result from endosomal-like structure accumulation. An additional suggested quantification is on vesicle # SV > 80nm as previously reported in the cited references dealing with endosomal proteins and presynaptic morphology.

      We fully agree that the characterization of vesicle size is important and that it was not clearly stated which vesicles were included in the total number of SV (Fig. 5e). We have now added this to the figure description. We have also added a histogram that contains the vesicle numbers of different bin sizes for SNX4 cKO synapses and control synapses (Supplementary Fig. 4, page 21) including # SVs > 80nm. (Whilst it seems that there are more “bigger” vesicles in the KO, further analysis revealed that this is mostly driven by one experiment and this effect is not consistent.)

      (7) Due to the high scientific interest in presynaptic autophagy for SV recycling and degradation, and the paucity of experimental work assessing the proteins involved, an initial evaluation of the neuronal autophagy process (by western blot analysis and immunocytochemistry) for the characterization of the model will better support the paragraph in the discussion (lines 314-322) and contribute to future work in the field. Although very rare, autophagosomes quantification at presynaptic sites can also be performed from the already acquired images. A double membrane structure with the material inside is evident in the representative control image presented!

      We appreciate the reviewer’s suggestion and agree that presynaptic autophagy is an interesting potential mechanism that would elaborate our current working model. To address the reviewers’ suggestion, we added multiple independent experiments to investigate basal autophagy markers such as ATG5 using western blot analysis, characterization of p62 levels using immunohistochemistry and performed additional morphometric analysis on the electron microscopy data (Supplementary Fig. 5). In SNX4 cKO neurons, there was no significant difference in P62 puncta numbers or P62 somatic intensity under basal conditions or after blocking autophagic P62 degradation by bafilomycin treatment, suggesting that autophagic flux remains normal. Also, no changes in total ATG5 protein levels were observed and ultrastructural analysis revealed no differences in the total number of autophagosomes. Collectively, these data indicate that SNX4 depletion does not impact the basal autophagic flux, ATG5 protein levels, or the number of autophagosomes.

      Minor points:

      (1) Dorrbaun et al. 2018 is missing from the reference list. In the legend to figure 1 there is an incorrect reference to Figure 6, rather than Figure 4.

      We have now adjusted the figure legend and added the reference (page 16, line 604).

      (2) Information on the construct employed for the rescue is missing. Is it a fluorescent tag construct? Representative images of the three autaptic neurons (control, KO, KO+SNX4) would nicely complement data presentation in Figure 2. 

      We have now elaborated on this in material and methods section (p12, line 418-421). Unfortunately, we did not obtain pictures of autaptic neurons used for electrophysiology experiments.

      Reviewer #2 (Recommendations For The Authors):

      (1) Figure 2d and f are somewhat inconsistent. Total charges for the 1st EPSCs differ almost 2-fold in the same condition.

      We appreciate the reviewer’s concern. The average EPSCs charge of the first evoked was 89, 122 and 57 pC for control, KO and rescued neurons respectfully. The average charge of the first pulse of 40Hz train was 41,58 and 32 pC for control, KO and rescued neurons respectfully, which is roughly 50% of the naïve response of the same cells. These trains were recorded after 2 or 3 other stimulation paradigms, which can have affected the total charge released in the 40Hz train. That said, the proportional difference between groups is high comparable, with a 37% increased average charge released in SNX4 cKO compared to control in the naïve response and 41% increased response in the first response of the 40 Hz train, and rescued cells show a 53% reduction in average released charge compared to control in the naïve response compared to a 44% reduction in the first response of the 40 Hz train. Although the absolute values differ between these readouts, we conclude that the biological comparison between groups is consistent.

      (2) Figure 2h. This type of analysis has a drawback. See Neher (2015) for the problems associated with this analysis.

      We fully agree with the reviewer’s comment. As noted in our discussion (page 9 line 285), while this analysis has its limitations, it can still provide an indication of the ready releasable pool.   

      (3) The EPSC phenotype may be due to postsynaptic effects. This should be excluded by additional experiments (mEPSC analysis) or further clarification.

      We fully agree that the characterization of miniature excitatory postsynaptic currents recording would strengthen the synaptic characterization and complement the electrophysiological recordings. Therefore, we have now added additional experiments showing the mEPSCs (Fig. 2k-m) in SNX4 cKO neurons versus control. This data shows that the amplitude and frequency of spontaneous miniature EPSCs (mEPSCs) were not affected upon SNX4 depletion, suggesting that it is unlikely that the observed increase in neurotransmission is due to post-synaptic effects.

      (4) The increased number of docked vesicles observed in EM and the increased slope (vesicle recruitment, Figure 2h) are not consistent with each other. Maybe the definition of docked vesicles is unclear in this version of the manuscript.

      As noted in our material & methods (page 15, line 547-548), SVs were defined as docked if there was no distance visible between the SV membrane and the active zone membrane. We have added the pixel size for clarification. Indeed, we do not observe an increase in release probability or first evoked response, which would correspond with an increased docked pool. However, we think that the increase in docked vesicles might contribute to an enhanced SV recruitment (see discussion).

      (5) Figure 3: Vesicle cycling was monitored in only a limited condition. It is known that there are multiple pathways of vesicle cycling. Ideally, these pathways should be dissected. At least, the authors mention the possibility that they have missed some "positive" conditions.

      We fully agree with the reviewer’s comment that vesicle recycling is complex with several parallel pathways involved. While we did not study individual endocytosis pathways, we used different assays covering various recycling pathways. The SypHy assay (Fig. 3c & f) combined with the 100 AP stimulation paradigm at room temperature predominantly addresses clathrin-mediated endocytosis. Additionally, the FM-64 dye assay at 37 degrees Celsius covers ultrafast endocytosis pathways as well as bulk endocytosis routes. Since neither assay showed major effects, we decided not to pursue further experiments focusing on different endocytosis pathways.

      Reviewer #3 (Recommendations For The Authors):

      Major points:

      (1) Since all of the work here is culture-focussed, the in vivo phenotype is not as relevant, however the in vitro properties are. The incomplete Cre-dependent removal of SNX4 is concerning (especially axonal SNX4 levels identified via immunofluorescence), however, the main concern is that there was no profiling of the other molecular changes within these cultures. This is important, since there may be considerable alterations in the expression of a number of presynaptic proteins which may explain the observed phenotypes. Ideally, these cultures could have been profiled in an unbiased manner via mass spectrometry to identify potential changes in the presynaptic proteome, or at the very least the levels of key fusion molecules would have been assessed via Western blotting.

      We thank the reviewer for their suggestion and agree that mass spectrometry would strengthen the interpretation of the observed phenotype. However, due to contractual constraints, we are unable to pursue a mass spectrometry follow-up experiment. We agree that characterizing key fusion molecules is of potential interest. Therefore, based on literature, we selected a likely candidate, VAMP2, which did not show any alterations in expression levels when knocking out SNX4. Given the previously described role of SNX4 in the degradation pathway, one would expect increased degradation of key fusion molecules if they are recycled by SNX4. Other literature indicates that reduced levels of key fusion molecules, such as synaptotagmin or SNAP-25 (Broadie et al., 1994; Washbourne et al., 2001) , do not mimic our phenotype.

      (2) The experiments reported in Figure 2, in particular those in 2c and 2d, suggest that overexpression of SNX4 has a dominant-negative effect on neurotransmitter release. This is strongly supported by the supplementary data during a stimulus train (particularly the start point of the 5 Hz train in Supplementary Figure 2). Therefore, the perceived rescue of EPSC charge in Figure 2f, 2g may be a result of SNX4 inhibiting neurotransmitter release. A determination of the impact of SNX4 overexpression (and level of overexpression) in WT neurons is essential to show that this is a bonefide rescue, rather than a direct inhibition by SNX4 overexpression.

      We thank the reviewer for their suggestion and agree that an additional experimental group (control + SNX4) would strengthen interpretation of the observed phenotype. We have now added a new experiment with an extra experimental condition with overexpression of SNX4 on a control background (Supplementary Fig. 3 page 21). This data shows that the amplitude and charge of the first evoked response were not affected in control + SNX4 neurons compared to control, and no differences were detected in the response to the 40 Hz stimulation train (Supplementary Fig. 3a-e).  Together, these data suggest that SNX4 overexpression in itself does not affect the neurotransmission protocols studied in SNX4 cKO experiments.

      (3) The experiments in Figure 3 clearly reveal a lack of effect of SNX4 depletion on synaptic vesicle endocytosis. However, the assumption that synaptic vesicle recycling is unaffected is a little premature. The fact that the second evoked SypHy peak is significantly larger than the first (Figures 3c-e) suggests that more vesicles may be recycling in KO neurons. Furthermore, the FM dye experiments do not aid interpretation, since there may be insufficient time (10 min) for new vesicles to be generated from endosomal intermediates experiments. Therefore, to confirm an absence of effect on recycling, the authors could either 1) perform the same experiment as 3c, but with 4 stimulation trains (to drive the system harder to reveal any phenotype) or 2) repeat the FM dye experiment but increase the time between loading and unloading to 30 min.

      We fully agree with the reviewers' comment that vesicle recycling is an important component to consider and is complex with several parallel pathways involved. We conducted multiple independent experiments covering the most significant recycling pathways. The SypHy assay (Fig. 3c & f) combined with the 100 AP stimulation paradigm at room temperature predominantly addresses clathrin-mediated endocytosis. Additionally, the FM-64 dye assay at 37 degrees Celsius covers ultrafast endocytosis pathways as well as bulk endocytosis routes. To further challenge the system and reveal recycling phenotypes, we included a second 100 AP stimulation in our SypHy assay. While only the increase of the second SypHy peak is significant, the absolute numbers do not differ much from the first peak (0,17 for control and 0,21 for KO second peak and 0,19 for control and 0,22 for KO first peak, Supplementary table1). We nevertheless do not see any effects on recycling after the second peak (mean decay time is 27 for control and 26 for KO Supplementary Table 1). A single 100 AP 40 Hz train depletes all the synchronous release (not shown) and most of the evoked charge (see Fig 2f), hence two of these trains with one minute recovery is already a very demanding protocol. Although increasing the time between loading and unloading to 30 minutes might uncover other recycling components, it has been shown that ultrafast endocytosis occurs within 30 seconds (Watanabe et al., 2013), suggesting that 10 minutes should provide enough time for synaptic vesicle recycling. This is also evident from the fact that we can significantly destain synapses loaded with FM dye by electrical stimulation (Fig 3j), indicating that synaptic vesicle recycling took place. Since neither assay showed major effects, we concluded that under these circumstances, synaptic recycling is not significantly affected. However, we cannot exclude the possibility that recycling deficits in SNX4 cKO neurons could be detected in other paradigms,

      (4) There is no obvious effect on VAMP2 levels or location in SNX4 KO neurons (Figure 4). However, when one considers that SNX4 is proposed to have a role in VAMP2 trafficking, it is surprising that an experiment examining the live trafficking of VAMP2-SypHy was not performed. This would have revealed activity-dependent alterations that would have been missed by simply measuring VAMP2 expression and localization, and potentially provided a molecular explanation for the enhanced neurotransmitter release during a stimulus train.

      We appreciate the reviewer’s suggestion and agree that it could be a valuable experiment However, overexpressing a VAMP2-pHluorin construct might obscure potential phenotypes related to VAMP2 trafficking. SNX4 is expected to be involved in VAMP2 recycling, even with activity-dependent changes. Mis-sorted VAMP2 would accumulate in acidic vesicles, which could be masked by the VAMP2-pHluorin construct. Similarly, mis-sorting of other SNX4 cargo, such as the transferrin receptor, has been identified through lysosomal degradation, as shown by Western blot analysis of expression levels of the endogenous protein. We did not detect any differences in endogenous levels of VAMP2 within 21 days of SNX4 deletion (Fig 4), indicating that SNX4-dependent endosome sorting is not essential for VAMP2 recycling.

      (5) The morphological data in Figure 5 report a series of small changes in docked vesicles and active zone length. In many cases, significance is obtained due to synapses being used as the experimental n, and thus inflating the statistical power. When one considers that no significant effect was observed on evoked release (apart from during a stimulus train), it suggests that the number of docked vesicles does not alter release probability in this system (which the authors point out). Instead, they suggest that an increased supply of vesicles is responsible, via increased recruitment to RRP/releasable pool (but not via increased recycling). If this is the case, it should have been reflected as an increase in the evoked SypHy response in Fig 2c,d (which is borderline significant). What may help is to determine the morphological landscape immediately after a stimulus strain, since this is the only condition where enhanced release is observed, and thus provide a morphological correlate to the physiological data.

      We fully agree with the reviewer’s suggestion that an ultrastructural characterization immediately after a stimulus train would be informative. Unfortunately, contract constraints prevent us from performing this experiment. For our ultrastructural morphological data, we treated synapses as individual experimental n since it is not possible to determine whether synapses in a micronetwork on one sapphire originate from the same neuron. We used 18 independent sapphires from 3 independent pups to ensure the technical and biological replication of our data and measuring independent neurons. We fully agree with the reviewers comment to be careful with ‘inflating the statistical power’ due to potential nesting effects when using synapses as experimental n. To mitigate the potential nesting effect of analyzing multiple synapses per neuron, the intracluster correlation (ICC) is calculated per variable and per nesting effect. If ICC was close to 0.1, indicating that a considerable portion of the total variance can be attributed to e.g. synapse or sapphire, multilevel analysis was performed to accommodate nested data (Aarts et al., 2014).

      Minor points

      (1) When a new mouse model is generated, it is usually accompanied by a thorough characterization of its properties. However, in this case, there was no information provided about the conditional SNX4 knockout mouse. This is surprising and at a minimum, the following should be provided a) the background strain, b) method of generation, c) the number of animals used to establish the colony, d) breeding strategy, e) backcrossing strategy, f) genotyping protocol.

      We apologize that a thorough characterization of our novel mouse model was lacking and therefore added this to our material & methods section (page 11, line 377-391).

      (2) There is a noticeable difference between WT and KO neurons during train stimulation in Figure 2f, however, this appears to be due to the fact that there is a far higher EPSC charge to begin with in KO neurons. Why is there such a disparity when there is no difference in response to single pulses (Figures 2b-d) or presynaptic plasticity (Figure 2e)?

      We understand the reviewer’s concern. We excluded an outlier (3x SD) in the KO dataset that drove the initial far higher EPSC charge in the graph (was already excluded for the statistics, Supplementary table 1). The average charge of the first pulse of 40Hz train is 41 pC and for KO neurons 58 pC, which did not differ significantly.  These trains of Fig. 2f were recorded after 2 or 3 other stimulation paradigms, which can have affected the total charge released in the 40Hz train. That said, the proportional difference between groups is high comparable between Fig 2b-d and 2f, with a 37% increased average charge released in SNX4 cKO compared to control in the naïve response (Fig. 2d) and 41% increased response in the first response of the 40 Hz train (Fig. 2f), and rescued cells show a 53% reduction in average released charge compared to control in the naïve response compared to a 44% reduction in the first response of the 40 Hz train. Although the absolute values differ between these readouts, we conclude that the biological comparison between groups is consistent.

      (3) Line 343-344 - "(Supplementary Figure 1a)" should be "(Figure 1a)".

      We thank the reviewer for this comment and adjusted this in the manuscript.

    1. Welcome back to stage two of this advanced demo lesson and again have included full instructions attached to this lesson.

      And this stage of the demo will be another one where you're entering lots of commands because you're going to automate the build of the WordPress application instance.

      So again, I would recommend opening the instructions for this demo lesson and copy and pasting the commands rather than typing them out by hand.

      Now at this point in the advanced demo series, you're going to have a leftover instance that you used to manually install WordPress in the previous stage.

      It should be called WordPress - Manual.

      So I'm going to want you to go ahead and right click on that and select terminate instance and confirm that process to remove this instance from your AWS account.

      We're going to be setting up exactly the same single instance deployment of WordPress, so both the database and the application on the same instance.

      But instead of manually building this, we're going to be using a launch template.

      So from the EC2 console, just go ahead and click on launch templates under instances.

      The first step is to create a launch template for our WordPress application.

      So go ahead and click on create launch template.

      Now launch templates are actually a new version of launch configurations that were previously used with auto scaling groups.

      Launch templates allow you to either launch instances manually using the template or they can be part of auto scaling groups.

      But what a launch template allows you to do is to specify all of the configuration in advance to launch an instance and that template can be used to launch one or many instances.

      So we're going to create a launch template which will automate the installation of WordPress, MariaDB and perform all of the configuration.

      And a launch template can actually have many different versions, which is a feature we'll use throughout this demo series as we evolve the design.

      So the first step is to name this template and we're going to call it WordPress.

      Under template version description, go ahead and enter single server DB and app.

      And then check this box which says provide guidance to help me set up a template that I can use with EC2 auto scaling.

      We're not immediately going to set it up as part of an auto scaling group, but it will help us highlight any options which are required if we want to use it with an auto scaling group.

      Now launch templates can actually be created from scratch or they can be based on a previous template version.

      If we expand source template, you're able to specify a template which this template is based on.

      But in this case, we're creating one from scratch so we won't set any of those options.

      Now just scroll down.

      So the next thing we're going to define in this launch template is the AMI that we're going to use.

      So go ahead and click on Quickstart.

      And once this has changed, we're going to use the same AMI we've been using previously.

      So I want you to go ahead and click on Amazon Linux, specifically Amazon Linux 2023.

      It should be the SSD volume type.

      It should be listed as free tier eligible and just make sure that you've got 64 bit x86 selected.

      And then scroll down further still and in the instance type drop down, we're looking for the T series of instances.

      And then you need to select the one that's free tier eligible.

      In most cases, this will be T2.micro, but select whichever is free tier eligible.

      We want to keep this advanced demo as much as possible within the free tier.

      Scroll down again and for key pair, just make sure that it says don't include in the launch template.

      Move down further still to network settings.

      Then make sure select existing security group is selected.

      And then in the security groups drop down, click in that and make sure that you select the A4L.

      VPC - SG WordPress.

      So this is the security group which will automatically be associated with any instances launched using this launch template.

      So select A4L.

      VPC - SG WordPress and there will be some randomness after this.

      That's fine.

      Just make sure you select the SG WordPress group and then we can scroll down further still.

      Now we can leave storage volumes as default.

      We won't set any resource tags.

      We won't do any configuration of network interfaces, but I will want you to expand advanced details.

      There are a few things that we need to set within advanced details.

      The first is an IAM instance profile.

      So click in this drop down and then make sure that you pick A4L.

      VPC - SG WordPress instance profile.

      Again, there will be some randomness.

      That's fine.

      What this is doing is creating the configuration which will attach an instance role to this EC2 instance.

      And this instance role is going to provide all the permissions required to interact with the parameter store and the elastic file system and anything else that this instance requires.

      And this was pre-created on your behalf using the cloud formation template.

      Next, scroll down further still and look for credit specification.

      Remember, this is the same option that you set when launching an instance manually.

      Now, as before, it's always best to set this to unlimited.

      But if you are using a brand new AWS account, then it's possible that AWS won't allow you to use this option.

      So you should probably go ahead and pick standard.

      It won't make that much of a difference.

      I'm going to pick unlimited, but I do suggest if you are using a fairly new account, you go ahead and select standard.

      So that's the configuration for the instance, the base level configuration.

      What I want you to do now though is to scroll all the way down to the bottom and there's a user data box.

      This user data allows us to specify bootstrapping information to automatically configure our EC2 instances.

      So into this user data box, I want you to paste the entire code snippet within stage 2B of this stages instructions.

      And again, they're attached to this lesson.

      The top line should be hash bang forward slash bin forward slash bash and then a space hyphen XE.

      And then if you scroll all the way down to the bottom, the last line should be RM space forward slash TMP forward slash DB dot setup.

      And now we can see we've pasted this entire user data.

      Once you've done that, go ahead and click on create launch template.

      Now that user data that you just pasted in is essentially all of the commands that you ran in the previous stage of the demo.

      Only instead of pasting them one by one, you've defined them within the user data.

      So this simply automates the process end to end.

      So to test this, go ahead and click on launch templates towards the top of the screen.

      It should show that you have a single launch template.

      It's called WordPress.

      The default version is one and the latest version is one.

      And as we move throughout this demo series, the latest version and the default version will change.

      So just keep an eye on those as we go.

      For now, though, I want you to click in the checkbox next to this launch template, click on actions and then launch instance from template.

      So this is going to launch an EC2 instance using this launch template.

      We're asked to choose a launch template and a version and define the number of instances and we can leave all of these as the defaults.

      If we just scroll down, you'll see how it's pre-populating all of these values with the configuration from the launch template.

      And that's what we want.

      Under key pair name, just select to proceed without a key pair not recommended.

      And that's the default value.

      Scroll down further still.

      Even the networking configuration is partially pre-populated.

      The only thing we need to do is specify a subnet that this instance will be launched into.

      And when we configure auto scaling groups to use this launch template, the auto scaling group will configure the subnets on our behalf.

      Because we're launching an instance directly from the launch template, we have to specify this subnet.

      So click in the subnet dropdown and then look for SN-PUB-A.

      Because we're going to deploy this WordPress instance into the public subnet in Availability Zone A.

      So select that.

      Scroll down.

      Look for the resource tag section and click on add tag.

      We're going to add a tag to the instance launched by this template.

      So into key, just type name and then for value, use WordPress-LT.

      And this will just tell us that this is an instance launched using the launch template.

      Once you've entered those, just scroll all the way down to the bottom and click launch instance.

      And this will launch an EC2 instance using this template.

      And this will automate everything that we had to do in the previous stage manually.

      So this saves us significant time and it enables us to use automation in later stages of this demo series.

      So now go ahead and click on the instance ID in this success box and this will take you to the EC2 console.

      Just give this instance a couple of minutes to finish its build process.

      Even though we're automating the process, it does still take some time to perform the installation and the configuration of all of those different components.

      So go ahead and just copy the public IP version for address of this instance into your clipboard.

      And then after you've waited a few minutes, open that in a new tab.

      If you get an error or it opens with a blank page, then you just need to give it a few minutes longer.

      But when it's finished, it should show the same WordPress installation screen.

      Once it does load the installation screen, we're going to follow the same process.

      So site title is Categorum, username is Admin.

      Enter the same password and then enter the fake test at test.com email address.

      Then click on install WordPress.

      Then click on login.

      Enter admin again.

      Enter the password.

      Click on login.

      It looks as though our automated WordPress build has worked because the dashboard has loaded.

      Click on posts.

      Delete the default post.

      Click on add new.

      For the title, the best animals again, click on the plus, select gallery, click on upload.

      And again, pick a selection of animal pictures and click on open.

      Remember, this is a new EC2 instance.

      So the one we previously terminated will have also deleted the data on that previous instance.

      Once these images have uploaded, click on publish and then publish again to upload the images to the EC2 instance and store the data within the database.

      So remember two components, the data stored in the database and the images or media stored locally on the EC2 instance.

      Click on view post to make sure that this loads correctly.

      It does.

      So that means the automatic build has worked okay.

      Everything's functioning as we expect.

      This has been an automatic build of a functional WordPress application.

      Now, the only thing that's changed from the previous stage of this advanced demo series is we've automated the build of this instance.

      It still has much the same limitations as the previous stage.

      So while we can improve the build time and we can use launch templates to support further automation, the database and application are still on the same instance.

      So neither can scale without the other.

      The database of the application is still located on that instance, meaning scale in or out operations risk this data.

      The WordPress content store is also stored locally on the instance.

      So again, any scale in or out operations risk the media that's stored locally as well as the database.

      Customers still connect directly to the instance, which means we can't perform health checks or automatically heal any failed instances.

      For this, we need a load balancer which we'll be looking at in later stages of this demo series.

      And of course, the IP address of the instance is still hard coded into the database.

      So this is something else we need to resolve as we move through the demo series.

      With that being said, though, that is everything that you needed to do in stage two of this demo series.

      So in this stage, you've automated the build of the WordPress instance using a launch template.

      Now, in stage three, you're going to migrate the data from the local database on EC2 into RDS.

      And this will move the data out of the lifecycle of the EC2 instance.

      And this makes it easier to scale.

      So in stage three, you're going to perform that migration and then update the launch template to take account of that configuration change.

      So go ahead and complete this stage of the demo lesson.

      And when you're ready, I'll look forward to you joining me in the next.

    1. residential racial

      Still using race as a tag here. Not a super fan but if carefully explained how this is being used as a measure for systemic and structural racism and show how it correlates with income and thus likely other unmeasured determinants.

    2. Model 3 included all factors in Model 2 plus %AGA

      Why not also have Model 1 + %AGA if part of the point is that doing this does tag mortality - I would like to see that here

    1. Author response:

      Public reviews:

      Reviewer #1:

      Epigenetic regulation complex (PRC2) is essential for neural crest specification, and its misregulation has been shown to cause severe craniofacial defects. This study shows that Eed, a core PRC2 component, is critical for craniofacial osteoblast differentiation and mesenchymal proliferation after neural crest induction. Using mouse genetics and single-cell RNA sequencing, the researcher found that conditional knockout of Eed leads to significant craniofacial hypoplasia, impaired osteogenesis, and reduced proliferation of mesenchymal cells in post-migratory neural crest populations.

      Overall, the study is superficial and descriptive. No in-depth mechanism was analyzed and the phenotype analysis is not comprehensive.

      We thank the reviewer for sharing their expertise and for taking the time to provide a helpful suggestion to improve our study. We are gratified that the striking phenotypes we report from Eed loss in post-migratory neural crest craniofacial tissues were appreciated. The breadth and depth of our phenotyping techniques, including skeletal staining, micro-CT, echocardiogram, immunofluorescence, histology, and unbiased single-cell gene expression analysis, provide comprehensive data in support our conclusion that PRC2 is required for craniofacial osteoblast differentiation. We hypothesize that epigenetic regulation of chromatin accessibility downstream of PRC2 activity is the molecular mechanism that underlies these phenotypes. To test this hypothesis in our revision, we are using CUT&Tag to profile H3K27me3 epigenetic modifications genome-wide and at the loci encoding the differentially expressed genes revealed by our single-cell transcriptomics in developing craniofacial structures. We anticipate that these experiments will reveal an epigenetic mechanism underlying the phenotypes we report from Eed loss in post-migratory neural crest craniofacial tissues.

      Reviewer #2:

      Summary:The role of PRC2 in post-neural crest induction was not well understood. This work developed an elegant mouse genetic system to conditionally deplete EED upon SOX10 activation. Substantial developmental defects were identified for craniofacial and bone development. The authors also performed extensive single-cell RNA sequencing to analyze differentiation gene expression changes upon conditional EED disruption.

      Strengths:

      (1) Elegant genetic system to ablate EED post neural crest induction.

      (2) Single-cell RNA-seq analysis is extremely suitable for studying the cell type-specific gene expression changes in developmental systems.

      We thank the reviewer for their generous and helpful comments on our study. We are pleased that our mouse genetic and single-cell RNA sequencing approaches were appropriate in pairing the craniofacial phenotypes we report with distinct gene expression changes in post-migratory neural crest tissues upon Eed deletion.

      Weaknesses:

      (1) Although this study is well designed and contains state-of-the-art single-cell RNA-seq analysis, it lacks the mechanistic depth in the EED/PRC2-mediated epigenetic repression. This is largely because no epigenomic data was shown.

      Thank you for this suggestion. As described in response to Reviewer #1, we will include H2K27me3 CUT&Tag data in craniofacial tissue harvested from E12.5 and E16.5 Sox10-Cretg+ Eedfl/fl and Sox10-Cretg+ Eedfl/wt  embryos in our revision. Our analyses will including genome-wide and targeted metaplot visualizations across genotypes and developmental timepoints and assess how H3K27me3 occupancy relates to gene expression changes in our single-cell RNA sequencing data.

      (2) The mouse model of conditional loss of EZH2 in neural crest has been previously reported, as the authors pointed out in the discussion. What is novel in this study to disrupt EED? Perhaps a more detailed comparison of the two mouse models would be beneficial.

      We acknowledge the study the reviewer has indicated (Schwarz et al. Development 2014). This elegant investigation uses Wnt1-Cre to delete Ezh2 and found a similar phenotype to ours in the form of catastrophic craniofacial hypoplasia. We sought to add depth to the study of PRC2’s vital role in neural crest development by ablating Eed, which has a unique function in the PRC2 complex by binding to H3K27me3 and allosterically activating Ezh2. In this sense, we sought to test if phenotypes arising from deletion of Eed, the PRC2 “reader”, differ from phenotypes arising from deletion of Ezh2, the PRC2 “writer”, in neural crest derived tissues. Due to limitations associated with the Wnt1-Cre transgene (Lewis et al. Developmental Biology 2013), we used the Sox10-Cre allele which targets the migratory neural crest and is completely recombined by E10.5, instead of Wnt1-Cre which targets pre-migratory neural crest cells. A more detailed comparison of these mouse models will be included in the Discussion section of our revised manuscript, and we thank the reviewer for this thoughtful suggestion.

      (3) The presentation of the single-cell RNA-seq data may need improvement. The complexity of the many cell types blurs the importance of which cell types are affected the most by EED disruption.

      We agree with the reviewer’s critique of the scRNA-seq data presentation. Because Sox10+ cells were not sorted (via FACS, for example) from craniofacial tissues before single-cell RNA sequencing, we identified a breath of cell types in UMAP space unrelated to epigenetic disruption of neural crest derived tissues. We will include subcluster visualization plots in the figures of our revised manuscript to highlight specific changes in clusters, such as osteoblasts and mesenchymal stem cells, that arise from Eed loss in post-migratory neural crest craniofacial tissues.

      (4) While it's easy to identify PRC2/EED target genes using published epigenomic data, it would be nice to tease out the direct versus indirect effects in the gene expression changes (e.g Figure 4e).

      We agree with the reviewer that our single-cell RNA sequencing data do not provide insight into direct versus indirect changes in gene expression downstream of PRC2. We hope that the aforementioned CUT&Tag experiment will provide the necessary mechanistic insight into H3K27me3 occupancy and direct effects on gene expression resulting from PRC2 inactivation in our mouse model.

    1. Author response:

      Reviewer #1 (Public review):

      Summary:

      This work investigated the role of CXXC-finger protein 1 (CXXC1) in regulatory T cells. CXXC1-bound genomic regions largely overlap with Foxp3-bound regions and regions with H3K4me3 histone modifications in Treg cells. CXXC1 and Foxp3 interact with each other, as shown by co-immunoprecipitation. Mice with Treg-specific CXXC1 knockout (KO) succumb to lymphoproliferative diseases between 3 to 4 weeks of age, similar to Foxp3 KO mice. Although the immune suppression function of CXXC1 KO Treg is comparable to WT Treg in an in vitro assay, these KO Tregs failed to suppress autoimmune diseases such as EAE and colitis in Treg transfer models in vivo. This is partly due to the diminished survival of the KO Tregs after transfer. CXXC1 KO Tregs do not have an altered DNA methylation pattern; instead, they display weakened H3K4me3 modifications within the broad H3K4me3 domains, which contain a set of Treg signature genes. These results suggest that CXXC1 and Foxp3 collaborate to regulate Treg homeostasis and function by promoting Treg signature gene expression through maintaining H3K4me3 modification.

      Strengths:

      Epigenetic regulation of Treg cells has been a constantly evolving area of research. The current study revealed CXXC1 as a previously unidentified epigenetic regulator of Tregs. The strong phenotype of the knockout mouse supports the critical role CXXC1 plays in Treg cells. Mechanistically, the link between CXXC1 and the maintenance of broad H3K4me3 domains is also a novel finding.

      Weaknesses:

      (1) It is not clear why the authors chose to compare H3K4me3 and H3K27me3 enriched genomic regions. There are other histone modifications associated with transcription activation or repression. Please provide justification.

      Thank you for highlighting this important point. We prioritized H3K4me3 and H3K27me3 because they are well-established markers of transcriptional activation and repression, respectively. These modifications provide a robust framework for investigating the dynamic interplay of chromatin states in Treg cells, particularly in regulating the balance between activation and suppression of key genes. While histone acetylation, such as H3K27ac, is linked to enhancer activity and transcriptional elongation, our focus was on promoter-level regulation, where H3K4me3 and H3K27me3 are most relevant. Although other histone modifications could provide additional insights, we chose to focus on these two to maintain clarity and feasibility in our analysis. We are happy to further elaborate on this rationale in the manuscript if necessary.

      (2) It is not clear what separates Clusters 1 and 3 in Figure 1C. It seems they share the same features.

      We apologize for not clarifying these clusters clearly. Cluster 1 and 3 are both H3K4me3 only group, with H3K4me3 enrichment and gene expression levels being higher in Cluster 1. At first, we divided the promoters into four categories because we wanted to try to classify them into four categories: H3K4me3 only, H3K27me3 only, H3K4me3-H3K27me3 co-occupied, and None. However, in actual classification, we could not distinguish H3K4me3-H3K27me3 co-occupied group. Instead, we had two categories of H3K4me3 only, with cluster 1 having a higher enrichment level for H3K4me3 and gene expression levels.

      (3) The claim, "These observations support the hypothesis that FOXP3 primarily functions as an activator by promoting H3K4me3 deposition in Treg cells." (line 344), seems to be a bit of an overstatement. Foxp3 certainly can promote transcription in ways other than promoting H3K3me3 deposition, and it also can repress gene transcription without affecting H3K27me3 deposition. Therefore, it is not justified to claim that promoting H3K4me3 deposition is Foxp3's primary function.

      We appreciate the reviewer’s thoughtful observation regarding our claim about FOXP3’s role in promoting H3K4me3 deposition. We acknowledge that FOXP3 is a multifunctional transcription factor with diverse mechanisms of action, including transcriptional activation independent of H3K4me3 deposition and transcriptional repression that does not necessarily involve H3K27me3 deposition.

      Our intention was not to imply that promoting H3K4me3 deposition is the exclusive or predominant function of FOXP3 but rather to highlight that this mechanism contributes significantly to its role in regulating Treg cell function. We agree that our wording may have overstated this point, and we will revise the text to provide a more nuanced interpretation. Specifically, we will clarify that our observations suggest FOXP3 can facilitate transcriptional activation, in part, by promoting H3K4me3 deposition, but this does not preclude its other regulatory mechanisms.

      (4) For the in vitro suppression assay in Figure S4C, and the Treg transfer EAE and colitis experiments in Figure 4, the Tregs should be isolated from Cxxc1 fl/fl x Foxp3 cre/wt female heterozygous mice instead of Cxxc1 fl/fl x Foxp3 cre/cre (or cre/Y) mice. Tregs from the homozygous KO mice are already activated by the lymphoproliferative environment and could have vastly different gene expression patterns and homeostatic features compared to resting Tregs. Therefore, it's not a fair comparison between these activated KO Tregs and resting WT Tregs.

      Thank you for this insightful comment and for pointing out the potential confounding effects associated with using Treg cells from homozygous Foxp3Cre/Cre (or Cre/Y) Cxxc1fl/fl mice. We agree that using Treg cells from _Foxp3_Cre/+ _Cxxc1_fl/fl (referred to as “het-KO”) and their littermate _Foxp3_Cre/+ _Cxxc1_fl/+ (referred to as “het-WT”) female mice would provide a more balanced comparison, as these Treg cells are less likely to be influenced by the activated lymphoproliferative environment present in homozygous KO mice.

      To address this concern, we will perform additional experiments using Treg cells isolated from _Foxp3_Cre/+ _Cxxc1_fl/fl (“het-KO”) and their littermate _Foxp3_Cre/+ _Cxxc1_fl/+ (“het-WT”) female mice. We will update the manuscript with these new data to provide a more accurate assessment of the impact of CXXC1 deficiency on Treg cell function.

      (5) The manuscript didn't provide a potential mechanism for how CXXC1 strengthens broad H3K4me3-modified genomic regions. The authors should perform Foxp3 ChIP-seq or Cut-n-Taq with WT and Cxxc1 cKO Tregs to determine whether CXXC1 deletion changes Foxp3's binding pattern in Treg cells.

      Thank you for your insightful comments and valuable suggestions. We greatly appreciate your recommendation to explore the potential mechanism by which CXXC1 enhances broad H3K4me3-modified genomic regions.

      In response, we plan to conduct CUT&Tag experiments for Foxp3 in both WT and Cxxc1 cKO Treg cells.

      Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition.

      Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      The findings of the current study are pretty intriguing, and it would be great if the authors could fully address the following comments to support these interesting findings.

      Major points:

      (1) There is insufficient evidence in the first part of the Results to support the conclusion that "FOXP3 functions as an activator by promoting H3K4Me3 deposition in Treg cells". The authors should compare the results for H3K4Me3 in FOXP3-negative conventional T cells to demonstrate that at these promoter loci, FOXP3 promotes H3K4Me3 deposition.

      We appreciate the reviewer’s critical observation regarding our claim about FOXP3’s role in promoting H3K4me3 deposition. We acknowledge that FOXP3 is a multifunctional transcription factor with diverse mechanisms of action, including transcriptional activation independent of H3K4me3 deposition and transcriptional repression that does not necessarily involve H3K27me3 deposition.

      Our intention was not to imply that promoting H3K4me3 deposition is the exclusive or predominant function of FOXP3 but rather to highlight that this mechanism contributes significantly to its role in regulating Treg cell function. We agree that our wording may have overstated this point, and we will revise the text to provide a more nuanced interpretation. Specifically, we will clarify that our observations suggest FOXP3 can facilitate transcriptional activation, in part, by promoting H3K4me3 deposition, but this does not preclude its other regulatory mechanisms.

      We will compare H3K4me3 levels at the promoter loci of interest between FOXP3-negative conventional T cells and FOXP3-positive regulatory T cells. This comparison will help elucidate whether FOXP3 directly promotes H3K4me3 deposition at these loci.

      (2) In Figure 3 F&G, the activation status and IFNγ production should be analyzed in Treg cells and Tconv cells separately rather than in total CD4+ T cells. Moreover, are there changes in autoantibodies and IgG and IgE levels in the serum of cKO mice?

      We appreciate the reviewer’s constructive feedback on the analyses presented in Figures 3F and 3G and the additional suggestion to investigate autoantibodies and serum immunoglobulin levels.

      Regarding Figures 3F and 3G, we agree that separating Treg cells and Tconv cells for analysis of activation status and IFN-γ production would provide a more precise understanding of the cellular dynamics in Cxxc1 cKO mice.

      To address this, we will reanalyze the data to examine Treg and Tconv cells independently and include these results in the revised manuscript.

      As for the changes in autoantibodies and serum IgG and IgE levels, we acknowledge that these parameters are important indicators of systemic immune dysregulation.

      We will now measure serum autoantibodies and immunoglobulin levels in Cxxc1 cKO mice and WT controls.

      (3) Why did Cxxc1-deficient Treg cells not show impaired suppression than WT Treg during in vitro suppression assay, despite the reduced expression of Treg cell suppression assay -associated markers at the transcriptional level demonstrated in both scRNA-seq and bulk RNA-seq?

      Thank you for your thoughtful question. We appreciate your interest in understanding the apparent discrepancy between the reduced expression of Treg-associated suppression markers at the transcriptional level and the lack of impaired suppression observed in the in vitro suppression assay.

      There are several potential explanations for this observation:

      (1) Functional Redundancy: Treg cell suppression is a complex, multi-faceted process involving various effector mechanisms such as cytokine production (e.g., IL-10, TGF-β), cell-cell contact, and metabolic regulation. Thus, even though the transcriptional signature of suppression-associated genes is altered, compensatory mechanisms may still allow Cxxc1-deficient Treg cells to retain functional suppression capacity under these specific in vitro conditions.

      (2) In Vitro Assay Limitations: The in vitro suppression assay is a simplified model of Treg function that may not capture all the complexities of Treg-mediated suppression in vivo. While we observed altered gene expression in Cxxc1-deficient Treg cells, this might not directly translate to a functional defect under the specific conditions of the assay. In vivo, additional factors such as cytokine milieu, cell-cell interactions, and tissue-specific environments may be required for full suppression, which could be missing in the in vitro assay.

      (4) Is there a disease in which Cxxc1 is expressed at low levels or absent in Treg cells? Is the same immunodeficiency phenotype present in patients as in mice?

      Thank you for your insightful question regarding the role of CXXC1 in Treg cells and its potential link to human disease. To our knowledge, no specific human disease has been identified where CXXC1 is expressed at low levels or absent specifically in Treg cells. There is currently no direct evidence of an immunodeficiency phenotype in human patients that parallels the one observed in Cxxc1-deficient mice.

      Reviewer #3 (Public review):

      In the report entitled "CXXC-finger protein 1 associates with FOXP3 to stabilize homeostasis and suppressive functions of regulatory T cells", the authors demonstrated that Cxxc1-deletion in Treg cells leads to the development of severe inflammatory disease with impaired suppressive function. Mechanistically, CXXC1 interacts with Foxp3 and regulates the expression of key Treg signature genes by modulating H3K4me3 deposition. Their findings are interesting and significant. However, there are several concerns regarding their analysis and conclusions.

      Major concerns:

      (1) Despite cKO mice showing an increase in Treg cells in the lymph nodes and Cxxc1-deficient Treg cells having normal suppressive function, the majority of cKO mice died within a month. What causes cKO mice to die from severe inflammation?

      Considering the results of Figures 4 and 5, a decrease in Treg cell population due to their reduced proliferative capacity may be one of the causes. It would be informative to analyze the population of tissue Treg cells.

      We thank the reviewer for this insightful comment and acknowledge the importance of understanding the causes of severe inflammation and early mortality in cKO mice. Based on our data and previous studies, we propose the following explanations:

      (1) Reduced Treg Proliferative Capacity: As shown in Figure 5I, the decreased proportion of FOXP3+Ki67+ Treg cells in cKO mice likely reflects impaired proliferative capacity, which may limit the expansion of functional Treg cells in response to inflammatory cues, particularly in peripheral tissues where active suppression is required.

      (2) Altered Treg Function and Activation: Cxxc1-deficient Treg cells exhibit increased expression of activation markers (Il2ra, Cd69) and pro-inflammatory genes (Ifng, Tbx21). This suggests a functional dysregulation that may impair their ability to suppress inflammation effectively, despite their presence in lymphoid organs.

      (3) Tissue Treg Populations: Although our study focuses on lymph node-resident Treg cells, tissue-resident Treg cells play a crucial role in maintaining local immune homeostasis. It is plausible that Cxxc1 deficiency compromises the accumulation or functionality of tissue Treg cells, contributing to uncontrolled inflammation in non-lymphoid organs. Unfortunately, we currently lack data on tissue Treg populations, which limits our ability to directly address this hypothesis.

      Regarding the suggestion to analyze tissue Treg populations, we agree that this would be an important next step in understanding the cause of the severe inflammation and early mortality in Cxxc1-deficient mice.

      We plan to perform detailed analyses of Treg cell populations in various tissues, including the gut, lung, and liver, to determine if there are specific defects in tissue-resident Treg cells that could contribute to the observed phenotype.

      (2) In Figure 5B, scRNA-seq analysis indicated that Mki67+ Treg subset are comparable between WT and Cxxc1-deficient Treg cells. On the other hand, FACS analysis demonstrated that Cxxc1-deficient Treg shows less Ki-67 expression compared to WT in Figure 5I. The authors should explain this discrepancy.

      Thank you for pointing out the apparent discrepancy between the scRNA-seq and FACS analyses regarding Ki-67 expression in Cxxc1-deficient Treg cells.

      In Figure 5B, the scRNA-seq analysis identified the Mki67+ Treg subset as comparable between WT and Cxxc1-deficient Treg cells. This finding reflects the overall proportion of cells expressing Mki67 transcripts within the Treg population. In contrast, the FACS analysis in Figure 5I specifically measures Ki-67 protein levels, revealing reduced expression in Cxxc1-deficient Treg cells compared to WT.

      To address this discrepancy more comprehensively, we will further analyze the scRNA-seq data to directly compare Mki67 mRNA expression levels between WT and Cxxc1-deficient Treg cells.

      In addition, the authors concluded on line 441 that CXXC1 plays a crucial role in maintaining Treg cell stability. However, there appears to be no data on Treg stability. Which data represent the Treg stability?

      We appreciate the reviewer’s observation and recognize that our wording may have been overly conclusive. Our data primarily highlight the impact of Cxxc1 deficiency on Treg cell homeostasis and transcriptional regulation, rather than providing direct evidence for Treg cell stability. Specifically, the downregulation of Treg-specific suppressive genes (Nt5e, Il10, Pdcd1) and the upregulation of pro-inflammatory markers (Gzmb, Ifng, Tbx21) indicate a shift in functional states. While these findings may suggest an indirect disruption in the maintenance of suppressive phenotypes, they do not constitute a direct measure of Treg cell stability.

      To address the reviewer’s concern, we will revise our conclusion to more accurately state that our data support a role for CXXC1 in maintaining Treg cell homeostasis and functional balance, without overextending claims about Treg cell stability. Thank you for bringing this to our attention, as it will help us improve the clarity and precision of our manuscript.

      (3) The authors found that Cxxc1-deficient Treg cells exhibit weaker H3K4me3 signals compared to WT in Figure 7. This result suggests that Cxxc1 regulates H3K4me3 modification via H3K4 methyltransferases in Treg cells. The authors should clarify which H3K4 methyltransferases contribute to the modulation of H3K4me3 deposition by Cxxc1 in Treg cells.

      Thank you for pointing out the need to clarify the role of H3K4 methyltransferases in the modulation of H3K4me3 deposition by CXXC1 in Treg cells.

      In our study, we found that Cxxc1-deficient Treg cells exhibit reduced H3K4me3 levels, as shown in Figure 7. CXXC1 has been previously reported to function as a non-catalytic component of the Set1/COMPASS complex, which contains H3K4 methyltransferases such as SETD1A and SETD1B. These methyltransferases are the primary enzymes responsible for H3K4 trimethylation.

      References:

      (1) Lee J.H., Skalnik D.G. CpG-binding protein (CXXC finger protein 1) is a component of the mammalian Set1 histone H3-Lys4 methyltransferase complex, the analogue of the yeast Set1/COMPASS complex. J. Biol. Chem. 2005; 280:41725–41731.

      (2). J. P. Thomson, P. J. Skene, J. Selfridge, T. Clouaire, J. Guy, S. Webb, A. R. W. Kerr, A. Deaton, R. Andrews, K. D. James, D. J. Turner, R. Illingworth, A. Bird, CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature 464, 1082–1086 (2010).

      (3) Shilatifard, A. 2012. The COMPASS family of histone H3K4 methylases: mechanisms of regulation in development and disease pathogenesis. Annu. Rev. Biochem. 81:65–95.

      (4) Brown D.A., Di Cerbo V., Feldmann A., Ahn J., Ito S., Blackledge N.P., Nakayama M., McClellan M., Dimitrova E., Turberfield A.H. et al. The SET1 complex selects actively transcribed target genes via multivalent interaction with CpG Island chromatin. Cell Rep. 2017; 20:2313–2327.

      Furthermore, it would be important to investigate whether Cxxc1-deletion alters Foxp3 binding to target genes.

      Thank you for this important suggestion regarding the impact of Cxxc1 deletion on FOXP3 binding to target genes. We agree that understanding whether Cxxc1 deficiency affects FOXP3’s ability to bind to its target genes would provide valuable insight into the regulatory role of CXXC1 in Treg cell function.

      To address this, we plan to perform CUT&Tag experiments to assess FOXP3 binding profiles in Cxxc1-deficient versus wild-type Treg cells. These experiments will allow us to determine if Cxxc1 loss disrupts FOXP3’s occupancy at key regulatory sites, which may contribute to the observed functional impairments in Treg cells.

      (4) In Figure 7, the authors concluded that CXXC1 promotes Treg cell homeostasis and function by preserving the H3K4me3 modification since Cxxc1-deficient Treg cells show lower H3K4me3 densities at the key Treg signature genes. Are these Cxxc1-deficient Treg cells derived from mosaic mice? If Cxxc1-deficient Treg cells are derived from cKO mice, the gene expression and H3K4me3 modification status are inconsistent because scRNA-seq analysis indicated that expression of these Treg signature genes was increased in Cxxc1-deficient Treg cells compared to WT (Figure 5F and G).

      Thank you for the insightful comment. To clarify, the Cxxc1-deficient Treg cells analyzed for H3K4me3 modification in Figure 7 were indeed derived from Cxxc1 conditional knockout (cKO) mice, not mosaic mice.

      The scRNA-seq analysis presented in Figures 5F and G revealed an upregulation of Treg signature genes in Cxxc1-deficient Treg cells. This finding suggests that the loss of Cxxc1 drives these cells toward a pro-inflammatory, activated state, underscoring the pivotal role of CXXC1 in maintaining Treg cell homeostasis and suppressive function.

      Regarding the apparent discrepancy between the reduced H3K4me3 levels and the increased expression of these genes, it is important to note that H3K4me3 primarily functions as an epigenetic mark that facilitates chromatin accessibility and transcriptional regulation, acting as an upstream modulator of gene expression. However, gene expression levels are also influenced by downstream compensatory mechanisms and complex inflammatory environments. In this context, the reduction in H3K4me3 likely reflects the direct role of CXXC1 in epigenetic regulation, whereas the upregulation of gene expression in Cxxc1-deficient Treg cells may result as a side effect of the inflammatory environment.

      To further substantiate our findings, we performed RNA-seq analysis on Treg cells from Foxp3_Cre/+ _Cxxc1_fl/fl (“het-KO”) and their littermate _Foxp3_Cre/+ _Cxxc1_fl/+ (“het-WT”) female mice, as presented in Figure S6C. This analysis revealed a notable reduction in the expression of key Treg signature genes, including _Icos, Ctla4, Tnfrsf18, and Nt5e, in het-KO Treg cells. Importantly, the observed changes in gene expression were consistent with the altered H3K4me3 modification status, further supporting the epigenetic regulatory role of CXXC1. These results further emphasize the critical role of CXXC1 promotes Treg cell homeostasis and function by preserving the H3K4me3 modification.

    2. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition.

      Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      The findings of the current study are pretty intriguing, and it would be great if the authors could fully address the following comments to support these interesting findings.

      Major points:

      (1) There is insufficient evidence in the first part of the Results to support the conclusion that "FOXP3 functions as an activator by promoting H3K4Me3 deposition in Treg cells". The authors should compare the results for H3K4Me3 in FOXP3-negative conventional T cells to demonstrate that at these promoter loci, FOXP3 promotes H3K4Me3 deposition.

      (2) In Figure 3 F&G, the activation status and IFNγ production should be analyzed in Treg cells and Tconv cells separately rather than in total CD4+ T cells. Moreover, are there changes in autoantibodies and IgG and IgE levels in the serum of cKO mice?

      (3) Why did Cxxc1-deficient Treg cells not show impaired suppression than WT Treg during in vitro suppression assay, despite the reduced expression of Treg cell suppression assay -associated markers at the transcriptional level demonstrated in both scRNA-seq and bulk RNA-seq?

      (4) Is there a disease in which Cxxc1 is expressed at low levels or absent in Treg cells? Is the same immunodeficiency phenotype present in patients as in mice?

    1. Author response:

      The following is the authors’ response to the original reviews.

      eLife Assessment

      This important study addresses how 3' splice site choice is modulated by the conserved spliceosome-associated protein Fyv6. The authors provide compelling evidence Fyv6 functions to enable selection of 3' splice sites distal to a branch point and in doing so antagonizes more proximal, suboptimal 3' splice sites. The study would be improved through a more nuanced discussion of alternative possibilities and models, for instance in discussing the phenotypic impact of Fyv6 deletion.

      We thank the editors and reviewers for their supportive comments and assessment of this manuscript. We have improved the discussion at several points as suggested by the reviewers to include discussion of alternative possibilities.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      A key challenge at the second chemical step of splicing is the identification of the 3' splice site of an intron. This requires recruitment of factors dedicated to the second chemical step of splicing and exclusion of factors dedicated to the first chemical step of splicing. Through the highest resolution cyroEM structure of the spliceosome to-date, the authors show the binding site for Fyv6, a factor dedicated to the second chemical step of splicing, is mutually exclusive with the binding site for a distinct factor dedicated to the first chemical step of splicing, highlighting that splicing factors bind to the spliceosome at a specific stage not only by recognizing features specific to that stage but also by competing with factors that bind at other stages. The authors further reveal that Fyv6 functions at the second chemical step to promote selection of 3' splice sites distal to a branch point and thereby discriminate against proximal, suboptimal 3' splice site. Lastly, the authors show by cyroEM that Fyv6 physically interacts with the RNA helicase Prp22 and by genetics Fyv6 functionally interacts with this factor, implicating Fyv6 in 3'SS proofreading and mRNA release from the spliceosome. The evidence for this study is robust, with the inclusion of genomics, reporter assays, genetics, and cyroEM. Further, the data overall justify the conclusions, which will be of broad interest.

      Strengths:

      (1) The resolution of the cryoEM structure of Fyv6-bound spliceosomes at the second chemical step of splicing is exceptional (2.3 Angstroms at the catalytic core; 3.0-3.7 Angstroms at the periphery), providing the best view of this spliceosomal intermediate in particular and the core of the spliceosome in general.

      (2) The authors observe by cryoEM three distinct states of this spliceosome, each distinguished from the next by progressive loss of protein factors and/or RNA residues. The authors appropriately refrain from overinterpreting these states as reflecting distinct states in the splicing cycle, as too many cyroEM studies are prone to do, and instead interpret these observations to suggest interdependencies of binding. For example, when Fyv6, Slu7, and Prp18 are not observed, neither are the first and second residues of the intron, which otherwise interact, suggesting an interdependence between 3' splice site docking on the 5' splice site and binding of these second step factors to the spliceosome.

      (3) Conclusions are supported from multiple angles.

      (4) The interaction between Fyv6 and Syf1, revealed by the cyroEM structure, was shown to account for the temperature-sensitive phenotypes of a fyv6 deletion, through a truncation analysis.

      (5) Splicing changes were observed in vivo both by indirect copper reporter assays and directly by RT-PCR.

      (6) Changes observed by RNA-seq are validated by RT-PCR.

      (7) The authors go beyond simply observing a general shift to proximal 3'SS usage in the fyv6 deletion by RNA-seq by experimentally varying branch point to 3' splice site distance experimentally in a reporter and demonstrating in a controlled system that Fyv6 promotes distal 3' splice sites.

      (8) The importance of the Fyv6-Syf1 interaction for 3'SS recognition is demonstrated by truncations of both Fyv6 and of Syf1.

      (9) In general, the study was executed thoroughly and presented clearly.

      We thank the reviewer for their recognition of the strengths of our multi-faceted approach that led to highly supported conclusions.

      Weaknesses:

      (1) Despite the authors restraint in interpreting the three states of the spliceosome observed by cyroEM as sequential intermediates along the splicing pathway, it would be helpful to the general reader to explicitly acknowledge the alternative possibility that the difference states simply reflect decomposition from one intermediate during isolation of the complex (i.e., the loss of protein is an in vitro artifact, if an informative one).

      We thank the reviewer for noticing our restraint in interpreting these structures, and we agree that the scenario described by the reviewer is a possibility. We have now explicitly mentioned this in the Discussion on lines 755-757.

      (2) The authors acknowledge that for prp8 suppressors of the fyv6 deletion, suppression may be indirect, as originally proposed by the Query and Konarska labs - that is, that defects in the second step conformation of the spliceosome can be indirectly suppressed by compensating, destabilizing mutations in the first step spliceosome. Whereas some of the other suppressors of the fyv6 deletion can be interpreted as impacting directly the second step spliceosome (e.g., because the gene product is only present in the second step conformation), it seems that many more suppressors beyond prp8 mutants, especially those corresponding to bulky substitutions, which would more likely destabilize than stabilize, could similarly act indirectly by destabilization of first step conformation. The authors should acknowledge this where appropriate (e.g., for factors like Prp8 that are present in both first and second step conformations).

      We agree that this is also a possibility and have now included this on lines 480-486.

      Reviewer #2 (Public Review):

      In this manuscript, Senn, Lipinski, and colleagues report on the structure and function of the conserved spliceosomal protein Fyv6. Pre-mRNA splicing is a critical gene expression step that occurs in two steps, branching and exon ligation. Fyv6 had been recently identified by the Hoskins' lab as a factor that aids exon ligation (Lipinski et al., 2023), yet the mechanistic basis for Fyv6 function was less clear. Here, the authors combine yeast genetics, transcriptomics, biochemical assays, and structural biology to reveal the function of Fyv6. Specifically, they describe that Fyv6 promotes the usage of distal 3'SSs by stabilizing a network of interactions that include the RNA helicase PRP22 and the spliceosome subunit SYF1. They discuss a generalizible mechanism for splice site proofreading by spliceosomsal RNA helicases that could be modulated by other, regulatory splicing factors.

      This is a very high quality study, which expertly combines various approaches to provide new insights into the regulation of 3'SS choice, docking, and undocking. The cryo-EM data is also of excellent quality, which substantially extends on previous yeast P complex structures. This is also supported by the authors use of the latest data analysis tools (Relion-5, AlphaFold2 multimer predictions, Modelangelo). The authors re-evaluate published EM densities of yeast spliceosome complexes (B*, C,C*,P) for the presence or absence of Fyv6, substantiate Fyv6 as a 2nd step specific factor, confirm it as the homolog of the human protein FAM192A, and provide a model for how Fyv6 may fit into the splicing pathway. The biochemical experiments on probing the splicing effects of BP to 3'SS distances after Fyv6 KO, genetic experiments to probe Fyv6 and Syf1 domains, and the suppressor screening add substantially to the study and are well executed. The manuscript is clearly written and we particularly appreciated the nuanced discussions, for example for an alternative model by which Prp22 influences 3'SS undocking. The research findings will be of great interest to the pre-mRNA splicing community.

      We thank the reviewer for their positive comments on our manuscript.

      We have only few comments to improve an already strong manuscript.

      Comments:

      (1) Can the authors comment on how they justify K+ ion positions in their models (e.g. the K+ ion bridging G-1 and G+1 nucleotides)? How do they discriminate e.g. in the 'G-1 and G+1' case K+ from water?

      The assignment of K+ at this position is justified by both longer coordination distances and relatively high cryo-EM density compared to structured water molecules in the same vicinity. We have added a panel to figure3-figure supplement 4C to show the density for the G-1/G+1 bridging K+ ion and to show the adjacent density for putative water molecules which coordinate the ion. The K+ ion density is larger and has stronger signal than the adjacent water molecules. The coordination distances are also longer than would be expected for a Mg2+. For these reasons and because K+ was present in the purification buffer, we modelled the density as K+.

      (2) The authors comment on Yju2 and Fyv6 assignments in all yeast structures except for the ILS. Can the authors comment on if they have also looked into the assignment of Yju2 in the yeast ILS structure in the same manner? While it is possible that Fyv6 could dissociate and Yju2 reassociate at the P to ILS transition, this would merit a closer look given that in the yeast P complex Yju2 had been misassigned previously.

      We thank the reviewer for pointing out this very interesting topic! We have used ModelAngelo to analyze the S. cerevisiae ILS structure for support of density assignment as Yju2 (and not Fyv6). This analysis supports the assignment as Yju2 in this structure and we have no evidence to doubt its presence in those particular purified spliceosomes. We have updated Figure 4- figure supplement 1B accordingly.

      That being said, we do think that this issue should be studied more carefully in the future. The S. cerevisiae ILS structure (5Y88) was determined by purifying spliceosome complexes with a TAP-tag on Yju2. So the conclusion that Yju2 is part of the ILS spliceosome involves some circular logic: Yju2 is part of ILS spliceosome complexes because it is present in ILS complexes purified with Yju2. We also note that Yju2 was absent in ILS complexes recently determined from metazoans by the Plaschka group.  We have added some additional nuance to the Discussion to raise this important mechanistic point at lines 711-718.

      (3) For accessibility to a general reader, figures 1c, d, e, 2a, b, would benefit from additional headings or labels, to immediately convey what is being displayed. It is also not clear to us if Fig 1e might fit better in the supplement and be instead replaced by Supplementary Figure 1a (wt) , b (delta upf1), and a new c (delta fyv6) and new d (delta upf1, delta fyv6). This may allow the reader to better follow the rationale of the authors' use of the Fyv6/Upf1 double deletion.

      We thank the reviewer for the suggestion and have updated Figures 1 C-E to include additional information in the headings and labels. We have not changed the labels in Figures 2A, B but have added additional clarifying language to the legend.

      In terms of rearranging the figures, we thank the reviewer for the suggestion but have decided that the figures are best left in their current ordering.

      (4) The authors carefully interpret the various suppressor mutants, yet to a general reader the authors may wish to focus this section on only the most critical mutants for a better flow of the text.

      We thank the reviewer for this suggestion. While this section of the manuscript does contain (to quote Reviewer #3) “extensive new information regarding functional interactions”, it was a bit long. We have reduced this section of the manuscript by ~200 words for a more focused presentation for general readers.

      Reviewer #3 (Public Review):

      In this manuscript the authors expand their initial identification of Fyv6 as a protein involved in the second step of pre-mRNA splicing to investigate the transcriptome-wide impact of Fyv6 on splicing and gain a deeper understanding of the mechanism of Fyv6 action.

      They first use deep sequencing of transcripts in cells depleted of Fyv6 together with Upf1 (to limit loss of mis-spliced transcripts) to identify broad changes in the transcriptome due to loss of Fyv6. This includes both changes in overall gene expression, that are not deeply discussed, as well as alterations in choice of 3' splice sites - which is the focus of the rest of the manuscript

      They next provide the highest resolution structure of the post-catalytic spliceosome to date; providing unparalleled insight into details of the active site and peripheral components that haven't been well characterized previously.

      Using this structure they identify functionally critical interactions of Fyv6 with Syf1 but not Prp22, Prp8 and Slu7. Finally, a suppressor screen additionally provides extensive new information regarding functional interactions between these second step factors.

      Overall this manuscript reports new and essential information regarding molecular interactions within the spliceosome that determine the use of the 3' splice site. It would be helpful, especially to the non-expert, to summarize these in a table, figure or schematic in the discussion.

      We thank the reviewer for the positive comments and suggestions. We did include a summary figure in panel 7H. However, it was a bit buried. To highlight the summary figure more clearly, we have moved panel 7H to its own figure (Fig. 8).

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      (1) The resolution of some panels is poor, nearly illegible (e.g., Supp Fig 1A, B).

      The resolution of panels in supplemental figure 1 has been increased. However, this may be an artifact of the PDF conversion process. We will pay attention to this during the publication process.

      (2) Panel S6B: 6HYU is a structure of DHX8, not DDX8

      We have corrected DDX8 to DHX8 in Supplemental Fig. S6D and associated figure legend.

      (3) The result that Syf1 truncations can suppress the Fyv6 deletion is impressive. The subsequent discussion seems muddled. A discussion of Fyv6 binding at the first step, instead of Yju2, doesn't seem relevant here (though worthy of consideration in the discussion), given that the starting mutation is the Fyv6 deletion. Further, conjuring rebinding of Yju2 based on the data in the paper seems unnecessarily speculative (assumes that biochemical state III is on pathway), unless I am unaware of some other evidence for such rebinding. Instead, a simpler explanation would seem to be that in the absence of Fyv6, Syf1 inappropriately binds Yju2 instead at the second step and that deletion of the common Fyv6/Yju2 binding site on Syf1 suppresses this defect. In this case, the ts phenotype of the Fyv6 deletion would result from inappropriate binding of Yju2, and the splicing defect would be due to loss of Fyv6 activity. Alternatively, especially considering the work of the labs of Query and Konarska, the authors should consider the possibility that i) the Fyv6 deletion destabilizes the second step conformation, shifting an equilibrium to the first step conformation, and that ii) the Syf1 truncation destabilizes binding of Yju2, thereby restoring the equilibrium. In this case the ts phenotype of the Fyv6 deletion is due to a disturbed equilibrium and the splicing defect is due to the failure of Fyv6 to function at the second step.

      We believe the reviewer is specifically referencing the final paragraph of this Results section (the paragraph that comes just before the section “Mutations in many different splicing factors…”). In retrospect, we agree that our discussion was convoluted. In particular, we emphasized rebinding of Yju2 based on its presence in the cryo-EM structure of the yeast ILS complex. However, given some uncertainties about whether or not Yju2 is a bona fide ILS component (as discussed above). We don’t think it is appropriate to over-emphasize rebinding of Yju2 and have decided to incorporate the elegant mechanisms proposed by the reviewer. This paragraph has now been edited accordingly (lines 386-395).

      (4) The authors imply they have performed biochemical studies, which I think is misleading. Of course, RT-PCR and primer extension assays for example are performed in vitro, but these are an analysis of RNA events that occurred in vivo. In my view a higher threshold should be used for defining "biochemistry". To me "biochemistry" would imply that the authors have, for example, investigated 3' splice site usage in splicing extracts of the fyv6 deletion or engaged in an analysis of the Syf1-Fyv6 interaction involving the expression of the interacting domains in bacteria followed by a binding analysis in the test tube.

      We disagree with the reviewer on this point. Biochemistry is defined as the “branch of sciences concerned with the chemical substances, reactions, and physico chemical processes which occur within living organisms; biological or physical chemistry.” (Oxford English Dictionary). Biochemical studies are not defined by whether or not they take place in vitro, in vivo, or even in silico. Indeed, much of the history of biochemistry (especially in studies of metabolism, for example) involved experiments occurring in vivo that reported on the molecular properties and mechanisms of biological processes. We think many of our experiments fall into this category including our structure/function analysis of splicing factors and the use of the ACT1-CUP1 reporter substrate.

      (5) The monovalents are shown; inositol phosphate is shown; is the binding of Prp22 to RNA shown?

      We have added a panel to Figure 3-figure supplement 4D showing density for the 3' exon within Prp22.

      (6) The authors invoke undocking of the 3'SS in the P complex. Where is the 3'SS in the ILS? The author's model predicts: undocked.

      In all ILS structures to date, the 3′ SS is undocked, in agreement with this prediction. We have now noted this observation in line 760.

      (7) Would be helpful to show fyv6 deletion in Fig 1b.

      We have included growth data for an additional fyv6 deletion strain (in a cup1Δ background) in Figure 1b. The results are quite similar to the upf1_Δ_ background except with slightly worse growth at 23°C.

      Reviewer #2 (Recommendations For The Authors):

      Minor comments

      (1) Fig.3b is the arrow indicating the right rotation?

      This typo has been fixed.

      (2) Fig.4b, panel H is annotated, which should read 'F'.

      This typo has been fixed.

      (3) Line 178: "Finally, we analyzed the sequence features of the alternative 3ʹ SS activated by loss of Fyv6." We would suggest 'used after' instead of 'activated by'.

      We have replaced ‘activated by’ with ‘with increased use after’.

      (4) In Line 544, the authors speculate on a Slu7 requirement for 3'SS docking and on 3'SS docking maintenance. In the results section (Line 265) they however only mention the latter possibility. These statements should be consistent.

      We thank the reviewer for pointing this out. We have added a reference to docking maintenance to the results section at line 325.

      (5) Line 476: "Unexpectedly, Prp22 I1133R was actually deleterious when Fyv6 was present for this reporter." We suggest removing "actually".

      We have removed ‘actually’.

      (6) The authors describe the observed changes in splicing events in absolute numbers (e.g. in Fig 1c). To better assess for the reader whether these numbers reflect large or small effects of Fyv6 in defining mRNA isoforms, it would be more useful to state these as percent changes of total events or to provide a reference number for how many introns are spliced in S.c. See for example the statements in Lines 132 and 145.

      We have added a percentage at line 138 that indicates ~20% of introns in yeast showed splicing changes.

      Reviewer #3 (Recommendations For The Authors):

      Do the authors have a proposed explanation for the observed DGE in non-intron containing genes in the Fyv6 depleted cells?

      The simplest explanation is that this is an indirect effect due to splicing changes occurring in other genes (such as transcription factors, ribosomal protein genes, etc..). It is possible that this can be further dissected in the future using shorter-term knockdown of Fyv6 using Anchors Away or AID-tagging. However, that is beyond the scope of the current manuscript, and we do not wish to comment on these non-intron containing genes further at present.

      Figure 2A - What is going on with the events that show no FAnS value under one condition (i.e. are up against the X or Y axis)? These are of interest as most on the Y- axis are blue.

      The events along one of the axes denote alternative splice sites that are only detected under one condition (either when Fyv6 is present or when it is absent). At this stage, we do not wish to interpret these events further since most have a relatively low number of reads overall.

    1. "u" and "i"

      Charles, talk about a freaking amazing academic writer! I’m so jealous of your expansive vocabulary! Especially in your false dreams writing, your highly descriptive and emotional sentences really shone through – you’ve definitely got an ear for music! For this and the other writings, each one of your sentences contained so much meaning and clearly related to the purpose of the writing – especially with your concluding ideas!

      Most of the comments I made were very minor ones - usually relating to grammar or sentence structure - because I thought you clearly stated your thoughts. One big suggestion is to try and implement shorter sentences to add a sort of “attitude to your writing.” You are fantastic at formally stating your ideas, yet sometimes I find that the most influential writings use a conversational tone here and there. I also noticed that many of your sentences end with a comma then -ing word; therefore, maybe look to change this up somehow by making shorter sentences, placing the dependent clause at the beginning of the sentence, or using different punctuation to help with structure variation. Also, I understand you didn’t have enough time to do this yet, but definitely implement some media to help your project’s visual appeal.

      I like the linear structure that you went with. I think (other than possibly switching “The Duality of Vulnerability Between ‘u’ and ‘i’” and “How Kendrick Lamar Transformed Cultural Trauma Into To Pimp a Butterfly”) the order you have is great. One thing that I suggest would be to incorporate more of the tag feature at the bottom of your pages. For example, tag the bibliography page at the bottom of each page where you use cites and the lyrics page after you cite one of the song’s lyrics.

      In the end, I really enjoyed your project. Of course I knew who Kendrick Lamar was, but I had no clue of all the details about his young life. I enjoyed your unique approach to this writing: analyzing two songs instead of one. The relationship that you discussed between these songs (especially in “The Duality of Vulnerability Between ‘u’ and ‘i’”) is very informative and overall intriguing – I love it when music artists tell a story with multiple songs (just as you did in false dreams)! For me, analyzing one song was hard enough but two…that’s just impressive. And the best part: you did it beautifully!

    1. Lyrics

      I think it would be awesome if every time in your project you talked bout the lyrics, you would hyperlink it back to here and tag this page at the bottom of your writing. It would help give your project more connections and give this lyrics page more purpose!

    1. Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2024-02640

      Corresponding author(s): Purusharth I, Rajyaguru; Stephan Vagner

      1. General Statements

      This section is optional. Insert here any general statements you wish to make about the goal of the study or about the reviews.

      In the manuscript titled, "RGG motif-containing Scd6/LSM14A proteins regulate the translation of specific mRNAs in response to hydroxyurea-induced genotoxic stress" we elucidate a conserved role of an RNA-binding protein with low-complexity sequences (RGG-motifs) in genotoxic stress response. This work uncovers HU-stress mediated translation regulation of SRS2, Ligase IV and RTEL1 transcripts by Scd6 (yeast)/LSM14 (human). It further identifies RNP condensates and arginine methylation as sites and means of this regulation.

      We heartily thank all three reviewers for their overall encouraging comments about the significance of this manuscript. Specifically, we appreciate their view that the manuscript provides new functional insights into the role of RGG-motif-containing RNA-binding protein in genotoxic stress response. They further agree that such knowledge will impact and interest the general audience of RNA biology and stress biology.

      We have carefully noted all the comments raised by three reviewers. We have addressed almost all the comments, including several by performing new experiments. The new results and their analysis have helped us improve the manuscript, allowing us to provide a stronger mechanistic and functional insight underlying the findings presented in this work. We thank the reviewers for their insightful comments. Below, we provide a point-by-point response to each of the comments.

      2. Description of the planned revisions

      Insert here a point-by-point reply that explains what revisions, additional experimentations and analyses are planned to address the points raised by the referees.

      Reviewer 3

      Major Comment 4: Page 7, top: '...indicating that Scd6 regulated the expression of SRS2 in a HU-dependent manner.' In my opinion, the results so far suggest that Scd6 and SRS2 are somehow functionally connected during HU-treatment. To substantiate the statement of the authors, they should provide a Western blot showing that the levels of SRS2 change upon Scd6 KO or OE during HU-treatment. This will also substantiate the results shown in Figs 2G-H.

      Response: We thank the reviewer for this comment. Detecting Srs2 protein has been technically challenging. The SRS2 construct used in this study is untagged. Unfortunately, the commercial SRS2 antibody has been discontinued. We requested several groups who have used SRS2 antibody in their past studies but they have either closed down their labs or are unable to find an aliquot to share. We have tried tagging SRS2 with 6xHis/1XFLAG/3xFLAG tags at N and C-terminal, but unfortunately, the protein was undetectable in the Western blot analysis using either of the tag-specific antibodies. We have also tried western blot analysis using SRS2-GFP strain, but the protein does not get detected by anti-GFP antibody, probably because of very low expression.

      Since we will not be able to provide western blots for Srs2 protein levels due to technical challenges, we shall provide western blots for RTEL1 (human homolog of Srs2) protein levels upon Lsm14A knockdown in the presence and absence of HU. This will validate the polysome data we have of RTEL1 regulation by LSM14A, and would, by extension, substantiate the SRS2 polysome data.

      Major Comment 5: Figs 3: How are the localization of Scd6 protein and SRS2 mRNA to granules, and the levels of Srs2 protein, in cells exposed to HU after deletion of Hmt1? This would substantiate a role of Hmt1 in vivo.

      Response: We will provide the data for Scd6 protein localization and SRS2 mRNA localization in granule enriched fraction upon HU treatment in Δhmt1 background. This experiment is ongoing.

      3. Description of the revisions that have already been incorporated in the transferred manuscript

      Reviewer 1

      Major Comment 1: Fig. 1 F/G: were the delta RGG and LSM variants expressed at an equivalent level to the WT protein in these experiments?

      Response: We thank the reviewer for this comment. We have quantified the total fluorescence intensity of GFP from the existing microscopy images for WT and domain deletion mutants for both Scd6 and Sbp1 (Now Figure 3A and 3D). This result (added as a new figure panel Fig 3C and 3F) indicates that the levels of Scd6∆RGG mutant is more whereas Scd6∆Lsm protein levels are comparable than WT. Similarly, Sbp1∆RGG mutant expression is comparable to WT in the given experimental conditions.

      Major Comment 2: Fig. 3G: The 6 data points for the delta LSM variant are literally spread evenly up and down the graph, making these data appear highly questionable as to whether one can draw a definitive conclusion from them.

      Response: We agree with the reviewer that the data points are varied. To address the scatter in data, we have performed additional experiments and added those to the existing results. Even though there is a spread in the points, except for one data point, all others show an increase in methylation of LSM domain deletion mutant compared to WT, which is statistically significant. The old blot and graph (Old Figure 3F and 3G) have now been replaced with new ones (Figure 5F and 5G) which look more convincing. The result and conclusion derived from it remain unchanged.

      Minor Comments

      Comment 1: Abstract: the acronym NHEJ likely will need to be defined for the general reader.

      Response: The acronym has been expanded in the abstract and explained in the introduction.

      Comment 2: Introduction, first paragraph: change gene expression to 'transcription' in the phrase 'Even if the contribution of gene expression to GSR..' as I assume this is what is meant here. Gene expression consists of synthesis, processing, translation and decay.

      Response: The required change has been made.

      Comment 3: Pg. 3 Introduction: Since they are liquid-liquid phase condensates and ribonucleoproteins (RNPs) refer to any protein-RNA interaction, I think that referring to PBs and SGs as mRNPs is a bit misleading (especially the 'major mRNPs').

      Response: The statement has been rewritten.

      Comment 4: Introduction: are PBs truly 'sites' of mRNA decay as stated? There are papers in the literature that would argue otherwise.

      Response: The statement has been modified with more citations.

      Comment 5: Pg. 3, three lines from bottom. Change LSM14 to LSM14A

      Response: The addition has been done.

      Comment 6: Pg. 4 top - What is an 'LCS' - containing protein? The acronym has not been defined

      Response: The acronym has been defined now. We have also defined acronyms wherever they were missing.

      Comment 7: Fig. S1 - there are a lot of important data in this figure that demonstrate the coordinated movement of Scd6 and Sbp1 to granules. They should be moved into the main body of the manuscript in my opinion. Likewise, a whole section of the Results is dedicated to Fig. S2 - thus I would suggest moving these data into the main body of the manuscript to assist the reader.

      Response: We thank the reviewer for pointing this out. Figure S1 has now been added to the main body of the manuscript as Figure 2. Figure S2 has now been added to Figure 1 and new Figure 3. This rearrangement has improved the flow of the manuscript.

      Comment 8: Fig. 1F should be flipped in the figure with panel G since G is discussed in the results section before F

      Response: Figure 1F and 1G are now Figure 3A and 3D and in the same order as mentioned in the text.

      Comment 9: Be sure to define all acronyms for the reader.

      Response: All acronyms in the manuscript have been defined wherever applicable.

      Comment 11: Fig. 3H/I: It might be optimal to calculate and compare Kd's for the methylated and unmethylated variants. Also, the labels at the top of 3H do not line up with the wells of the EMSA gel.

      Response: We have calculated the Kd’s for the EMSA, and it has been added to the results section. We have also aligned the labels at the top of the EMSA gel (now Figure 5I) to match with the wells.

      Reviewer 2

      Major Comment 1: Fig. 2A, B. While there seems to be an effect on the lag phase, it could be revealing if the authors pls. calculate the doubling times for the strains and treatments (taking through the exponential growth phase). Furthermore, it would be good if the authors can show the rescue of phenotypes for deletion strains (ie. reintroduction of respective gene on ARS-CEN based plasmids or (if not available) with the OE plasmids.

      Response: We thank the reviewer for this remark. We have calculated the doubling times for the strains in the tested conditions and added in the text. We have analyzed the effect of complementing the deletion strains with the respective genes on the CEN plasmid. We observe that Δscd6 shows tolerance to HU stress as previously seen, which gets rescued almost completely upon complementation with WT SCD6. This result has been included in the manuscript as a new figure panel (Figure S1A) . Δsbp1 also shows marginal tolerance to HU stress, but complementation with WT SBP1 only slightly rescues the phenotype, which is not statistically significant (Figure S1B). This result highlights a more important role of Scd6 as compared to Sbp1 in genotoxic stress response.

      Major Comment 2 (part 1): Fig. 3H. The authors tested the 5'UTR of SRS2 for interaction with recombinant Scd6. Firstly, it is unclear why the authors have chosen the 5'UTR for investigation? Can the authors explain.

      Response: We thank the reviewer for this important comment. During experimentation and analysis, we assayed Scd6 binding to two different fragments of SRS2 mRNA: 5’ and 3’UTR of same lengths (200 bases). We used the UTR fragments because there are numerous reports indicating the role of UTRs in the regulation by RNA binding proteins (https://doi.org/10.1093/bfgp/els056, https://doi.org/10.1126/science.aad9868, https://doi.org/10.1093/jxb/erae073). RNA EMSAs with purified Scd6 and in vitro transcribed UTR RNA fragments revealed a significantly better binding of Scd6 with the 5’ UTR fragment of SRS2 mRNA compared to the 3’ UTR. Therefore, we proceeded with the 5’ UTR fragment for further analysis. We have now added this as a supplementary figure panel and explanation in the manuscript text (Figure S2B).

      Major Comment 2 (part 2): Secondly, the affinities are relatively low (µM), and the gel shift assay lacks a negative control. The authors should test an unrelated RNA fragment of approximately the same size to control for specificity (negative control). It is unclear whether the protein could interact with any RNA fragment through a charged RNA backbone.

      Response: Our in vivo data suggests that the binding of Scd6 with SRS2 mRNA is condition and RNA-specific and is regulated by methylation (now Figure 5C, S2A and 5E). As the reviewer mentioned, Scd6, in principle, could bind to any RNA molecule given the affinity of an RNA-binding protein (with positively charged amino acids such as arginine) to RNA molecule. Nevertheless, the significant difference in the binding of Scd6 to the 5’UTR and 3’UTR fragments itself acts as a relative control for EMSA. The aim of the in vitro experiment (EMSA) was to establish the difference, if any, in the binding affinities of unmethylated vs methylated Scd6, like the in vivo data, where we observe significantly increased binding to SRS2 mRNA upon decreased Scd6 methylation.

      Major Comment 2 (part 3): Thirdly, it would be good if the authors could show a Coomassie gel for the recombinant protein used in those assays.

      Response: The Coomassie gel which was provided as part the supplementary data (now Figure S2C), have now been added as another gel image to the main figure (Figure 5H), next to the EMSA, for better clarity.

      Major Comment 3: Methods and Materials: The Materials and Methods section lacks important information and requires further details to evaluate the study (see below 11 – 17)

      Response: The comment has been duly noted.

      Minor Comments

      Results:

      Comment 4: The numbering of Figure S1, S2 is confused in the first part of the results section. The authors should check numbering. In general, numbering should follow in the order of the text - pls. check.

      Response: Based on the comment#7 by Reviewer 1, Figure S1 and S2 have now been added to the main figure, and the changes in the text have been made accordingly.

      Comment 5: Pg. 5. CHX treatment leads to a decrease in Scd6-GFP and SBP-1 GFP granules. Essentially, CHX blocks translation elongation so the result indicates that puncta depend on active translation. The authors may want to add this liaising point towards the claim that mRNAs could be present in those puncta. How this results integrates with data shown in Fig. S5B*.

      *

      Response: We thank the reviewer for this comment. Since granules are dynamic structures that depend on active translation, CHX treatment leads to the dissociation of Scd6 and Sbp1 granules. This indicate that most of the mRNAs present in these granules could be recycled for translation in polysomes. This strategy has been used in multiple research articles for similar deductions (10.1091/mbc.E08-05-0499, https://doi.org/10.1083/jcb.151.6.1257, https://doi.org/10.1093/nar/gku582). We have now modified the text in the manuscript to accommodate this point. It has been previously reported that core components of stress granules, once formed are stable and resistant to RNase, EDTA and NaCl treatment ex vivo (https://doi.org/10.1016/j.cell.2015.12.038), even when these structures have RNA. Figure S5B (now S3C) indicates that the granule enriched fraction derived from untreated and treated cells indeed behaves like stress granule cores and not protein aggregates allowing us to proceed with downstream experiments.

      Comment 6: Fig. 2H. It would be helpful to the reader, if the authors could mark the respective fraction in the polysomes taken for analysis of relative enrichments. How was this relative enrichment was calculated needs further description.

      Response: The modification has been made (now Figure 4G) and added to the methods and materials.

      Comment 7: Fig. S5B. 1% SDS treatment cause absence for Scd6 signal from the pellet fraction. Based on this result, I am not clear how based on this result they can claim for presence of higher order mRNA-protein complexes? Why does it exclude the possibility for Scd6 aggregates accumulating in the pellet? The authors need to explain/ modify this statement. Related to earlier findings that showed dependency of puncta upon CHX treatment, one wonders how this result matches to this earlier observation (ie.EDTA should dissassemble ribosomes)? Can the authors explain?

      Response: The very stable β-zipper interactions present in prion like domains, which leads to aggregation, is resistant to 1-2% SDS treatment (https://doi.org/10.1016/j.cell.2015.12.038). Hence, we think that solubilization upon 1% SDS treatment indicates that these are not aggregates. EDTA and NaCl are capable of disrupting interactions, which are stabilized mainly by electrostatic forces. Our observations (now Figure S3C) indicate that Scd6 could be part of the more stable mRNP condensate core structure and are therefore resistant to these treatments. Such observations have been previously reported, for example, stress granules in yeast are not affected by EDTA and NaCl treatments (https://doi.org/10.1016/j.cell.2015.12.038).

      Comment 8 (part 1): Fig. 5E, F. For the RNA-seq, the authors compared polysomes with free RNAs (up to 80S) and found enrichment of LIG4 and RTEL1. However, the polysomal profiling mainly shows a slight shift of those mRNAs in higher polysomes; while there is no difference compared to free fractions. How can this be explained?

      Response: We observed a shift from lower polysome fractions (11-12-13) (not from free fractions) to higher polysome fractions (14-15) indicating an increased number of ribosomes translating the RTEL1 mRNA.

      Comment 8 (part 2): On the line, the authors should indicate clearly what fractions were pooled for RNA seq analysis. It is also not clear how the authors quantified percentage of RNA in individual fractions (have they spiked-in an RNA?) - this needs to be stated in the M&M section.

      Response: We have now added the requested information in the Materials and Methods section. Fractions 13 to 17 were pooled for RNAseq analysis. The % of RNA in each fraction was calculated as described in Panda AC et al. Bio Protoc . 2017 Feb 5;7(3):e2126. doi: 10.21769/BioProtoc.2126

      Comment 9: At the end, if may be beneficial to the reader if the authors could provide a simple scheme depicting the model develop during this study.

      Response: We thank the reviewer for this comment. We have included a model derived from our study as a new figure (Figure 8).

      Comment 10: Supplemental Data set (.xls) The adjusted p-values are clustered and >0.05. Can the authors check and describe how those were calculated. How does it match with Volcano plots.

      Response: The adjusted p-values are indeed >0.05. The p-values (and not the adjusted p-values) are plotted in the Volcano plot (now Fig. 7E)

      Materials and Methods:

      Comment 11: A list of primers should be given with specification of their use.

      Response: The list has been added in the supplementary files (Table S3)

      Comment 12: The plasmids constructed for (over)expression of proteins/ production of recombinant proteins should be added. If published, references should be added accordingly.

      Response: The list has been added in the supplementary files (Table S4)

      Comment 13: RIP: the media for growing yeast cells should be added. Check also other section if defined.

      Response: The information has been added wherever required.

      Comment 14: RT-qPCR is not sufficiently described. RT kit needs specification, PCR reaction cycles should be given.

      Response: The information has been added

      Comment 15: Quantification of mRNA levels in polysomes is unclear. How was the distribution of mRNA profiles determined? Have the authors added some RNA spikes to fractions?

      See above.

      Response: The % of RNA in each fraction was calculated as described in Panda AC et al. Bio Protoc . 2017 Feb 5;7(3):e2126. doi: 10.21769/BioProtoc.2126. Details have now been added in the Mat and Meth section.

      Comment 16: The calculation for the enrichments in IPs is not described conclusively and should be added.

      Response: The calculation has now been elaborated and added to the methods and materials section.

      Comment 17: Polysomes fractionation (mammalian). It is indicated that the resultant supernatant was adjusted to 5M NaCl and 1 M MgCl2. This seems to be very high - is this a typo? OR why such high concentrations have been chosen?

      Response: The sentence has been removed. There is no need for such adjustment.

      Review 3

      Major Comment 2: Fig 2A-F: The effects of Scd6 and Sbp1 deletion upon HU-treatment are very small. A more convincing effect is observed upon over-expression of both SRS2 and SCD6. What is the effect of over-expression of SCD6 and SBP1 alone (i.e. without SRS2 over-expression)?

      Response: We thank the reviewer for this comment. The effects are indeed small but consistent and reproducible with two different kinds of assays (growth curve and plating assay, now Figure 4A-C). Overexpression of Scd6 or Sbp1 alone when expressed from a CEN/2u plasmid does not have any phenotype in the presence of HU (Figure S1A and S1B). Although, it has been previously reported that galactose-inducible Scd6 causes a severe growth defect (https://doi.org/10.1093/nar/gkw762), we performed spot assays with galactose inducible Scd6 and Sbp1 on control and HU plates, but did not see any difference in the extent of growth upon HU treatment. This data has now been presented as Figure S1C.

      Major Comment 3: Fig 2E: Why is there an opposite effect of deletion of Scd6 and Sbp1in the SRS2 over-expression background?

      Response: We thank the reviewer for this comment; however, we respectfully disagree with the idea that overexpression of SRS2 yields opposite phenotypes in SCD6 and SBP1 deletion backgrounds. Figure 2E (now Figure 4E) gives the impression that SRS2 overexpression in SBP1 deletion grows significantly more for two reasons. There was an increased spotting of Dsbp1 cells overexpressing SRS2 (row#6) as compared to Dscd6 cells overexpressing SRS2 (row#4), which is evident in the plate without HU (left panel). Additionally, there is also reduced spotting of wild-type cells overexpressing SRS2 (row#2) as compared to Dscd6 cells overexpressing SRS2 (row#4). We have now replaced these panels with another image with better loadings. Quantitation of five experiments (Figure S1F) indicates that Dsbp1 grows slightly better in both EV and SRS2 over-expression background, but the increase is not statistically significant. We interpret this data to suggest that SRS2 is not a direct target of Sbp1. Another protein perhaps performs the specific role of Sbp1 in assisting Scd6 in genotoxic stress response in Dsbp1 background.

      Major Comment 6: Fig 3C: Is the increased interaction of SRS2 mRNA with Scd6 due to increased levels of SRS2 mRNA upon HU treatment? See also comment below.

      Response: Based on RT-qPCR of total RNA, SRS2 mRNA levels do not seem to increase, which has now been added as a Supplementary figure (Figure S3D, left panel). Moreover, quantification of SRS2 mRNA from the FISH data also does not support an increase in mRNA levels (Figure 6D, left panel).

      Major Comment 7: Fig 4A: There seems to be an enrichment of SRS2 mRNA both in the granule-enriched pellet and in the supernatant upon HU treatment in the Scd6-GFP context, suggesting increased SRS2 mRNA levels altogether. The enrichment in granules upon HU is difficult to see, as one should measure the distribution of the mRNA in the pellet relative to the supernatant. Can the authors represent the ratio pellet/supernatant normalized to a control transcript? A similar calculation can be done for the protein normalized to a control protein.

      Response: As mentioned earlier, RT-qPCR data with SRS2 mRNA levels in total lysate has been added to supplementary data (Figure S3D, left panel). Based on RT-qPCR of total RNA, SRS2 mRNA levels do not seem to increase.

      The quantification of SRS2 mRNA and Scd6 protein enrichment is done such that the supernatant and pellet fractions are separately normalized to their respective controls (Scd6GFP, untreated sample) and therefore do not represent the mRNA distribution but relative mRNA enrichment. However, as per the recommendation by the reviewer, the data has been replotted as a ratio of supernatant and pellet with the addition of two more data points and has been added in the main figure (Figure 6E). The data concludes increased enrichment of SRS2 mRNA in granules upon HU treatment. The previous data has been included in the supplementary data as Supplementary figure (Figure S3D, right panel).

      Major Comment 8: Fig 4B: Increased juxtaposition of SRS2 mRNA and Scd6 granules upon HU treatment does not really mean increased colocalization. Granules are likely significantly apart such that increased interactions between the two partners are not explained by increased juxtaposition. Please, comment, tune-down and provide examples where increased granule juxtaposition is associated with increased interaction.

      Response: We believe that the usage of term ‘juxtaposition’ is leading to misinterpretation of the data. Therefore, we have replaced it with ‘percentage area overlap’ analysis to demonstrate that the SRS2 mRNA foci indeed overlap/localize with Scd6GFP foci up to an average of 43.5% in HU stress. This analysis has been added as an additional panel (Figure 6C), indicating that the SRS2 mRNA interacts with Scd6 in the granules. Even though the granules do not overlap/localize completely, the observed area of granule overlap (43.5%) is functionally effective as it leads to the physical interaction of Scd6 and SRS2 (Figure 6E & 5C) and, consequently, repression (Figure 4H). The FISH data, granule enrichment, and RNA immunoprecipitation data demonstrate Scd6 protein and SRS2 mRNA interaction in granules.

      Major Comment 9: Fig 4D: These results are in direct contradiction with those shown in Fig 1C.

      Response: We thank the reviewer for this comment. Figure 1C (now Figure 1B and 1C) demonstrates that Scd6 localization to puncta, when expressed from a CEN plasmid, significantly increases upon HU stress. The same trend is visible in Figure 4D (now Figure 6D) where Scd6 is expressed from a 2μ plasmid; however, it is not significant. The data in 1C and 4D (now 1C and 6D respectively) are rather inconsistent with each other than being contradictory. Nevertheless, we understand this reviewer’s concern and address it below.

      The initial localization experiments were performed using Scd6 expressed from CEN plasmid or genomically tagged Scd6. Since both these versions of Scd6 are not detectable using western blotting, we used Scd6 expressed from 2μ plasmid. Localization to condensates by liquid-liquid phase separation is a concentration-driven phenomenon. Therefore, when Scd6 is expressed from a 2μ plasmid amounting to increased protein levels, its localization to puncta increases even in the absence of stress, which is visible in the quantitation provided in the figure (Figure 6D) as compared to Figure 1C. We have now analyzed the percentage granular localization (granule intensity) of Scd6 (2µ), which significantly increases upon HU stress (Figure S3A). Thus although number of Scd6 granules does not increase upon HU stress when expressed from a 2µ plasmid, there is significant increase in localization of Scd6 to granule upon HU stress (Figure S3A).

      Major comment 10: Fig 5E: Can the authors provide a GO analysis of the up- and down- regulated transcripts?

      Response: We have now provided a GO analysis (Table S2). However, due to the low number of regulated genes, only a few GO terms with weak scores appeared in the analysis.

      Minor comments:

      Comment 11: Figures S1 and S2 seem to be swapped. Please make sure that Figures and panels are arranged in the order they are mentioned in the main text.

      Response: We thank the reviewer for pointing it out. Based on the comment#7 by Reviewer 1, Figure S1 and S2 have now been added to the main figure, and the changes in the text have been made accordingly. We have ensured that the order of figures matches the text.

      Comment 12: Page 5, sentence: 'our results argue for the role of Scd6 and Sbp1 in HU-mediated stress response'. I do not agree, as no functional assays showing that these proteins affect HU-mediated stress response have been provided at this point of the story. Please, delete.

      Response: We have removed the sentence from the existing paragraph.

      Comment 13: Page 6: The authors state 'Since Dscd6 and Dsbp1 showed tolerance to chronic HU exposure...'. Where is this shown?

      Response: The growth curve in Figure 2A and 2B (now Figure 4A and 4B) and the plating assay in Figure 2C (now Figure 4C) was done with hydroxyurea in the media/plate. Hence, we state that deletion of either SCD6 or SBP1 shows tolerance to chronic (or continuous) HU stress.

      Comment 14: Fig 2F: The rescue by SCD6 OE is not complete, as mentioned in the main text.

      Response: We have now included the quantification of the spot assay in 2F (now Figure 4F) to show that the rescue by SCD6 overexpression is complete (Fig S1G).

      Comment 15: Figure 2G-H: Please, indicate in the figure what the authors consider 'translated' and 'untranslated’ fractions.

      Response: The fractions have now been labelled to indicate the missing information in Figure 2G (now Figure 4G).

      4. Description of analyses that authors prefer not to carry out



      Review 1


      Minor Comment 10: Pg. 8/Fig. S3D/4A: It would be interesting to complete the story and determine the functional relationship of Scd6 to the DNL4 mRNA

      Response: It is indeed an interesting observation and is currently being pursued as part of another story. We believe it is beyond the scope of the current manuscript.


      Review 3

      Major Comment 1: Page 5 and Fig S2E-F: The CLHX experiment to conclude that mRNA is present in Scd6 and Sbp1 puncta is rather indirect. The fact that RNase treatment of a granule-enriched pellet has no effect (Fig S5B) does not help. The authors should perform RNase treatment of intact cells and see that the puncta disappear.

      Response: We thank the reviewer for this comment. Cycloheximide treatment is a well-accepted assay to detect the presence of mRNA in granules. Since granules are dynamic structures, and these depend on active translation, CHX treatment leads to the dissociation of Scd6 and Sbp1 granules. This indicates that granule assembly depends on the availability of mRNA derived from translating ribosomes. The observation that Scd6 puncta are sensitive to cycloheximide but not to RNase A treatment is not surprising. It indeed is consistent with the properties of some of the condensates reported in the literature. For example, stress granule cores that are sensitive to cycloheximide, like Scd6 puncta, are resistant to RNase treatment in lysate, indicating that once formed, these structures are quite stable (https://doi.org/10.1016/j.cell.2015.12.038). It is interpreted to suggest that the RNAs in these condensates are protected by the RNA-binding proteins. Also, subsequently, in the study, we do RNA immunoprecipitation and granule enrichment experiments and show specific RNA enrichment with Scd6 (Figure 5C, 6A).

    1. Contents

      I noticed that you have a works cited page on each of your writings and that is very important. But I wonder if it would help to also have your entire bibliography page connected to the notes as an indirect connections (you can do this by editing the page and adding a tag)

    1. https://stationeryfestival.com/exhibitors

      Elite Accessories<br /> 3428 Hauck Rd, Ste K<br /> Cincinnati, OH 45241<br /> (630) 945-2710

      Represents the following stationery manufacturers in the US:<br /> - Kaweco (Germany) fountain pens - Kyo No Oto (Tag Stationery) inks - Oeda Letterpress (Osaka Japan) letterpress stationery - Onishi Seisakusho (fountain pens) - Diamine Inks (Liverpool, UK)

    1. Reviewer #2 (Public review):

      Summary:

      The authors tried to determine how PA28g functions in oral squamous cell carcinoma (OSCC) cells. They hypothesized it may act through metabolic reprogramming in the mitochondria.

      Strengths:

      They found that the genes of PA28g and C1QBP are in an overlapping interaction network after an analysis of a genome database. They also found that the two proteins interact in coimmunoprecipitation and pull-down assays using the lysate from OSCC cells with or without expression of the exogenous genes. They used truncated C1QBP proteins to map the interaction site to the N-terminal 167 residues of C1QBP protein. They observed the levels of the two proteins are positively correlated in the cells. They provided evidence for the colocalization of the two proteins in the mitochondria and the effect on mitochondrial form and function in vitro and in vivo OSCC models, and the correlation of the protein expression with the prognosis of cancer patients.

      Weaknesses:

      Many data sets are shown in figures that cannot be understood without more descriptions either in the text or the legend, e.g., Fig. 1A. Similarly, many abbreviations are not defined.

      The revision addressed these issues.

      Some of the pull-down and coimmunoprecipitation data do not support the conclusion about the PA28g-C1QBP interaction. For example, in Appendix Fig. 1B the Flag-C1QBP was detected in the Myc beads pull-down when the protein was expressed in the 293T cells without the Myc-PA28g, suggesting that the pull-down was not due to the interaction of the C1QBP and PA28g proteins. In Appendix Fig. 1C, assume the SFB stands for a biotin tag, then the SFB-PA28g should be detected in the cells expressing this protein after pull-down by streptavidin; however, it was not. The Western blot data in Fig. 1E and many other figures must be quantified before any conclusions about the levels of proteins can be drawn.

      The revision addressed these problems.

      The immunoprecipitation method is flawed as it is described. The antigen (PA28g or C1QBP) should bind to the respective antibody that in turn should binds to Protein G beads. The resulting immunocomplex should end up in the pellet fraction after centrifugation, and analyzed further by Western blot for coprecipitates. However, the method in the Appendix states that the supernatant was used for the Western blot.

      The revision corrected this method.

      To conclude that PA28g stabilizes C1QBP through their physical interaction in the cells, one must show whether a protease inhibitor can substitute PA28q and prevent C1QBP degradation, and also show whether a mutation that disrupt the PA28g-C1QBP interaction can reduce the stability of C1QBP. In Fig. 1F, all cells expressed Myc-PA28g. Therefore, the conclusion that PA28g prevented C1QBP degradation cannot be reached. Instead, since more Myc-PA28g was detected in the cells expressing Flag-C1QBP compared to the cells not expressing this protein, a conclusion would be that the C1QBP stabilized the PA28g. Fig. 1G is a quantification of a Western blot data that should be shown.

      The binding site for PA28g in C1QBP was mapped to the N-terminal 167 residues using truncated proteins. One caveat would be that some truncated proteins did not fold correctly in the absence of the sequence that was removed. Thus, the C-terminal region of the C1QBP with residues 168-283 may still bind to the PA29g in the context of full-length protein. In Fig. 1I, more Flag-C1QBP 1-167 was pull-down by Myc-PA28g than the full-length protein or the Flag-C1QBP 1-213. Why?

      The interaction site in PA28g for C1QBP was not mapped, which prevents further analysis of the interaction. Also, if the interaction domain can be determined, structural modeling of the complex would be feasible using AlphaFold2 or other programs. Then, it is possible to test point mutations that may disrupt the interaction and if so, the functional effect.

      The revision added AlphaFold models for the protein interaction. However, the models were not analyzed and potential mutations that would disrupt the interact were not predicted, made and tested. The revision did not addressed the request for the protease inhibitor.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      It is evident that studying leukocyte extravasation in vitro is a challenge. One needs to include physiological flow, culture cells and isolate primary immune cells. Timing is of utmost Importance and a reproducible setup essential. Extra challenges are met when extravasation kinetics in different vascular beds is required, e.g., across the blood-brain barrier. In this study, the authors describe a reliable and reproducible method to analyze leukocyte TEM under physiological flow conditions, including this analysis. That the software can also detect reverse TEM is a plus.

      Strengths:

      It is quite a challenge to get this assay reproducible and stable, in particular as there is flow included. Also for the analysis, there is currently no clear software analysis program, and many labs have their own methods. This paper gives the opportunity to unify the data and results obtained with this assay under label-free conditions. This should eventually lead to more solid and reproducible results.

      Also, the comparison between manual and software analysis is appreciated.

      We thank the Reviewer for their positive evaluation of our manuscript and highlighting the value of obtaining more reproducible and unbiases results, as well as detection of forward and reverse transmigration with UFMTrack.

      Weaknesses:

      The authors stress that it can be done in BBB models, but I would argue that it is much more broadly applicable. This is not necessarily a weakness of the study but more an opportunity to strengthen the method. So I would encourage the authors to rewrite some parts and make it more broadly applicable.

      We thank the Reviewer for this suggestion. In the revised version of our manuscript, we have now emphasized the broader applicability of UFMTrack to analyze the interaction of immune cells with 2dimensional endothelial monolayers in various contexts in the abstract, introduction, and discussion sections.

      Reviewer #2 (Public Review):

      Summary:

      This paper develops an under-flow migration tracker to evaluate all the steps of the extravasation cascade of immune cells across the BBB. The algorithm is useful and has important applications.

      Strengths:

      Algorithm is almost as accurate as manual tracking and importantly saves time for researchers.

      We thank the Reviewer for this positive evaluation of our work.

      Weaknesses:

      Applicability can be questioned because the device used is 2D and physiological biology is in 3D. Comparisons to other automated tools was not performed by the authors.

      We thank the Reviewer for pointing our attention to these weaknesses in our manuscript.

      We have clarified in the revised manuscript that using 2D endothelial monolayer models in parallel laminar flow chambers is still a state-of-the-art methodology for studying the multi-step extravasation process of immune cells across endothelial monolayers under physiological flow by in vitro live cell imaging. These models provide excellent optical quality that is not yet achieved in 3D models. We have extended the introduction to emphasize the limitations of existing tools that motivated us to establish UFMTrack. We have furthermore extended the discussion section to highlight the features unique to our UFMTrack framework.

      Reviewer #3 (Public Review):

      Summary:

      The authors aimed to establish a faster and more efficient method of tracking steps of T-cell extravasation across the blood brain barrier. The authors developed a framework to visualize, recognize and track the movement of different immune cells across primary human and mouse brain microvascular endothelial cells without the need for fluorescence-based imaging. The authors succinctly describe the basic requirements for tracking in the introduction followed by an in-depth account of the execution.

      We thank the Reviewer for their positive evaluation of our manuscript and highlighting the value of label-free analysis of the multistep immune cell extravasation cascade with UFMTrack.

      Weaknesses and Strengths:

      Materials & methods and results:

      (1) The methods section also lacks details of the microfluidic device that the authors talk about in the paper. Under physiological sheer stress, the T-cells detach from the pMBMEC monolayer, and are hence unable to be detected; however, this observation requires an explanation pertaining to the reason of occurrence and potential solutions to circumvent it to ensure physiologically relevant experimental parameters.

      We thank the Reviewer for pointing out this oversight. We have used a custom-made microfluidic device that has been published and described in detail before. This information has now been included in the Methods Section under Point 7, and the two references describing the flow chamber in depth are mentioned below and have been included in the manuscript.  

      Coisne Caroline, Ruth Lyck and Britta Engelhardt. 2013. Live cell imaging techniques to study T cell trafficking across the blood-brain barrier in vitro and in vivo. Fluids and Barriers of the CNS 10:7 doi:10.1186/20458118-10-7; 21 January 2013

      Lyck R, Hideaki Nishihara, Sidar Aydin, Sasha Soldati and Britta Engelhardt. 2022. Modeling brain vasculature immune interactions in vitro. Angogenesis, 2nd edition. Editors PatriciaD’Amore and Diane Bielenberg Cold Spring Harb Perspect Med doi: 10.1101/cshperspect.a041185

      T cell detachment is a physiologically relevant parameter besides T cell arrest, polarization, crawling, probing, and transmigration during the interaction with an endothelial monolayer. T cell detachment means that post-arrest, the T cell cannot engage adhesion molecules required for subsequent polarization and, eventually, transmigration. 

      (2) The author describes a method for debris exclusion using UFMTrack that eliminates objects of <30 pixels in size from analysis based on a mean pixel size of 400 for T lymphocytes. However, this mean pixel size appears to stem from in-vitro activated CD8 T cells, which rapidly grow and proliferate upon stimulation. In line with this, activated lymphocytes exhibit increased cytoplasmic area, making them appear less dense or “brighter” by phase microscopy compared to naïve lymphocytes, which are relatively compact and subsequently appear dimmer. Given this, it is not clear whether UFMTrack is sufficiently trained to identify naïve human lymphocytes in circulating blood, nor smaller, murine lymphocytes. Analysis of each lymphocyte subtype in terms of pixel size and intensity would be beneficial to strengthen the claim that UFMTrack can identify each of these populations. Additionally, demonstrating that UFMTrack can correctly characterize the behavior of naïve versus activated lymphocytes isolated from murine and human sources would strengthen the claim that UFMTrack can be broadly applied to study lymphocyte dynamics in diverse models without additional training

      We thank the Reviewer for the suggestion to more precisely evaluate the range of cell sizes that can be analyzed by our framework. We have included a visualization of crawling cell sizes successfully analyzed by the UFMTrack in Supplementary Figure 7. It demonstrates that the human peripheral blood mononuclear cells, that are almost twice as small as the activated mouse CD4 T cells used in these assays, can be successfully segmented, tracked, and analyzed with the UFMTrack framework. Thus, our UFMTrack framework is suitable for a broad application to differentially sized immune cells during their interaction with the endothelial cell monolayer under flow. 

      (3) Average precision was compared to the analysis of UFMTrack but it is unclear how average precision was calculated. This information should have been included in the methods section

      We thank the Reviewer for pointing our attention to the missing information. We have added a subsection, “Performance Analysis”, to the Materials and Methods section, where we describe the statistical methods and the performance metrics used to evaluate the UFMTrack framework.

      (4) CD4 and CD8 T cells exhibit distinct biology and interaction kinetics driven in part by their MHC molecule affinity and distinct receptor expression profiles. Thus, it is unclear why two distinct mechanisms of endothelial cell activation are needed to see differences between the populations.

      We thank the Reviewer for pointing out that different cytokine stimulations of endothelial cells were used in the assays used here to test our UFMTrack to analyze CD4 and CD8 T cell interactions with the endothelial monolayer. While the Reviewer is correct that CD4 and CD8 T cells use different mechanism to cross the pMBMEC monolayer as show by us (doi: 10.1002/eji.201546251.) and others and that recognition of cognate antigen on MHC class I on pMBMECs will arrest CD8 T cells and lead to CD8 T-cell mediated apoptosis ( doi: 10.1038/s41467-023-38703-2.) the focus of the present study was not on comparing CD4 and CD8 T cell interactions with the pMBMEC monolayer but rather to test suitability of UFMTrack to study the different multi-step transmigration of these T cell subsets across the endothelial monolayer. 

      (5) The BMECs are barrier tissues but were cultured on µdishes in this study. To study the transmigration of T-cells across the endothelium, the model would have been more relevant on a semi-permeable membrane instead of a closed surface.

      We understand the critique of the Reviewer, but laminar flow chambers with endothelial monolayers still provide a state-of-the-art and established methodology to study immune cell migration across endothelial monolayers by in vitro live cell imaging including endothelial cells forming the blood-brain barrier.  

      (6) Methods are provided for the isolation and expansion of human effector and memory CD4+ T cells. However, there is no mention of specific CD4+ T cell populations used for analysis with UFMTrack, nor a clear breakdown of tracking efficiency for each subpopulation. Further, there is no similar method for the isolation of CD8+ T cell compartments. A clear breakdown of the performance efficiency of UFMTrack with each cell population investigated in this study would provide greater insight into the software’s performance with regard to tracking the behavior and movement of distinct immune populations.

      We thank the Reviewer for this comment. Since a fair performance evaluation requires collecting reliable and consistent manual annotations, in this work we have performed such analysis only for the mouse CD8 T-cell population migrating on the pMBMEC monolayer. We have chosen this as a reference since it is a different cell population than the one the segmentation model was trained on. This provides an insight into how high performance is expected when other immune cell types are studied than the ones used for model development.

      (7) The results section is quite extensive and discusses details of establishment of the framework while highlighting both the pros and cons of the different aspects of the process, for example the limitation of the two models, 2D and 2D+T were highlighted well. However, the results section includes details which may be more fitting in the methods section.

      We thank the Reviewer for highlighting the extensive work carried out in the development of our UFMTrack framework. We decided to include in the results section only the description of key elements and design decisions taken when developing the framework, such as the need to include a time series of images for successful segmentation of the transmigrated cells. At the same time, the majority of implementational details can be found in the Supplementary Material.

      (8) A few statements in the results section lacked literary support, which was not provided in the discussion either, such as support for increased variance of T-cell instantaneous speed on stimulated vs non-stimulated pMBMECs. Another example is the enhancement of cytokine stimulation directed T-cell movement on the pMBMECs that the authors observed but failed to relay the physiological relevance of it. The authors don’t provide enough references for developments in the field prior to their work which form the basis and need for this technology.

      We thank the Reviewer for this comment and for asking for literature references. However, we cannot provide such references as these are original observations we made by employing the UFMTrack framework.  This shows that UFMTrack observes T-cell behaviors that have previously been overlooked. Their physiological relevance will have to be explored in separate studies. We have extended the introduction section to include the details on the existing methods developed in the field, as well as their weaknesses that motivated the development of the UFMTrack framework.

      (9) The rationale for use of OT-1 and 2D2-derived murine lymphocytes is unclear here. The OT-1 model has been generated to study antigen-specific CD8+ T cell responses, while the 2D2 model has been generated to recapitulate CD4 T cell-specific myelin oligodendrocyte glycoprotein (MOG) responses.

      To establish and test the UFMTrack framework, we have made use of the specific T-cell subsets and endothelial cell models we generally use within our research context. Especially for animal work, this is according to the 3R rules requesting to reduce animal experimentation.  

      Figures and text:

      (1) There are certain discrepancies and misarrangement of figures and text. For example, discussion of the effect of sheer flow on T cell attachment as part of the introduction in figure 1 and then mentioning it in the text again in the results section as part of figure 4 is repetitive.

      We thank the Reviewer for pointing our attention to this misarrangement. We have adjusted the label of Figure 4 to emphasize that this effect is correctly captured by the UFMTrack.

      (2) Section IV, subsection 1 of the results section, refers to ‘data acquisition section above’ in line 279, however the said section is part of materials and methods which is provided towards the end of the manuscript.

      We thank the Reviewer for pointing our attention to this misarrangement. We have adjusted the text to reflect the correct chapter order.

      (3) There are figures in the manuscript that have not been referenced in the results section, for example, figure 3A and B. Figure 1 hasn’t been addressed until subsection 7 of materials and methods

      We thank the Reviewer for pointing our attention to this misarrangement. We have adjusted the text to refer to all figure panels and the clarification of the cell multiplicity estimation in the supplementary information section. References to Figure 1 were added in the introduction section to illustrate the in vitro under flow imaging setup as well as the typical T cell behaviors in such experiments.

      (4) A lack of significance but an observed trend of increased variance of T cell instantaneous speed is reported in line 296-298; however, the graph (figure 4G) shows a significant change in instantaneous speed between non-stimulated and TNFα-stimulated systems. This is misleading to the readers.

      We thank the Reviewer for pointing our attention to this discrepancy. We have expanded the text to indicate a low statistical significance for the TNF and no significance but just a trend for the IL1-beta conditions.

      (5) The authors talk about three beginner experimentors testing the manual T cell tracking process but figure 5 only showcases data from two experimentors without stating the reason for excluding experimentor 1.

      We thank the Reviewer for pointing our attention to this ambiguity. While both the migration analysis and the manual cell tracking were performed by all three beginner experimenters, the cell tracking data for the first one was unfortunately lost due to a hardware failure.

      Discussion:

      (1) While the discussion captures the major takeaways from the paper, it lacks relevant supporting references to relate the observation to physiological conditions and applicability.

      This study is not about the physiological relevance of the microfluidic devices and immune cells used but rather about advancing methodology to analyze dynamic immune cell behavior on endothelial monolayers under physiological flow. Therefore, the discussion does not extend to comparing the physiological relevance of the specific in vitro models employed in this study.   

      (2) The discussion lacks connection to the results since the figures were not referenced while discussing an observed trend

      We thank the Reviewer for pointing our attention to this misarrangement. We have included the references to the relevant figures as well as supporting references.

      (3) The authors briefly looked into mouse and human BMECs and their individual interaction with Tcells, but don’t discuss the differences between the two, if any, that challenged their framework.

      We thank the Reviewer for pointing our attention to this weakness. We have added to the discussion section clarifications on the challenges of analyzing the T cell interactions with the HBMEC and the BMDM interactions with the pMBMEC monolayer.

      (4) Even though though the imaging tool relies on difference in appearance for detection, the authors talk about lack of feasibility in detecting transmigration of BMDMs due to their significantly different appearance. The statement lacks a problem solving approach to discuss how and why this was the case.

      We thank the Reviewer for pointing our attention to this weakness and apologize for the misleading explanation of the problem of analyzing the BMDM sample. Since the transmigrated part of the macrophages differs in appearance from a transmigrated part of a T cell, its detection by a Deep Neural Network trained on the T cell data is worse than that for the T cells. At the same time, the detection performance before the transmigration is sufficient for the BMDM migration analysis. The potential approaches to alleviate this are added to the discussion section.

      Relevance to the field:

      Utilizing the framework provided by the authors, the application can be adapted and/or utilized for visualizing a range of different cell types, provided they are different in appearance. However, this would require extensive changes to the script and won’t be adaptable in its current form.

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      The authors should announce in the abstract that the software analysis Track is downloadable and free to use for all researchers. They may consider providing some sort of helpdesk, although I realize that that may run into too much time.

      As said above, they stress that it can be done in BBB models, but I would argue that it is much more broadly applicable.

      We thank the Reviewer for these suggestions. We have emphasized the broader applicability of UFMTrack in the abstract and pointed out the public availability of the code and data.

      Can they add an experiment that shows that it also works for neutrophils for example? I understand that on paper yes it should work, but the neutrophils are of course faster etc.

      This is an excellent suggestion, but we tested UFMTrack within the current framework of ongoing research, which does not include the investigation of neutrophil transmigration across endothelial monolayers.  

      Also, the combination of different leukocytes in one TEM assay would really be a step forward. If the software can detect different-sized leukocytes, then this should be possible.

      We thank the Reviewer for this suggestion. We have added Supplementary Figure 7, demonstrating the range of cell sizes that were successfully analyzed by the UFMTrack framework throughout our manuscript. We also added a statement to the discussion that according to this data, “simply by discriminating cells by size, it is possible to extend UFMTrack to study the interaction of several types of immune cells migrating on top of a cellular monolayer under flow.”

      Extra challenges: can the method also discriminate between paracellular and transcellular migration modes? In particular for T-cells this is known to happen.

      We thank the Reviewer for this suggestion. We have added this to the potential applications of UFMTrack in the discussion section. While this differentiation is not feasible relying solely on the phasecontrast imaging data, UFMTrack can simplify this analysis by providing automatically the predictions of the transmigration locations, for analysis of the fluorescent data of the junctional labels.

      Reviewer #2 (Recommendations For The Authors):

      This paper develops an under-flow migration tracker to evaluate all the steps of the extravasation cascade of immune cells across the BBB. The algorithm is useful and has important applications. There are several points that need to be addressed, particularly about the claims made by the authors.

      Please see the comments below for more details:

      • Lines 88-92: Add a citation for the characteristics of the BBB as a barrier

      We have added two references accordingly.  

      • Lines 94-95: Can the authors indicate what models were used for these studies and how those compare to their in vitro model? In addition, can the authors say whether T cells were manually tracked in this study to translate results to the clinic and whether the results were successful when translated to the clinic? This may enhance the argument that automatic trackers are needed if the translation was not 100% successful

      This introductory paragraph summarizes in vivo and in vitro observations from several laboratories. Although these studies include manual tracking of T cells, they do not necessarily distinguish all sequential steps of the multi-step T cell transmigration cascade. Thus, automated tracking may provide additional insights, allowing for increased translation of findings to the clinic.  

      • Lines 96-98: Citing the work of Roger Kamm and Noo Li Jeon would be helpful here as they pioneered these BBB microfluidic models and have protocol papers on how to build them and how to use them for cancer cell extravasation studies. Roger Kamm has also worked on several extravasation studies with neutrophils, monocytes, and PBMCs from 3D vasculatures in microfluidic devices, under flow using pressurized fluid or recirculating pumps. Mentioning those would be helpful as they are directly related to what the authors are presenting in their paper.

      We thank the Reviewer for this comment, and we consider the work of Roger Kamm and Noo Li Jeon as very valuable for the field. However, these authors have focused on developing functional 3D microfluidic devices, including, e.g., all cells of the neurovascular unit which is not the focus of this present study that solely employed parallel flow chamber devices and endothelial monolayers.  

      • Lines 110-116: Can the authors comment on the use of ImageJ or similar automatic tracking tools and how these compare to the under-flow migration tracker developed in this paper? Several groups use ImageJ to track cellular migration successfully and in an automatic manner with short intervals between each frame. One paper that comes to mind is Chen et al: DOI: 10.1073/pnas.1715932115 where neutrophil migration in 3D was assessed with ImageJ in microfluidic devices of the vasculature. If the authors can highlight differences between their tool and what is currently available and used for automatic tracking (e.g. ImageJ), this would help in understanding the advantages of the migration tracker developed in this paper.

      • Lines 118-121: Add citations for the current state of the art for T cell extravasation tracking

      We thank the Reviewer for these suggestions. We have extended the introduction to add more details on the available tools for tracking migrating immune cells and their limitations, as well as the discussion section to emphasize the features unique to the developed UFMTrack framework.

      • Figure 1: The device used by the authors is considered to be a 2D microfluidic device with a monolayer of mouse brain endothelial cells. I would recommend the authors to carefully revise the claims made in the paper to mention that this is a 2D device as opposed to a 3D device, in order to not mislead readers who may be expecting these analyses to be performed in 3D vasculatures.

      We thank the Reviewer for this suggestion. We have included in the summary the mention of the 2dimensional nature of the employed BBB model.

      • Figure 1: The T cells used in this study are not fluorescently-labeled but the authors mention that this is an issue from current state-of-the-art tools. I would recommend that the authors remove this point as being an issue because it is not addressed in their paper. The T cells are also not labeled in this study so this limitation of other systems is not addressed in this paper.

      We apologize to the Reviewer as we do not understand this question. There will be many experimental conditions not allowing to study fluorescently tagged T cells. Therefore, UFMTrack is tailored to follow and analyze T cells and other immune cells during their interaction with endothelial monolayers independent of a fluorescence tag.  

      • Figure 1: Was the shear stress controlled manually with a syringe? Or with the use of a pressure controller? I would clarify this aspect and discuss human errors that can be introduced from manually controlling the pressure applied to the monolayer.

      We thank the Reviewer for pointing our attention to this ambiguity. We have added a mention of the automated syringe pump used to control the shear stress in the text where the values of shear stress applied to the sample are first mentioned.

      • Figure 1: Does T cell attachment occur within the first 5 minutes? Can the authors comment on how they chose this timeline and the percentage of T cells that are washed off at the second step at 1.5 dynes/cm^2? Is 30 seconds enough to ensure all the non-adhered T cells are washed off with 1.5 dyns/cm^2?

      Superfusion of the T cells over the endothelial monolayer is performed under 0.5 dynes/cm2 to allow the T cells to settle on the endothelial cell monolayer under flow. After increasing to physiological, flow non adherent T cells detach within 30 seconds, as described by the Reviewer. We have included in the Methods Section Point 7 the references describing in depth the design of the flow chamber device and methods used here.  

      • Line 154: How many images were used in the training vs. testing dataset for T cell migrations?

      We thank the Reviewer for pointing our attention to this missing information. We have added the sizes of the training and validation datasets. Specifically, the 226MPix of available imaging data was split into 154Mpix training and 37 MPix validation sets. The gap in between was introduced to avoid a correlation between validation and training set that would compromise the performance evaluation.

      • Are the supplementary videos at real speed or accelerated?

      We thank the Reviewer for pointing our attention to this missing information. The videos are sped up by a factor of 96. We have added this information to the Supplementary video descriptions.  

      • Lines 208 216: Can the authors comment on how their initial adhesion timeframe of 30sec before starting the recording at 5.5min affects the number of T cells with rapid displacement? 30 seconds may not be enough to ensure T cells have adhered to the endothelium

      Please see our comment above. The methodology used in the present assays has been set up and validated in numerous publications. We have included in the Methods Section under Point 7 the references describing in depth the design of the flow chamber device and the methods used here.  

      • Lines 275-277: Was the number of testing images 18? Can the authors comment on how this compares to training dataset size and whether these numbers are enough to achieve robust results?

      We apologize for this ambiguity in our manuscript. The framework was evaluated on 18 imaging datasets, each corresponding to 32 minutes of recording, not 18 images. We have added this clarification to the “CD4+ T cell analysis” subsection. The total size of these datasets is 18 datasets * 191 timeframe/dataset * 9.9MPix/frame = 34MPix

      • Figure 4B: Can the authors add statistics here? Individual datapoints on the error bars would be helpful too. 

      We thank the Reviewer for pointing our attention to this weakness. The data corresponds to the statistical errors as evaluated based on all cells in the 18 datasets. We have added the total number of cells in each of the endothelium stimulation conditions to the text.

      • Figure 4C-J: Can the authors put individual datapoints here as well and explain whether they considered each T cell to be one datapoint or each endothelium (averaging all T cells) to be one datapoint? 

      We thank the Reviewer for this suggestion. However, adding about one thousand points corresponding to each cell would be impractical. We thus present the distributions of the evaluated from the data metrics as a histogram on the violin plot instead of the swarm plot.

      • Figure 4: Did the authors wash the monolayers before introducing T cells? Soluble unbound cytokines may still be present and there are two different questions that would be studied here: “Is the inflamed endothelium affecting T cell migration?” (if washing was performed) or “Is T cell and microenvironmental inflammation affecting T cell migration?” (if no washing was performed)

      The endothelial monolayers are “washed” by starting the flow in the flow chamber device and this is before superfusing the T cells over the endothelial monolayer. We agree that our flow chamber device combined with UFMTrack will allow to address all these questions.

      • Figure 4I: Are all the T cells decelerating? (negative AM speed)

      We thank the Reviewer for this question. The cells are moving along the flow, which, in our experiments, is from left to right. The vector of speed is thus pointing against the x-axis, and thus the AM speed is negative.

      • Lines 302 306: Please explain how this compares to ImageJ or similar trackers that can achieve similar outputs. 

      We thank the Reviewer for this question. We have added a statement in the “T-cell tracking” section emphasizing that standard trackers are incapable of correctly capturing large displacements.

      • Lines 306-309: It is not lower for TNF stimulation though. How do the authors address this? TNF is also a pro-inflammatory cytokine.

      We have previously shown that stimulation of pMBMECs with IL-1 and TNF-a induces different cell surface levels of ICAM-1 and VCAM-1, which will influence T cell behavior on the pMBMEC monolayer.  

      • Lines 313-315: Could this be because the monolayer was not washed and soluble cytokines affected T cell response directly?

      Please see our answer to lines 306-309.  

      • Lines 319: Please cite Roger Kamm and Noo Li Jeon’s papers on BBB models with human BMECs, pericytes and astrocytes in 3D microfluidic devices.

      We thank the Reviewer again for pointing out these studies. As mentioned above, as our present study does not explore 3D models of the BBB, we think it does not fit into the framework of our study to elaborate on 3D models of the BBB. In addition, this would require the inclusion of a discussion of the work of others like, e.g., Peter Searson and others.  

      • Figure 5: Several statistics are missing from parts of the figure. Please add those.

      We apologize – but we do not understand which statistical analysis the Reviewer is missing from this Figure.  

      • Can the authors comment on the number of T cells perfused over the monolayer and if this ratio of T cells to endothelial cells makes physiological sense? Too many T cells may result in endothelium inflammation and increased diapedesis.

      The number of T cells used to suprerfuse over the endothelial monolayer is tested to avoid aggregation of T cells in suspension and thus artificial interactions with the endothelial monolayer. T cell behavior on the pMBMEC monolayer remains the same over the dilution of factor 10.  

      • Lines 381 383: How does this compare to analyses that look at the cross-section of the endothelium? It is difficult to assess transmigration looking at the top view of the endothelium. Perhaps, cross-section assessments will identify differences in manual vs. automatic tracking.

      There is, to the best of our knowledge, no microscopic device that would allow for in vitro live cell imaging of a live endothelial monolayer – this is in the presence of tissue culture medium – from the side at a resolution that would allow to define transmigration. Our current study rather shows the UFMTrack can distinguish cells moving above or below the endothelial monolayer.  

      • Figure 5J: This is probably the most important argument of the paper. If the authors can show statistical differences in their graph, this would greatly help convince readers that this tool is necessary and actually computationally efficient compared to manual work by researchers.

      We thank the Reviewer for this suggestion. However, comparing a single data point for automated measurement with four manual experimenter analysts is not a statistically sound comparison. We believe that Figure 5K is clearly showing the factor 5 difference in analysis speed as compared to manual analysis. More importantly, though, the automated analysis is taking the machine time, lifting the need for the experimenter to invest even 1/5th of the original analysis time.

      • Figure 6: Did the authors use autologous immune cells and endothelial cells? This is particularly relevant with the use of human-derived T cells (line 436) on the BMEC monolayer. Can the authors comment on non-self reactivity by the T cells encountering BMEC from another human subject?

      Autologous T cell interaction with BMECs would only be possible when using hiPSC-derived EECM-BMECs and the T cells from the same individual. All other experimental frameworks will not include autologous interactions. This is the experimental framework used by most authors studying immune cell interactions with commercially available donors. We have not studied alloreactive interactions in our assays and thus cannot further comment.  

      • Figure 6M,N,O: How does this compare to ImageJ for tracking of fluorescent cells? I recommend the authors to try that, at least for this section, as this may enhance their argument for their tool vs. standard tools like ImageJ if success rates are higher for their tool.

      We thank the Reviewer for this suggestion. We included a note on the analysis of the fluorescent datasets using the  TrackMate plugin for imageJ performed previously in our lab in the “Human T cells on immobilized recombinant BBB adhesion molecules” subsection.

      • Figure 6: Please put individual datapoints on the bar or violin plots where they are missing.

      We thank the Reviewer for this suggestion. However, adding about one thousand points corresponding to each cell would be impractical. We thus present the distributions of the evaluated from the data metrics as a histogram on the violin plot instead of the swarm plot.

      • Lines 467-471: This argument is important and should be mentioned earlier in the introduction.

      Another point that can be mentioned is the application of this platform to imaging modalities in vivo (mouse or human) given that there is no fluorescent staining in these cases. This review may be relevant: https://doi.org/10.1002/jcb.10454

      We thank the Reviewer for this suggestion. We have clarified in the introduction that UFMTrack does not require fluorescent labels of the imaged migrating cells and relies solely on the phase contrast imaging data.

      • Discussion: Please address a few more potential applications to this study. One can be cancer and immune infiltration.

      We thank the Reviewer for this suggestion. We have elaborated on additional potential applications to the discussion section.

      Reviewer #3 (Recommendations For The Authors):

      (1) Line 327-328: The authors talk about ‘As we have previously shown…pMBMEC monolayers differs between CD4+ and CD8+ cells…’. Where was this shown? If it was in a previously published article, please provide a reference.

      We have added these missing references.  

      (2) Line 353: Please provide clear location on where to find the associated information instead of stating ‘see below’.

      We thank the Reviewer for pointing our attention to this ambiguity. We have corrected the phrase to “see next paragraph”

      (3) Line 439: Please correct the acronym to BMECs

      We thank the Reviewer for pointing our attention to this typo. We have corrected it.

    1. Author response:

      The following is the authors’ response to the original reviews.

      Public Reviews:

      Reviewer #1 (Public Review):

      Summary:

      The manuscript by Choi and co-authors presents "P3 editing", which leverages dual-component guide RNAs (gRNA) to induce protein-protein proximity. They explore three strategies for leveraging prime-editing gRNA (pegRNA) as a dimerization module to create a molecular proximity sensor that drives genome editing, splitting a pegRNA into two parts (sgRNA and petRNA), inserting self-splicing ribozymes within pegRNA, and dividing pegRNA at the crRNA junction. Among these, splitting at the crRNA junction proved the most promising, achieving significant editing efficiency. They further demonstrated the ability to control genome editing via protein-protein interactions and small molecule inducers by designing RNA-based systems that form active gRNA complexes. This approach was also adaptable to other genome editing methods like base editing and ADAR-based RNA editing.

      Strengths:

      The study demonstrates significant advancements in leveraging guide RNA (gRNA) as a dimerization module for genome editing, showcasing its high specificity and versatility. By investigating three distinct strategies-splitting pegRNA into sgRNA and petRNA, inserting self-splicing ribozymes within the pegRNA, and dividing the pegRNA at the repeat junction-the researchers present a comprehensive approach to achieving molecular proximity and reconstituting function. Among these methods, splitting the pegRNA at the repeat junction emerged as the most promising, achieving editing efficiencies up to 76% of the control, highlighting its potential for further development in CRISPR-Cas9 systems. Additionally, the study extends genome editing control by linking protein-protein interactions to RNA-mediated editing, using specific protein-RNA interaction pairs to regulate editing through engineered protein proximity. This innovative approach expands the toolkit for precision genome editing, demonstrating the feasibility of controlling genome editing with enhanced specificity and efficiency.

      Weaknesses:

      The initial experiments with splitting the pegRNA into sgRNA and petRNA showed low editing efficiency, less than 2%. Similarly, inserting self-splicing ribozymes within pegRNA was inefficient, achieving under 2% editing efficiency in all constructs tested, possibly hindered by the prime editing enzyme. The editing efficiency of the crRNA and petracrRNA split at the repeat junction varied, with the most promising configurations only reaching 76% of the control efficiency. The RNA-RNA duplex formation's inefficiency might be due to the lack of additional protein binding, leading to potential degradation outside the Cas9-gRNA complex. Extending the approach to control genome editing via protein-protein interactions introduced complexity, with a significant trade-off between efficiency and specificity, necessitating further optimization. The strategy combining RADARS and P3 editing to control genome editing with specific RNA expression events exhibited high background levels of non-specific editing, indicating the need for improved specificity and reduced leaky expression. Moreover, P3 editing efficiencies are exclusively quantified after transfecting DNA into HEK cells, a strategy that has resulted in past reproducibility concerns for other technologies. Overall, the various methods and combinations require further optimization to enhance efficiency and specificity, especially when integrating multiple synthetic modules.

      Thank you for this accurate summary and assessment of the strengths and weaknesses of the P3 editing as it stands. Looking ahead, we agree that further optimizations will be important, as will characterizing the performance of P3 editing in additional cellular contexts. The revised Discussion (see below) now makes these points more clearly.

      Reviewer #2 (Public Review):

      Choi et al. describe a new approach for enabling input-specific CRISPR-based genome editing in cultured cells. While CRISPR-Cas9 is a broadly applied system across all of biology, one limitation is the difficulty in inducing genome editing based on cellular events. A prior study, from the same group, developed ENGRAM - which relies on activity-dependent transcription of a prime editing guide RNA, which records a specific cellular event as a given edit in a target DNA "tape". However, this approach is limited to the detection of induced transcription and does not enable the detection of broader molecular events including protein-protein interactions or exposure to small molecules. As an alternative, this study envisioned engineering the reconstitution of a split prime editing guide RNA (pegRNA) in a protein-protein interaction (PPI)-dependent manner. This would enable location- and content-specific genome editing in a controlled setting.

      The authors explored three different design possibilities for engineering a PPI-dependent split pegRNA. First, they tried splitting pegRNA into a functional sgRNA and corresponding prime editing transRNA, incorporating reverse-complementary dimerization sequences on each guide half. This approach, however, resulted in low editing efficiency across 7 different designs with various complementary annealing template lengths (<2% efficiency). They also tried inserting a self-splicing ribozyme within the pegRNA, which produces a functional pegRNA post-transcriptionally. The incorporation of a split-ribozyme, dependent on a PPI, could have been used to reconstitute the split pegRNA in an event-controlled manner. However again, only modest levels of editing were observed with the self-splicing ribozyme design (<2%). Finally, they tried splitting the pegRNA at the repeat:anti-repeat junction that was used to join the original dual-guide system comprised of a crRNA and tracrRNA, into a single-guide RNA. They incorporated the prime editing features into the tracrRNA half, to create petracrRNA. Dimerization was initially induced by different complementary RNA annealing sequences. Using this design, they were able to induce an editing efficiency of ~28% (compared to 37% efficiency using a positive control epegRNA guide).

      Having identified a suitable split pegRNA system, they next sought to induce the reconstitution of the two halves in a PPI-dependent manner. They replaced the complementary RNA annealing sequences with two different RNA aptamers (MS2 and BoxB). MS2 detects the MCP protein, while BoxB detects the LambdaN protein. Close proximity between MCP and LambdaN would thus bring together the two split pegRNA halves, creating a functional pegRNA that would enable prime editing at a specific target site. They demonstrated that they could induce MCP-BoxB proximity by fusing them to different dimerizing protein partners: 1) constitutive epitope-nanobody/antibody pairs such as scFv/GCN4 or NbALFA/ALFA-Tag; 2) split-GFP; or 3) chemically-induced protein pairs such as FKBP/FRB or ABI/PYL. For all of these approaches, they could achieve between ~20-60% normalized editing efficiency (relative to positive control editing levels with epegRNA). Additional mutation of the linkers between the RNA and aptamers could increase editing efficiency but also increase non-specific background editing even in the absence of an induced PPI.

      Additional applications of this overall strategy included incorporating the design with different DNA base editors, with the most promising examples shown with the base editors CBE4max and ABE8. It should be noted that these specific examples used a non-physiological LambdaN-MCP direct fusion protein as the "bait" that induced reconstitution of the two halves of the guideRNA, rather than relying on a true induced PPI. They also demonstrated that the recently reported RADARS strategy could be incorporated into their system. In this example, they used an ADAR-guide-RNA to drive the expression of a LambdaN-PCP fusion protein in the presence of a specific target RNA molecule, IL6. This induced LambdaN-PCP protein could then reconstitute the split peg-RNAs to drive prime editing. To enable this last application, they replaced the MS2 aptamer in their pegRNA with the PP7 aptamer that binds the PCP protein (this was to avoid crosstalk with RADARS, which also uses MS2/MCP interaction). Using this strategy, they observed a normalized editing efficiency of around 12% (but observed non-specific editing of around 8% in the absence of the target RNA).

      Strengths:

      The strengths of this paper include an interesting concept for engineering guide RNAs to enable activity-dependent genome editing in living cells in the future, based on discreet protein-protein interactions (either constitutively, spatially, or chemically induced). Important groundwork is laid down to engineer and improve these guide RNAs in the future (especially the work describing altering the linkers in Supplementary Figure 3 - which provides a path forward).

      Weaknesses:

      In its current state, the editing efficiency appears too low to be applied in physiological settings. Much of the latter work in the paper relies on a LambdaN-MCP direction fusion protein, rather than two interacting protein pairs. Further characterizations in the future, especially varying the transfection amounts/durations/etc of the various components of the system, would be beneficial to improve the system. It will also be important to demonstrate editing at additional sites; to characterize how long the PPI must be active to enable efficient prime editing; and how reversible the reconstitution of the split pegRNA is.

      Thank you for this assessment of the strengths and weaknesses of the P3 editing as it stands. Looking ahead, we agree that further optimizations will be important, including along the lines suggested by the reviewer, as will further characterization of the system with respect to dependencies, reversibility, etc. The revised Discussion (see below) now makes these points more clearly.

      Recommendations for the authors:

      Reviewing Editor comments:

      It would be helpful to better describe the nature of improvements (on-targeting and/or off-targeting) that would be needed to effectively use this approach in vitro and in vivo applications.

      We agree, and have accordingly revised the last paragraph of our discussion to better describe what improvements are needed for in vitro and in vivo applications:

      “In our view, there are four outstanding challenges for P3 editing to be broadly useful: evaluating additional cellular contexts, the method’s efficiency and specificity, understanding the limit of detectable protein-protein interactions, and the development of sensors compatible with multiplex P3 editing within the same cell. First, we have thus far only conducted P3 editing in HEK293T cells, and obviously needs to be tested in additional cell types. Second, both the efficiency and specificity of the P3 editing need to be improved before it can be used as a selective editing tool in model systems. We have explored how modifying the crRNA and petracrRNA pair sequences can tune the efficiency-vs-specificity tradeoff, but alternative avenues to improvement (e.g., better docking of RNA-aptamers such as MS2, BoxB, or PP7 by testing more linker sequences that place crRNA and petracrRNA for duplex formation) may be more fruitful in terms of achieving high efficiency and specificity at once (e.g., >50% editing in the setting of a specific protein-protein interaction, and <1% editing without it). Second, it is not clear whether weak and transient interactions among proteins can be used to trigger P3 editing. Assuming the genome editing complex formation is reversible, improving P3 editing efficiency may be able to capture different strengths of protein-protein interactions, although some interactions may be too transient to promote functional guide RNA formation. Finally, the current P3 editing design uses a pair of RNA aptamers and their corresponding protein binders, limiting the multiplex detection of protein-protein pairs. More orthogonal protein-RNA pairs need to be identified (e.g., using a massively parallel platform (Buenrostro et al., 2014) and/or computational prediction (Baek et al., 2023)) to allow for large numbers of P3 sensors for different protein-protein interactions to be deployed within the same cell. Overcoming these four challenges is necessary for P3 editing to be broadly useful for gating genome editing on physiological levels of specific protein-protein interactions in a multiplex fashion.”

      Reviewer #2 (Recommendations For The Authors):

      It does not appear that all plasmids necessary to reproduce the results of this paper have been deposited to addgene, but only a small subset. The authors might include that these plasmids are available upon request, if not uploaded to a public repository.

      We have added a statement that additional plasmids are available upon request. Our Data Availability Statement reads (with the added sentence underlined):

      “Raw sequencing data have been uploaded to Sequencing Read Archive (SRA) with the associated BioProject ID PRJNA1004865. The following plasmids have been deposited to Addgene: pU6-crRNA-MS2, pU6-BoxB-petracrRNA, pCMV-LambdaN-MCP, pCMV-LambdaN-NbALFA,  and pCMV-ALFA-MCP (Addgene ID 207624 - 207628). The rest of the plasmids used in this study are available upon request.”

      It could be useful to include somewhere why, specifically, editing the guide RNAs as opposed to the Cas9 itself is advantageous. Light-inducible split Cas9s have been engineered, and I imagine other PPI-inducible split Cas9s have also been engineered. A specific mention of the advantages of using engineered split pegRNAs could put the significance of this work in a better context.

      Thanks for raising this, and we agree. We have revised the first paragraph of the Results section to highlight why we think splitting the guide RNAs as opposed to Cas9 might be advantageous:

      “In the split architecture, the “dimerization module” is a key sensor component. Although strategies that split the protein component of the genome editing complex have been described (e.g., split-Cas9 (Yu et al., 2020)), we reasoned that having the guide RNA serve as the dimerization module rather than the protein, i.e. by splitting it into two parts, and making the restoration of its function dependent on a molecular proximity event, would afford even more control. For example, if multiple split gRNAs were present within the same cell, they could be independently controlled, whereas a split Cas9 would only allow a single control point.  In our initial experiments, we focused on splitting the pegRNA used in prime editing.”

    1. Welcome back.

      This is part two of this lesson.

      We're going to continue immediately from the end of part one.

      So let's get started.

      Okay, so the instance is now in an available state.

      Let's just close down this informational dialogue at the top.

      And let's just minimize this menu on the left.

      Let's maximize the amount of screen space that we have for this specific purpose.

      So I just want us to go inside this database instance and explore together the information that we have available.

      So I talked in the theory lesson how every RDS instance is given an endpoint name and an endpoint port.

      So this is the information that we'll use to connect to this RDS instance.

      Networking wise, this instance has been provisioned in US-EAST-1A.

      It's in the Animals for Life VPC and it's used our A4L subnet group that we created at the start of this demo.

      And that means that it's currently utilizing all three database subnets in the Animals for Life VPC.

      But it's chosen because we only deployed one instance to use US-EAST-1A.

      Now this is the VPC security group that we're going to need to configure.

      So right click on this and open it in a new tab and move to that tab.

      This is the security group which controls access to this RDS instance.

      So let's expand this at the bottom.

      So currently it has my IP address being the only source allowed to connect into this RDS instance.

      So the only inbound rule on the security group protecting this RDS instance is allowing my IP address.

      So we're going to click on Edit and then click on Add Rule.

      And we're going to add a rule which allows our other instances to connect to this RDS instance.

      So first in the type drop down click and then type mySQL to get the same option as the line above and then click to select.

      Next go ahead and type instance into the source box and then select the migrate to RDS-instance security group.

      Now this is the security group that's used by any instances deployed by our one click deployment.

      And this allows those instances to connect to our RDS instance and that's what we want.

      So go ahead and select that and then click on Save Rules.

      And this means now that our WordPress instance can communicate with RDS.

      So now let's move back to the RDS tab and then make sure we're inside the A4L WordPress database instance.

      So that's the connectivity and the security tab.

      We also have the monitoring tab and it's here where you can see various CloudWatch provided metrics about the database instance.

      You also have logs and events related to this instance.

      So if we go and have a look at recent events we can see all of the events such as when the database instance was created, when its first backup was created.

      And you can explore those because they might be different in your environment.

      You can click on the Configuration tab and see the current configuration of the RDS instance.

      The Maintenance and Backups tab is where you can configure the maintenance and backup processes and then of course you can tag the RDS instance.

      Now in other lessons in this section of the course and depending on what course you're taking I will be talking about many of these options, what you can modify and which actions you can perform on RDS instances.

      But for now we're just going to move on with this demo.

      So the next step is that we need to migrate our existing data into this RDS instance.

      So what we're going to do is to click on the Connectivity and Security tab and we're going to leave this open.

      We're going to need this endpoint name and port very shortly.

      You should still have a tab open to the EC2 console.

      If you don't you can reach that by going on Services and then opening EC2 in a new tab.

      But I want you to select the A4L-WordPress instance and then right click and connect to it using Instance Connect.

      So go ahead and do that.

      Once you've done that we're going to start referring to the lesson commands document.

      So make sure you've got that open.

      We're going to use this command to take a backup of the existing MariaDB database.

      So we need to replace a placeholder.

      What we need to do is delete this and replace it with the private IP address of the MariaDB EC2 instance.

      So go back to the EC2 console, select the DB-WordPress instance and copy the private IP version 4 address into your clipboard.

      And then let's move back to the WordPress instance and paste that in.

      Go ahead and press Enter and it will prompt you for the password.

      And the password is the same Animals for Life strong password that we've been using everywhere.

      Copy that into your clipboard.

      So this is the password for the A4L WordPress user on the MariaDB EC2 instance.

      So paste that in and press Enter and then LS-LA to confirm that we now have this A4L WordPress.SQL database backup file.

      And we do, so that's good.

      So as we did in the previous demo lesson, we're going to take this backup file and we're going to import it into the new destination database, which is going to be the RDS instance.

      To do that, we'll use this command, but we're going to need to replace the placeholder hostname with the CNAME of the RDS instance.

      So go ahead and delete this placeholder, then go back to the RDS console and I'll want you to copy the endpoint name into your clipboard.

      So select it, right click and then copy.

      We won't need the port number because this is the standard MySQL port and if you don't specify it, most applications will assume this default.

      So just make sure that you have the endpoint DNS name or endpoint CNAME in your clipboard.

      And then back on the WordPress EC2 instance, go ahead and paste this database name into this command and press Enter.

      And again, you'll be asked for the password and that's the same Animals for Life strong password.

      So copy that into your clipboard, paste that in and press Enter.

      And that's imported this A4LWordPress.SQL file into the RDS instance.

      So now we need to follow the same process and change WordPress so that it points at the RDS instance.

      And we do that by moving to where the WordPress configuration file is.

      So cd space forward slash var forward slash ww w forward slash html and press Enter.

      And then shudu.

      So we have admin privileges, nano, which is a text editor and then wp-config.php and press Enter.

      Then we need to scroll down and we're looking for where it says DB host and currently it has a host name here.

      Now if you go back to the EC2 console and you look at the A4L-DB-WordPress instance, you'll see that its private IP version for DNS name is what's listed inside this configuration item.

      So it's currently pointing at this dedicated database instance.

      What we need to do is replace that and we're going to replace it with the RDS database DNS name or the CNAME of this RDS instance.

      So copy that into your clipboard and then go ahead and delete this private DNS name for the MariaDB EC2 instance and then paste in the RDS endpoint name, also known as the RDS CNAME.

      Once you've done that, control O and Enter to save and control X to exit.

      And now our WordPress instance is pointing at the RDS instance for its database.

      Now we can verify that by checking WordPress, move back to instances, select the WordPress instance, copy the public IP version for addressing to your clipboard.

      Don't use this open address link.

      Open that in a new tab.

      Go ahead and just click on the best cats ever to verify the functionality and it does look as though it's working.

      And to verify that, if we go back to the EC2 console, select the A4L-DB-WordPress instance and right click and then stop that instance.

      Now the original database that was providing database services to WordPress is going to move into a stopped state.

      And if our WordPress blog continues functioning, we know that it's using the RDS instance.

      So let's keep refreshing and wait for this to change into a stopped state.

      There we go.

      It's stopped.

      And if we go back to our WordPress page and refresh, it still loads.

      And so we know that it's now using RDS for its database services.

      So at this point, that's everything that I wanted you to do in this demo lesson.

      You've stepped through the process of provisioning an RDS instance.

      So you've created a subnet group, provisioned the instance itself, explored the functionality of the instance, including how to provide access to it by selecting a security group.

      And then editing that security group to allow access.

      You've performed a database migration and you've explored how the RDS instance is presented in the console.

      So that's everything that you need to do within this demo lesson.

      And don't worry, we're going to be exploring much more of the advanced functionality of RDS as we move through this section of the course.

      For now, though, I want us to clear up the infrastructure that we've created as part of this demo lesson.

      Now, because we've provisioned RDS manually outside of CloudFormation, unfortunately, there is a little bit more manual work involved in the cleanup.

      So I want you to go to the RDS console, move to databases, select this database, click on actions, and then select delete.

      Now it will prompt you to create a final snapshot and we're not going to do that.

      We're not going to retain automated backups and so you'll need to acknowledge that upon instance deletion, automated backups including any system snapshots and pointing time recoveries will no longer be available.

      And don't worry, I'll be talking about backups and recovery in another lesson in this section of the course.

      For now, just acknowledge that and then type delete me into this box and confirm the deletion.

      Now this deletion is going to take a few minutes.

      It's not an immediate process.

      It will start in a deleting state and we need to wait for this process to be completed before we continue the cleanup.

      So go ahead and pause this video and wait for this instance to fully delete before continuing.

      Now that the instance has been deleted, it vanishes from this list.

      Next, we need to delete the subnet group that we created earlier.

      So click on subnet groups, select the subnet group and then delete it.

      You'll need to confirm that deletion.

      Once done, it too should vanish from that list.

      Next, go to the tab you've got open to the VPC console, scroll down and select security groups.

      Now look through this list and locate the security group that you created as part of provisioning the RDS instance.

      It should be called a4LVPC-RDS-SG.

      Select that, click on actions and then delete security group and you'll need to confirm that process as well.

      Once that's deleted, the final step is to go to the cloud formation console and then you'll need to delete the cloud formation stack that was created using the one-click deployment at the start of the demo.

      It should be called migrate to RDS.

      Select it, click on delete and confirm that deletion.

      And once deleted, the account will be returned into the same state as it was at the start of the demo lesson.

      So all of the infrastructure that we've used will be removed from the account and the account will be in the same state as at the start of the demo.

      Now I hope you've enjoyed this demo and that we're repeating the same WordPress installation and then the creation of the blog post over and over again.

      But I want you to get used to different parts of this process over and over again.

      You need to know why not to use a database on EC2.

      You need to know why not to perform a lot of these processes manually.

      From this point onward in the course, we're going to be using RDS to evolve our WordPress design into something that is truly elastic.

      And so all of these processes, the things I'm having you repeat are really useful to aid in your understanding of all of these different components.

      So from this point onward, we're going to be automating the creation of RDS and focusing on the specific pieces of functionality that you need to understand.

      But at this point, that's everything that you need to do in this demo.

      So go ahead, complete the video and when you're ready, I look forward to you joining me in the next.

    1. Author response:

      The following is the authors’ response to the current reviews.

      Reviewer #4

      We sincerely appreciate the time and effort you have taken to review our manuscript. We followed your recommendations to polish the text and make it easier to understand.

      Regarding terms and terminology, we changed “non-breeding” everywhere in the text to “over- wintering.”

      Regarding the title, as it was suggested by reviewer #1 as his recommendation, we tried to find a compromise and make the changes you suggested but left part of the suggestion from reviewer #1. So, now it’s “Foxtrot migration and dynamic over-wintering range of an arctic raptor”

      Thank you for highlighting the importance of snow cover and changes in snow cover as a possible factor of over-wintering movements. We appreciate your feedback and have explored several approaches to address this issue. Specifically, we examined how both snow cover extent and changes in snow cover influenced movement distance. However, we found no effect of either factor on movement distance.

      Our data show that birds leave their sites in October and move southwest, even though snow cover is minimal at that time. They also leave their sites in November and in subsequent months, regardless of the snow cover levels. Thus, we observed no pattern of birds leaving sites when snow cover reaches a specific threshold (e.g., 75-80%). Similarly, we found no evidence of birds staying in areas with a certain snow cover extent (e.g., 30%), nor did they leave sites when snow cover increased by a specific amount (e.g., by 10 or 20%).

      It is possible that more experienced birds anticipate that October plots will become inaccessible later in the winter and, therefore, leave early without waiting for significant snow accumulation. Alternatively, other factors, such as brief heavy snowfalls, may trigger movement, even if these do not lead to sustained increases in snow cover. Multiple factors, possibly acting asynchronously, could also play a role. This complexity adds an interesting dimension to the study of ecological patterns. However, in this study, we chose to focus on describing the migration pattern itself and its impact on aspects like over-winter range determination and population dynamics. While we have prioritized this approach, we remain committed to further analyzing the data to uncover additional details about this behavior.

      In response to your suggestion, we have expanded the Methods sections to clarify that we tested the effects of snow cover and changes in snow cover on distance (Lines 241-246); the Results section (Lines 348-349). We have also included the relevant plots in the Supplementary Materials. In the Discussion, we noted that this approach did not reveal any significant dependence and acknowledged that this issue requires further investigation (Lines 422-459).

      ---------

      The following is the authors’ response to the previous reviews.

      Reviewer #2:

      We sincerely appreciate the time and effort you have taken to review our manuscript. 

      First of all, we apologize for publishing the preprint without incorporating certain adjustments outlined in our earlier response, particularly in the Methods section. This was due to an oversight regarding the different versions of the manuscript. We have corrected this mistake. Our response to the feedback on this section (Methods), with line numbers of the changes made, is immediately below this response. In addition, we have included the units of measurement (mean and standard deviation) in both the results and figure captions for clarity.

      To focus on the main point regarding wintering strategies, we acknowledge that in the previous versions, this aspect was inadequately addressed and caused some confusion. In the revised edition, both the Introduction and the Discussion have been thoroughly reworked.

      As you suggested, we have removed the long introductory paragraph and all references to foxtrot migrations from the Introduction. As a result, the Introduction is now short and to the point. In the second paragraph, we explain why we propose the wintering strategies outlined (L74-81).

      In the Discussion, we've added a substantial new section at the beginning that discusses different wintering strategies. We have also updated Figure 4 accordingly. Previously, we erroneously suggested that Montagu's harrier and other African-Palaearctic migrants might adopt wintering strategies similar to those we describe. Upon further investigation, however, we found that almost all African-Palaearctic migrants exhibit an itinerant wintering strategy. Conversely, the strategy we describe is primarily observed in mid-latitude wintering species.

      We have shown that, unlike itinerancy, the birds in our study don't pause for 1-2 months at multiple non-breeding sites, but instead migrate significant distances, up to 1000 km, throughout the winter. Furthermore, unlike itinerancy, the sites they reach are consistently snow-free throughout the year. Following the logic of publications on Montagu's harriers (Schlaich et al. 2023), our birds do not wait for favorable conditions at the next site, as is typical of itinerancy. Moreover, this behavior is influenced by external factors such as snow cover dynamics and occurs primarily in mid-latitudes. Researchers studying a species similar to our subject, the Common buzzard, observed a similar pattern and termed it "prolonged autumn migration" rather than itinerancy. Although their transmitters stopped working in mid-winter, precluding a full observation of the annual cycle, they captured the essence of continued migration at a slower pace, distinct from itinerancy. We've detailed all of these findings in a new section.

      In addition, we acknowledge the mischaracterization of the implications of our research as ‘Conservation implications’ and have corrected this to ‘Mapping ranges and assessing population trends’, as you suggested.

      Finally, we've rewritten the Conclusion, removing overly grandiose statements and simply summarizing the main findings.

      We appreciate your time and effort in reviewing our manuscript. With your invaluable input, it has become clearer, more concise, and easier to understand.

      Dataset: unclear what is the frequency of GPS transmissions. Furthermore, information on relative tag mass for the tracked individuals should be reported.

      We have included this information in our manuscript (L 115-122). We also refer to the study in which this dataset was first used and described in detail (L 123).

      Data pre-processing: more details are needed here. What data have been removed if the bird died? The entire track of the individual? Only the data classified in the last section of the track? The section also reports on an 'iterative procedure' for annotating tracks, which is only vaguely described. A piecewise regression is mentioned, but no details are provided, not even on what is the dependent variable (I assume it should be latitude?).

      Regarding the deaths, we only removed the data when the bird was already dead. We estimated the date of death and excluded tracking data corresponding to the period after the bird's death. We have corrected the text to make this clear (L 130-131).

      Regarding the piecewise regression. We have added a detailed description on lines 136-148.

      Data analysis: several potential issues here:

      (1) Unclear why sex was not included in all mixed models. I think it should be included.

      Our dataset contains 35 females and eight males (L116). This ratio does not allow us to include sex in all models and adequately assess the influence of this factor. At the same time, because adult females disperse farther than males in some raptor species, we conducted a separate analysis of the dependence of migration distance on sex (Table S8) and found no evidence for this in our species. We have written about that in the Methods (L177-181) and after in the Results (L277-278).

      (2) Unclear what is the rationale of describing habitat use during migration; is it only to show that it is a largely unsuitable habitat for the species? But is a formal analysis required then? Wouldn't be enough to simply describe this?

      Habitat use and snow cover determine the two main phases (quick and slow) of the pattern we describe. We believe that habitat analysis is appropriate in this case, and a simple description would be uninformative and not support our conclusions.

      (3) Analysis of snow cover: such a 'what if' analysis is fine but it seems to be a rather indirect assessment of the effect of snow cover on movement patterns. Can a more direct test be envisaged relating e.g. daily movement patterns to concomitant snow cover? This should be rather straightforward. The effectiveness of this method rests on among-year differences in snow cover and timing of snowfall. A further possibility would be to demonstrate habitat selection within the entire non-breeding home range of an individual in relation snow cover. Such an analysis would imply associating presenceabsence of snow to every location within the non-breeding range and testing whether the proportion of locations with snow is lower than the proportion of snow of random locations within the entire nonbreeding home range (95% KDE) for every individual (e.g. by setting a 1/10 ratio presence to random locations).

      The proposed analysis will provide an opportunity to assess whether the Rough-legged buzzard selects areas with the lowest snow cover, but will not provide an opportunity to follow the dynamics and will therefore give a misleading overall picture. This is especially true in the spring months. In March-April, Rough-legged buzzards move northeast and are in an area that is not the most open to snow. At this time, areas to the southwest are more open to snow (this can be seen in Figure 3b). If we perform the proposed analysis, the control points for this period would be both to the north (where there is more snow) and to the south (where there is less snow) from the real locations, and the result would be that there is no difference in snow cover. 

      A step-selection analysis could be used, as we did in our previous work (Curk et al 2020 Sci Rep) with the same Rough-legged buzzards (but during migration, not winter). But this would only give us a qualitative idea, not a quantitative one - that Rough-legged Buzzards move from snow (in the fall) and follow snowmelt progression (in the spring). 

      At the same time, our analysis gives a complete picture of snow cover dynamics in different parts of the non-breeding range. This allows us to see that if Rough-legged buzzards remained at their fall migration endpoint without moving southwest, they would encounter 14.4% more snow cover (99.5% vs. 85.1%). Although this difference may seem small (14.4%), it holds significance for rodent-hunting birds, distinguishing between complete and patchy snow cover.

      Simultaneously, if Rough-legged buzzards immediately flew to the southwest and stayed there throughout winter, they would experience 25.7% less snow cover (57.3% vs. 31.6%). Despite a greater difference than in the first case, it doesn't compel them to adopt this strategy, as it represents the difference between various degrees of landscape openness from snow cover.

    1. node* Address

      kalo di notal "pointer to node"

      ok intinya ini pake tag node biar bisa memberi instruksi ke preprocessor membuat struct baru node dengan Address yang beda-beda.

      pada umumnya itu typedef Node (cara aksesnya)

      cuman karna ini pake tag, instead of mengubah, kita membuat baru dengan address yang bisa beda beda

      ini typedef struct node* Address (perhatikan bahwa struct di tulis juga)

    2. node

      ini tag

      tag dan type nya dibedakan (node dan Node) untuk mengatasi strictnya bahasa C dimana tipe tidak bisa di declare setelah operasi lain. dibuatlah jadi tag, im not to sure so ask again ke GPT

    Annotators

    1. Author response:

      The following is the authors’ response to the current reviews.

      We are grateful to the reviewers for their positive assessment of the revised version of the article.

      Please find below our answers to the last, minor comments of the reviewers.

      We thank the reviewer for this important comment. In our live imaging experiments, we actually tracked the dorsal and ventral borders of the omp:yfp positive clusters in control and sly mutant embryos. These measurements showed that the omp:yfp positive clusters are more elongated along the DV axis in mutants as compared with control siblings, as seen on fixed samples (data not shown), suggesting that this difference in tissue shape is not due to fixation.

      Reviewer #4 (Public review):

      Summary:

      In this elegant study XX and colleagues use a combination of fixed tissue analyses and live imaging to characterise the role of Laminin in olfactory placode development and neuronal pathfinding in the zebrafish embryo. They describe Laminin dynamics in the developing olfactory placode and adjacent brain structures and identify potential roles for Laminin in facilitating neuronal pathfinding from the olfactory placode to the brain. To test whether Laminin is required for olfactory placode neuronal pathfinding they analyse olfactory system development in a well-established laminin-gamma-1 mutant, in which the laminin-rich basement membrane is disrupted. They show that while the OP still coalesces in the absence of Laminin, Laminin is required to contain OP cells during forebrain flexure during development and maintain separation of the OP and adjacent brain region. They further demonstrate that Laminin is required for growth of OP neurons from the OP-brain interface towards the olfactory bulb. The authors also present data describing that while the Laminin mutant has partial defects in neural crest cell migration towards the developing OP, these NCC defects are unlikely to be the cause of the neuronal pathfinding defects upon loss of Laminin. Altogether the study is extremely well carried out, with careful analysis of high-quality data. Their findings are likely to be of interest to those working on olfactory system development, or with an interest in extracellular matrix in organ morphogenesis, cell migration, and axonal pathfinding.

      Strengths:

      The authors describe for the first time Laminin dynamics during the early development of the olfactory placode and olfactory axon extension. They use an appropriate model to perturb the system (lamc1 zebrafish mutant), and demonstrate novel requirements for Laminin in pathfinding of OP neurons towards the olfactory bulb.

      The study utilises careful and impressive live imaging to draw most of its conclusions, really drawing upon the strengths of the zebrafish model to investigate the role of laminin in OP pathfinding. This imaging is combined with deep learning methodology to characterise and describe phenotypes in their Laminin-perturbed models, along with detailed quantifications of cell behaviours, together providing a relatively complete picture of the impact of loss of Laminin on OP development.

      Weaknesses:

      Some of the statistical tests are performed on experiments where n=2 for each condition (for example the measurements in Figure S2) - in places the data is non-significant, but clear trends are observed, and one wonders whether some experiments are under-powered.

      We initially planned the electron microscopy experiments in order to analyse 3 embryos per genotype per stage. However, because of technical issues we could not perform the measurements in all the cases, explaining why we have n = 2 in some of the graphs. The trends were quite clear, so we chose to keep these data in the article. We believe they nicely complement the immunostaining data assessing basement membrane integrity in control and mutant embryos.


      The following is the authors’ response to the original reviews.

      Public Reviews: 

      Reviewer #1 (Public Review): 

      Summary: 

      The authors describe the dynamic distribution of laminin in the olfactory system and forebrain. Using immunohistochemistry and transgenic lines, they found that the olfactory system and adjacent brain tissues are enveloped by BMs from the earliest stages of olfactory system assembly. They also found that laminin deposits follow the axonal trajectory of axons. They performed a functional analysis of the sly mutant to analyse the function of laminin γ1 in the development of the zebrafish olfactory system. Their study revealed that laminin enables the shape and position of placodes to be maintained late in the face of major morphogenetic movements in the brain, and its absence promotes the local entry of sensory axons into the brain and their navigation towards the olfactory bulb. 

      Strengths: 

      - They showed that in the sly mutants, no BM staining of laminin and Nidogen could be detected around the OP and the brain. The authors then elegantly used electron microscopy to analyse the ultrastructure of the border between the OP and the brain in control and sly mutant conditions. 

      - To analyse the role of laminin γ1-dependent BMs in OP coalescence, the authors used the cluster size of Tg(neurog1:GFP)+ OP cells at 22 hpf as a marker. They found that the mediolateral dimension increased specifically in the mutants. However, proliferation did not seem to be affected, although apoptosis appeared to increase slightly at a later stage. This increase could therefore be due to a dispersal of cells in the OP. To test this hypothesis, the authors then analysed the cell trajectories and extracted 3D mean square displacements (MSD), a measure of the volume explored by a cell in a given period of time. Their conclusion indicates that although brain cell movements are increased in the absence of BM during coalescence phases, overall OP cell movements occur within normal parameters and allow OPs to condense into compact neuronal clusters in sly mutants. The authors also analysed the dimensions of the clusters composed of OMP+ neurons. Their results show an increase in cluster size along the dorso-ventral axis. These results were to be expected since, compared with BM, early neurog1+ neurons should compact along the medio-lateral axis, and those that are OMP+ essentially along the dorso-ventral axis. In addition to the DV elongation of OP tissue, the authors show the existence of isolated and ectopic (misplaced) YFP+ cells in sly mutants. 

      - To understand the origin of these phenotypes, the authors analysed the dynamic behaviour of brain cells and OPs during forebrain flexion. The authors then quantitatively measured brain versus OPs in the sly mutant and found that the OP-brain boundary was poorly defined in the sly mutant compared with the control. Once again, the methods (cell tracks, brain size, and proliferation/apoptosis, and the shape of the brain/OP boundary) are elegant but the results were expected. 

      - They then analysed the dynamic behaviour of the axon using live imaging. Thus, olfactory axon migration is drastically impaired in sly mutants, demonstrating that Laminin γ1dependent BMs are essential for the growth and navigation of axons from the OP to the olfactory bulb. 

      - The authors therefore performed a quantitative analysis of the loss of function of Laminin γ1. They propose that the BM of the OP prevents its deformation in response to mechanical forces generated by morphogenetic movements of the neighbouring brain. 

      Weaknesses: 

      - The authors did not analyse neurog1 + axonal migration at the level of the single cell and instead made a global analysis. An analysis at the cell level would strengthen their hypotheses.  

      - Rescue experiments by locally inducing Laminin expression would have strengthened the paper. 

      - The paper lacks clarity between the two neuronal populations described (early EONs and late OSNs).  

      - The authors quantitatively measured brain versus OPs in the sly mutant and found that the OP-brain boundary was poorly defined in the sly mutant compared with the control. Once again, the methods (cell tracks, brain size, proliferation/apoptosis, and the shape of the brain/OP boundary) are elegant but the results were expected. 

      - A missing point in the paper is the effect of Laminin γ1 on the migration of cranial NCCs that interact with OP cells. The authors could have analysed the dynamic distribution of neural crest cells in the sly mutant. 

      We thank the reviewer for the overall positive assessment of our work, and we carefully responded to all her/his insightful comments below. Live imaging experiments to (1) visualise exit and entry point formation with only a few axons labelled, (2) characterise the behaviour of single neurog1:GFP-positive neurons/axons during OP coalescence and to (3) analyse the migration of cranial NCC are now included in the revised manuscript to address the reviewer’s questions, and reinforce our initial conclusions.

      Reviewer #2 (Public Review): 

      Summary: 

      This manuscript addresses the role of the extracellular matrix in olfactory development. Despite the importance of these extracellular structures, the specific roles and activities of matrix molecules are still poorly understood. Here, the authors combine live imaging and genetics to examine the role of laminin gamma 1 in multiple steps of olfactory development. The work comprises a descriptive but carefully executed, quantitative assessment of the olfactory phenotypes resulting from loss of laminin gamma. Overall, this is a constructive advance in our understanding of extracellular matrix contributions to olfactory development, with a well-written Discussion with relevance to many other systems. 

      Strengths: 

      The strengths of the manuscript are in the approaches: the authors have combined live imaging, careful quantitative analyses, and molecular genetics. The work presented takes advantage of many zebrafish tools including mutants and transgenics to directly visualize the laminin extracellular matrix in living embryos during the developmental process. 

      Weaknesses: 

      The weaknesses are primarily in the presentation of some of the imaging data. In certain cases, it was not straightforward to evaluate the authors' interpretations and conclusions based on the single confocal sections included in the manuscript. For example, it was difficult to assess the authors' interpretation of when and how laminin openings arise around the olfactory placode and brain during olfactory axon guidance. 

      We thank the reviewer for the overall positive assessment of our work, and we carefully responded to all her/his insightful comments below. To address these comments, live imaging data to visualise exit and entry point formation with a sparse labelling of axons, and z-stacks showing how exit and entry points are organised in 3D, have been added to the revised manuscript.

      Reviewer #3 (Public Review): 

      This is a beautifully presented paper combining live imaging and analysis of mutant phenotypes to elucidate the role of laminin γ1-dependent basement membranes in the development of the zebrafish olfactory placode. The work is clearly illustrated and carefully quantified throughout. There are some very interesting observations based on the analysis of wild-type, laminin γ1, and foxd3 mutant embryos. The authors demonstrate the importance of a Laminin γ1-dependent basement membrane in olfactory placode morphogenesis, and in establishing and maintaining both boundaries and neuronal connections between the brain and the olfactory system. There are some very interesting observations, including the identification of different mechanisms for axons to cross basement membranes, either by taking advantage of incompletely formed membranes at early stages, or by actively perforating the membrane at later ones. 

      This is a valuable and important study but remains quite descriptive. In some cases, hypotheses for mechanisms are stated but are not tested further. For example, the authors propose that olfactory axons must actively disrupt a basement membrane to enter the brain and suggest alternative putative mechanisms for this, but these are not tested experimentally. In addition, the authors propose that the basement membrane of the olfactory placode acts to resist mechanical forces generated by the morphogenetic movement of the developing brain, and thus to prevent passive deformation of the placode, but this is not tested anywhere, for example by preventing or altering the brain movements in the laminin γ1 mutant. 

      We thank the reviewer for the overall positive assessment of our work and for suggesting interesting experiments to attempt in the future, and we carefully responded to all her/his constructive comments below.

      Recommendations for the authors:

      Reviewer #1 (Recommendations For The Authors):

      In general, it would be easier to draw conclusions and compare data if the authors used similar stages throughout the article. 

      Throughout the article we tried to focus on a series of stages that cover both the coalescence of the OP (up to 24 hpf) and later stages of olfactory system development spanning the brain flexure process (28, 32, 36 hpf). However, for technical reasons it was not always possible to stick to these precise stages in some of our experiments. Also, in Fig. 1E-J, we picked in the movies some images illustrating specific cell or axonal behaviours, and thus the corresponding stages could not match exactly the stage series used in Fig. 1A-D and elsewhere in the article. Nevertheless, this stage heterogeneity does not affect our main conclusions.

      It would be useful to schematise the olfactory placode and the brain in an insert to clearly visualise the system in each figure. 

      We hope that the schematic which was initially presented in Fig. 1K already helps the reader to understand how the system is organised. Although we have not added more schematic views to represent the system in each figure (we think this would make the figures overcrowded), we have added additional legends to point to the OP and the brain in the pictures in order to clarify the localisation of each tissue.

      In the Summary, the authors refer to the integrity of the basement membrane. I don't think there is any attempt to affect basement membrane integrity in the article. It would be important to do so to look at the effect on CNS-PNS separation and axonal elongation. 

      In the Summary, we use the term « integrity of the basement membrane » to mention that we have analysed this integrity in the sly mutant. Given the results of our immunostainings against three main components of the basement membrane (Laminin, Collagen IV and Nidogen), as well as our EM observations, we see the sly mutant as a condition in which the integrity of the basement membrane is strongly affected.

      Rescue experiments by locally inducing Laminin expression would have strengthened the paper. 

      We have attempted to rescue the sly mutant phenotypes by introducing the mutation in the transgenic TgBAC(lamC1:lamC1-sfGFP) background, in which Laminin γ1 tagged with sfGFP is expressed under the control of its own regulatory sequences (Yamaguchi et al., 2022). To do so, we crossed sly+/-;Tg(omp:yfp) fish with sly+/-; Tg(lamC1:LamC1-sfGFP) fish. Surprisingly, while a rescue of the global embryo morphology was observed, no clear rescue of the olfactory system defects could be detected at 36 hpf. This could be due to the fact that the expression level of LamC1-sfGFP obtained with one copy of the transgene is not sufficient to rescue the olfactory system phenotypes, or that the sfGFP tag specifically affects the function of the Laminin 𝛾1 chain during the development of the olfactory system, making it unable to rescue the defects. Given the results of our first attemps, we decided not to continue in this direction.

      (1) Developing OP & brain are surrounded by laminin-containing BM (already described by Torrez-Pas & Whitlock in 2014). 

      "we first noticed the appearance of a continuous Laminin-rich BM surrounding the brain from 14-18 hpf, while around the OP, only discrete Laminin spots were detected at this stage (Fig. 1A, A'). " 

      Around 8ss for Torrez-Pas & Whitlock (before 14 hpf). Can you modify the text, or show an 8ss stage embryo? As far as I know, the authors do not show images at 14hpf. Please correct this sentence or show a 14 hpf picture. 

      The reviewer is right, we do not show any 14 hpf stage in the images and thus have removed this stage in the text and replaced it by 17 hpf.

      In Figure 1A, the labelling of laminin 111 does not appear to be homogeneous along the brain.

      Is this true? 

      At this stage the brain’s BM revealed by the Laminin immunostaining appears fairly continuous (while the OP’s one is clearly dotty and less defined), but indeed very tiny/local interruptions of the signal can been seen along the structure as detected by the reviewer. We thus modified the text to mention these tiny interruptions.

      How is the Laminin antibody used by the authors specific to laminin 111?  

      We thank the reviewer for raising this important point. The immunogen used to produce this rabbit polyclonal antibody is the Laminin protein isolated from the basement membrane of a mouse Engelbreth Holm-Swarm sarcoma (EHS). It is thus likely to recognise several Laminin isoforms and not only Laminin 111. We thus replaced Laminin 111 by Laminin when mentioning this antibody in the text and Figures.

      Please schematise in Figure 1K the stages you have tested and shown here in the article i.e. stages 18 - 22 - 28 -36 hpf using immunohistochemistry and 17-26-27-29-33 and 38 hpf using transgenics for laminin 111 and LamC1 respectively.  

      As suggested by the reviewer, we changed the stages in the schematics for stages we have presented in Figure 1 (analysed either with immunostaining or in live imaging experiments). We chose to represent 17 - 22 - 26 - 33 hpf (and thus adapted some of the schematics for them to match these stages).  

      Please specify in the Figure 1 legend for panels A to D whether this is a 3D projection or a zsection.

      We indicated in the Figure 1 legend that all these images are single z-sections (as well as for panels E-J).

      Furthermore, the schematisation in Fig. 1K does not reflect what the authors show: at 22 hpf laminin 111 labelling appears to be present only near the brain, and no labelling lateral to the olfactory placode and anteriorly and posteriorly. Thus, the schematisation in Figure 1K needs to be modified to reflect what the authors show.

      We agree with the reviewer that the Laminin staining at this stage is observed around the medial region of the OP, but not more laterally. We modified the schematic view accordingly in Figure 1K. Anterior and posterior sides of the OP are not represented in this schematic because we chose to represent a frontal view rather than a dorsal view.

      The authors suggest that" the laminin-rich BM of OP assembles between 18 and 22 hpf, during the late phase of OP coalescence". However, their data indicate that this BM assembles around 28hpf (Figure 1C). Can they clarify this point?

      What we meant with this sentence is that we cleary see two distinct BMs from 22 hpf. However, as noticed by the reviewer, the OP’s BM is only present around the medial/basal regions of the OP and does not surround the whole OP tissue at this stage. We modified the text to clarify this point (in particular by mentioning that the OP’s BM starts to assemble between 18 and 22 hpf), and replaced the image shown in Figure 1B, B’ with a more representative picture (the previous z-section was taken in very dorsal regions of the OP).

      It would be useful to disrupt these cells that have a cytoplasmic expression of Laminin-sfGFP, to analyse their contribution to BM and OP coalescence.

      Indeed it will be interesting in the future to test specifically the role of the cells expressing cytoplasmic Laminin-sfGFP around and within the OP, as proposed by the reviewer. Laser ablation of these cells could be attempted, but due to their very superficial localisation, close to the skin, we believe these ablations (with the protocol/set-up we currently use in the lab) would impair the skin integrity, preventing us to conclude. We consider that the optimisation of this experiment is out of the scope of the present work.

      Tg(-2.0ompb:gapYFP)rw032 marks ciliated olfactory sensory neurons (OSNs) (Sato et al., 2005). The authors should mention this. 

      Please see our detailed response to the next point below.

      Points to be clarified: 

      -Tg(-2.0ompb:gapYFP)rw032 marks ciliated olfactory sensory neurons (OSNs) (Sato et al., 2005). The authors should mention this here. Moreover, the authors refer to "OP neurons" throughout the article. In the development of the olfactory organ, two types of neurons have been described in the literature: early EONs (12hpf-26hpf) and later OSNs. Each could have a specific role in the establishment and maintenance of the BM described by the authors. The authors need to clarify this point as, in Figure 1 for example, they use a marker for Tg(neurog1:GFP) EONs and a marker for ciliated OSNs without distinction. The distinction between EONs and OSNs comes a little late in the text and should be placed higher up. 

      As mentioned by the reviewer, according to the initial view of neurogenesis in the OP, OP neurons are born in two waves. A transient population of unipolar, dendrite-less pioneer neurons would differentiate first, in the ventro-medial region of the OP and elongate their axons dorsally out of the placode, along the brain wall. These pioneer axons would then be used as a scaffold by later born OSNs located in the dorso-lateral rosette to outgrow their axons towards the olfactory bulb (Whitlock and Westerfield, 1998). 

      Another study further characterised OP neurogenesis and showed that the first neurons to differentiate in the OP (the early olfactory neurons or EONs) express the Tg(neurog1:GFP) transgene (Madelaine et al., 2011). As mentioned by the authors in the discussion of this article, neurog1:GFP+ neurons appear much more numerous than the previously described pioneer neurons, and may thus include pioneers but also other neuronal subtypes.

      We would like here to share additional, unpublished observations from our lab that further suggest that the situation is more complex than the pioneer/OSN and EON/OSN nomenclatures. First, in many of our live imaging experiments, we can clearly visualise some neurog1:GFP+ unipolar neurons, initially located in a medial position in the OP, which intercalate and contribute to the dorsolateral rosette (where OSNs are proposed to be located) at the end of OP coalescence, from 22-24 hpf. Second, in fixed tissues, we observed that most neurog1:GFP+ neurons located in the rosette at 32 hpf co-express the Tg(omp:meRFP) transgene (Sato et al., 2005). These observations suggest that at least a subpopulation of neurog1:GFP+ neurons could incorporate in the dorsolateral rosette and become ciliated OSNs during development. We can share these results with the reviewer upon request. Further studies are thus needed to clarify and describe the neuronal subpopulations and lineage relationships in the OP, but this detailed investigation is out of the scope and focus of the present study. 

      An additional complication comes from the fact that, as shown and acknowledged by the authors in Miyasaka et al., 2005, the Tg(omp:meYFP) line (6kb promoter) labels ciliated OSNs in the rosette but also some unipolar, ventral neurons (around 10 neurons at 1 dpf, Miyasaka et al. 2005, Figure 3A, white arrowheads). This was also observed using the 2 kb promoter Tg(omp:meYFP) line (see for instance Miyasaka et al., 2007) and in our study, we can indeed detect these ventro-medial neurons labelled in the Tg(omp:meYFP) line (2 kb promoter), see for instance Figure 1C’, D’ or Movie 6. It is unclear whether these unipolar omp:meYFPpositive cells are pioneer neurons or EONs expressing the omp:meYFP transgene, or OSN progenitors that would be located basally/ventrally in the OP at these stages.

      For all these reasons, we decided to present in the text the current view of neurogenesis in the OP but instead of attributing a definitive identity to the neurons we visualise with the transgenic lines, we prefer to mention them in the manuscript (and in the rest of the response to the reviewers) as neurons expressing neurog1:GFP or omp:meYFP transgenes (or cells/axons/neurons expressing RFP in the Tg(cldnb:Gal4; UAS:RFP) background).

      What we also changed in the text to be more clear on this point:

      - we moved higher up in the text, as suggested by reviewer 1, the description of the current model of neurogenesis in the OP,

      - we mentioned that neurog1:GFP+ neurons are more numerous than the initially described pioneer neurons, as discussed in Madelaine et al., 2011,

      - we wrote more clearly that the Tg(omp:meYFP) line labels ciliated OSNs but also a subset of unipolar, ventral neurons (Miyasaka et al., 2005), and pointed to these ventral neurons in Figure 1C’, D’,

      - in the initial presentation of the current view of OP neurogenesis we renamed neurog1:GFP+ into EONs to be coherent with Madelaine et al., 2011.

      - To visualise pioneer axons, the authors should use an EONS marker such as neurog1 because, to my knowledge, OMP only marks OSN axons and not pioneer axons.  

      To visualise neurog1:GFP+ axons during OP coalescence, we performed live imaging upon injection of the neurog1:GFP plasmid (Blader et al., 2003) in the Tg(cldnb:Gal4; UAS:RFP) background (n = 4 mutants and n = 4 controls from 2 independent experiments). We observed some GFP+ placodal neurons exhibiting retrograde axon extension in both controls and sly mutants. In such experiments it is very difficult to quantify and compare the number of neurons/axons showing specific behaviours between different experimental conditions/genetic background. Indeed, due to the cytoplasmic localisation of GFP, the axons can only be seen in neurons expressing high levels of GFP, and due to the injection the number of such neurons varies a lot in between embryos, even in a given condition. Nevertheless, our qualitative observations reinforce the idea that the basement membrane is not absolutely required for mediolateral movements and retrograde axon extension of neurog1:GFP+ neurons in the OP. We added examples of images extracted from these new live imaging experiments in the revised Fig. S5A, B.

      - The authors should analyse the presence of laminin in the OP and forebrain in conjunction with neural crest cell dynamics (using a Sox10 transgenic line for example) to refine their entry and exit point hypotheses. 

      As described in the answer to the next point, we performed new experiments in which we visualised NCC migration in the Tg(neurog1:GFP) background, which allowed us to analyse the localisation of NCC at the forebrain/OP boundary, in ventral and dorsal positions, both in sly mutant embryos and control siblings.

      - A dynamic analysis of the distribution of neural crest cells in the sly mutant over time and during OP coalescence would be important. 

      The dynamics of zebrafish cranial NCC migration in the vicinity of the OP has been previously analysed using sox10 reporter lines (Harden et al., 2012, Torres-Paz and Whitlock, 2014, Bryan et al., 2020). To address the point raised by the reviewer, we performed live imaging from 16 to 32 hpf on sly mutants and control siblings carrying the Tg(neurog1:GFP) and Tg(UAS:RFP) transgenes and injected with a sox10(7.2):KalTA4 plasmid (Almeida et al., 2015). This allows the mosaic labelling of cells that express or have expressed sox10 during their development which, in the head region at these stages, represents mostly NCC and their derivatives. 3 independent experiments were carried out (n = 4 mutant embryos in which 8 placodes could be analysed; n = 6 control siblings in which 10 placodes could be analysed). A new movie (Movie 9) has been added to the revised article to show representative examples of control and mutant embryos.

      From these new data, we could make the following observations:

      - As expected from previous studies (Harden et al., 2012, Torres-Paz and Whitlock, 2014, Bryan et al., 2020), in control embryos a lot of NCC had already migrated to reach the vicinity of the OP when the movies begin at 16 hpf, and were then seen invading mainly the interface between the eye and the OP (10/10 placodes). Surprisingly, in sly mutants, a lot of motile NCC had also reached the OP region at 16 hpf in all the analysed placodes (8/8), and populated the eye/OP interface in 7/8 placodes (10/10 in controls). Counting NCC or tracking individual NCC during the whole duration of the movies was unfortunately too difficult to achieve in these movies, because of the low level of mosaicism (a high number of cells were labelled) and of the high speed of NCC movements (as compared with the 10 min delta t we chose for the movies). 

      - in some of the control placodes we could detect a few NCC that populated the forebrain/OP interface, either ventrally, close to the exit point of the axons (4/10 placodes), or more dorsally (8/10 placodes). By contrast, in sly mutants, NCC were observed in the dorsal region of the brain/OP boundary in only 2/8 placodes, and in the ventral brain/OP frontier in only 2/8 placodes as well. Interestingly, in these 2 last samples, NCC that had initially populated the ventral region of the brain/OP interface were then expelled from the boundary at later stages.

      We reported these observations in a new Table that is presented in revised Fig. S6B. In addition, instances of NCC migrating at the eye/OP or forebain/OP interfaces are indicated with arrowheads on Movie 9. Previous Figure S6 was splitted into two parts presenting NCC defects in sly mutants (revised Figure S6) and in foxd3 mutants (revised Figure S7).

      Altogether, these new data suggest that the first postero-anterior phase of NCC migration towards the OP, as well as their migration in between the eye and OP tissues, is not fully perturbed in sly mutants. The subset of NCC that populate the OP/forebrain seem to be more specifically affected, as these NCC show defects in their migration to the interface or the maintenance of their position at the interface. Since the crestin marker labels mostly NCC at the OP/forebrain interface at 32 hpf (revised Fig. S6A), this could explain why the crestin ISH signal is almost lost in sly mutants at this stage.

      (2) Laminin distribution suggests a role in olfactory axon development 

      "Laminin 111 immunostaining revealed local disruptions in the membrane enveloping the OP and brain, precisely where YFP+ axons exit the OP (exit point) and enter the brain (entry point) (Fig. 1C-D')." Can the authors quantify this situation? It would be important to analyse this behaviour on the scale of a neuron and thus axonal migration to strengthen the hypotheses. 

      As suggested by the reviewer, to better visualise individual axons at the exit and entry point, we used mosaic red labelling of OP axons. To achieve this sparse labelling, we took advantage of the mosaic expression of a red fluorescent membrane protein observed in the Tg(cldnb:Gal4; UAS:lyn-TagRFP) background. The unpublished Tg(UAS:lyn-TagRFP) line was kindly provided by Marion Rosello and Shahad Albadri from the lab of Filippo Del Bene. We crossed the Tg(cldnb:Gal4; UAS:lyn-TagRFP) line with the TgBAC(lamC1:lamC1-sfGFP) reporter and performed live imaging on 2 embryos/4 placodes, in a frontal view. A new movie (Movie 3 in the revised article) shows examples of exit and entry point formation in this context.This allowed us to visualise the formation of the exit and entry points in more samples (6 embryos and 12 placodes in total when we pool the two strategies for labelling OP axons) and through the visualisation of a small number of axons, and reinforce our initial conclusions. 

      (3) The integrity of BMs around the brain and the OP is affected in the sly mutant 

      Why do the authors analyse the distribution of collagen IV and Nidogen and not proteoglycans and heparan sulphate? 

      We attempted to label more ECM components such as proteoglycans and heparan sulfate, but whole-mount immunostainings did not work in our hands.

      A dynamic analysis of the distribution of neural crest cells in the sly mutant over time and during OP coalescence would be important. 

      See our detailed response to this point above.  

      (4) Role of Laminin γ1-dependent BMs in OP coalescence 

      The authors use the size of the Tg(neurog1:GFP)+ OP cell cluster at 22 hpf as a marker.  The authors should count the number of cells in the OP at the indicated time using a nuclear dye to check that in the sly mutant the number of cells is the same over time. Two time points as analysed in Figure S2 may not be sufficient to quantify proliferation which at these stages should be almost zero according to Whitlock & Westerfield and Madelaine et al.

      Counting the neurog1:GFP+ cell numbers in our existing data was unfortunately impossible, due to the poor quality of the DAPI staining. We are nevertheless confident that the number of cells within neurog1:GFP+ clusters is fairly similar between controls and sly mutants at 22 hpf, since the OP dimensions are the same for AP and DV dimensions, and only slightly different for the ML dimension. In addition, we analysed proliferation and apoptosis within the neurog1:GFP+ cluster at 16 and 21 hpf and observed no difference between controls and mutants.

      (5) Role of Laminin γ1-dependent BMs during the forebrain flexure 

      In Figure 4F at 32hpf, the presence of 77% ectopic OMP+ cells medially should result in an increase in dimensions along the M-L? This is not the case in the article. The authors should clarify this point. 

      As we explained in the Material and Methods, ectopic fluorescent cells (cells that are physically separated from the main cluster) were not taken into account for the measurement of the OP dimensions. This is now also also mentioned in the legends of the Figures (4 and S3) showing the quantifications of OP dimensions.

      Cell distribution also seems to be affected within the OMP+ cluster at 36hpf, with fewer cells laterally and more medially. The authors should analyse the distribution of OMP+ cells in the clusters. in sly mutants and controls to understand whether the modification corresponds to the absence of BM function. 

      On the pictures shown in Figure 4F,G, we agree that omp:meYFP+ cells appear to be more medially distributed in the mutant, however this is not the case in other sections or samples, and is rather specific to the z-section chosen for the Figure. We found that the ML dimension is unchanged in mutants as compared with controls, except for the 28 hpf stage where it is smaller, but this appears to be a transient phenomenon, since no change is detected at earlier or later stages (Figure 4A-D and Figure S3A-L). The difference we observe at 28 hpf is now mentioned in the revised manuscript.

      The conclusions of Figures 4 and S3 would rather be that laminin allows OMP+ cells to be oriented along the medio-lateral axis whereas it would control their position along the dorsoventral axis. The authors should modify the text. It would be useful to map the distribution of OMP+ cells along the dorsoventral and mediolateral axes. The same applies to Neurog1+ cells. An analysis of skin cell movements, for example, would be useful to determine whether the effects are specific.  

      We are confident that the measurements of OP dimensions in AP, DV and ML are sufficient to describe the OP shape defects observed in the sly mutants. Analysing cell distribution along the 3 axes as well as skin cell movements will be interesting to perform in the future but we consider these quantifications as being out of the scope of the present work.

      (6) Laminin γ1-dependent BMs are required to define a robust boundary between the OP and the brain 

      The authors must weigh this conclusion "Laminin γ1-dependent BMs serve to establish a straight boundary between the brain and OP, preventing local mixing and late convergence of the two OPs towards each other during flexion movement." Indeed, they don't really show any local mixing between the brain and OP cells. They would need to quantify in their images (Figure 5A-A' and Figure S4 A-A') the percentage of cells co-labelled by HuC and Tg(cldnb:GFP). 

      We agree with the reviewer and thus replaced « reveal » by « suggest » in the conclusion of this section. 

      (7) Role of Laminin γ1-dependent BMs in olfactory axon development 

      An analysis of the retrograde extension movement in the axons of OMP+ ectopic neurons in the sly1 mutant condition would be useful to validate that the loss of laminin function does not play a role in this event. 

      Indeed, even though we can visualise instances of retrograde extension occurring normally in sly mutants, we can not rule out that this process is affected in a subset of OP neurons, for instance in ectopic cells, which often show no axon or a misoriented axon. We added a sentence to mention this in the revised manuscript.

      Minor comments and typos: 

      Please check and mention the D-V/L-M or A-P/L-M orientation of the images in all figures. 

      This has been checked.

      Legend Figure 1: "distalmost" is missing a space "distal most". 

      We checked and this word can be written without a space.

      Figure 1 panel C: check the orientation (I am not sure that Dorsal is up). 

      We double-checked and confirm that dorsal is up in this panel.

      Movie 1 Legend: "aroung "the OP should be around the OP. 

      Thanks to the reviewer for noticing the typo, we corrected it.

      Reviewer #2 (Recommendations For The Authors):

      The comments below are relatively minor and mostly raise questions regarding images and their presentation in the manuscript. 

      • Figure 1, visualization of exit and entry points: It is a bit difficult to visualize the axon exit and entry points in these images, and in particular, to understand how the exit and entry points in C and D correspond to what is seen in F, F', H, and H'. There appears to be one resolvable break in the staining in C and D, whereas there are two distinct breaks in F-H'. Are these single optical sections? Is it possible to visualize these via 3-dimensional rendering? 

      All the images presented in Figure 1 are single z-sections, which is now indicated in the Figure legend. As noticed by the reviewer, Laminin immunostainings on fixed embryos at 28 and 36 hpf suggested that the exit and entry points are facing each other, as shown in Figure 1C-D’. However, in our live imaging experiments we always observed that the exit point is slightly more ventral than the entry point (of about 10 to 20 µm). This discrepancy could be due to the fixation that precedes the immunostaining procedure, which could modify slightly the size and shape of cells/tissues. We added a sentence on this point in the text. In addition, we added new movies of the LamC1-sfGFP reporter with sparse red axonal labelling (Movie 3, see response to reviewer 1), as well as z-stacks presenting the organisation of exit and entry points in 3D (Movie 4), which should help to better illustrate the mechanisms of exit and entry point formation.

      • Movie 2, p. 6, "small interruptions of the BM were already present near the axon tips, along the ventro-medial wall of the OP." This is a bit difficult to assess since the movie seems to show at least one other small interruption in the BM in addition to the exit point, in particular, one slightly dorsal to the exit point. Was this seen in other samples, or in different optical sections? 

      Indeed the exit and entry points often appear as regions with several, small BM interruptions, rather than single holes in the BM. We now show in revised Movie 4 the two z-stacks (the merge and the single channel for green fluorescence) corresponding to the last time points of the movies showing exit and entry point formation in Movie 2, where several BM interruptions can be seen for both the exit and entry points. We had already mentioned this observation in the legend of Movie 2, and we added a sentence on this point in the main text of the revised manuscript. This is also represented for both exit and entry points in the new schematics in revised Fig. 1K and its legend. 

      • Movie 2, p. 6, "The opening of the entry point through the brain BM was concomitant with the arrival of the RFP+ axons, suggesting that the axons degrade or displace BM components to enter the brain." Similar to the questions regarding the exit point, it was a bit difficult to evaluate this statement. There appears to be a broader region of BM discontinuity more dorsal to the arrowhead in Movie 2. A single-channel movie of just the laminin fluorescence might help to convey the extent of the discontinuity. As with above, was this seen in other samples, or in different optical sections?  

      See our response to the previous comment.

      • Figure 1H, I, "the distal tip of the RFP+ axons migrated in close proximity with the brain's BM." This is again a bit difficult to see, and quite different than what is seen in Figure 4A, in which the axons do not seem close to the BM in this section. Is it possible to visualize this via 3-dimensional rendering? 

      In fixed embryos or in live imaging experiments, we observed that, once entered in the brain, the distal tips (the growth cones) of the axons are located close to the BM of the brain. However, this is not the case of the axon shafts which, as development proceeds, are located further away from the BM. This can clearly be seen at 36 hpf in Figure 1D’ and Figure 4A, as spotted by the reviewer. We modified the text to clarify this point.

      • Figure 2J, J', p. 7, the gap between the OP and brain cells of sly mutants "was most often devoid of electron-dense material." It is difficult to see this loss of electron-dense material in 2J'. The thickness of the space is quantified well and is clearly smaller, but the change in electron-dense material is more difficult to see.  

      We looked at Figure 2 again and it seems clear to us that there is electron-dense material between the plasma membranes in controls, which is practically not seen (rare spots) in the mutants. We added a sentence mentioning that we rarely see electron-dense spots in sly mutants.

      • Figure 5E-F': There are concerns about evaluating the shape of a tissue based on nuclear position. Is there a way to co-stain for cell boundaries (maybe actin?), and then quantify distortion of the dlx+ cell population using the cell boundaries, rather than nuclear staining? 

      We agree with the reviewer that it is not ideal to evaluate the shape of the OP/brain boundary based on a nuclear staining. As explained in the text, we could not use the Tg(eltC:GFP) or Tg(cldnb:Gal4; UAS:RFP) reporter lines for this analysis, due to ectopic or mosaic expression. However we are confident that the segmentation of the Dlx3b immunostaining reflects the organisation of the cells at the OP/brain tissue boundary: in other data sets in which we performed Dlx3b staining with membrane labelling independently of the present study and in the wild type context, we clearly see that cell membranes are juxtaposed to the Dlx3b nuclear staining (in other words, the cytoplasm volume of OP cells is very small). 

      • Figure S5E: It would be helpful to see representative images for each of the categories (Proper axon bundle; Ventral projections; Medial projections) or a schematic to understand how the phenotypes were assessed. 

      To address this point we added a schematic view to illustrate the phenotypes assessed in each column of the table in revised Figure S5G.

      • Figure 6, p. 12, "Laminin gamma 1-dependent BMs are essential for growth and navigation of the axons...": What fraction of the tracked axons managed to exit the OP? Given the quantitative analyses in Figure 6, one might interpret this to mean that laminin gamma 1 is not essential for axon growth (speed and persistence are largely unchanged), but rather, primarily for navigation. 

      As noticed by the reviewer, the speed and persistence of axonal growth cones are largely unchanged in the sly mutants (except for the reduced persistence in the 200-400 min window, and an increased speed in the 800-1000 min window), showing that the growth cones are still motile. However, as shown by the tracks, they tend to wander around within the OP, close to the cell bodies, which results in the end in a perturbed growth of the axons. The navigation issues are rather revealed by the analysis of fixed Tg(omp:meYFP) embryos presented in the table of Figure S5G. We modified the text to separate more clearly the conclusions of the two types of experiments (fixed, transgenic embryos versus live, mosaically labelled embryos).

      Reviewer #3 (Recommendations For The Authors):

      Testing the hypotheses mentioned in the public review will be interesting experiments for a follow-up study, but are not essential revisions for this manuscript. 

      I have only a few minor suggestions for revisions: 

      P8 subheading 'Role of Laminin γ1-dependent BMs in OP coalescence' - since no major role was demonstrated here, this heading should be reworded.  

      We agree with the reviewer and replaced the previous title by « OP coalescence still occurs in the sly mutant ».

      P11, line 3 - the authors conclude that the forebrain is smaller 'due to' the inward convergence of the OPs. I do not think it is possible to assign causation to this when the mutant disrupts Laminin γ1 systemically - it is equally possible that the OPs move inward due to a failure of the brain to form in the normal shape. Thus, the wording should be changed here. (In the Discussion on p15, the authors mention the 'apparent distortion' of the brain, and say that it is 'possibly due' to the inward migration of the placodes', but again this could be toned down.) 

      We agree with the reviewer’s comment and changed the wording of our conclusions in the Results section.

      P11 and Fig. S5 - The table and text seem to be saying opposite things here. The text on p11 (3rd paragraph) indicates that the normal exit point is ventral and that this is disrupted in the mutant, with axons exiting dorsally. However, in the table, at each time point there is a higher % of axons exiting ventrally in the mutant. Please clarify. The table does not provide a % value for axons exiting dorsally - it might help to add a column to show this value. 

      We are grateful to the reviewer for pointing this out, and we apologize for the lack of clarity in the first version of the manuscript. We have modified the text and Figure S5 in order to clarify the different points raised by the reviewer in this comment. The Table in Fig. S5G does not represent the % of axons showing defects, but the % of embryos showing the phenotypes. In addition, an embryo is counted in the ventral or medial projection category if it shows at least one ventral or medial projection (even if its shows a proper bundle). This is now clearly indicated in the title of the columns in the table itself and in the legend. The embryos in which the axons exit dorsally in sly mutants are actually those counted in the left column of the Table (they exit dorsally and form a bundle), as shown by the new schematics added below the table. We also added this information in the title of the left column, and mention in the legend the pictures in which this dorsal exit can be observed in the article (Figures 4B and S3E’). Having more sly mutant embryos with axons exiting dorsally is thus compatible with more embryos showing at least one ventral projection.

      Fig. S6, shows the lack of neural crest cells between the olfactory placode and the brain in both laminin γ1 mutants (without a basement membrane) and foxd3 mutants (which retain the membrane). Comparison of the two mutants here is a neat experiment and the result is striking, demonstrating that it is the basement membrane, and not the neural crest, that is required for correct morphology of the olfactory placode. I think this figure should be presented as a main figure, rather than supplementary.  

      Our new live imaging characterisation of NCC migration in sly mutants and control siblings (Movie 9) revealed that at 32 hpf, in the vicinity of the OP, NCC (or their derivatives) are much more numerous than the subset of NCC showing crestin expression by in situ hybridisation (compare the end of our control movie – 32 hfp, with crestin ISH shown in Figure S6A for instance). 

      Thus, the extent of the NCC migration defects should be analysed in more detail in the foxd3 mutant in the future (using live imaging or other NCC markers), and for this reason we chose to keep this dataset in the supplementary Figures.

      One of the first topics covered in the Discussion section is the potential role of Collagen. I was surprised to see the description on P15 'the dramatic disorganization of the Collagen IV pattern observed by immunofluorescence in the sly mutant', as I hadn't picked this up from the Results section of the paper. I went back to the relevant figure (Fig. 2) and description on p7, which does not give the same impression: 'in sly mutants, Collagen IV immunoreactivity was not totally abolished'. This suggested to me that there was only minor (not dramatic) disorganisation of the Collagen IV. This needs clarification.  

      The linear, BM-like Collagen IV staining was lost in sly mutants, but not the fibrous staining which remained in the form of discrete patches surrounding the OP. We modified the text in the Results section as well as in the Figure 2 legend to clarify our observations made on embryos immunostained for Collagen IV.

      Typos etc 

      P5 - '(ii) above of the neuronal rosette' - delete the word 'of'. 

      P5 two lines below this - ensheathed. 

      P10 - '3 distinct AP levels' (delete s from distincts). 

      P10 - distortion (not distorsion) . 

      P12 - 'From 14 hpf, they' should read 'From 14 hpf, neural crest cells'. 

      P15, line 1 - 'is a consequence of' rather than 'is consecutive of'? 

      P22 'When the data were not normal,' should read 'When the data were not normally distributed,'. 

      We thank the reviewer for noticing these typos and have corrected them.

      General 

      Please number lines in future manuscripts for ease of reference. 

      This has been done.

    1. In all this time, our men being all or the most part well recovered, and not willing to trifle away more time then necessitie enforced us into: we thought good, for the better content of the adventurers, in some reasonable sort of fraight home Maister Nelson, with Cedar wood. About which, our men going with willing minds, was in very good time effected, and the ship sent for England. Wee now remaining being in good health, all our men wel contented, free from mutinies, in love one with another, and as we hope in a continuall peace with the Indians: where we doubt not but by Gods gracious assistance, and the adventurers willing minds and speedie furtherance to so honorable an action, in after times to see our Nation to enjoy a Country, not onely exceeding pleasant habitation, but also very profitable for comerce in generall; no doubt pleasing to almightie God, honourable to our gracious Soveraigne, and commodious generally to the whole Kingdome.

      Most of the second half of John Smith account talks about trade relations and exploratory missions between various indigenous tribes in the area. (Smith, John “A True Relation of Such Occurrences) Because of this, there wasn't too much to compare to the movie. For one, the movie is short and I can understand why a lot of the mundane time that is spent setting up a colony wasn't included. ("Goldberg, Eric, and Mike Gabriel. 1995. Pocahontas") The movie also deviates so far from this, and other scholarly sources, that there isn't much to compare. Overall, this source is heavily biased with a fair bit of exaggeration, that modern day historians know not to be true. At the same time, half of what John Smith talks about is a gateway into what life was like in the early days of Jamestown. It talks about disease, conditions of the settlement, various indigenous tribes (which the rest of the world knew relatively little about), the land and new sources of food which was an important source at the time it was published. (Smith, John “A True Relation of Such Occurrences) While Disney's Pocahontas isn't that close to this primary source, nor is it to other sources detailing this part of history, it does a good job in respecting Native American culture. There weren't a lot of films depicting Native Americans in a positive or appropriate light before this movie was made. While there is still shockingly low number of films that tell Native American stories, Pocahontas I think was a small catalyst for future indigenous movies due to its commercial success.

      Bibliography: “A True Relation of Such Occurrences and Accidents of Note as Hath Hapned in Virginia Since the First Planting of That Colony, Which Is Now Resident in the South Part Thereof, till the Last Returne from Thence. Written by Captaine Smith One of the Said Collony, to a Worshipfull Friend of His in England.,” April 13, 2005. http://web.archive.org/web/20050413081941/http://etext.lib.virginia.edu/etcbin/toccer-new2?id=J1007.xml&images=images/modeng&data=/texts/english/modeng/parsed&tag=public&part=all.

      Goldberg, Eric, and Mike Gabriel. 1995. Pocahontas. United States: Buena Vista Pictures.

    1. I’m always negotiating the relationship between micro.blog and my big blog, but I’m getting closer to a system in which micro.blog is a box of delights and the big blog is a Memex. Gonna try to stick with that model.

      reply to @ayjay @annie at https://micro.blog/ayjay/48571448

      @ayjay I've long presumed you were digitally commonplacing by means of your websites, so thanks for laying out some of your specific current thoughts on the process.

      ​@Annie I've been collecting examples of bloggers who are using their personal websites as commonplaces, zettelkasten, and "thought spaces" at https://indieweb.org/commonplace_book. If you're interested, you'll also find examples and details to explore in my own digital commonplace. "Thought spaces" is an interesting entry point.

      Doctorow goes through more of his process in which he's saving both his "box of delights" and the refashioning of them into longer pieces in "20 years a blogger". In his case it's (now) all done on Pluralistic and syndicated out from there, in much the same way @dave has done for years.

  8. Oct 2024
    1. Using the same microscopy setup as above, in vegetative cells, PHAkt-Achilles and PHAkt-mNeonGreen fluorescence appeared localized in the pinocytic cups (Fig. 2A),

      Was the cytoplasmic background also brighter here (not just the localized signal)? I'm just naively wondering if the achilles tag is causing some stress that is increasing background autofluorescence in the cell (given the onset of uniform cytoplasmic fluorescence in Fig 1).

    1. Reviewer #1 (Public review):

      Summary:

      The authors describe a method to probe both the proteins associated with genomic elements in cells, as well as 3D contacts between sites in chromatin. The approach is interesting and promising, and it is great to see a proximity labeling method like this that can make both proteins and 3D contacts. It utilizes DNA oligomers, which will likely make it a widely adopted method. However, the manuscript over-interprets its successes, which are likely due to the limited appropriate controls, and of any validation experiments. I think the study requires better proteomic controls, and some validation experiments of the "new" proteins and 3D contacts described. In addition, toning down the claims made in the paper would assist those looking to implement one of the various available proximity labeling methods and would make this manuscript more reliable to non-experts.

      Strengths:

      (1) The mapping of 3D contacts for 20 kb regions using proximity labeling is beautiful.

      (2) The use of in situ hybridization will probably improve background and specificity.

      (3) The use of fixed cells should prove enabling and is a strong alternative to similar, living cell methods.

      Weaknesses:

      (1) A major drawback to the experimental approach of this study is the "multiplexed comparisons". Using the mtDNA as a comparator is not a great comparison - there is no reason to think the telomeres/centrosomes would look like mtDNA as a whole. The mito proteome is much less complex. It is going to provide a large number of false positives. The centromere/telomere comparison is ok, if one is interested in what's different between those two repetitive elements. But the more realistic use case of this method would be "what is at a specific genomic element"? A purely nuclear-localized control would be needed for that. Or a genomic element that has nothing interesting at it (I do not know of one). You can see this in the label-free work: non-specific, nuclear GO terms are enriched likely due to the random plus non-random labeling in the nucleus. What would a Telo vs general nucleus GSEA look like? (GSEA should be used for quantitative data, no GO). That would provide some specificity. Figures 2G and S4A are encouraging, but a) these proteins are largely sequestered in their respective locations, and b) no validation by an orthogonal method like ChIP or Cut and Run/Tag is used.

      You can also see this in the enormous number of "enriched" proteins in the supplemental volcano plots. The hypothesis-supporting ones are labeled, but do the authors really believe all of those proteins are specific to the loci being looked at? Maybe compared to mitochondria, but it's hard to believe there are not a lot of false positives in those blue clouds. I believe the authors are more seeing mito vs nucleus + Telo than the stated comparison. For example, if you have no labeling in the nucleus in the control (Figures 1C and 2C) you cannot separate background labeling from specific labeling. Same with mito vs. nuc+Telo. It is not the proper control to say what is specifically at the Telo.

      I would like to see a Telo vs nuclear control and a Centromere vs nuc control. One could then subtract the background from both experiments, then contrast Telo vs Cent for a proper, rigorous comparison. However, I realize that is a lot of work, so rewriting the manuscript to better and more accurately reflect what was accomplished here, and its limitations, would suffice.

      (2) A second major drawback is the lack of validation experiments. References to literature are helpful but do not make up for the lack of validation of a new method claiming new protein-DNA or DNA-DNA interactions. At least a handful of newly described proximal proteins need to be validated by an orthogonal method, like ChIP qPCR, other genomic methods, or gel shifts if they are likely to directly bind DNA. It is ok to have false positives in a challenging assay like this. But it needs to be well and clearly estimated and communicated.

      (3) The mapping of 3D contacts for 20 kb regions is beautiful. Some added discussion on this method's benefits over HiC-variants would be welcomed.

      (4) The study claims this method circumvents the need for transfectable cells. However, the authors go on to describe how they needed tons of cells, now in solution, to get it to work. The intro should be more in line with what was actually accomplished.

      (5) Comments like "Compared to other repetitive elements in the human genome...." appear to circumvent the fact that this method is still (apparently) largely limited to repetitive elements. Other than Glopro, which did analyze non-repetitive promoter elements, most comparable methods looked at telomeres. So, this isn't quite the advancement you are implying. Plus, the overlap with telomeric proteins and other studies should be addressed. However, that will be challenging due to the controls used here, discussed above.

    2. Author response:

      Public Reviews:

      Reviewer #1 (Public review):

      Summary:

      The authors describe a method to probe both the proteins associated with genomic elements in cells, as well as 3D contacts between sites in chromatin. The approach is interesting and promising, and it is great to see a proximity labeling method like this that can make both proteins and 3D contacts. It utilizes DNA oligomers, which will likely make it a widely adopted method. However, the manuscript over-interprets its successes, which are likely due to the limited appropriate controls, and of any validation experiments. I think the study requires better proteomic controls, and some validation experiments of the "new" proteins and 3D contacts described. In addition, toning down the claims made in the paper would assist those looking to implement one of the various available proximity labeling methods and would make this manuscript more reliable to non-experts.

      Strengths:

      (1) The mapping of 3D contacts for 20 kb regions using proximity labeling is beautiful.

      (2) The use of in situ hybridization will probably improve background and specificity.

      (3) The use of fixed cells should prove enabling and is a strong alternative to similar, living cell methods.

      Weaknesses:

      (1) A major drawback to the experimental approach of this study is the "multiplexed comparisons". Using the mtDNA as a comparator is not a great comparison - there is no reason to think the telomeres/centrosomes would look like mtDNA as a whole. The mito proteome is much less complex. It is going to provide a large number of false positives. The centromere/telomere comparison is ok, if one is interested in what's different between those two repetitive elements. But the more realistic use case of this method would be "what is at a specific genomic element"? A purely nuclear-localized control would be needed for that. Or a genomic element that has nothing interesting at it (I do not know of one). You can see this in the label-free work: non-specific, nuclear GO terms are enriched likely due to the random plus non-random labeling in the nucleus. What would a Telo vs general nucleus GSEA look like? (GSEA should be used for quantitative data, no GO). That would provide some specificity. Figures 2G and S4A are encouraging, but a) these proteins are largely sequestered in their respective locations, and b) no validation by an orthogonal method like ChIP or Cut and Run/Tag is used.

      You can also see this in the enormous number of "enriched" proteins in the supplemental volcano plots. The hypothesis-supporting ones are labeled, but do the authors really believe all of those proteins are specific to the loci being looked at? Maybe compared to mitochondria, but it's hard to believe there are not a lot of false positives in those blue clouds. I believe the authors are more seeing mito vs nucleus + Telo than the stated comparison. For example, if you have no labeling in the nucleus in the control (Figures 1C and 2C) you cannot separate background labeling from specific labeling. Same with mito vs. nuc+Telo. It is not the proper control to say what is specifically at the Telo.

      I would like to see a Telo vs nuclear control and a Centromere vs nuc control. One could then subtract the background from both experiments, then contrast Telo vs Cent for a proper, rigorous comparison. However, I realize that is a lot of work, so rewriting the manuscript to better and more accurately reflect what was accomplished here, and its limitations, would suffice.

      (2) A second major drawback is the lack of validation experiments. References to literature are helpful but do not make up for the lack of validation of a new method claiming new protein-DNA or DNA-DNA interactions. At least a handful of newly described proximal proteins need to be validated by an orthogonal method, like ChIP qPCR, other genomic methods, or gel shifts if they are likely to directly bind DNA. It is ok to have false positives in a challenging assay like this. But it needs to be well and clearly estimated and communicated.

      (3) The mapping of 3D contacts for 20 kb regions is beautiful. Some added discussion on this method's benefits over HiC-variants would be welcomed.

      (4) The study claims this method circumvents the need for transfectable cells. However, the authors go on to describe how they needed tons of cells, now in solution, to get it to work. The intro should be more in line with what was actually accomplished.

      (5) Comments like "Compared to other repetitive elements in the human genome...." appear to circumvent the fact that this method is still (apparently) largely limited to repetitive elements. Other than Glopro, which did analyze non-repetitive promoter elements, most comparable methods looked at telomeres. So, this isn't quite the advancement you are implying. Plus, the overlap with telomeric proteins and other studies should be addressed. However, that will be challenging due to the controls used here, discussed above.

      We thank the Reviewer for their careful reading of manuscript and constructive suggestions. We plan to substantially revise the framing and presentation of manuscript to address the concerns raised by all three reviewers.

      Reviewer #2 (Public review):

      Summary

      Liu and MacGann et al. introduce the method DNA O-MAP that uses oligo-based ISH probes to recruit horseradish peroxidase for targeted proximity biotinylation at specific DNA loci. The method's specificity was tested by profiling the proteomic composition at repetitive DNA loci such as telomeres and pericentromeric alpha satellite repeats. In addition, the authors provide proof-of-principle for the capture and mapping of contact frequencies between individual DNA loop anchors.

      Strengths

      Identifying locus-specific proteomes still represents a major technical challenge and remains an outstanding issue (1). Theoretically, this method could benefit from the specificity of ISH probes and be applied to identify proteomes at non-repetitive DNA loci. This method also requires significantly fewer cells than other ISH- or dCas9-based locus-enrichment methods. Another potential advantage to be tested is the lack of cell line engineering that allows its application to primary cell lines or tissue.

      Weaknesses

      The authors indicate that DNA O-MAP is superior to other methods for identifying locus-specific proteomes. Still, no proof exists that this method could uncover proteomes at non-repetitive DNA loci. Also, there is very little validation of novel factors to confirm the superiority of the technique regarding specificity.

      The authors first tested their method's specificity at repetitive telomeric regions, and like other approaches, expected low-abundant telomere-specific proteins were absent (for example, all subunits of the telomerase holoenzyme complex). Detecting known proteins while identifying noncanonical and unexpected protein factors with high confidence could indicate that DNA O-MAP does not fully capture biologically crucial proteins due to insufficient enrichment of locus-specific factors. The newly identified proteins in Figure 1E might still be relevant, but independent validation is missing entirely. In my opinion, the current data cannot be interpreted as successfully describing local protein composition.

      Finally, the authors could have discussed the limitations of DNA O-MAP and made a fair comparison to other existing methods (2-5). Unlike targeted proximity biotinylation methods, DNA O-MAP requires paraformaldehyde crosslinking, which has several disadvantages. For instance, transient protein-protein interactions may not be efficiently retained on crosslinked chromatin. Similarly, some proteins may not be crosslinked by formaldehyde and thus will be lost during preparation (6).

      (1) Gauchier M, van Mierlo G, Vermeulen M, Dejardin J. Purification and enrichment of specific chromatin loci. Nat Methods. 2020;17(4):380-9.

      (2) Dejardin J, Kingston RE. Purification of proteins associated with specific genomic Loci. Cell. 2009;136(1):175-86.

      (3) Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, et al. In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Cell. 2017;170(5):1028-43 e19.

      (4) Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al. ChromID identifies the protein interactome at chromatin marks. Nat Biotechnol. 2020;38(6):728-36.

      (5) Santos-Barriopedro I, van Mierlo G, Vermeulen M. Off-the-shelf proximity biotinylation for interaction proteomics. Nat Commun. 2021;12(1):5015.

      (6) Schmiedeberg L, Skene P, Deaton A, Bird A. A temporal threshold for formaldehyde crosslinking and fixation. PLoS One. 2009;4(2):e4636.

      We thank the Reviewer for their constructive feedback on our work. As noted above, we plan to substantially revise the framing and presentation of manuscript to address the concerns raised by all three reviewers.

      Reviewer #3 (Public review):

      Significance of the Findings:

      The study by Liu et al. presents a novel method, DNA-O-MAP, which combines locus-specific hybridisation with proximity biotinylation to isolate specific genomic regions and their associated proteins. The potential significance of this approach lies in its purported ability to target genomic loci with heightened specificity by enabling extensive washing prior to the biotinylation reaction, theoretically improving the signal-to-noise ratio when compared with other methods such as dCas9-based techniques. Should the method prove successful, it could represent a notable advancement in the field of chromatin biology, particularly in establishing the proteomes of individual chromatin regions - an extremely challenging objective that has not yet been comprehensively addressed by existing methodologies.

      Strength of the Evidence:

      The evidence presented by the authors is somewhat mixed, and the robustness of the findings appears to be preliminary at this stage. While certain data indicate that DNA-O-MAP may function effectively for repetitive DNA regions, a number of the claims made in the manuscript are either unsupported or require further substantiation. There are significant concerns about the resolution of the method, with substantial biotinylation signals extending well beyond the intended target regions (megabases around the target), suggesting a lack of specificity and poor resolution, particularly for smaller loci. Furthermore, comparisons with previous techniques are unfounded since the authors have not provided direct comparisons with the same mass spectrometry (MS) equipment and protocols. Additionally, although the authors assert an advantage in multiplexing, this claim appears overstated, as previous methods could achieve similar outcomes through TMT multiplexing. Therefore, while the method has potential, the evidence requires more rigorous support, comprehensive benchmarking, and further experimental validation to demonstrate the claimed improvements in specificity and practical applicability.

      We thank the Reviewer for providing detailed critiques of our manuscript. As noted above, we plan to substantially revise the framing and presentation of manuscript to address the concerns raised by all three reviewers.

    1. Reviewer #3 (Public review):

      Summary:

      The study explores the cellular and circuit features that distinguish dentate gyrus semilunar granule cells and granule cells activated during contextual memory formation. The authors tag memory and enriched environment-activated dentate granule cells and semilunar granule cells and show their reactivation in an appropriate context a week later. They perform patch clamp recordings from activated and surrounding neurons to understand cellular driving the selective activation of semilunar granule cells and granule cells. Authors perform dual patch clamp recordings from various pairs of labeled semilunar granule cells, labeled granule cells, unlabeled granule cells, and unlabeled semilunar granule cells. The sustained firing of semilunar granule cells explained their preferential activation. In addition, activated neurons received correlated inputs.

      Strengths:

      The authors confirmed engram cell properties of activated semilunar granule cells and granule cells in two different paradigms, validated using an enriched environment paradigm.

      The authors carefully separate semilunar granule cells from granule cells, using electrophysiology and morphology. Cell filling to confirm morphology further strengthens confidence.

      The dual patch recordings, which are technically challenging, are carefully performed, and the presence of synaptic activity is confirmed.

      Finally, the correlation analysis of EPSCs on labeled neurons is rigorous.

      Weaknesses:

      (1) Engram cells are (i) activated by a learning experience, (ii) physically or chemically modified by the learning experience, and (iii) reactivated by subsequent presentation of the stimuli present at the learning experience (or some portion thereof), resulting in memory retrieval. The authors show that exposure to Barnes Maze and the enriched environment-activated semilunar granule cells and granule cells preferentially in the superior blade of the dentate gyrus, and a significant fraction were reactivated on re-exposure. However, physical or chemical modification by experience was not tested. Experience modifies engram cells, and a common modification is the Hebbian, i.e., potentiation of excitatory synapses. The authors recorded EPSCs from labeled and unlabeled GCs and SGCs. Was there a difference in the amplitude or frequency of EPSCs recorded from labeled and unlabeled cells?

      (2) The authors studied five sequential sections, each 250 μm apart across the septotemporal axis, which were immunostained for c-Fos and analyzed for quantification. Is this an adequate sample? Also, it would help to report the dorso-ventral gradient since more engram cells are in the dorsal hippocampus. Slices shown in the figures appear to be from the dorsal hippocampus.

      (3) The authors investigated the role of surround inhibition in establishing memory engram SGCS and GCs. Surprisingly, they found no evidence of lateral inhibition in the slice preparation. Interneurons, e.g., PV interneurons, have large axonal arbors that may be cut during slicing. Similarly, the authors point out that some excitatory connections may be lost in slices. This is a limitation of slice electrophysiology.

    1. Reviewer #1 (Public review):

      In this manuscript, Sun et al report the development of a POST-IT (Pup-On-target for Small molecule Target Identification Technology) approach for drug target identification. Generally, this new technology applies a non-diffusive proximity tagging system by utilizing an engineered fusion of proteasomal accessory factor A (PafA) and HaloTag to transfer prokaryotic ubiquitin-like protein (Pup) to proximal proteins upon directly binding to the small molecule. After the pupylated targets are captured, they are able to be detected by mass spectrometry. Significant optimization (Lys-Arg and other mutations) was conducted to eliminate the interference of self-pupylation, polypupylation, and depupylation, POST-IT was successfully applied for the target identification of 2 well-known drugs: dasatinib and hydroxychloroquine, which yielded SEPHS2 and VPS37C as their new potential targets, respectively. Furthermore, POST-IT was also applied in live zebrafish embryos, highlighting its potential for broad biological research and drug development.

      This work was well designed and the experiments were logically conducted. The solid results support POST-IT as a promising technology for new drug target identification.

      Weakness and limitations:

      (1) The technology requires a halo-tagged derivation of the active compound, and the linked position will have a huge impact on the potential "target hits" of the molecules. Given the fact that most of the active molecules lack of structure-activity relationship information, it is very challenging to identify the optimal position of the halo tag linkage.

      (2) Although POST-IT works in zebrafish embryos, there is still a long way to go for the broad application of the technology in other animal models.

      (3) The authors identified SEPHS2 as a new potential target of dasatinib and further validated the direct binding of dasatinib with this protein. However, considering the super strong activity of dasatinib against c-Src (sub nanomolar IC50 value), it is hard to conclude the contribution of SEPHS2 binding (micromolar potency) to its antitumor activity.

    1. Technical Feedback (8/20)

      HTML Structure (3/5)

      • ✓ Good heading variety (h1-h4)
      • ✗ Structural issues:
      • <h3> nested inside <h3>
      • Invalid custom tags (<p1>, <p2>)
      • ✓ Links properly embedded
      • ⚠ Image implementation:
      • Alt attributes present
      • Some invalid URLs (\ddd)
      • Inconsistent sources

      CSS Implementation (4/10)

      • ✗ Missing IDs completely
      • ✗ No class usage
      • ✗ Style issues:
      • Invalid selectors (p1, p2)
      • Redundant background declarations
      • Overuse of inline styles
      • ⚠ Limited styling scope:
      • Basic font sizing
      • Simple background images
      • Needs more detailed styling

      Code Quality (1/5)

      • ✗ Organization problems:
      • Excessive <br> tags
      • Missing closing tags
      • Poor indentation
      • ✗ Invalid elements:
      • Custom paragraph tags
      • Broken image sources
      • Improper tag nesting

      Priority Fixes:

      1. Fix HTML structure:
      2. Replace <p1>, <p2> with <p>
      3. Correct heading hierarchy
      4. Add proper closing tags
      5. Fix image URLs

      6. Improve CSS:

      7. Add 5+ unique IDs
      8. Create reusable classes
      9. Remove redundant styles
      10. Replace inline styling

      11. Clean up code:

      12. Replace <br> with margins/padding
      13. Improve indentation
      14. Fix tag nesting

      Your content structure shows promise, but needs technical cleanup. Focus first on using valid HTML elements and building a proper CSS structure with IDs and classes.

    1. Technical Feedback (18/20)

      HTML Structure (5/5)

      • ✓ Excellent heading hierarchy (h1-h3)
      • ✓ Well-organized paragraphs
      • ✓ Links properly implemented:
      • Correct <a> tag usage
      • Good use of target="_blank"
      • ✓ Images:
      • Properly embedded
      • Well-styled

      CSS Implementation (9/10)

      • ✓ Strong ID usage:
      • #intro
      • #ind
      • #iow
      • #pel
      • ✓ Effective class reuse:
      • .div1 across sections
      • .div2 across sections
      • ✓ Comprehensive tag styling:
      • Headers
      • Paragraphs
      • Images
      • ⚠ Minor optimization needed:
      • Redundant properties in .div1 and .div2
      • Could combine common styles

      Code Quality (4/5)

      • ✓ Clean, readable structure
      • ✓ Proper indentation
      • ✓ Good element nesting
      • ✗ Missing </head> closing tag

      Suggestions for Perfect Score:

      1. Optimize CSS:
      2. Create shared class for common div styles
      3. Combine repeated properties
      4. Add missing </head> tag

      Excellent work overall! Your code is clean and well-structured. Making these minor improvements would make it perfect. Your use of classes and IDs is particularly strong, showing good understanding of CSS organization.

    1. Technical Feedback (8/20)

      HTML Structure (2/5)

      • ✗ Critical structure issues:
      • <div> inside <h1> (invalid)
      • Multiple <body> tags
      • Missing closing tags for <a> and <ol>
      • ✗ Invalid <frame> usage (should be <iframe>)
      • ⚠ Heading issues:
      • Uses <h1> and <h3>
      • Improper nesting
      • ⚠ Custom paragraph ID used instead of <p> tag
      • ✓ Images have alt attributes

      CSS Implementation (5/10)

      • ⚠ Problematic ID usage:
      • #heading
      • #heading2
      • #p (should be tag selector)
      • Split styles that should be unified
      • ✗ Class issues:
      • Invalid .container: syntax
      • Missing second reusable class
      • ✗ Style problems:
      • Redundant h1/h3 styles
      • Inline styles in <body>
      • Misplaced colons
      • Missing semicolons

      Code Quality (1/5)

      • ✗ Major structural issues:
      • Multiple body tags
      • Broken closing tags
      • Improper element nesting
      • ✗ Redundant styling
      • ✗ Invalid HTML/CSS syntax
      • ✗ Disorganized code structure

      Critical Fixes:

      1. Fix HTML structure:
      2. Remove extra <body> tag
      3. Fix tag nesting
      4. Close all tags properly
      5. Correct element usage:
      6. Replace <frame> with <iframe>
      7. Use proper <p> tags
      8. Fix CSS:
      9. Remove .container: syntax error
      10. Consolidate heading styles
      11. Move inline styles to CSS file
      12. Clean up redundant code
      13. Fix all closing tags

      Hi Collin, I really enjoyed your projects concept; however, your project needs significant technical improvements to function properly. Focus first on fixing the HTML structure and closing tags, then work on organizing your CSS more efficiently.

    1. Technical Feedback (19/20)

      HTML Structure (5/5)

      • ✓ Excellent heading hierarchy (h1-h5)
      • ✓ Proper paragraph structure
      • ✓ Media well-implemented (YouTube, Giphy iframes)
      • ✓ Images correctly formatted
      • ⚠ Minor note: Redundant <a> tag after Giphy embed

      CSS Implementation (10/10)

      • ✓ Strong ID usage:
      • #containerOne
      • #leftnote
      • #rightnote
      • #color
      • #define
      • #bold
      • #big
      • ✓ Effective class reuse:
      • .notes
      • .small
      • ✓ Comprehensive tag styling:
      • Tables (table, th, td)
      • Headings
      • Paragraphs

      Code Quality (4/5)

      • ✓ Clean, readable structure
      • ✓ Good separation of concerns
      • ✓ Proper indentation
      • ⚠ Some inline styles could move to CSS file

      Suggestions for Perfect Score:

      1. Remove redundant <a> tag after Giphy
      2. Move inline styles to CSS file
      3. Review table styling for consistency

      Outstanding work on HTML structure and CSS implementation. Your code is clean, semantic, and well-organized. Minor tweaks to styling organization, but overall nice job.

    1. Technical Feedback (8/20)

      HTML Structure (3/5)

      • ✓ Main heading (<h1>) used correctly
      • ✗ Custom tags used instead of standard <p> tags (<p1>, <p2>, <p4>)
      • ⚠ Links present but have syntax errors (missing >)
      • ✓ Image (elio2.jpeg) implemented correctly
      • ✗ Needs more section headings

      CSS Implementation (4/10)

      • ⚠ IDs implemented:
      • #containerone
      • #containertwo
      • #floatingpup
      • Need 2 more to meet requirements
      • ⚠ Classes:
      • .container used well
      • Need another reusable class (3+ instances)
      • ✗ Style issues:
      • Invalid syntax (opacity: .7.5)
      • Missing semicolons
      • Broken custom tag selectors

      Code Quality (1/5)

      • ✗ Invalid HTML elements (<div1>, <p1>, <p2>, <p4>)
      • ✗ Improper CSS formatting
      • ✗ Missing closing brackets
      • ✗ Invalid font-family declarations
      • ✗ Misused quotes in div1 styling

      Priority Fixes:

      1. Replace custom tags (<p1>, <p2>, <p4>) with standard <p> tags
      2. Add 2 more unique IDs
      3. Create another reusable class
      4. Fix link syntax
      5. Clean up CSS syntax (semicolons, opacity values)

      Enjoyed this project overall! Address the technical issues listed here and this will be a solid submission.

    1. Technical Feedback (14/20)

      HTML Structure (4/5)

      • ✓ Good use of heading hierarchy (h1-h6)
      • ✓ Paragraphs properly tagged
      • ✗ Two empty <p> tags need content
      • ✗ Missing navigation links
      • ⚠ Images work but need better organization

      CSS Implementation (7/10)

      • ✓ Multiple IDs used effectively
      • ✓ Good reuse of .container class
      • #rain1 ID exists in CSS but not in HTML
      • .container class missing style definitions
      • ✗ Layout issues due to undefined container styles

      Code Quality (3/5)

      • ✗ HTML syntax errors:
      • Missing > in <link> tag
      • Unclosed final <div>
      • ✗ Unused CSS selectors (p2, h2, #rain1)
      • ✗ Inconsistent margin spacing
      • ✗ Div structure needs optimization

      Key Improvements:

      1. Add navigation links
      2. Define .container styles
      3. Fix HTML syntax errors
      4. Clean up unused CSS
      5. Improve div organization

      Overall I really enjoyed your concept and visuals that reinforced the theme of the page. Focus on cleaning up the technical details and completing the missing style definitions to take this to the next level.