PatientID: 161

KindredID: 62

Case: F, 41Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The patient's daughter presented with a CNS hemangioblastoma and multiple pancreatic cysts and tumors at the age of 14.

CasePresentingHPOs: HP:0005584; HP:0002666; HP:0010797; HP:0001737; HP:0001732 (Renal cell carcinoma, Pheochromocytoma, Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband presented with a CNS hemangioblastoma at age 28, and a renal cell carcinoma, multiple pancreatic cysts/tumors, and a pheochromocytoma at age 41.

CaseNotHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R161* (c.481C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2217, https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: 179

KindredID: 70

Case: F, 44Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 179) had a daughter (patient 180) who was confirmed with the mutation, and present4ed with a retinal angioma and multiple pancreatic cysts/tumors at 17. The proband also has three family members who were unconfirmed with the mutation (passed away before diagnosis): patient 181 (proband's brother) had a CNS hemangioblastoma at 17, patient 182 (proband's father) had a CNS hemangioblastoma at 49, renal cell carcinoma and multiple pancreatic cysts/tumors at 56, and patient 183 (proband's uncle) had a CNS hemangioblastoma at 32 and a retinal angioma at 30.

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a renal cell carcinoma at 44, and multiple pancreatic cysts/tumors at 28.

CaseNotHPOs: HP:0010797; HP:0002666; HP:0009711 (Hemangioblastoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162* (c.486C>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223226; https://www.ncbi.nlm.nih.gov/clinvar/variation/223226/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162* (c.486C>A)

MultipleGeneVariants: N/A

PatientID: 151

KindredID: 55

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 150) has a father (patient 151) who was also confirmed with this germline mutation, and presented at 22 with a CNS hemangioblastoma and 28 with renal cell carcinoma. The proband presented with a CNS hemangioblastoma at 14 and multiple pancreatic cysts/tumors at 17. The proband also has a grandmother (patient 153) who presented with a CNS hemangioblastoma at 43, but who passed away before diagnosis/ genetic testing.

CasePresentingHPOs: HP:0010797; HP:0005584 (Hemangioblastoma, Renal cell carcinoma)

CaseHPOFreeText: The proband's father presented with a CNS hemangioblastoma at 22 and renal cell carcinoma at 28.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0001737; HP:0001732 (Retinal capillary hemangioma, Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.I151S (c.452T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223215, https://www.ncbi.nlm.nih.gov/clinvar/variation/223215/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: I151S (c.452T>G)

MultipleGeneVariants: N/A

PatientID: 138

KindredID: 52

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: HP:0010797, HP:0001737; HP:0001732; HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband presented at age 28 with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: proband (III:2)

KindredID: 1

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Two of the proband's maternal cousins were healthy individuals that were demonstrated to carry the same mutation, as revealed by Sanger sequencing: III:4, male, and III:8, female as seen in the pedigree from Figure 1. A further five affected members of the family had previously died from this syndrome, including the proband's mother (II:2), maternal grandfather (I:1), two uncles (II:3 and II:5), and a cousin (III:10). These deceased family members had not previously been tested for mutations in the VHL gene. Pedigree: see Figure 1.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: A cyst and a nodule were revealed via brain MRI. The cyst was demonstrated to be a hemangioblastoma tumor following surgical excision

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: NA

SupplementalData: NA

Variant: p.H115Q (c.345C>A)

ClinVar: 496057 https://www.ncbi.nlm.nih.gov/clinvar/variation/496057/

CAID:N/A

gnomAD: N/A

VariantEvidence: RNA extracted from peripheral blood samples obtained from patients in the pedigree and the healthy controls. No significant difference in the expression of pVHL was demonstrated between the mutated and wild type cDNA, as demonstrated by RT-sqPCR analysis.

MutationType: missense_variant;transversion

CivicName: H115Q (c.345C>A)

MultipleGeneVariants: N/A

PatientID: III:1

KindredID: 6002

Case: M, 28Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Maternal uncle (II:1) had a history of testicular cancer but no genetic data was available.

CohortInfo: Patients met at least one of the criteria: RCC < forty years of age or bilateral or multifocal RCC < sixty years of age or family history of RCC or three relatives with RCC, melanoma or mesothelioma (at least one case of RCC) or patients diagnosed with RCC and melanoma. Family history of RCC is defined as two or more first-degree relatives with RCC. Patients with a previously identified pathogenic variant in a renal cancer predisposition gene were not included. Patient inclusion took place from February 2014 to January 2015. This patient was grouped in “Group 1” where only one family member was affected by renal cell carcinoma (n=20).

CasePresentingHPOs: HP:0006770 (Clear cell renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: The patient has been through the national screening program for putative VHL, which includes MRI of the cerebrum, spinal medulla and abdomen, neurological examination, auditory tests, ocular examination and blood work for chromogranin A and metanephrines, with normal results.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Figure 3

Variant: p.M1I (c.3G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 135406, https://www.ncbi.nlm.nih.gov/clinvar/variation/135406/

CAID: N/A

gnomAD: 0.00007043, https://gnomad.broadinstitute.org/variant/3-10183534-G-A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: M1I (c.3G>A)

MultipleGeneVariants: Germline, VHL, c.631A>C (p.Met211Leu)

MultipleGeneVariants: Germline, BAP1, c.1729+8T>C

PatientID: None

KindredID: 6

Case: F, 28Y0M, Ethnicity Unknown

DiseaseAssertion: Clear Cell Renal Cell Carcinoma

FamilyInfo: N/A

CohortInfo: The National Cancer Institute has a frozen tumour bank of ccRCC tumours that have been removed from VHL patients. We selected six patients, three males and three females, with at least five tumours from a single surgery from one kidney.

CasePresentingHPOs: HP:0006770 (clear cell renal cell carcinoma)

CaseHPOFreeText: The patient presented with ccRCC at age 28.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 1-3 Loss

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: In the 13 tumours that was sequenced from this patient, 10 had completely lost the other copy of chromosome 3.

MutationType: exon_loss_variant

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 12

KindredID: 6004

Case: F, 28Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: She presented with one pathologic pancreatic endocrine tumour.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

LegacyVariant: p.R161* (c.694C>T)

CaseProblemVariantFreeText: N/A

ClinVar:2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: CA020408 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.481C%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: II-3

KindredID: I

Case: M, Age Unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: In the patient’s 12 member Chinese family, 7 members were found to carry the NM_000551.3:c.114delC mutation. Five had manifestations of CNS hemangioblastoma, and three of the five were deceased. The other two members found to carry the mutation were asymptomatic, although the paper states that this is likely due to their young age.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient is deceased. The paper implies that the mutation was confirmed through stored tumour tissue.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G39Afs*28(c.114delC)

LegacyVariant: p.G39Afs*28(c.327delC)

ClinVarID: N/A

CAID: CA2573047816, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA2573047816

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: G39Afs(c.114delC)

MultipleGeneVariants: N/A

PatientID: Proband 6

KindredID: 2

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Mother, aunt and aunt’s cousin (all relative to proband 6) had this variant. Mother and proband presented with unilateral pheochromocytoma and aunt and aunt’s cousin were asymptomatic. Proband also presented with a renal cyst and hypertension.

CasePresentingHPOs: HP:0002666; HP:0000107; HP:0000822 (Pheochromocytoma, Renal cyst, Hypertension)

CaseHPOFreeText: Unilateral PCC diagnosed at 28Y and unilateral renal cyst and hypertension. Stated as having VHL type IIC.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R120T (c.359G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753738, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.359G%3EC

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R120T (c.359G>C)

MultipleGeneVariants: N/A

PatientID: CIV:1

KindredID: C

Case: M, 28Y0M, Chinese

DiseaseAssertion: hemangioblastoma

FamilyInfo: A 4-generation family is given with 3 confirmed members with this mutation. 3 other members had VHL-presenations however had not been tested for the gene.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: diagnosed with hemangioblastoma and died of surgical complications at the age of 28Y

CaseNotHPOs: HP:0002666; HP:0005584; HP:0001737; HP:0009711 (pheochromocytoma, renal cell carcinoma, pancreatic cysts, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S80I (c.239G>T) [assumed]

LegacyVariant: p.S80I (c.452G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 625229 https://www.ncbi.nlm.nih.gov/clinvar/variation/625229/

CAID: N/A

gnomAD: N/A

VariantEvidence: No genetic testing was done prior to death, however family history and presentation leads to this assumption

MutationType: missense_variant; transversion

CivicName: S80I (c.239G>T)

MultipleGeneVariants: N/A

PatientID: 277

KindredID: 108

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 277, presented with a CNS hemangioblastoma at age 16, retinal angioma a 20, and renal cell carcinoma at 28. Their father who passed away before diagnosis presented with a CNS hemangioblastoma at 48.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband, patient 277, presented with a CNS hemangioblastoma at age 16, retinal angioma a 20, and renal cell carcinoma at 28.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 30

KindredID: 11

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 30) has a son (patient 31) who was genetically confirmed with the mutation, who was asymptomatic at the time of analysis. She also has a father (patient 32, CNS hemangioblastoma at 42), a brother 1 (patient 33, CNS hemangioblastoma at 28), brother 2 (patient 34, CNS hemangioblastoma at 30), and uncle (patient 35, retinal angioma at 60) who passed away before they could be diagnosed/ genetically confirmed with the mutation.

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Hemangioblastoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at 28, retinal angioma at 26, renal cell carcinoma at 37, and multiple pancreatic cysts/tumors at 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336). This mutation was also published in PMID 32179488 in reference to one patient with VHL disease type 1 in this paper with the c.227_229del variant. However, it is unclear whether patient #27, #28, or #30 is specifically published in PMID 32179488.

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.F76del (c.227_229del)

LegacyVariant: F76del (c.224_226delTCT)

CaseProblemVariantFreeText: The protein coding change for this variant is listed in this paper as p.F76Cfs*138. However the DNA change listed in this paper (c.224_226delTCT) is equivalent to c.227_229delTCT, and results in p.F76del. This variant is entered on CIViC with p.F76del. As a note the latter c. nomenclature is preferred due to the 3' rule.

ClinVarID: N/A

CAID: CA357012; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

PatientID: 259

KindredID: 100

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 259, presented with a CNS hemangioblastoma and multiple pancreatic cysts/tumors at age 28, and a retinal angioma at age 24. The proband's son, patient 260, was asymptomatic at the time of analysis.

CasePresentingHPOs: N/A

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband, patient 259, presented with a CNS hemangioblastoma and multiple pancreatic cysts/tumors at age 28, and a retinal angioma at age 24.

CaseNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1-2 Deletion (c.1-?_463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1-2 Deletion

MultipleGeneVariants: N/A

PatientID: 81

KindredID: 27

Case: M, 38Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 81) had 3 family members confirmed with the mutation: his aunt 2 (patient 85) had pancreatic cysts and/or tumors at age 50, his cousin/ the son of Aunt 2 was asymptomatic at the time of assessment, and the granddaughter of aunt 2 was also asymptomatic at the time of assessment. The proband also had 3 family members who passed away before diagnosis/ before confirming the mutation: his mother (patient 82) had a CNS hemangioblastoma at 33, his Aunt 1 (patient 83) had a CNS hemangioblastoma at 32, and his cousin/ the son of Aunt 1 (patient 84) had a CNS hemangioblastoma at 30.

CasePresentingHPOs: HP:0010797; HP:0001732; HP:0001737; HP:0005584; HP:0002666 (Hemangioblastoma, Abnormality of the pancreas, Pancreatic cysts, Renal cell carcinoma, Pheochromocytoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at age 28, and renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 38.

CaseNotHPOs: HP:0009711(Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172; https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

PatientID: 71

KindredID: 25

Case: F, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband has the same mutation as her son (patient no.72). Her son did not present with hemangioblastoma, multiple pancreatic cysts/tumors, retinal angioma, renal cell carcinoma, or pheochromocytoma, and is apparently asymptomatic.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The patient presented with renal cell carcinoma at age 28, multiple pancreatic cysts/tumors at age 28, and hemangioblastoma at age 30.

CaseNotHPOs: HP:0009711; HP:0002666 (Retinal capillary hemangioma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182978, https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

PatientID: 5

KindredID: 5

Case: 28Y0M, Sex unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs:  HP:0010797; HP:0005584 (hemangioblastoma, renal cell carcinoma)

CaseHPOFreeText: CNS hemangioblastoma first presenting at age 28Y and RCC at age 28Y

CaseNotHPOs: HP:0009715; HP:0002666 (Papillary cystadenoma of the epididymis, pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S (c.233A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: N78S (c.233A>G)

MultipleGeneVariants: N/A

PatientID: III-4 (Proband)

KindredID: 1

Case: M, 28Y0M, Mexican

DiseaseAssertion: VHL

FamilyInfo: Family composed of six affected individuals and three diseased subjects (III-2, III-3, III-4) were studied. III-4 (proband) presented with a CNS hemangioblastoma and a retinal hemangioblastoma. The mother (II-1) developed cerebellar, medullar and bilateral retinal HBs; two maternal aunts (II-2 and II-3) were affected by retinal and CNS HBs and unspecified renal tumors, whereas his grandfather (I-2) had unspecified abdominal tumors. All these relatives died in their early 30s. A 35-year-old sister (III-2) demonstrated cerebellar HB, right eye retinal HB and renal cell carcinoma, whereas a 32-year-old brother (III-3) presented with cerebellar HB, right eye retinal HB, renal cell carcinoma and pheochromocytoma. A mutation-carrier nephew (IV-2) presented only atrophy of the retinal pigment epithelium. All of these family members were found to have the R82P (c.245G>C) germline VHL variant. Eighteen additional healthy relatives were analyzed and tested negative for the mutation.

CohortInfo: Two families and one apparently non-familial case were studied at the Institute of Ophthalmology ‘Conde de Valenciana’ (Mexico City, Mexico).

CasePresentingHPOs: HP:0010797; HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: MRI of brain and spine was performed in this subject demonstrating cerebellar HB. Funduscopic evaluation of the right eye showed a well defined orange-red mass corresponding to a peripheral retinal HB of approximately 1 disc diameter associated with a prominent feeding artery and to a draining vein. FAG demonstrated hyperfluorescence of this retinal angioma as well as enlargement and tortuosity of retinal blood vessels.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Family pedigree (Figure 1(a))

Variant: p.R82P (c.245G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 526675, https://www.ncbi.nlm.nih.gov/clinvar/variation/526675/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R82P (c.245G>C)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 30Y0M, Vietnamese

DiseaseAssertion: VHL

FamilyInfo: None - The diagnosis of VHL had not been established in her parents or her relatives, who lived in Vietnam without further evaluation.

CasePresentingHPOs: HP:0009711; HP:0001737 (retinal capillary hemangioma; pancreatic cysts)

CaseHPOFreeText: At 28Y presented with multiple retinal capillary hemangioma (complicated tractional retinal detachment and multiple large angiomas) and multiple pancreatic cysts. Underwent PPV combined with relaxing retinectomy.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 3

Case: Sex Unknown, 38Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Patient had family history of VHL disease. The patient’s aunt and her son had the same mutation, but no clinical manifestations. The patient’s mother, another aunt and her son had hemangioblastomas at age 30, 33, and 32, respectively, but died prior to genetic testing could be performed.

CohortInfo: 16 Chinese patients clinically diagnosed with VHL disease.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001732 (hemangioblastoma; renal cell carcinoma; abnormality of the pancreas)

CaseHPOFreeText: The patient presented with a hemangioblastoma at age 28, as well as renal cell carcinoma at age and abnormality of the pancreas at age 38.

CaseNotHPOs: HP:0009711, HP:0002666, HP:0030393, (retinal capillary hemangioma, pheochromocytoma, endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172, https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

GroupID: 8

Case: 37Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0005584; HP:0009711; HP:0006880 (renal cell carcinoma; retinal capillary hemangioma; cerebellar hemangioblastoma)

CaseHPOFreeText: patient had retinal angiomas diagnosed at 28Y, cerebellar hemangioblastomas diagnosed at 22Y, and renal cell carcinoma diagnosed at 37Y.

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.R177* (c.529A>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 625258 https://www.ncbi.nlm.nih.gov/clinvar/variation/625258/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R177* (c.529A>T)

MultipleGeneVariants: N/A

PatientID: 104

KindredID: 35

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 104, presented with multiple pancreatic cysts/tumors at age 27. Their sister, patient 105 presented with pancreatic cysts/tumors at age 28. Their mother presented with a CNS hemangioblastoma at 45 but passed away before diagnosis/genetic testing.

CasePresentingHPOs: HP:0001737; HP:0001732 (Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0009711; HP:0010797 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98S (c.293A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 219160; https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: 1 (Proband)

KindredID: 12

Case: M, 57Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: This patient had a father that was assumed to have the c.406T>C germline mutation of the VHL gene but was not confirmed genetically. His father presented with renal cell carcinoma and died at 47Y.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0000077; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the kidney, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (37Y), retinal angioma (27Y) and renal and pancreatic cyst or tumor (unspecified) (28Y).

CaseNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.S65P (c.193T>C)

LegacyVariant: c.406T>C

CaseProblemVariantFreeText: N/A

ClinVarID: 547829, https://www.ncbi.nlm.nih.gov/clinvar/variation/547829/

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reference sequence is unclear in the current paper. After consulting the SickKids patient database, and finding the protein change to be recorded as: p.Ser65Pro, it was concluded that the current paper reported the cDNA change according to the legacy reference sequence (AF010238.1) and was mapped to c.193T>C (NM_000551.3).

MutationType: missense_variant;transition

CivicName: S65P (c.193T>C)

MultipleGeneVariants: N/A

PatientID: 6 (Mother)

KindredID: 18

Case: F, 75Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (54Y) and retinal angioma (28Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0001732; HP:0002666 (Renal cell carcinoma, Abnormality of the kidney, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: N/A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Authors state that the c.712C>T germline familial variant of the VHL gene in this patient is “inferred from the family”. No genetic testing was done on this patient to confirm this. Being that this familial variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: N/A

CivicName: N/A

MultipleGeneVariants: N/A

GroupID: 18

Case: 28Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: retinal capillary hemangioma

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: patient had retinal angiomas diagnosed at 28Y

CaseNotHPOs: HP:0005584; HP:0002666; HP:0006880 (renal cell carcinoma; pheochromocytoma; cerebellar hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.R113Efs*46 (c.337del)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA432420675 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.337del

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: R113FS (c.337delC)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 3

Case: F, 28Y0M, German

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748, HP:0006880, HP:0009713, HP:0030405, HP:0010302 (Adrenal pheochromocytoma, cerebellar hemangioblastoma, spinal hemangioblastoma, pancreatic endocrine tumour, spinal cord tumor)

CaseHPOFreeText: At age 16 she presented with a left adrenal pheochromocytoma which was removed laparoscopically. At age 28, a cystic cerebellar hemangioblastoma was removed. In 2010, she was admitted to the Freiburg Preventive Medicine Center. Baseline MRI detected multiple intraspinal hemangioblastomas associated with tumor cysts. Abdominal MRI also showed a 5.6 × 5.4 cm solid tumor in the pancreatic tail that was richly vascularized. Three of eleven lymph nodes showed metastases.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: I-2

KindredID: 1

Case: F, Age Unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: In the patient’s 12 member Chinese family, 7 members were found to carry the NM_000551.3:c.114delC mutation. Five had manifestations of CNS hemangioblastoma, and three of the five were deceased. The other two members found to carry the mutation were asymptomatic, although the paper states that this is likely due to their young age.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient is deceased. The paper implies that the mutation was confirmed through stored tumour tissue.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G39Afs*28(c.114delC)

LegacyVariant: p.G39Afs*28(c.327delC)

ClinVarID: N/A

CAID: CA2573047816, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA2573047816

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: G39fs(c.114delC)

MultipleGeneVariants: N/A

PatientID: III-5

KindredID: 1

Case: M, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: In the patient’s 12 member Chinese family, 7 members were found to carry the NM_000551.3:c.114delC mutation. Five had manifestations of CNS hemangioblastoma, and three of the five were deceased. The other member found to carry the mutation were asymptomatic, although the paper states that this is likely due to their young age.

CasePresentingHPOs: N/A

CaseHPOFreeText: The paper states that the patient is young, but no specific age is given.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G39Afs*28(c.114delC)

LegacyVariant: p.G39Afs*28(c.327delC)

ClinVarID: N/A

CAID: CA2573047816, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA2573047816

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: G39Afs(c.114delC)

MultipleGeneVariants: N/A

PatientID: III-3

KindredID: 1

Case: M, Age Unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: In the patient’s 12 member Chinese family, 7 members were found to carry the NM_000551.3:c.114delC mutation. Five had manifestations of CNS hemangioblastoma, and three of the five were deceased. The other two members found to carry the mutation were asymptomatic, although the paper states that this is likely due to their young age.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient suffered from progressive severe neck pain and numbness of the left arm for 6 months. The patient was initially treated with opioids and antiinflammatory medications and wore rigid neck collars. Despite intense conservative therapy, the patient experienced inadequate pain relief and underwent resection of CNS hemangioblastoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G39Afs*28(c.114delC)

LegacyVariant: p.G39Afs*28(c.327delC)

ClinVarID: N/A

CAID: CA2573047816, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA2573047816

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: G39Afs(c.114delC)

MultipleGeneVariants: N/A

PatientID: 8

KindredID: 8

Case: M,35Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Thirteen patients with a supratentorial hemangioblastoma.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: The patient had a meckel cave hemangioblastoma at age 28. The patient had a papillary edema and pituitary stalk hemangioblastoma at age 34. The patient died of VHL disease.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: B1

KindredID: 1

Case: Sex Unknown, 28Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: No testing

CasePresentingHPOs: HP:0009713, HP:0000107, HP:0001737 (spinal hemangioblastoma, renal cyst, pancreatic cyst)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: no other clinical features were found after the cerebellar hemangioblastoma during 5 years 10 months of follow-up

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T124Mfs*33 (c.369_375del)

LegacyVariant: c.582_589delGACACAC

ClinVarID: N/A

CAID: CA913189240 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.369_375del

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: T124Mfs*33(c.369_375del)

MultipleGeneVariants: N/A

The specific description of the restaurant makes me feel uncomfortable , especially the “fly-invested” make me confusing that why Connie and their friend would like to go there

I think the comparison to a church service is interesting because church is usually associated with safety, faith, and guidance, while the music Connie listens to eventually becomes connected to something dangerous.

suddenly surprised or frightened by something unexpected

unable to think clearly because you are shocked, confused, or tired

pulling something with force

a false appearance; pretending that something is true

a feeling of great annoyance or frustration

to walk by dragging or rubbing your feet along the ground

a stupid person

to gradually disappear or become part of something else

moved something from side to side, especially a tail or finger

to make a long, narrow cut or opening in something

became wider or made something wider

shining brightly, especially because something is clean, polished, or reflecting light

half of a circle

a simple seat without a back or arms

to rely on someone or something, or to be affected by a particular situation

very stiff and unable to bend or change

wanted something very strongly, especially something that is difficult or impossible to have

appeared or came into view, especially in a large, unclear, or threatening way

waiting for something to happen, especially with excitement or hope

a confusing network of paths or passages that is difficult to find your way through

up in the air or in a high position

smiling widely, especially because you are happy, amused, or pleased

urning around a central point or axis

speaking in a slow, lazy way, with the sounds of the words stretched out

believing that people are selfish and that their actions are usually motivated by personal interests rather than good intentions

smiling in a way that shows you feel pleased with yourself, superior, or amused

moving or acting in a slow, relaxed way because you have little energy or interest

scratched or damaged on the surface, usually by rubbing or hitting against something

honest and genuine, without pretending or hiding your true feelings

a meal eaten in the evening, especially a light or informal evening meal

to say that someone or something is good, impressive, or deserving of admiration

A mother could tease her daughter because she is envious of her daughter's beauty.

quick photographs taken with a camera, usually of a person, place, or moment

staring at someone or something for a long time, often because you are surprised or curious

to speak angrily to someone because they have done something wrong

stretching your neck forward or upward to see something better

This sentence is interesting because it presents the idea that the easiest way of life is the best, which contrasts with the modern belief that success requires hard work and struggle. It makes me reflect on whether a simple and peaceful life might actually lead to greater happiness than constant ambition and pressure.

endovascular stenting emerging as first-line therapy for rapid symptom relief, while definitive treatment targets the underlying cause

for - embryo - 28 days - first circulation system - why? CO2 and O2 diffuse over distances of a few microns - at 28 days, the embryo is about 30mm so needs a circulatory system to diffuse CO2 and O2

It is troubling that Montresor shows no hesitation or guilt while listening to Fortunato’s cries. His enjoyment of the sound of chains reveals his cruelty and the disturbing pleasure he takes in revenge.

It is surprising that Fortunato suddenly regains his awareness, but it is already too late for him to escape. Montresor’s calm reaction to his desperate struggle is unexpected and chilling.

This motto foreshadows Montresor’s plan for revenge. It warns that anyone who offends him will face punishment.

It’s interesting how he begins so calmly, just describing a painting — but there’s already something unsettling underneath. It makes me curious about what really happened to the Duchess.

I was shocked by how easily he admits giving “commands”, as if ordering his wife’s death was just another act of pride. He sounds more offended by his wife’s kindness.

The author's words appear calm, but I feel something terrible happened, like he ended his wife’s life without remorse.

I used to think that the job of college advisors was only to help with class schedules, but now I see that they also give emotional support and guidance when students face problems. It’s interesting to know that building a relationship with an advisor can really make a big difference in college life.

This situation shows how easily anxiety can keep someone from connecting with others. It’s sad that John feels the need to hide behind his phone instead of giving himself a chance to meet new people. It reminds me how difficult social situations can be when fear takes over, and how important it is to slowly build confidence to open up.

When we take care of ourselves, we have more energy and positivity to share with others. It made me realize that loving yourself is the first step to loving others. I used to think taking care of myself was less important than caring for others, but now I see how closely they are connected.

https://en.wikipedia.org/wiki/Henry_Hazlitt

https://www.instagram.com/sully_dawg2/

https://en.wikipedia.org/wiki/Paradox_of_tolerance

This is the story of the conversion of HIPAA, a law with no privacy, interoperability or security details turned into the central privacy regulatory framework for healthcare data in the US.

Ende April 2025 forderte der EU-Energiekommissar Dan Jørgensen erneut mehr LNG-Importe aus den USA, um die Abhängigkeit von russischem Gas zu verringern. Die EU plant, bis 2027 kein russisches Gas mehr zu beziehen. Kritiker, wie Greenpeace, warnen jedoch vor den höheren Kosten und Klimaschäden von LNG und fordern stattdessen Investitionen in erneuerbare Energien.

[Zusammenfassung mit Mistral generiert] https://taz.de/Unabhaengigkeit-von-russischem-Gas/!6082106/

https://www.liberation.fr/international/europe/en-espagne-la-panne-electrique-geante-ravive-le-debat-autour-des-energies-renouvelables-20250501_MI7RP64JCNCYJNWOQL2ADODKSQ/

In Frankreich steht das dritte näherjährige Energieprogramm kurz vor der Verabschiedung. Der Artikel informiert ausführlich über dieses Programm, dass eine Reduktion des fossilen Endenergieferbrauchs auf 35 Prozent Bis 2030, Vorsicht.

https://www.liberation.fr/economie/energie-la-ppe-tout-un-programme-20250428_LSEXS5JSEVH2BNDEYHXSTNOMSI/

This is a review of Medicare Advantage Plans provider directories. It details multiple failings in these provider directories. NPPES is not directly mentioned, but is likely the source of the various business address problems in the data.

This is the current SORN for NPPES. Does not appear to have changed since 2017.

This is the original SORN for the predecessor to NPPES: NPS.

Disease: Von-willebrand Disease (Type 2A)

Patient: 50 yo female

Variant: VWF NM_000552.5 c:4232_4249del p.(Val411_Ile416del), Exon 28, heterozygous variant

According to this paper, ACMG-AMP guidelines for interpreting this variant resulted in classification of likely pathogenic

Phenotypes: increased bruising, fatigue, recurrent sinusitis, menorrhagia, neutropenia, anaemia. Reduction in high-molecular-weight multimers

Family: segregation analysis showed two affected family members had the variant and two unaffected family members did not have variant.

Note: Patient also has diagnosed Acute Myeloid Leukaemia (AML) NM_000546.6(TP53):c704A>G p.(Asn235Ser), listed as VUS and found by NGS

• 看不懂
• 文字愛康可V2一起提供，但計算邏輯需一致
• 當有多檻優惠，只顯示最接近購物車金額門檻

Just so much honor, when thou yield’st to me, Will waste, as this flea’s death took life from thee.

In connection to line 27, it seems what seems to be getting lost is the listener's honor. The speaker (?) seems to connect this, comparing the fear of loosing her honor in connection to the flea's death. By saying this, the speaker goes on to push, saying that similar to the flea's death having no consequence, their will be no consequence to them being intimate.

Reuters-Bericht über die bisher mindestens 800 Entlassungen bei der amerikanischen Wetter- und Klimaagentur NOAA, die am Donnerstag begannen. Betroffen sind unter anderem Wissenschaftler:innen, die sich mit Klimamodellierung beschäftigten. Leidtragen sind nicht nur Gruppen, die auf präzise Wettervorhersagen angewiesen sind, sondern auch arme Länder, die sich keine ähnlichen Einrichtungen leisten können. https://www.reuters.com/world/us/trumps-firings-us-weather-agency-will-put-lives-risk-scientists-say-2025-02-28/

Überblicksartikel von 2019 zu den Angriffen auf die Wissenschaft während der ersten Trump-Regierung und ihre kurz- und langfristigen Folgen. Forschungen zur Klimakrise und öffentlichen Gesundheit wurden behindert, weil sie den Interessen der fossilen Industrien schaden. Der Kampf gegen Foschung, die Interessen bestimmter Unternehmen und Branchen bedroht, ging aber weit über die Klimathematik hinaus und dient u.a. auch der Chemie- und Agroindustrien. Zu den Maßnahmen gehörten: - Beendigung von Forschungsprojekten - Abbau des Einflusses von Wissenschaftler:innen auf regulatorische Entscheidungen - Verhinderung von öffentlichen Stellungnahmen von Wissenschaftler:innen - Behinderung von Forschungen zum menschengemachten Klimawandel - Vorschreiben erwünschter Forschungsergebnisse - Overruling von Experten durch politische Funktionäre bei Begutachtungen und Regulierungen - Einstellungsstopps und Entlassungen - Entfernung bestimmter Wissenschaftler:innen aus Beratungsgremien - Verbot der Berücksichtigung bestimmter Wissenschaftstypen bei Regulierungen - Druck auf Forschende, unwissenschaftliche Aussagen des Präsidenten zu unterstützen - Schließung von Forschungszentren und -büros und Auflösung von Ausschüssen - Umsiedlungen von Behörden und Forschungseinrichtungen in unattraktive Gegenden

https://www.nytimes.com/2019/12/28/climate/trump-administration-war-on-science.html

Kurzer Kommentar zum „War on Science“ der Trump-Regierung. Dazu gehören die Kürzung von 65% des Budgets der Umweltbehörde EPA, die Entlassung Hunderter von Wissenschaftller:innen bei der Klima- und Wettterbehörde NOAA und die Streichung des Worts „Klima“ aus Regierungsdokumenten. Der Untertitel „The Performance of Power over Truth“ trifft such die Bloßstellung Selenskyjs gestern.

https://theclimatehistorian.substack.com/p/the-war-on-science

for - longterminism - libertarianism - to - Guardian article - ‘Eugenics on steroids’: the toxic and contested legacy of Oxford’s Future of Humanity Institute - 2024, Apr 28. - Future of Life Institute closes down! - https://hyp.is/R3wU4uYEEe-MwW8DKwDeoQ/www.theguardian.com/technology/2024/apr/28/nick-bostrom-controversial-future-of-humanity-institute-closure-longtermism-affective-altruism

for - Guardian article - ‘Eugenics on steroids’: the toxic and contested legacy of Oxford’s Future of Humanity Institute - 2024, Apr 28. - longterminism - Future of Life Institute - had no future - from Guido Palazzo - article - From Übermensch to Uber-man - https://hyp.is/LuxHUOYCEe-m1JsgFH7ABQ/guidopalazzo.com/from-ubermensch-to-uber-man/

for - YouTube - Deep seek - techno-feudalism - Yanis Varoufakis - 2025, Jan 28

https://www.newscientist.com/article/2465689-surge-in-ocean-heat-is-a-sign-climate-change-is-accelerating/

Die Europäische Union befindet sich bei der Umsetzung ihrer Klimaziele in einem entscheidenden Moment. In einem Bericht des European Council on Foreign Relations werden die politischen HIndernisse für die Dekaarbonisierung analysiert, Dabei wird detailliert auf die geopolitische Situation und auf die Bedingungen in den EU-Staaten eingegangen..

https://www.theguardian.com/environment/2023/sep/28/eu-faces-make-or-break-moment-for-green-transition-report-says

Report: https://ecfr.eu/publication/ends-of-the-earth-how-eu-climate-action-can-weather-the-coming-election-storm/

Es wird erwartet, dass der britische Premierminister Sunak in seiner nächsten Regierungserklärung eine Ausdehnung der Öl- und Gasförderung in der Nordsee und Maßnahmen zum Schutz von Autofahren, z.B. vor Geschwindigkeitsbegrenzungen in Städten, ankündigt. Durch seine anti-Umweltpolitik will sich Sunak von der Labour-Opposition absetzen, die im Augenblick in Großbritannien in Meinungsumfragen weit vor den Tories liegt. https://www.theguardian.com/politics/2023/oct/28/rishi-sunak-to-double-down-on-anti-green-policies-in-kings-speech

for - Medium article - Nyams I have known and loved - Alexander Vezhnevets, 2022, Apr 28

for - definition - nyam - Tibetan term for intense psychophysical meditative experience - from Medium article - Nyams I have known and loved - Alexander Vezhnevets - 2022, Apr 28

What did "Russifying" consist of?

Cite your source(s)!

1:28:29 Government spends by creating money and when it taxes, the government destroys money

Disease: Von-willebrand Disorder, type 1

Patient 1 Variant: VWF NM_000552.5: c.4135C>T p.(Arg1379Cys) Exon 28

Family: History not mentioned

Patient 1 phenotype: near normal VWF:Ag and WVF:RCo levels RIPA within normal range Platelet VWF levels were normal normal pattern for multimeric analysis of plasma Slightly reduced VWF levels

In silico predictions available:

I-Mutant 3.0 value = -1.36 PYMOL prediction = substitution of ARG 1379 with a cysteine results in the loss of hydrogen bonds with Lys1407 and Lys1408, predicted change in secondary structure of A1 domain

Thrown weapons would benefit due to "Enforcer" [PERK:00322354] checked for Subject.WornHasKeyword = WeaponTypeShotgun instead of Subject.HasKeyword = WeaponTypeShotgun

Thrown weapons would benefit due to "Enforcer" [PERK:00322354] checked for Subject.WornHasKeyword = WeaponTypeShotgun instead of Subject.HasKeyword = WeaponTypeShotgun

tamal (singular) or tamale from Nahuatl tamalii<br /> tamaladas - tamale making events/parties<br /> tamaleras - people who make tamales

flour - masa harina<br /> masa preparada - ready made dough<br /> slaked lime (aka "cal")

alternate names for customized tamal: pasteles, hallacas, humitas

https://en.wikipedia.org/wiki/Urban_forest_inequity

urban forest inequity

Mentions of humans thinning trees for better tree canopy in the section on black ash trees in Braiding Sweetgrass by Robin Wall Kimmerer.