5,023 Matching Annotations
  1. Jul 2021
    1. Reviewer #1 (Public Review):

      This manuscript is an interesting extension and major follow-up on a previous paper by some of the same authors, currently published as a preprint (Reference as listed by the authors in the current manuscript: DELLA-FLORA NUNES, G., WILSON, E. R., MARZIALI, L. N., HURLEY, E., SILVESTRI, N., HE, B., O'MALLEY, B. W., BEIROWSKI, B., POITELON, Y., WRABETZ, L. & FELTRI, M. L. 2020. Prohibitin 1 is essential to preserve mitochondria and myelin integrity in Schwann cells. Available at Research Square, Preprint (Version 1)).

      The current manuscript uses mainly a mouse model lacking Prohibitin 1 specifically in Schwann cells to elucidate the mechanistic connections between mitochondrial dysfunction and demyelination (much of the basic analyses of these mice is described in the preprint mentioned above). Employing an elaborate combination of mouse genetics, pharmacological interventions and cell culture experiments, the authors provide evidence that the mTORC1 and JUN pathways are involved. Furthermore, individual contributions of these pathways have been examined.

      The major strengths of the manuscript lay in the thorough genetic approaches in vivo and the extensive data analysis. Furthermore, the presented data are sound and the approaches suitable.

    1. SciScore for 10.1101/2021.06.29.450452: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-cleared supernatants were incubated with 5 μg of anti-SARS-CoV-2 nucleocapsid antibody mixture (GTX135357 and GTX632269 [6H3]; GeneTex), anti-DDX21 (A300-627A; Bethyl Lab), anti-DDX6 (A300-460A; Bethyl Lab), or anti-MOV10 (A301-571A; Bethyl Lab) antibody at 4°C for 1 hour (h).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX632269</div><div>suggested: (GeneTex Cat# GTX632269, RRID:AB_2888304)</div></div><div style="margin-bottom:8px"><div>anti-DDX21</div><div>suggested: (Bethyl Cat# A300-627A, RRID:AB_513601)</div></div><div style="margin-bottom:8px"><div>anti-DDX6</div><div>suggested: (Bethyl Cat# A300-460A, RRID:AB_420926)</div></div><div style="margin-bottom:8px"><div>A301-571A; Bethyl Lab </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were then subjected to SDS-PAGE, followed by immunoblot analysis using anti-SARS-CoV-2 nucleocapsid (GTX632269 [6H3]), anti-DDX21, anti-DDX6 or anti-MOV10 antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid ( GTX632269</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MOV10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were fixed in 3.6% formaldehyde in phosphate-buffered saline (PBS), permeabilized in 0.1% NP-40 in PBS at room temperature, and incubated with anti-HA antibody (3F10; F. Hoffmann-La Roche AG, Basel, Switzerland) at a 1:300 dilution in PBS containing 3% bovine serum albumin (BSA) at 37°C for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also used anti-DDX6 (A300-460A; Bethyl Lab), anti-XRN1 (A300-443A; Bethyl Lab), anti-G3BP1 (A302-033A; Bethyl) anti-DDX21 (A300-627A; Bethyl Lab), anti-MOV10 (A301-571A; Bethyl Lab), anti-DDX5 (A300-523A; Bethyl Lab), or anti-SARS-CoV-2 nucleocapsid (ab273434 [6H3]; Abcam or GTX632269 [6H3]; GeneTex) antibodies as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-XRN1</div><div>suggested: (Bethyl Cat# A300-443A, RRID:AB_2219047)</div></div><div style="margin-bottom:8px"><div>anti-G3BP1</div><div>suggested: (Bethyl Cat# A302-033A, RRID:AB_1576539)</div></div><div style="margin-bottom:8px"><div>anti-DDX5</div><div>suggested: (Bethyl Cat# A300-523A, RRID:AB_451048)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with Donkey anti-mouse IgG (H+L) secondary antibody, Alexa Fluor 594 conjugate and/or Donkey anti-rabbit or anti-rat IgG (H+L) secondary antibody, Alexa Fluor 488 conjugate (Thermo Fisher Scientific Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit or anti-rat IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2-infected cells were detected using anti-SARS-CoV-2 Spike (GTX632604 [1A9]; GeneTex, Irvine, CA, USA) or anti-SARS-CoV-2 nucleocapsid (ab273434 [6H3]; Abcam or GTX632269 [6H3]; GeneTex) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid (ab273434 [</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: 293T, HepG2, HEK293T ACE2 (SL221</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid construction: To construct pcDNA3-HA-MOV10, a DNA fragment encoding MOV10 was amplified from HuH-7 cDNA by PCR using KOD-Plus DNA polymerase (TOYOBO, Osaka, Japan) and the following pairs of primers: 5’-CGGGATCCAAGATGCCCAGTAAGTTCAGCTG-3’ (Forward), 5’-CCGCTCGAGTCAGAGCTCATTCCTCCACTCTG-3’ (Reverse).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuH-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vector particles were produced by transient transfection of the second-generation packaging construct pCMVΔR8.74 (42, 43) and the VSV-G-envelope-expressing plasmid pMD2G as well as pRDI292 into 293T cells with TransIT-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection experiments with SARS-CoV-2 virus, HEK293T ACE2 cells (2×105 cells/well) were plated onto 6-well plates and cultured for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Actually, 1μl of culture supernatants of SARS-CoV-2-infected VeroE6 TMPRSS2 cells (2.7×108 TCID50/ml) were inoculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6 TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid construction: To construct pcDNA3-HA-MOV10, a DNA fragment encoding MOV10 was amplified from HuH-7 cDNA by PCR using KOD-Plus DNA polymerase (TOYOBO, Osaka, Japan) and the following pairs of primers: 5’-CGGGATCCAAGATGCCCAGTAAGTTCAGCTG-3’ (Forward), 5’-CCGCTCGAGTCAGAGCTCATTCCTCCACTCTG-3’ (Reverse).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-HA-MOV10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained DNA fragments were subcloned into either the BamHI-NotI sites of the pcDNA3-HA vector, and the nucleotide sequences were determined by Sanger sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-HA</div><div>suggested: RRID:Addgene_78782)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We previously described pHA-DDX3 (8–12), pcDNA3-HA-DDX1 and pcDNA3-HA-DDX6 (9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHA-DDX3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-HA-DDX1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-HA-DDX6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.1 SARS-CoV-2 N was a gift from Dr. Jeremy Luban</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 SARS-CoV-2</div><div>suggested: RRID:Addgene_158080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid #158079; http://n2t.net/addgene:158079; RRID:Addgene_158079) (38).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_158079)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The oligonucleotides above were annealed and subcloned into the BglII-HindIII site, downstream from an RNA polymerase III promoter of pSUPER (39), to generate pSUPER-DDX1, pSUPER-DDX21, and pSUPER-MOV10, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSUPER-DDX1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSUPER-DDX21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSUPER-MOV10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct pLV-shDDX1, pLV-shDDX21, or pLV-shMOV10, the BamHI-SalI fragments of the corresponding pSUPER plasmids were subcloned into the BamHI-SalI site of pRDI292, an HIV-1-derived self-inactivating lentiviral vector containing a puromycin resistance marker allowing for the selection of transduced cells (40).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-shDDX1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV-shDDX21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV-shMOV10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSUPER</div><div>suggested: RRID:Addgene_26210)</div></div><div style="margin-bottom:8px"><div>pRDI292</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We previously described pLV-shDDX3, pLV-shDDX5, and pLV-shDDX6 (11, 12, 41)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-shDDX3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV-shDDX5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV-shDDX6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vector particles were produced by transient transfection of the second-generation packaging construct pCMVΔR8.74 (42, 43) and the VSV-G-envelope-expressing plasmid pMD2G as well as pRDI292 into 293T cells with TransIT-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVΔR8.74</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV-G-envelope-expressing</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMD2G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CACO-2 human colon carcinoma cells (RCB0988; RIKEN BioResource Research Center, Tsukuba, Ibaraki, Japan) were cultured in DMEM supplemented with 20% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RIKEN BioResource</div><div>suggested: (RIKEN BioResource Center, RRID:SCR_003250)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56, 53, 54 and 55. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.09.451732: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethics Commission of Chongqing Medical University (ref. no. 2020003).<br>Consent: Written informed consent was waived by the Ethics Commission of the designated hospital for emerging infectious diseases.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD monoclonal antibodies (mAbs) against the SARS-CoV-2 Spike protein were obtained from the blood samples of COVID-19 convalescent patients as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T cells or A549 cells transfected with human ACE2 (293T-ACE2 or A549-ACE2) were cultured under the same conditions with the addition of G418 (0.5 mg/mL) to the medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Spike-mediated pseudoviral entry assay: To detect Spike variant-mediated viral entry, 293T-ACE2 and A549-ACE2 cells (1.5× 104) grown on 96-well plates were infected with 50 μL pseudoviruses (1 × 104 copies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmid pAdTrack-TO4-S, encoding SARS-CoV-2 Spike protein and enhanced green fluorescent protein (eGFP), was transfected into HEK 293T cells using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus-based neutralization assay: The 293T-ACE2 cells (1.5 × 104 cells/well) were seeded on 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">D614G mutation was introduced using site-directed mutagenesis (denoted as pCMV3-S-D614G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3-S-D614G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing, China) and cloned into pCMV3 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3</div><div>suggested: RRID:Addgene_161029)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vpr luciferase reporter vector (pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmid pAdTrack-TO4-S, encoding SARS-CoV-2 Spike protein and enhanced green fluorescent protein (eGFP), was transfected into HEK 293T cells using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAdTrack-TO4-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In parallel, another group of HEK 293T cells was transfected with hACE2 expressing plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2</div><div>suggested: RRID:Addgene_1786)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI, Bethesda, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The titers of neutralizing antibodies were calculated as 50% inhibitory dose (ID50), the half-maximal inhibitory concentrations (IC50) of monoclonal antibodies (mAbs) against pseudoviruses was calculated using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses of the data were performed using GraphPad Prism version 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitation of this study include its small sample size, only focus on pseudovirus-basded antibody neutralization in cell culture, and the possibility that mutations may alter neutralization by modulating Spike function rather than its antigenicity. To fully characterize the features of B.1.617 variant, in vivo study with authentic virus and the role of memory T or B cells in protection against this variant will be required. Conclusions about vaccine-mediated protection must be validated by real-world data collected in regions where B.1.617 variant is circulating. Collectively, this study will be helpful for understanding the increased spread of B.1.617 variant and highlight the need to in depth survey of this variant. Given the evolving nature of the SARS-CoV-2 RNA genome, new variant of concern will continue to arise, which may threaten vaccine efficacy. Therefore, antibody therapeutics and vaccine evaluations against new variants are worthy of further investigation.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.07.451505: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Animal study approval was provided by the Institutional Animal Care and Use Committee (IACUC) at Rocky Mountain Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: 12 male rhesus macaques between 3-5 years old were screened for SARS-CoV-2 status by ELISA, and when found to be negative for prior exposure were sorted by body weight, and then divided into two groups of six animals, resulting in near equal contribution of body weights.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were detected using affinity-purified polyclonal antibody peroxidase-labeled goat-anti-monkey IgG (Seracare, 074-11-021) in casein and TMB 2-component peroxidase substrate (Seracare, 5120-0047), developed for 5-10 min, and reaction was stopped using stop solution (Seracare, 5150-0021) and read at 450 nm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus neutralization: VeroE6 cells were maintained in Dulbecco’s modified Eagle’s media (DMEM) supplemented with 10% fetal bovine serum (Gibco), 1 mM L-glutamine, 50 U/mL streptomycin and 50 ug/mL penicillin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.06.21259226: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma from a convalescent patient featuring a high titer of anti-SARS-CoV-2-RBD antibodies was purchased from AllCells (commercial sample 1 – CS1) and used as a standard positive control throughout the study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human recombinant monoclonal Anti-SARS-CoV-2 antibody, mAb CR3022 produced in Nicotiana bethamiana (tobacco plant) was obtained from Novici Biotech LLC (Lot NCV_051520B) as a 1.0 mg/mL solution in PBS (pH 7.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: (Abcam Cat# ab273074, RRID:AB_2847846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot identification of enriched antibody isotypes: An enrichment was performed as described in the section “Enrichment of RBD-reactive antibodies from patient samples” above to screen for the presence of individual human antibody isotypes (IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgE, and IgM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD antibody quantification: Titers of antibodies from patient plasma responsive to SARS-CoV-2 RBD were measured using Lumit™ Dx SARS-CoV-2 Immunoassay (Promega VB1080).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant expression of SARS-CoV-2 spike protein receptor-binding (RBD) domain: The plasmid pCAGGS SARS-CoV-2 RBD comprises an N-terminal signal sequence, amino acids 319-541 of the spike protein from SARS-CoV-2 (the receptor-binding domain, RBD), and a C-terminal 6-His tag34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vector pCAGGS Containing the SARS-Related Coronavirus 2, Wuhan-Hu-1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were identified from the tandem mass spectra extracted by Xcalibur version 4.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MS2 spectra were searched against the Spike protein RBD and SwissProt Homo sapiens database using Mascot search engine (Matrix Science, London, UK; version 2.7.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mascot</div><div>suggested: (Mascot, RRID:SCR_014322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 70 μL of the sample was sprayed through an Ion Max Source (Thermo Fisher Scientific) fitted with a HESI II probe at a flow rate of 1 μL/min delivered by a PAL3 robot (CTC Analytics) and analyzed by a Q Exactive Plus mass spectrometer (Thermo Fisher Scientific)37, 38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific)37</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MS data were processed using Skyline (Version 20.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Skyline</div><div>suggested: (Skyline, RRID:SCR_014080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: ANOVA statistics were calculated using SAS (SAS Institute, Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Person’s correlations were calculated using the function “cor.test” and method “pearson” on RStudio v3.1.1073.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Violin and dot plots were generated with GraphPad Prism 9.0.2 and that same software was used for calculating the statistical significance by one-way ANOVA with Tukey’s multiple comparison test (* p<0.05; ** p<0.01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and software availability: Processed datasets utilized for the IgMS analyses can be found on the MassiVE repository, MSV000087529, after puplication.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassiVE</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.05.21260035: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: A collection of 80 human serum from asymptomatic subjects (UNICORN study; ethics committee of the University of Milan, approval number 17/20, approval date March 6, 2020) was tested at 1:100 dilution, while fifteen human sera (five high positive for SARS-CoV-2, five low positive for SARS-CoV-2 and five pre-pandemic negative for SARS-CoV-2) were tested starting from 1:100 to 1:25600 dilutions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following electrophoresis, proteins were transferred onto a nitrocellulose membrane (Bio-Rad Laboratories), according to standard protocols, before blocking for 5 min at room temperature with EveryBlot Blocking Buffer (Bio-Rad Laboratories) and incubation with a 1:3000 dilution of anti-6x HisTag-HRP antibody (Thermo Fisher) in the EveryBlot Blocking Buffer for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x HisTag-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In particular, the proteins were transferred to nitrocellulose membranes (Bio-Rad Laboratories) which were incubated for 5 min at room temperature with EveryBlot Blocking Buffer (Bio-Rad Laboratories) and then incubated with a 1:3000 dilution of anti-SARS/SARS-CoV-2 Coronavirus Spike Protein (subunit 1) Antibody (Thermo Fisher) in the blocking buffer for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS/SARS-CoV-2 Coronavirus Spike Protein ( subunit 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In-House Leishmania-RBD Enzyme-Linked Immunosorbent Assay (ELISA) IgG qualification: The IgG ELISA assay was qualified for the serological detection of SARS-CoV-2 specific antibodies in human serum samples using the RBD antigen (Lt-RBD) according to International Conference on Harmonization Guidelines on Validation of Analytical Procedures (Q2 (R1)) [36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Q2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, after the washing step, 100 μL/well of Goat anti-Human IgG-Fc Horse Radish Peroxidase (HRP)-conjugated antibody 1:100,000 (Bethyl Laboratories, Montgomery USA) were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparative evaluation of SARS-CoV-2 IgG antibodies using two different RBD antigens: Specific anti-SARS-CoV-2 IgG antibodies in human sera were detected by means of an in-house RBD assay using Lt-RBD produced in L. tarentolae cells and com-RBD, produced from HEK 293 cells and purchased from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>com-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To this aim, 1, 2, 3 and 4 µg/ml coating concentrations were tested against human positive and negative sera for SARS-CoV-2 and compared with 1 μg/mL Spike-RBD (commercially available from Sino Biological, China - hereafter com-RBD) expressed and purified from HEK 293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pLEXSY-sat2 vector integrates into the chromosomal 18S rRNA (ssu) locus of the L. tarentolae parasite.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLEXSY-sat2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes with PBS + 0.1% (v/v) Tween-20 (PBS-T), the membrane was incubated for 5 min with the Clarity Western ECL Substrate (Bio-Rad Laboratories) and detected using the ChemiDoc Touch Imaging System (Bio-Rad</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed and plotted using the GraphPad Prism 7 (Graphpad Software)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, the use of mammalian cells for the production of viral antigens presents potential limitations, in particular for rapid application and fast production in developing countries: highly specialized cell factories are indeed needed for efficient protein production in mammalian cells, and production costs are relatively high, compared to microbial-based systems. Our study underlines L. tarentolae as a system that is easy to manipulate and culture, providing a sound alternative for the rapid production of serodiagnostic proteins, even at the forefront of novel epidemics, e.g. in the presence of “spillover” events in tropical countries [42]. Accordingly, we emphasize that L. tarentolae can produce high protein yields that can easily be increased to industrial scale, by growing the parasites in bioreactors and harvesting proteins using high throughput strategies [25]. Consequently, this renders the Leishmania microfactory also potentially applicable in developing countries.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.06.451340: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Manual quantification of N+ cells were performed by distributing 10-15 images of iPSC-airway infected with SARS-CoV-2 stained with DAPI and N (>200 cells/image) to 5 blinded scorers.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used were; anti-SARS-CoV nucleoprotein (N) antibody (rabbit polyclonal, 1:2500, Rockland Immunochemicals, Cat #200-401-A50), anti-α-TUBULIN antibody (mouse monoclonal, 1:500 sigma cat# T6199), and anti-MUC5B antibody (mouse monoclonal, Santa Cruz Biotechnology, 1:500</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV nucleoprotein ( N )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-α-TUBULIN</div><div>suggested: (Sigma-Aldrich Cat# T6199, RRID:AB_477583)</div></div><div style="margin-bottom:8px"><div>anti-MUC5B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, cells were washed with PBS three times (5 minutes, room temperature), and incubated with secondary antibody (AlexaFluor 546 AffiniPure Donkey Anti-mouse IgG (H+L), 1:500, and AlexFluor 647 donkey anti-mouse IgG (H+L) 1:500, Jackson ImmunoResearch) for 2 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine cellular tropism, Z-stack images of the infected transwells stained with either anti-SARS-CoV-2 N and α antibodies or anti-SARS-CoV-2 N and anti-mucin 5B antibodies were taken on Nikon Eclipse NiE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N and α</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mucin 5B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-MUC5AC (Abcam cat# ab198254) was applied and visualized with anti-rabbit NP (Roche) and anti-NP-AP (Roche) and detected with Discovery Yellow (Roche); counter stained with hematoxylin, rinsed with detergent, dehydrated, and cover-slipped with permanent mounting media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-MUC5AC</div><div>suggested: (LSBio (LifeSpan Cat# LS-B1927-50, RRID:AB_1128083)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 propagation and titration: SARS-CoV-2 stocks (isolate USA_WA1/2020, kindly provided by CDC’s Principal Investigator Natalie Thornburg and the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA)) were grown in Vero E6 cells (ATCC CRL-1586) cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2% fetal calf serum (FCS), penicillin (50 U/mL), and streptomycin (50 mg/mL) and titrated as described previously38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Custom configured targets include: CCL2/JE/MCP-1, CXCL-9/MIG, CXCL10/IP-10/CRG-2, GM-CSF, IFNβ, IL-6, TNFα, TRAIL/TNFSF10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCL2/JE/MCP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each image analyzed using ImageJ and DAPI+ nuclei and N+ cells were quantified with the multi-point tool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mean fluorescence intensity was measured to calculate final concentration in pg/mL using Bioplex200 and Bioplex Manager 5 software (Biorad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioplex200</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Bioplex</div><div>suggested: (BioPlex, RRID:SCR_016144)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality of the raw data was assessed using FastQC v.0.11.774.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence reads were aligned to a combination of the human genome reference (GRCh38) and the SARS-CoV-2 reference (NC_045512) using STAR v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Counts per gene were summarized using the featureCounts function from the subread package v.1.6.276.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div><div style="margin-bottom:8px"><div>subread</div><div>suggested: (Subread, RRID:SCR_009803)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The edgeR package v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The limma package v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed genes for each comparison were visualized using Glimma v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Glimma</div><div>suggested: (Glimma, RRID:SCR_017389)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study is not without limitations. The iPSC-airway epithelium is transcriptionally similar to primary airway epithelium and can be used to functionally model diseases such as cystic fibrosis (CF) in vitro40. However, iPSC-derived cells differentiated into many cell types of different organs tend to be more fetal or immature than their endogenous counterparts in adults65–67, and there may be differences including receptor expression and cell type distributions. Whether our model reflects a more fetal or pediatric response to SARS-CoV-2 will require further investigation. Another limitation of this model is that the epithelial response is studied in isolation, and the complex interplay between epithelial, immune, interstitial, and endothelial cells that leads to COVID-19 pneumonia is not captured in our model. However, the iPSC system offers a reductionist, physiologically relevant model system to study the intrinsic epithelial response and provides key insights into the initial stages of COVID-19. Furthermore, given the clinical spectrum of disease severity caused by SARS-CoV-2 infection there is pressing need to further understand the mechanisms that lead to serve disease. Numerous genes, variants and pathways are implicated in modulating the response to infection and require further investigation15, 16. This iPSC-based platform, coupled with gene-editing technology, opens up future directions to evaluate the mechanisms of the airway response to SARS-CoV-2 response.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34, 35 and 39. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.05.21259547: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approval: This study was approved by the NYU Langone Health Institutional Review Board, protocol number i21-00493. cDNA synthesis, library preparation and sequencing: Total RNA (11 μl) was converted to first strand cDNA by random priming using the Superscript IV first-strand synthesis system (Invitrogen, ref# 180901050).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The control group consisted of full-genome sequenced SARS-CoV-2 positive cases in our health system who were randomly selected for SARS-CoV-2 genomic surveillance, had Ct ≤30, and were collected in the same time period as the breakthrough infections.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequenced read processing: Sequencing reads were demultiplexed using the Illumina bcl2fastq2 Conversion Software v2.20 and adapters and low-quality bases were trimmed with Trimmomatic v0.36 27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BWA v0.7.17 28 was utilized for mapping reads to the SARS-CoV-2 reference genome (NC_045512.2, wuhCor1) and mapped reads were soft-clipped to remove SNAP tiled primer sequences using Primerclip v0.3.8 29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum likelihood IQ trees were performed using the IQ-TREE XSEDE tool, multicore version 2.1.2, on the Cipres Science gateway v.3.3 33. GTR+I+G was chosen as the best-fit substitution model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Propensity-score matching was implemented using the nearest neighbor strategy using a 1:1 ratio without replacement, with the MatchIt algorithm in RStudio version 1.4.1106 39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Libraries were prepared using Swift Normalase Amplicon Panel (SNAP) SARS-CoV-2 and Sar-Cov-2 additional Genome Coverage (Cat# SN-5×296 core kit, 96rxn), using 10 μl of first strand cDNA, following the manufacturer’s instruction: https://swiftbiosci.com/wp-content/uploads/2021/06/PRT-028-Swift-Normalase-Amplicon-Panels-SNAP-SARS-CoV-2-Panels-Rev-9.pdf).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SNAP</div><div>suggested: (SNAP, RRID:SCR_007936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The BWA-MEM algorithm of the alignment program, BWA v0.7.17 (Li and Durbin 2009), was utilized for mapping reads of each sample to the SARS-CoV-2 reference genome (NC_045512.2, wuhCor1) with the ‘-M’ flag for marking shorter split hits as secondary and the parameter ‘-U’ set to a 17 alignment score penalty for an unpaired read pair.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Name-sorted mapped reads in SAM alignment format were soft-clipped to remove primer sequences specific to the short overlapping (tiled) amplicon design of the Swift Normalase Amplicon SARS-CoV-2 Panel using Primerclip v0.3.8 (Swift Biosciences: https://github.com/swiftbiosciences/primerclip), and the Picard v2.18.20 “AddOrReplaceReadGroups” tool (Broad Institute: http://broadinstitute.github.io/picard/) was used in converting the primer-trimmed SAM files to coordinate-sorted and indexed BAM format with read-groups added for downstream analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The variant caller, BCFtools v1.9 (Li et al. 2009), was utilized to detect genetic mutations of the collected viral samples from BAM input: bcftools mpileup -r NC_045512.2 --count-orphans --no-BAQ --max-depth 50000 --max-idepth 500000 –annotate FORMAT/AD,FORMAT/ADF,FORMAT/ADR,FORMAT/DP,FORMAT/SP,INFO/AD,INFO/ADF,INFO/A DR --output-type v | bcftools call --ploidy 1 --keep-alts --multiallelic-caller --output-type v | bcftools norm --multiallelics -any --output-type v | bcftools filter -i “(DP4[0]+DP4[1])<(DP4[2]+DP4[3]) && ((DP4[2]+DP4[3])>0) & FORMAT/AD[0:1]>20” --output-type v | bcftools filter -e “IMF<0.5” --output-type v To generate viral sequences, the output in VCF format was applied to the reference sequence using ‘bcftools consensus’ while the BEDTools v2.30.0 utilities (Quinlan and Hall 2010), “genomecov” (with the ‘-bga’ option to report depth at each base including zero coverage sites), “merge” (for creating a BED file of low depth sites with <1000x coverage to be masked), and “maskfasta” in conjunction with the multiple sequence alignment program, MAFFT v4.471 (Katoh et al. 2002) in ‘--auto’ mode, were used in the production of final consensus sequences with all bases below 1000x coverage masked and both non-targeted ends of the sequences trimmed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BCFtools</div><div>suggested: (SAMtools/BCFtools, RRID:SCR_005227)</div></div><div style="margin-bottom:8px"><div>BEDTools</div><div>suggested: (BEDTools, RRID:SCR_006646)</div></div><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Compared to the large number of SARS-CoV-2 infections among unvaccinated individuals, the recorded breakthrough cases between February and April 2021 (n=67) remained at∼1% of total infections, with the caveat that both breakthrough cases as well as unvaccinated controls were not exhaustively screened and covered. Despite the overall effectiveness of vaccination, our full spike mutation analysis revealed a broad set of spike mutations (n=21) to be elevated in the vaccine breakthrough group. It indicates that adaptive selection is in progress that may subsequently come into full effect. At this point, the breakthrough cases and differences in mutation rates between case and control groups are still too low to draw meaningful conclusions. However, the overrepresentation of functionally important spike mutations including NTD deletions ΔH69-V70 and ΔY144 together with RBD mutations K417X, S477X, E484X, and N501X as well as P681X (near the S1/S2 interface) in the absence of a clear elevation of VOCs or VOIs may indicate a starting sieve effect at individual or combinations of functional mutations. Spike mutations and deletions reported to confer neutralization escape in vitro23, 43, 44 might thus be responsible for a sieve effect in a real-life situation, i.e., among vaccinated individuals. During the time of our sample and data collection, there were two major variants arising in the New York City metro area constituting about two thirds of all cases, B.1.1.7, which was first rep...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.04.21259848: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was approved by the local ethics committee of the Canton of Bern, Switzerland (ID 2021-00669) and was registered on clinicaltrials.gov (Identifier: NCT04877496).<br>Consent: The trial was performed in accordance with the principles of the Declaration of Helsinki, and all participants provided written informed consent prior to inclusion.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Individuals younger than 18 years of age and pregnant or lactating women were not eligible to participate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All study participants were tested for the presence of anti-nucleocapsid antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Creatinine values, lymphocyte subpopulation counts, and total immunoglobulin quantities (IgG, IgM, IgA) were obtained using the routine clinical analytical services of the Center of Laboratory Medicine, Department of Clinical Chemistry of University Hospital Bern. anti-SARS-CoV2 S1-IgG and NC-IgG responses to vaccines: To assess humoral responses to vaccines, IgG antibodies targeting the SARS-CoV2 S1 protein, were detected using a commercial ELISA test from Euroimmun AG, Lübeck, Germany, as previously described 23.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>total immunoglobulin quantities (IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV2 S1 protein,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washing steps, 100μl of HRP-labelled secondary anti-human IgG antibodies was added for 30 minutes at 37°C, followed by three more washing steps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The present study has limitations. First, we could not measure anti-SARS-CoV2 spike protein antibodies before vaccination, because the Swiss vaccination program accelerated in high-risk individuals before recruitment was initiated. Therefore, we measured currently circulating anti-SARS-CoV2 nucleocapsid antibodies and excluded the three participants with detectable anti-nucleocapsid antibodies. Second, the distribution of vaccines manufactured by Pfizer-BioNTech and Moderna was not identical between controls and patients. Comirnaty® was the earliest approved vaccine in Switzerland that was made primarily available for individuals at high risk for severe COVID19. By the time when health care professionals and the general population became eligible for SARS-COV2 vaccination, Moderna® constituted the largest share of vaccines delivered to Switzerland. Finally, the current study population was highly heterogeneous regarding the underlying diseases, indications for CD20 depletion treatment, and immunosuppressive co-medication. However, this complex study population represents a real-world scenario and provided a unique opportunity to explore routine laboratory parameters that are readily available and could be used to predict vaccination efficacy and therefore guide vaccination timing despite the complexity of the various immunosuppressive regimens. Based on the current data, we propose that a simple peripheral count of CD4+ cells could serve as a starting point to stratify patien...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04877496</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Responses to COVID19 Vaccination in Patients With a Treatmen…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.06.451301: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal experiments: All the animal experiments were performed in accordance with protocols approved by the Icahn School of Medicine at Mount Sinai Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunization and challenge studies: Female BALB/c mice were used in all studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All sections were evaluated by a veterinary pathologist who was blinded to the vaccination groups in the Comparative Pathology Laboratory (CPL) at ISMMS.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HRP-conjugated goat anti-mouse IgA secondary antibody (PA1-74397 Invitrogen) was used at 1: 2000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgA</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-74397, RRID:AB_10985723)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plaques were immuno-stained with an anti-SARS-CoV-2 NP primary mouse monoclonal antibody 1C7C7 kindly provided by Dr. Thomas Moran at ISMMS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HRP-conjugated goat anti-mouse secondary antibody was used at 1:2000 and the plaques were visualized using TrueBlue™ Peroxidase Substrate (SeraCare Life Sciences Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral titers in the lung homogenates were measured by plaque assay on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunization and challenge studies: Female BALB/c mice were used in all studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence of the HXP-S was inserted into pNDV_LS/L289A rescue plasmid (between P and M genes) by in-Fusion cloning (Clontech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNDV_LS/L289A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombination product was transformed into MAX Efficiency™ Stbl2™ Competent Cells (Thermo Fisher Scientific) to generate the pNDV-HXP-S rescue plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNDV-HXP-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were transfected with 2 μg of pNDV-HXP-S, 1 μg of pTM1-NP, 0.5 μg of pTM1-P, 0.5 μg of pTM1-L and 1 μg of pCI-T7opt were re-suspended in 250 μL of Opti-MEM (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTM1-NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTM1-P</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTM1-L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCI-T7opt</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The statistical analysis was performed using GraphPad Prism 7.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04764422</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assess the Safety and Immunogenicity of NDV-HXP-S Vaccine in…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04830800</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase 1/2 Safety and Immunogenicity Trial of COVID-19 Vacc…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04871737</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of a Live rNDV Based Vaccine Against COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.06.451119: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: 2.3 Ethics statement: Experiments were approved by the IIBR animal care and use committee (IACUC) and performed in accordance with the guidelines of the care and use of laboratory animals published by the Israeli Ministry of Health<br>Euthanasia Agents: 2.9 Vaccine Replication in the K18 hACE2 transgenic mouse model: Animals were euthanized by cervical dislocation immediately following vaccination (time 0), 24, 48 and 72 hours post vaccination (n=4 mice per time point).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female New Zealand White (NZW) rabbits were obtained from Charles River, France, and were 14-16 weeks of age at study initiation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Histopathologic changes consistent with neurovirulence were scored, in a double blinded manner, based on the presence and severity of perivascular infiltrates, gliosis, neurodegeneration, satellitosis, and necrosis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Control animals were injected with carrier buffer at an identical dose volume and under identical experimental conditions. 2.5 Immunogenicity and Cellular Immunity Determination: The immunogenicity of the vaccine was evaluated by determining the NT50 values of neutralizing antibodies against SARS-CoV-2 (the dilution at which 50% neutralization was observed), as was assessed by the plaque reduction neutralization test (PRNT) [6].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary recovery of the rVSV-ΔG-SARS-CoV-2-S was performed in BHK-21 cells infected with Modified Vaccinia Ankara T7 (MVA-T7), followed by co-transfection with the rVSV-SARS-CoV-2-S, and the VSV accessory plasmids encoding for VSV-N, P, L and G proteins under control of a T7 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The organs were processed for titration in 1.5ml ice-cold PBS and titered on VERO-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Animals: C57BL/6J, knockout for type I interferon (IFN) receptors (Ifnar−/−) and hACE2-K18 mice were obtained from The Jackson Laboratory, USA, and were 6-12 weeks of age at study initiation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hACE2-K18</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18 hACE2 transgenic mice were vaccinated by a single i.m. injection (hind limb) at a dose of 107 PFU and at a dose volume of 0.05 ml/animal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18 hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For histopathology evaluations, rVSV-ΔG-SARS-CoV-2-S C57BL/6 (n=3), rVSV-ΔG-SARS-CoV-2-S IFNAR (n=6) or VSV-WT C57BL/6 (n=5) intracranially injected mice were sacrificed on day 14, 14 and 2, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.1 Virus and vaccine: Generation of the pVSVΔG-S construct was described in detail, previously [6].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVΔG-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the pVSV-spike expression plasmid was constructed by PCR amplification of the full-length human codon-optimized S gene from pCMV3-SARS-CoV-2 S expression plasmid (Sino Biological, Cat# VG40588-UT) that was used to replace the VSV-G (Glycoprotein) open reading frame within the VSV full length expression vector, yielding pVSV-ΔG-spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSV-spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMV3-SARS-CoV-2 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSV-ΔG-spike</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04608305</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluate the Safety, Immunogenicity and Potential Efficacy o…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.03.451026: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocol was approved by the Animal Welfare Committee of Flinders University and carried out in strict accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes (2013)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse Immunisation Protocol: Female, BALB/c and C57BL/6 (BL6) mice (6-10 weeks old) were supplied by the central animal facility of Flinders University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Lung lesions were scored by a board-certified veterinary pathologist blinded to the study groups as follows: Alveolar (ALV) score: 1 = focal, 2 = multifocal, 3 = multifocal to coalescing, 4 = majority of section infiltrated by leukocytes; Perivascular cuffing (PVC) score: 1 = 1 layer of leukocytes surrounding blood vessel, 2 = 2-5 layers, 3 = 6 – 10 layers, 4 = greater than 10 cells thick; Interstitial Pneumonia (IP) score: 1 = alveolar septa thickened by 1 leukocyte, 2 = 2 leukocytes thick, 3 = 3 leukocytes, 4 = 4 leukocytes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking, 100 μl of diluted serum samples were added followed by biotinylated anti-mouse IgG (Sigma-Aldrich), IgG1, IgG2a/c, IgG2b, IgG3 and IgM antibodies (all from Abcam) with horseradish peroxidase(HRP)-conjugated Streptavidin (BD Biosciences) for 1 hour (h).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2b , IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, single-cell suspensions were prepared from spleens of mice and plated in Millipore MultiScreen-HA 96-well filter plates (Millipore) pre-coated with anti-mouse IL-2, IL-4, IL-17 or IFN-γ antibodies overnight at 4°C and blocked by RPMI-1640 containing 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed and incubated with biotinylated labelled anti-mouse IL-2, IL-4, IL-17 or IFN-γ antibody at room temperature (RT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IL-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, plates were washed 5 times with 0.05% PBST, and IgG antibodies were detected using horseradish peroxidase (HRP)-conjugated goat anti-ferret polyclonal IgG detection antibody (Abcam, Cambridge, UK) at a 1:4,000 dilution for a 90 min incubation at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ferret polyclonal IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lung sections were blocked with 5% horse serum in PBS for 1 h at RT, incubated with SARS-CoV-2 Nucleoprotein polyclonal antibody at 1:500 dilution (Invitrogen, Carlsbad, CA, USA) overnight at 4°C, and then incubated with biotinylated goat-antibody Rabbit IgG H&L (Abcam, Waltham, MA, USA) at 1:1000 dilution for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant baculovirus was expanded in Sf9 cells to P3 and then used for infection of High Five cells for protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles pseudotyped with SARS-COV2 Spike envelope were produced by co-transfecting HEK 293T cells with a GFP encoding 3rd generation lentiviral plasmid HRSIN-CSGW (a gift from Camille Frecha [26]), psPAX2 and plasmid expressing codon optimized but C-terminal truncated SARS COV2 S protein (pCG1-SARS-2-S Delta18 [27], herein Spike Delta18) courtesy of Professor Stefan Polhman using polyethylenimine as described previously [25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus-serum was then added onto ACE2-HEK 293T cells seeded at 2,500 cells per well in a 384-well tissue culture plate a day before.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Determination of Virus Titres in Ferret Nasal Washes: Nasal washes were titrated in quadruplicates in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse Immunisation Protocol: Female, BALB/c and C57BL/6 (BL6) mice (6-10 weeks old) were supplied by the central animal facility of Flinders University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The insect cell codon-optimised expression cassette was cloned into pFASTBac1, and baculovirus was generated following standard Bac-to-Bac</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFASTBac1</div><div>suggested: RRID:Addgene_1956)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The hACE2 open reading frame (Addgene# 1786) was cloned into a 3rd generation lentiviral expression vector pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene# 122053), and clonal HEK 293T cells stably expressing ACE2 were generated by lentiviral transductions as described previously [25], followed by single cell sorting into 50% HEK 293T conditioned media (media conditioned from 50% confluent HEK 293T cultures)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRRLSIN.cPPT.PGK-GFP.WPRE</div><div>suggested: RRID:Addgene_12252)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles pseudotyped with SARS-COV2 Spike envelope were produced by co-transfecting HEK 293T cells with a GFP encoding 3rd generation lentiviral plasmid HRSIN-CSGW (a gift from Camille Frecha [26]), psPAX2 and plasmid expressing codon optimized but C-terminal truncated SARS COV2 S protein (pCG1-SARS-2-S Delta18 [27], herein Spike Delta18) courtesy of Professor Stefan Polhman using polyethylenimine as described previously [25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRSIN-CSGW</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCG1-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The docked model was optimized using AMBER99SB-ILDN force field in Gromacs2020 (https://www.gromacs.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.gromacs.org/</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism 8.3.1 for Windows was used for drawing graphs and statistical analysis (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of the current study was that ferrets do not exhibit weight loss or other signs of SARS-CoV-2 clinical infection [51], with no animal models fully reproducing the features of severe SARS-CoV-2 clinical infection in humans. Ongoing studies are testing our Covax-19 vaccine in other species including hamsters and non-human primates to see whether the effects of the vaccine on inhibition of nasal virus replication extends to other species. The current study also only assessed protection soon after immunisation and it will also be important to assess the durability of vaccine protection. Conclusion: The COVID-19 pandemic represents a significant evolving global health crisis. The key to overcoming the pandemic lies in the development of an effective vaccine against SARS-CoV-2 that ideally prevents transmission as well as serious disease. Recombinant protein-based approaches to COVID-19 offer benefits over other technologies including a 40-year record of safety and effectiveness including in very young infants, together with reliable large scale manufacture and high stability under typical refrigerated conditions [52]. By contrast, other available technologies, including nucleic acid and adenoviral vector platforms have a high level of reactogenicity and pose cold chain and other distribution challenges [53, 54]. This study showed that an Advax-SM adjuvanted rSp vaccine (Covax-19 vaccine) when administered as two sequential intramuscular doses several weeks apart induc...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.29.21259605: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All individuals gave their writing informed consent for the use of their serum. 2.2.<br>IACUC: The experimental protocols were approved by the Ethical Committee on Animal Experimentation of the Center for Genetic Engineering and Biotechnology (CIGB, Havana, Cuba) and the Center for Production of Laboratory Animals (CENPALAB, Bejucal, Cuba).<br>Euthanasia Agents: The immunogen content per 500 µL: 50 µg of C-RBD-H6 PP protein adjuvated with 0.3 mg of aluminum hydroxide gel (Alhydrogel ®) in phosphate buffer (0.28 mg of disodium hydrogen phosphate, 0.31 mg of sodium dihydrogen phosphate dihydrate, 4.25 mg of sodium chloride).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six- to eight-week-old female BALB/c mice, and male and female SD rats were used for the study and housed in the animal facility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Three transformants from the plate with the highest concentration of Zeocin™ were randomly picked, purified by further streaking on YPD-Zeocin™, and used to prepare small seed banks.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Culture supernatants were analyzed at 96 h post-induction by SDS-PAGE and Western blotting with an anti-His6 antibody (Promega, USA). 2.3. Fermentation: Fermentation was carried out in a 75-liters Chemap fermenter (Germany) with a working volume of 50 L of fermentation medium containing per liter of culture 8.8 mL of 85 % phosphoric acid, 6.92 g MgSO4.7H2O, 1.23 g (NH4)2SO4, 16.77 g K2HPO4, 0.46 g CaCl2.2H2O, 32.3 mL of 98% glycerol, 4.61 g yeast extract, 4 mL histidine solution, 5 mL of 400X vitamin base solution (1 g L−1 myo-inositol, 0.8 g L−1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the plates were blocked with 2 % skim milk, 0.05 % Tween 20, serially diluted mouse, rat or NHP sera or control monoclonal antibodies SS-1, SS-4, SS-7 and SS-8 (Center for Genetic Engineering and Biotechnology, Sancti Spiritus, Cuba), were added and incubated at 37 °C for 2 h in 0.2 % skim milk, 0.05 % Tween 20 in PBS, followed by six washes with PBS containing 0.05 % Tween 20</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SS-8 ( Center for Genetic Engineering and Biotechnology , Sancti Spiritus , Cuba) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected with horseradish peroxidase-conjugated goat anti-mouse IgG (SIGMA, USA), anti-Rat IgG (SIGMA, USA</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Rat IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 0.25 µg of RBD protein produced in HEK293T cells (Center for Molecular Immunology, Havana) was used to coat 96-well microtiter plates (Corning Costar, Acton, MA) in 0.1 M sodium carbonate buffer (pH 9.6) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterward, Vero E6 cell were overlaid with virus suspensions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals and immunization schedules: Three different animal species were used for evaluation of immunogenicity of the C-RBD-H6 PP protein: BALB/c mice, Sprague–Dawley (SD) rats, and African green monkeys (Chlorocebus aethiops sabaeus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague–Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six- to eight-week-old female BALB/c mice, and male and female SD rats were used for the study and housed in the animal facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of Pichia pastoris strains expressing RBD from SARS-CoV-2 (C-RBD-H6 PP): A sequence coding for residues 331-530 of the Spike protein of SARS-CoV-2 strain Wuhan-Hu-1 (NCBI Acc. No. YP_009724390) with the appropriate N- and C-terminal extensions was codon-optimized for S. cerevisiae using J-Cat [17] and cloned in-frame with the KEX2 cleavage site of the pre-pro MATα sequence of pPICZαA (Invitrogen, USA), placing it under transcriptional control of the P. pastoris AOX1 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPICZαA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface plasmon resonance experimental procedure: The interaction between mFc-ACE2 fusion protein and the recombinant C-RBD-H6 PP was monitored by SPR using a BIACORE X (GE Health-care) at 25 °C in a multi-cycle mode.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE Health-care</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The equilibrium dissociation constant (binding affinity, KD) was estimated with the BIAevaluation® software (GE Healthcare) using the Langmuir 1:1 interaction model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAevaluation®</div><div>suggested: (BIAevaluation Software, RRID:SCR_015936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Prism 8.4.3 software was used to generate dose-response curves for ELISA test and to calculate EC50 values when needed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 49 and 54. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.21259661: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">, immunosuppression, baseline alanine transferase (ALT) above five times ULN (> 250 U/L), creatinine above 2.5 mg/ml, and not currently using antiandrogen drugs, and, in case of women, not pregnant or planning to become pregnant within 90 days and nor breastfeeding.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This is a post-hoc analysis of a double-blinded, randomized, placebo-controlled, prospective, two-arm RCT22 describing the results of the RCT restricted to OT analysis, i.e., excluding patients that discontinued treatment before 14 days of drug treatment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">A detailed description of the trial design, sample size calculation, settings, recruitment, patient selection criteria, randomization, blinding, procedures and statistical analysis are published in another manuscript and detailed elsewhere.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">A detailed description of the trial design, sample size calculation, settings, recruitment, patient selection criteria, randomization, blinding, procedures and statistical analysis are published in another manuscript and detailed elsewhere.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed in Stata/SE version 16.1 for Mac (StataCorp LLC, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has limitations inherent to post-hoc and retrospective analyses, although all the major barriers that could lead to confounding biases were addressed.25 Unbalanced actives and placebo distribution across sites and minor protocol modifications were the major weaknesses of the present RCT, while the lack of any modification of the ITT analysis prevented additional biases.21 The major confounding factor in the present analysis is the causality relationship between interrupting of treatment with proxalutamide and apparent higher mortality rate. Initially, differences in the mortality rate observed between the OT and ITT analysis could be due to the fact that patients tend to discontinue treatment in case of lack of response. Since the mortality rate was substantially lower in the proxalutamide arm compared to the placebo arm, and the number of non-completers was similar between these groups, similar increases in mortality rate would represent a higher increase in terms of percentage in the group with lower mortality rate, i.e., in the active arm. However, treatment non-compliance subjects in the placebo arm was not associated to poorer response compared to completers of the placebo arm. Conversely, non-completers of the proxalutamide arm had higher mortality rate compared to completers of the same arm and to the placebo arm. This reinforces the hypothesis of potential harm caused by abrupt and early interruption of proxalutamide. Indeed, in the male outpatient trial wi...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04728802</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Proxalutamide Treatment for Hospitalized COVID-19 Patients</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.30.21258984: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In contrast, four other studies failed to detect SARS-CoV-2 RNA in mechanically-ventilated healthcare spaces despite obtaining substantially larger volumes of filtered air and placing air samplers proximal to infected patients.[43–46] We also did not detect SARS-CoV-2 in bathrooms or PPE doffing rooms, contrasting with other studies that found these to be high-risk areas, indicating that risk in these spaces may be context dependent.[47] Of the samples in which we detected SARS-CoV-2 RNA, the median copy number was less than 1 copy/L of air sampled, which is comparable to other studies where SARS-CoV-2 RNA was detected in air samples from healthcare settings.[10–14,48] Given that previous estimates have suggested an infectious dose of SARS-CoV-2 may be in the range of 100-300 virions,[49,50] this could indicate the risk from aerosol transmission may be substantial, especially given that cumulative exposure may be more important for establishing infection than exposure at a single time point.[51] However, it is difficult to translate results of air sample collection to exposure to infectious quanta given limitations of the sample collection process. A unique aspect of this study is an investigation of which parameters of ventilation have the greatest impact on air exchange in naturally-ventilated settings and subsequently how risk was modified by these factors. Ceiling height was found to be the most influential parameter in the elasticity analysis, which has been previously d...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.23.21259402: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Trial Oversight: The design was approved by the institutional review board of the Massachusetts Institute of Technology (MIT) with Massachusetts General Hospital (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial Design, Eligibility, Randomization and Recruitment: Eligibility for the trial and randomization strategy were determined by data availability and power considerations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">We determined that a sample of 820 counties would provide 80% power to detect effect sizes of 0.2 standard deviations for county-level outcomes, comparing intervention (H) vs. control (L).</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations of the study. First, it is was conducted with Facebook subscribers and mobility is collected for Facebook users. Although Facebook has a remarkable reach, this remains just one type of media. Second, it was an ad campaign. The messages might have been more effective if they had been relayed by celebrities or locally known figures (12,13). Third, we tested one kind of message, recorded by clinicians on smartphones. The results could be different changing message content, identity of the messenger, length of message, production value of the videos, or name recognition of the originating organization. Despite these limitations, the findings provide evidence that clinicians can be an effective channel to communicate life-saving information at scale, through social media. This a new role that physicians and nurses embraced during the COVID-19 crisis, and we demonstrate that this is another way in which they can prevent illness and save lives. These findings also demonstrate, in a clustered randomized control trial, the impact of a travel reduction, a key non-clinical intervention whose impact had not been evaluated in a randomized controlled trial before. The findings suggest directions for future work. In particular, would similar messages be effective in encouraging COVID-19 vaccine uptake?

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04644328</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Doctors for Coronavirus Prevention Project Thanksgiving …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.26.21259239: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: COVIDsortium Healthcare Worker Participants: The COVIDsortium bioresource was approved by the ethical committee of UK National Research Ethics Service (20/SC/0149) and registered on ClinicalTrials.gov (NCT04318314).<br>Consent: All subjects gave written informed consent and the study conformed to the principles of the Helsinki Declaration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Other experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Other experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Power calculations were performed prior to week 16 sub-study sampling to determine the sample size needed to test the hypothesis that HCW with pre-existing T cell responses are enriched in exposed uninfected group at a range of incidence of infection, assuming 50% of cohort had pre-existing T cell responses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Spike ELISA: Seropositivity against SARS-CoV-2 spike was determined for medical student and laboratory staff cohort between July 2020 and Jan 2021 (Extended Data Table 4) by enzyme-linked immunosorbent assay, as validated and described previously50,60,61.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lab confirmed infection was determined by weekly nasopharyngeal RNA stabilizing swabs and reverse transcriptase polymerase chain reaction (RT-PCR; Roche cobas SARS-CoV-2 test, Envelope [E] gene) and antibody assay positivity (Spike protein 1 IgG Ab assay, EUROIMMUN) and anti-nucleocapsid total antibody assay (ROCHE) described in detail below.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike protein 1 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-nucleocapsid total</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot plates were developed with human biotinylated IFN-γ detection antibody (7-B6-1, Mabtech; 1μg/ml) for hr at RT, followed by incubation with goat anti-biotin alkaline phosphatase (Vector Laboratories; 1:1000) for 2 hr RT, both diluted in PBS with 0.5% BSA by volume (Sigma-Aldrich), and finally with 50 μl/well of sterile filtered BCIP/NBT Phosphatase Substrate (ThermoFisher) for 7 min RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-biotin alkaline phosphatase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed in PBS and incubated in perm buffer (TF staining buffer kit, diluted 1:10 in ddH2O) for 20 mins RT, washed in PBS and resuspended in perm buffer with saturating concentrations of anti-human antibodies for intracellular staining: IL-2 PerCp-eFluor710 (Invitrogen, clone MQ1-17H12)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CTV dilution and staining with anti-human-IFNγ antibodies was used to identify antigen-specific T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IFNγ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4 × 104 Huh7 cells suspended in 100 μl complete media were added per well and incubated for 72 hr at 37 °C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After initial incubation, pre-seeded Vero E6 cells were infected with the serum-virus samples and incubated (37 °C and 5% CO2) for 72 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVIDsortium Healthcare Worker Participants: The COVIDsortium bioresource was approved by the ethical committee of UK National Research Ethics Service (20/SC/0149) and registered on ClinicalTrials.gov (NCT04318314).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVIDsortium Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curves of relative infection rates (in %) versus the serum dilutions (log10 values) against a negative control of pooled sera collected prior to 2016 (Sigma) and a positive neutraliser were plotted using Prism 9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ODs were measured using a MultiskanFC (Thermofisher Scientific) plate reader at 405 nm and S1-specific IgG titers interpolated from the IgG standard curve using 4PL regression curve-fitting on GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Brilliant Violet Buffer (BD Biosciences): CD3 Bv510 (Biolegend, clone OKT3)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed by FlowJo version 10.7 (TreeStar)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A protein BLAST search of each 15mer peptide was then performed against a custom sequence database comprising 2531 Coronaviridae sequences40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned using the MUSCLE algorithm with default parameters and percentage identity was calculated in Geneious Prime 2020.1.2 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(https://www.geneious.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.geneious.com</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment figures were made in Snapgene 5.1 (GSL Biotech). qPCR: Total RNA from Tempus blood was extracted using the Tempus Spin RNA isolation kit (Applied Biosystems, 4380204). cDNA was obtained using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Snapgene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04318314</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19: Healthcare Worker Bioresource: Immune Protection a…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.30.450483: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: For infection, mice (both sexes) were anesthetized by i.p. injection of ketamine (100 mg/kg) and xylazine (10 mg/kg) and then intranasally infected with 50 μl of DMEM containing (or not, in a mock sample) 5×102 TCID50 of hCoV-19_IPL_France strain of SARS-CoV-2 (NCBI MW575140).<br>IRB: The experimental protocols using animals were approved by the institutional ethical committee “Comité d’Ethique<br>Field Sample Permit: The animal study was authorized by the “Education, Research and Innovation Ministry” under registration number APAFIS#25517-2020052608325772v3.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pharmacokinetic study: Clofoctol diluted in 1.75% final Kolliphor® RH40 (07076, Sigma) and 1.4% final ethanol in a sodium chloride solution (0.9%) was used for intraperitoneal (i.p.) injection (62.5 mg/kg in females and 50 mg/kg in male).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Compounds were spotted in a randomized order on the plates during the primary screen.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Investigators were blinded to allocation during the primary screen and the corresponding validation, during both assay performance and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data reporting: No statistical methods were used to predetermine sample size.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Dose response curves, EC50 calculations and hit validations: The selected hits were further validated in a 6-point dose-response confirmation assay for EC50 determination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were detected by using an anti-dsRNA (J2 monoclonal antibody, Scicons) diluted in blocking buffer to detect the presence of replicating SARS-CoV-2 virus as previously determined29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA ( J2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 30-min incubation, cells were rinsed 3 times for 5 min in PBS and incubated for 30 min with a cyanine 3-conjugated goat anti-mouse secondary antibody (Jackson Immunoresearch) and DAPI (4’,6-diamidino-2-phenylindole).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CCL-81), Vero-E6 cells (ATCC, CRL-1586), Huh-7 cells27 and HEK293T/17 cells (ATCC, CRL-11268) were grown at 37°C with 5% CO2 in Dulbecco’s modified eagle medium (DMEM, Gibco) supplemented with 10 % heat-inactivated fetal bovine serum (FBS, Eurobio)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day prior to infection, Vero-81 cells were seeded in 384-well plates, as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral secretion: Vero-81 and Vero-81-TMPRSS2 cells were infected at a MOI of 0.25 for 1h, then the cells were rinsed 3 times with PBS and further incubated in the presence of increasing concentrations of clofoctol for 16h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-81-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were co-transfected with a plasmid encoding Gag-Pol (pTG-Gag-Pol), a plasmid encoding the envelope glycoprotein and a plasmid containing a minigenome with a Firefly luciferase reporter gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48h of incubation, cell supernatants were collected, filtered and used to transduce Huh-7 cells expressing human ACE2 in the presence of increasing concentrations of clofoctol or CQ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viability assay: Vero cells, Huh-7 cells or Calu-3 cells were plated in 96-well plates and were then incubated the next day in 100 μl of culture medium containing increasing concentrations of clofoctol for 24h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Experimental infection of K18-hACE2 transgenic mice: Eight week-old K18-human ACE2 expressing C57BL/6 mice (B6.Cg-Tg(K18-hACE2)2Prlmn/J) were purchased from the Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-hACE2)2Prlmn/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral vectors expressing TMPRSS2 were produced by transfection of HEK293T cells with pTRIP-TMPRSS2, phCMV-VSVG and HIV gag-pol in the presence of Turbofect (Life Technologies) according to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTRIP-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection was carried out by chemoluminescence (Pierce) and signals were quantified by using the gel quantification function of ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the effect of the drug on translation: A plasmid containing a synthetic gene encompassing the 5’-UTR (nucleotides 1-265) and the 3’UTR (nucleotides 29675-29903) of SARS-CoV-2 isolate Wuhan-Hu-1 (Genebank NC_045512.2) separated by two head-to-tail BbsI sites was produced by GeneCust.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneCust</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific primers were designed using Primer Express software (Applied Biosystems, Villebon-sur-Yvette, France) and ordered to Eurofins Scientifics (Ebersberg, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer Express</div><div>suggested: (Primer Express, RRID:SCR_014326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed using GraphPad Prism v6 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.21259576: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the University of Pittsburgh Institutional Review Board (Study ID: 21030056/HCC 21-032).<br>Field Sample Permit: Data Collection and Outcomes: Study data were collected by the project coordinators and managed using the Research Electronic Data Capture (REDCap) hosted at the University of Pittsburgh.10 REDCap is a secure, web-based software platform designed to support data capture for research studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody assays: Serum underwent antibody testing using the Beckman Coulter SARS-CoV-2 platform (Spike (S) receptor-binding domain (RBD) IgG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike (S) receptor-binding domain (RBD) IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus (PSV) was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S (Wuhan-1 sequence containing D614G substitution) with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays, 104 293T-hACE2 cells were plated in 100 microliters (μL) media per well in 96 well white-wall white-bottom plates (Perkin Elmer) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus (PSV) was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S (Wuhan-1 sequence containing D614G substitution) with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFC37K-CMV-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-mCherry-luciferase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL.luc.R-E-plasmid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3 mCherry luciferase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Collection and Outcomes: Study data were collected by the project coordinators and managed using the Research Electronic Data Capture (REDCap) hosted at the University of Pittsburgh.10 REDCap is a secure, web-based software platform designed to support data capture for research studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study include lack of longitudinal sampling and assessment of cellular immunity. Nonetheless, our data call for the need for funding to better understand immune responses to COVID-19 vaccines in immunosuppressed patients. Future studies should focus on correlating immune responses with clinical efficacy of COVID-19 vaccines and measurement of other correlates of immunity such as T-cell and memory B-cell responses, particularly in seronegative patients. There is a critical need to develop studies of revaccination, and for countries providing revaccination to publish their data. There is also a critical need to design trials of passive immunity using monoclonal antibodies or direct-acting antivirals for the prevention of COVID-19 in immunocompromised patients. Finally, results such as ours should not be used to fuel vaccine hesitancy, but rather to encourage vaccination and emphasize the need for ongoing vigilance until additional interventions are available.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04885907</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Third Dose of Moderna COVID-19 Vaccine in Transplant Recipie…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Peer Reviewed and recommended by Peer Community in Evolutionary Biology

      Recommendation<br> Separating adaptation from drift: A cautionary tale from a self-fertilizing plant<br> by Christoph Haag based on reviews by Jon Agren, Pierre Olivier Cheptou and Stefan Laurent.

      In recent years many studies have documented shifts in phenology in response to climate change, be it in arrival times in migrating birds, budset in trees, adult emergence in butterflies, or flowering time in annual plants (Coen et al. 2018; Piao et al. 2019). While these changes are, in part, explained by phenotypic plasticity, more and more studies find that they involve also genetic changes, that is, they involve evolutionary change (e.g., Metz et al. 2020). Yet, evolutionary change may occur through genetic drift as well as selection. Therefore, in order to demonstrate adaptive evolutionary change in response to climate change, drift has to be excluded as an alternative explanation (Hansen et al. 2012). A new study by Gay et al. (2021) shows just how difficult this can be.

      The authors investigated a recent evolutionary shift in flowering time by in a population an annual plant that reproduces predominantly by self-fertilization. The population has recently been subjected to increased temperatures and reduced rainfalls both of which are believed to select for earlier flowering times. They used a “resurrection” approach (Orsini et al. 2013; Weider et al. 2018): Genotypes from the past (resurrected from seeds) were compared alongside more recent genotypes (from more recently collected seeds) under identical conditions in the greenhouse. Using an experimental design that replicated genotypes, eliminated maternal effects, and controlled for microenvironmental variation, they found said genetic change in flowering times: Genotypes obtained from recently collected seeds flowered significantly (about 2 days) earlier than those obtained 22 generations before. However, neutral markers (microsatellites) also showed strong changes in allele frequencies across the 22 generations, suggesting that effective population size, Ne, was low (i.e., genetic drift was strong), which is typical for highly self-fertilizing populations. In addition, several multilocus genotypes were present at high frequencies and persisted over the 22 generations, almost as in clonal populations (e.g., Schaffner et al. 2019). The challenge was thus to evaluate whether the observed evolutionary change was the result of an adaptive response to selection or may be explained by drift alone.

      Here, Gay et al. (2021) took a particularly careful and thorough approach. First, they carried out a selection gradient analysis, finding that earlier-flowering plants produced more seeds than later-flowering plants. This suggests that, under greenhouse conditions, there was indeed selection for earlier flowering times. Second, investigating other populations from the same region (all populations are located on the Mediterranean island of Corsica, France), they found that a concurrent shift to earlier flowering times occurred also in these populations. Under the hypothesis that the populations can be regarded as independent replicates of the evolutionary process, the observation of concurrent shifts rules out genetic drift (under drift, the direction of change is expected to be random).

      The study may well have stopped here, concluding that there is good evidence for an adaptive response to selection for earlier flowering times in these self-fertilizing plants, at least under the hypothesis that selection gradients estimated in the greenhouse are relevant to field conditions. However, the authors went one step further. They used the change in the frequencies of the multilocus genotypes across the 22 generations as an estimate of realized fitness in the field and compared them to the phenotypic assays from the greenhouse. The results showed a tendency for high-fitness genotypes (positive frequency changes) to flower earlier and to produce more seeds than low-fitness genotypes. However, a simulation model showed that the observed correlations could be explained by drift alone, as long as Ne is lower than ca. 150 individuals. The findings were thus consistent with an adaptive evolutionary change in response to selection, but drift could only be excluded as the sole explanation if the effective population size was large enough.

      The study did provide two estimates of Ne (19 and 136 individuals, based on individual microsatellite loci or multilocus genotypes, respectively), but both are problematic. First, frequency changes over time may be influenced by the presence of a seed bank or by immigration from a genetically dissimilar population, which may lead to an underestimation of Ne (Wang and Whitlock 2003). Indeed, the low effective size inferred from the allele frequency changes at microsatellite loci appears to be inconsistent with levels of genetic diversity found in the population. Moreover, high self-fertilization reduces effective recombination and therefore leads to non-independence among loci. This lowers the precision of the Ne estimates (due to a higher sampling variance) and may also violate the assumption of neutrality due to the possibility of selection (e.g., due to inbreeding depression) at linked loci, which may be anywhere in the genome in case of high degrees of self-fertilization.

      There is thus no definite answer to the question of whether or not the observed changes in flowering time in this population were driven by selection. The study sets high standards for other, similar ones, in terms of thoroughness of the analyses and care in interpreting the findings. It also serves as a very instructive reminder to carefully check the assumptions when estimating neutral expectations, especially when working on species with complicated demographies or non-standard life cycles. Indeed the issues encountered here, in particular the difficulty of establishing neutral expectations in species with low effective recombination, may apply to many other species, including partially or fully asexual ones (Hartfield 2016). Furthermore, they may not be limited to estimating Ne but may also apply, for instance, to the establishment of neutral baselines for outlier analyses in genome scans (see e.g, Orsini et al. 2012).

      References

      Cohen JM, Lajeunesse MJ, Rohr JR (2018) A global synthesis of animal phenological responses to climate change. Nature Climate Change, 8, 224–228. https://doi.org/10.1038/s41558-018-0067-3

      Gay L, Dhinaut J, Jullien M, Vitalis R, Navascués M, Ranwez V, Ronfort J (2021) Evolution of flowering time in a selfing annual plant: Roles of adaptation and genetic drift. bioRxiv, 2020.08.21.261230, ver. 4 recommended and peer-reviewed by Peer Community in Evolutionary Biology. https://doi.org/10.1101/2020.08.21.261230

      Hansen MM, Olivieri I, Waller DM, Nielsen EE (2012) Monitoring adaptive genetic responses to environmental change. Molecular Ecology, 21, 1311–1329. https://doi.org/10.1111/j.1365-294X.2011.05463.xISTEX

      Hartfield M (2016) Evolutionary genetic consequences of facultative sex and outcrossing. Journal of Evolutionary Biology, 29, 5–22. https://doi.org/10.1111/jeb.12770

      Metz J, Lampei C, Bäumler L, Bocherens H, Dittberner H, Henneberg L, Meaux J de, Tielbörger K (2020) Rapid adaptive evolution to drought in a subset of plant traits in a large-scale climate change experiment. Ecology Letters, 23, 1643–1653. https://doi.org/10.1111/ele.13596

      Orsini L, Schwenk K, De Meester L, Colbourne JK, Pfrender ME, Weider LJ (2013) The evolutionary time machine: using dormant propagules to forecast how populations can adapt to changing environments. Trends in Ecology & Evolution, 28, 274–282. https://doi.org/10.1016/j.tree.2013.01.009

      Orsini L, Spanier KI, Meester LD (2012) Genomic signature of natural and anthropogenic stress in wild populations of the waterflea Daphnia magna: validation in space, time and experimental evolution. Molecular Ecology, 21, 2160–2175. https://doi.org/10.1111/j.1365-294X.2011.05429.xISTEX

      Piao S, Liu Q, Chen A, Janssens IA, Fu Y, Dai J, Liu L, Lian X, Shen M, Zhu X (2019) Plant phenology and global climate change: Current progresses and challenges. Global Change Biology, 25, 1922–1940. https://doi.org/10.1111/gcb.14619

      Schaffner LR, Govaert L, De Meester L, Ellner SP, Fairchild E, Miner BE, Rudstam LG, Spaak P, Hairston NG (2019) Consumer-resource dynamics is an eco-evolutionary process in a natural plankton community. Nature Ecology & Evolution, 3, 1351–1358. https://doi.org/10.1038/s41559-019-0960-9

      Wang J, Whitlock MC (2003) Estimating Effective Population Size and Migration Rates From Genetic Samples Over Space and Time. Genetics, 163, 429–446. PMID: 12586728

      Weider LJ, Jeyasingh PD, Frisch D (2018) Evolutionary aspects of resurrection ecology: Progress, scope, and applications—An overview. Evolutionary Applications, 11, 3–10. https://doi.org/10.1111/eva.12563

      Reviews.

      Revision round #2.<br> 2021-04-19.<br> Author's Reply.<br> Download author's reply (PDF file) Download tracked changes file.

      Dear Dr Haag,

      Thanks for handling the review of our manuscript. We agree that the comments of Jon Agren have further improved the quality of this manuscript and we tried to answer to all of them (see the point-by-point reply below). We provide a track-changes version where the changes in the main text and supplementary files are highlighted in bold. The new version is also available online on Biorxiv : https://www.biorxiv.org/content/10.1101/2020.08.21.261230v3.

      We hope that you will find this updated version of our manuscript suitable for recommendation by PCIEvolBiol and would be happy to take any further comments if you judge it would improve the manuscript.

      Laurène Gay, on behalf of all the coauthors

      Decision round #2.

      Dear Dr Gay,

      Your revised preprint "Evolution of flowering time in a selfing annual plant: Roles of adaptation and genetic drift" has now been reconsidered by two of the original reviewers. As you will see, while one of them is satisfied with the new version, the other is positive but recommends an additional round of minor revision. From my own reading, I agree that the suggestions by the reviewer will likely further strengthen the manuscript. Therefore, before reaching a final decision, I would like to ask you to consider these suggestions, and to revise the manuscript accordingly. When you submit the revised version, please include a letter in which you describe how you have responded to each of the referees comments.

      Best wishes, and many thanks for submitting to PCI Evol Biol,

      Christoph Haag

      Preprint DOI: https://www.biorxiv.org/content/10.1101/2020.08.21.261230v2

      Reviewed by Jon Agren, 2021-04-16 11:54.<br> I think the presentation has benefitted from the revisions made by the authors. Below is a list of comments on details regarding terminology and presentation that the authors may want to consider.

      p. 1, Abstract first sentence. Resurrection experiments can detect correlations between trait modifications and changes in the environment, but this is not really a test of a causation, is it? Or is the argument here that simultaneous parallel changes in many populations indicate a change in the environment acting over a large area? This could be indicated with a slight rewording.

      p. 1, Abstract first sentence. Change “traits modifications” to “trait modifications”.

      p. 2, first paragraph. Not fully clear what the important difference is between experimental and natural populations. In both cases, an estimate of effective population size is required.

      p. 2, right column, line 3. What does “>0.5” refer to? A broad-sense heritability estimate?

      p. 2, right column, line 27. Insert “selfing” after “predominantly”.

      p. 2, right column, line 36, “across 22 generations”. Does this species have any seed bank that may affect “effective generation time”?

      p. 2, right column, line 47, “taking into account the multilocus genotypic composition…”. Unclear how this should be understood. Reword?

      p. 2, right column, line 50, “for neutrality”. I suggest the authors indicate how this is achieved. – By using estimates of genotypic values for flowering time and assuming flowering time is a neutral trait?

      p. 3, first paragraph. I still find the procedure for building “families of full sibs” unclear: I suggest the authors state explicitly whether the families multiplied in 2011 each originated from a different pod collected in the field, or whether the families originated from seeds that had been randomly selected from pooled samples of seeds from 1987 and 2009, respectively.

      p. 3, right column, paragraph “Temporal changes in sensitivity to vernalization”, “measured as the slope…” This needs some more explanation. Are differences calculated between all possible pairs of plants in the two treatments?

      p. 4, third paragraph, “good approximation of the additive genetic covariance”. What about maternal environmental and genetic effects?

      p. 4, right column, first paragraph. State explicitly that the individuals analysed represented 145 different families?

      p. 5, second paragraph, “As a preliminary step,…”. To me the argument would make more sense in the reverse order, as the changes in flowering time and MLG frequency between 1987 and 2009 are the most direct estimates of evolutionary change. In other words, starting from the observation of the changes in flowering time and MLG frequency, one can examine the strength of the association between flowering time and MLG in the greenhouse, and whether the change is consistent with selection observed in the greenhouse. I see no a priori reason why selection on flowering time in the greenhouse should mirror that at the site of the focal population. To make this order of logic clear, the authors may want to move the description of the selection gradient analyses to after this argument has been formulated.

      p. 5, second paragraph, “whether selection in quantified in the greenhouse is likely to mirror selection in the field at present and 22 years ago”. To be strict , it would only need to mirror the predominant selection between 1987 to 2009 to be correlated with the change observed, right? Current selection in the field should matter little?

      p. 5, second paragraph, “We then measured…”. I like this approach! The authors should indicate which measure of flowering time was used in this analysis. The legend of Fig. 3 speaks about “average flowering time”. The sensitivity to vernalization treatment varied among genotypes. Are the results of this analysis essentially the same if the analysis is conducted separately for treatment 1 or 2, or separately for estimates of flowering time obtained based on the seed sample from 1987 and from 2009, respectively?

      p. 6, first paragraph; Table 3. Since a single line was sampled in each population, it is a bit misleading to call the examined effect a “population effect”. Change to “line effect”?

      p. 7, first paragraph, “predict an evolution of towards earlier flowering”. Since estimates of selection and heritabilities are specific to a given environment, this prediction is valid for the greenhouse and not necessarily for other environments.

      p. 7. Was there an effect of year of sampling on estimates of flowering time for MLGs sampled in both 1987 and 2009?

      p. 7, right column, second paragraph, “were persistent through time”. Change to “were observed in both years” to make the fact that altogether 5 lines were observed in both the 1987 and 2009 sampling more obvious?

      p. 7, right column, second paragraph, “Fig. 3A, regression only significant…”. Add sample size (i.e., number of family means included in this regression).

      p. 11, second paragraph, “Munguia-Rosas et al.”. Note that selection estimates considered in this meta-analysis largely ignores the effect of variation in number of flowers and plant size, suggesting that many of them rather reflect a correlation between plant condition and fitness.

      Finally, I suggest the authors somewhere add a caveat regarding possible G x E interactions for flowering time (greenhouse vs. field), when discussing the possible association between flowering time as expressed in the greenhouse and fitness and evolutionary change in the field.

      Reviewed by Stefan Laurent, 2021-03-20 17:00.

      I am satisfied with the answers to my comments and with the modifications to the main text. The qqplots should be added to the supplementary figures linked to main figure 3.

      Revision round #1.<br> 2020-10-26.

      Author's Reply.<br> Download author's reply (PDF file).<br> Download tracked changes file.

      Dear Dr Haag, Please find enclosed a revised version of our manuscript. We are very grateful to you and the reviewers for the comments and suggestions that have improved the manuscript substantially. We tried to answer to all of them (see the point-by-point reply below). We provide a track-changes version with line numbers, where the changes in the main text and supplementary files are highlighted in bold. We also added a revised version that you can find after the track-changes (starting page 19). We hope that you will find this updated version of our manuscript suitable for recommendation by PCIEvolBiol and would be happy to take any further comments if you judge it would improve the manuscript.<br> Laurène Gay, on behalf of all the coauthors.

      Decision round #1.<br> Dear Dr Gay, Thank you for submitting your preprint "Evolution of flowering time in a selfing annual plant: Roles of adaptation and genetic drift" to PCI Evol Biol. Your work has now been considered by three reviewers, whose comments are enclosed. As you will see, the reviews are largely positive, and, based on these reviews as well as my own reading, I am happy to further consider your preprint for recommendation. However, before reaching a final decision, I would like you to revise your manuscript according to the recommendations by the reviewers. Besides the more minor points (which also should be considered carefully), I think there are two main issues that need particular attention:

      • First, the introduction (and perhaps also some other sections) would profit from some streamlining. In my opinion, this does not mean that you should entirely drop the discussion of the effects of selfing on the efficacy of selection. But this section should be reduced in length and care should be taken to clearly state the objective of the study early on without raising issues (e.g., comparison between selfers and outcrossers) that are not subsequently addressed. Incidentally, from my own reading, I also think that the last part of page 1 (where you give some more detail on the different possible approaches to investigate the influence of selection on phenotypic change) would profit from some reformulation: I found this part difficult to follow and its purpose is not entirely clear to me: Do you want to provide details on some of the approaches or do you want to explain why you used only some bot not others in your study? Moreover, the statement that natural populations cannot be replicated may also need to be nuanced (replication might in principle be possible across different populations or using independent samples from the same population).
      • Second, the analysis of the frequency changes of the multilocus genotypes needs some clarification, both in terms of potential effects of excluding rare genotypes and in terms of confidence intervals given (likely) non-normal distribution of residuals. If you submit a revised version, please include a letter in which you describe how you have responded to each of the referees’ comments. Best withes, and apologies again for the delayed decision, Christoph Haag

      Additional requirements of the managing board:<br> As indicated in the 'How does it work?’ section and in the code of conduct, please make sure that: -Data are available to readers, either in the text or through an open data repository such as Zenodo (free), Dryad or some other institutional repository. Data must be reusable, thus metadata or accompanying text must carefully describe the data. -Details on quantitative analyses (e.g., data treatment and statistical scripts in R, bioinformatic pipeline scripts, etc.) and details concerning simulations (scripts, codes) are available to readers in the text, as appendices, or through an open data repository, such as Zenodo, Dryad or some other institutional repository. The scripts or codes must be carefully described so that they can be reused. -Details on experimental procedures are available to readers in the text or as appendices. -Authors have no financial conflict of interest relating to the article. The article must contain a "Conflict of interest disclosure" paragraph before the reference section containing this sentence: "The authors of this preprint declare that they have no financial conflict of interest with the content of this article." If appropriate, this disclosure may be completed by a sentence indicating that some of the authors are PCI recommenders: “XXX is one of the PCI XXX recommenders.”

      Preprint DOI: 10.1101/2020.08.21.261230

      Reviewed by Pierre Olivier Cheptou, 2020-10-20 11:18.<br> The study by Gay et al. reports empirical data on the evolution of flowering time in a highly selfing species: Medicago truncatula. The authors used several approach to investigate the question. In particular, they used a resurrection approach with seeds from 1987 and 2009. The aim of the study is to disentangle the role of drift and selection in the shift observed as well as estimating selection gradient of flowering time. The study is interesting and the different experiments (pop centered, regional) is consistent with a shift in flowering time. Below, my comments:

      1-The introduction discuss the question of adaptation face to environmental change. While the text is rich and well referenced, I found that the introduction is a bit long. There is a long discussion on whether outcrossing/selfing traits influences adaptation. The logical consequence would be to compare outcrossing/selfing populations. Since the study does not compare outcrossing and selfing populations, I think this part should be greatly reduced. Also, the statement that bottlenecks are more frequent in selfers (if true !!) would be more striking if the references were reporting empirical data. To my knowledge, Schoen and Brown (1991) and Ingvargsson 2002 hypothesize that it is the case but did not demonstrated that selfers suffer from higher bottlenecks. In the following paragraph, I found confusing to assert that “self-fertilization mays have facilitated adaptations to agricultural practices” when discussing the role of mating system on adaptation. Is it because the traits were preadapted or because the genetic architecture of selfers facilitates adaptation? In short, the introduction should be more focused to introduce the question short term adaptation of flowering time in the face of warming.

      2-Sum of temperature. The individual flowering time is converted in sum of temperature. The basal temperature is assumed to be 5°C, based on Moreau et al (2007). Would it be possible that Tb has evolved during the two decades? Would the conclusions be different if flowering time were measured as the number of days? At least, the possibility of a shift in Tb should be discussed as I found contradictory to evaluate adaptation to warming but keeping Tb constant.

      3-Maternal effects. If I understood well, the results on the studied populations are corrected for maternal effects (one generation to refresh seeds stock) but the results of regional analysis are based on the F1 generation (without correcting for maternal effects). I was interested by the amplitude of the shift: two days in the cape Corsica populations but five days in the regional analysis. This may be a “true result” or an effect of correcting for maternal effects. Did the authors measure the flowering date in the F1 of the cape Corsica populations. I would suggest to mention this result in the discussion. Is it possible that the difference in flowering date reported have changed in Cape Corsica population because of the F1 generation in greenhouse? My feeling is that these results are, as such, interesting. We often see this pattern of a lower amplitude after one generation. If it was only noise, the first generation should exhibit either lower or higher difference than the F2. Epigenetic components of flowering could have played a role in adaptation to warming and these effect cannot be distinguished from true quantitative genetic effects if parts of these effects last more than one generation. Do the same MLG (from 1987 and 2009) have the same fitness? Because the authors have the chance to have the same MLG, it would be interesting to look at this relationship to investigate maternal effects.

      4-Genetic analysis. If I understood well, the test for selection versus drift is based only on conserved multilocus genotypes, i.e. a fraction of the population. Why doing this choice? Why not using a Qst/Fst approach that would take into account all the individuals? (the design allows to estimate Qst, doesn’t it?). In addition, I see a potential bias because it assumes that the population behaves as a fully selfing populations, which is not the case. While the authors point the potential differential selective response of outcrossers versus selfers, the results reported are based only on the full selfing fraction of the population, which I found contradictory.

      Overall, I found the ms interesting and such long term dataset is rare. However, the ms would benefit from being more focused (particularly the introduction) in order to highlight the results and their biological interpretation.

      Reviewed by Jon Agren, 2020-10-19 15:12.<br> This study uses a resurrection experiment and simulations to explore the possible causes of changes in flowering time and genetic composition of a Medicago truncatula population across 22 generations. In the resurrection experiment, plants grown from seeds collected 22 years apart were raised in the greenhouse to produce selfed lines. These lines were then used to document possible changes in flowering time and to quantify selection on flowering time in the greenhouse. Changes in genetic composition were characterized by scoring 20 microsatellite loci (16 kept after filtering) and documenting changes in the frequencies of multilocus genotypes. The paper is well written and addresses interesting problems of wide general interest. However, I think the authors need to (a) motivate their approach to use estimates of selection obtained in the greenhouse to infer selection in the field, (b) provide more detail on the distribution of multi-locus genotypes and the power of their analysis of change in genetic composition, and (c) clarify a few details when it comes to sampling procedure (see below).

      Main comments:

      The authors appear to assume that selection quantified in the greenhouse is likely to mirror selection in the field at present and 22 years ago. This needs to be motivated.

      I suggest the authors provide more detail on the distribution multilocus genotype (MLG) frequencies, and that this information is given already at the start of the third paragraph on p. 7. They report that 60 different MLGs were detected in their sample of 145 individuals. Two MLGs were common, and 12 MLGs were shared between the two sampling years. This suggests that most MLGs were rare and perhaps only represented by a single plant? The authors may want to discuss whether their sample sizes are sufficient to characterize changes in genetic composition of a population with such skewed distributions of MLGs.

      I suggest the authors clarify a few details regarding sampling:

      (a) For the resurrection experiment, “100 seeds per sampling were replicated” (p. 3, second paragraph). Were these seeds from 100 different pods and thus sampled from 100 plants, or were they a random sample of 100 seeds from a pooled seed sample from each year?

      (b) For the genetic analysis, leaves were sampled from “the multiplication generation in the greenhouse” (p. 4, fifth paragraph), and after filtering 145 individuals remained in the data set to be analysed. Please, state explicitly that the “multiplication generation” refers to the plants derived from the 200 field-collected seeds (presumably representing seeds from 200 plants(?); see previous comment). Were seeds from the two sampling occasions equally represented among the 145 individuals included in the analysis?

      Minor corrections:

      Abstract, line 11 from bottom. Change “population” to “populations”

      p. 7, first paragraph, second line from bottom, “in both years”. From this wording, you easily get the impression that selection was quantified in two years. I suggest you add a few words to indicate that this rather refers to a similar negative relationship being observed among lines derived from each of the two years.

      To make text in graphs readable, font size should be increased in Figures (in particular in Figs. 3-5).

      Reviewed by Stefan Laurent, 2020-10-16 11:05.<br> In this study, the authors test whether flowering time evolved in an experimental population of Medicago truncatula and whether this change could represent an adaptation to varying environmental conditions. For this, they measure changes in flowering time in a natural population over 22 generations (2 timepoints), they quantify the association between flowering time and fitness (as approximated by the number of seeds produced), they track changes in haplotype frequencies characterized by different approximated fitness values, and finally they also measure changes in flowering time in 17 populations from the same geographical region that have been sampled twice over a comparable time range.

      The authors report a significant reduction in flowering in the main population and in the regional analysis that appears to be consistent with the specific effects of climate change in the Mediterranean region (i.e. limiting summer drought occurs earlier in the year). They also report a significant association between flowering time and seed production. However, the evidence for the effect of positive selection obtained by analyzing the changes in haplotypes is at best marginal; even if the authors do a good job in describing some of the uncertainty associated with this analysis, I think that one more aspect should be exposed.

      Besides my major comment, I find the manuscript clearly written, the analyses carefully conducted and presented, and the intro and discussion very well written and informative, at least for the non-expert.

      Major comment

      My only major criticism refers to the results presented in Figure 3. The selection gradients measured here seem to be heavily influenced by two outlier points with low seed production and early flowering. As a result, the linear models (especially the one for MLG found in 1987) appear to be a poor fit to the data, as can probably be seen by inspecting the residuals, which are unlikely to be normally distributed. I think that the authors should report the uncertainty around the slopes and that this uncertainty should be further considered in the analyses presented in figure 4, which will likely cause the observed selection gradient to be non-significant under a larger range of Ne values. I am not sure about the best way to obtain confidence intervals for the selection gradients but I imagine that a bootstrap approach should be applicable.

      Minor

      I agree with the authors that the N_e value estimated from the temporal Fst is very likely underestimated. Comparing the expect heterozygosity under Ne=19 with the observed He would further support the idea that larger Ne values are indeed realistic. How does the observed heterozygosity in the population compares to the theoretical expectations given by Nordborg and Donnelly (1997)? Rescaling the census number (>2000) by 1/(1+F) would lead to a less conservative Ne value for the test for selection and may allow a putative selection signal to be detected even after considering the uncertainty around the observed selection gradient.

    1. Collier, D. A., Ferreira, I. A. T. M., Kotagiri, P., Datir, R., Lim, E., Touizer, E., Meng, B., Abdullahi, A., Elmer, A., Kingston, N., Graves, B., Gresley, E. L., Caputo, D., Bergamaschi, L., Smith, K. G. C., Bradley, J. R., Ceron-Gutierrez, L., Cortes-Acevedo, P., Barcenas-Morales, G., … Gupta, R. K. (2021). Age-related immune response heterogeneity to SARS-CoV-2 vaccine BNT162b2. Nature, 1–9. https://doi.org/10.1038/s41586-021-03739-1

    1. Lemey, P., Ruktanonchai, N., Hong, S. L., Colizza, V., Poletto, C., Van den Broeck, F., Gill, M. S., Ji, X., Levasseur, A., Oude Munnink, B. B., Koopmans, M., Sadilek, A., Lai, S., Tatem, A. J., Baele, G., Suchard, M. A., & Dellicour, S. (2021). Untangling introductions and persistence in COVID-19 resurgence in Europe. Nature, 1–8. https://doi.org/10.1038/s41586-021-03754-2

    1. SciScore for 10.1101/2021.06.23.449282: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Baculovirus mediated dasTMPRSS2 protein production in Sf9 insect cells: Sf9 cells were grown in I-Max Insect Medium (Wisent Biocenter; Cat# 301-045-LL) to a density of 4×106 cells/mL and infected with 20 mL/L of suspension culture of baculovirus infected insect cells prior to incubation on an orbital shaker (145 rpm, 26 °C).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construct design and cloning: A construct encoding residues 109-492 comprising soluble TMPRSS2 ectodomain was amplified by two PCR fragments (Addgene plasmid# 53887) and subcloned into the pFHMSP-LIC C donor plasmid by LIC method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFHMSP-LIC C</div><div>suggested: RRID:Addgene_26100)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine Michaelis Menten kinetic parameters, 50 μL 4x enzyme stock was added through automated addition to microplates containing 150 μL substrate (0.5-1000 μM) in triplicate and initial reaction velocities were plotted against substrate concentration and curve fit using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, 7 inhibitor concentrations spanning three orders of magnitude across the IC50 value were used and inhibitor reaction velocities were normalized to uninhibited enzyme and plotted as one-site dose response curves in GraphPad.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human TTSP FASTA sequences (isoform 1) were accessed from UniProt and TMPRSS2 orthologs identified with UniProt BLAST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein Visualization and Property Calculation: The structure of dasTMPRSS2 was inspected and compared to other TTSPs using PyMol (Schrodinger) and the Molecular Operating Environment (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04583592</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Camostat Efficacy vs. Placebo for Outpatient Treatment of CO…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04625114</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Potential of Oral Camostat in Early COVID-19 Disease in …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04418128</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Efficacy of Nafamostat Mesylate for COVID-19 Pneumo…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04473053</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Rapid Experimental Medicine for COVID-19</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.19.449100: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All ED HCP personnel who chose to participate in this study provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was washed three times using wash buffer (TBS containing 0.2% Tween 20), then 50 μL of horseradish peroxidase-conjugated secondary Goat Anti-Human secondary antibody at 1:40,000 dilution in 3% milk was added for 40 minutes at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For measuring isotype specific antibody, only the respective goat antihuman HRP conjugated IgG, IgM, or IgA was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antihuman HRP conjugated IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For measuring isotype specific antibody, only the respective goat anti-human IgG, IgM, or IgA was used (Cat #109-035-008, 109-035-043, 109-035-011, Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>only the respective goat anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-008, RRID:AB_2337579)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Meso-scale multiplex surrogate neutralization assay: A multiplexed Meso Scale Discovery (MSD) immunoassay (MSD, Rockville, MD) was used to measure the ACE-2 blocking antibodies to SARS-CoV-2 reference strain and circulating variants (B.1.1.7, P1, B.1.351) using the MSD V-PLEX SARS-CoV-2 Panel 7 (ACE2) kit according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To describe the magnitude and spread of full spike and RBD binding IgG, IgM, and IgA titers, we generated jittered dot plots stratified by antibody isotype, time of sampling (post dose 1 and post dose 2), and prior exposure to SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Crossreactivity between WIV04 and three SARS-CoV-2 variants (B.1.1.7, B.1.351, and P.1), and crossreactivity between SARS-CoV-2 and other endemic human coronaviruses was compared using stratified description of antibody titers and kinetics following each vaccine dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B.1.351</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The halo-tagged SARS-CoV-2 NTD antigen (16–305 amino acids, Accession: P0DTC2.1) was designed and expressed in mammalian Expi293 cells as described for RBD antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, serum-virus complexes were added to the plated Vero E6 cells and incubated for 48 hours at 37C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867; http://n2t.net/addgene:157867; RRID:Addgene_157867)69.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_157867)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.21.449352: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Lung bud organoid differentiation and transduction: Lung bud organoids were generated from human pluripotent stem cells (hPSCs) and validated as previously described (77). hPSC differentiation into endoderm was performed in serum-free differentiation (SFD) medium of IMDM/Ham’s F-12 (3:1) (Life Technologies, Carlsbad, CA) supplemented with the following: 1 × N2 (Life Technologies), 0.5 × B27 (Life Technologies), 50 μg/ml ascorbic acid, 1 × Glutamax (Gibco), 0.4 μM monothioglycerol, 0.05% BSA, 10 μM Y27632, 0.5 ng/ml human BMP4 (R&D Systems), 2.5 ng/ml human FGF2 (R&D Systems, Minneapolis, MN), and 100 ng/ml human Activin (R&D Systems), in a 5% CO2/5% O2 atmosphere at 37 °C for 72-76 h.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike S1 antibody at 1:1000 (Prosci, Cat.# 9083); the S2 subunit was detected using anti-SARS-CoV/SARS-CoV-2 (COVID-19)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV/SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">spike antibody clone [1A9] at 1:1000 (GeneTex, Cat.# GTX632604); HIV-1 p24 was detected using a polyclonal anti-HIV-1 SF2 p24 rabbit antiserum at 1:6000 (obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH: ARP-4250, contributed by DAIDS/NIAID; produced by BioMolecular Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIV-1 SF2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV M protein was detected using anti-VSV M antibody clone [23H12] (KeraFast, Boston, MA, Cat.#</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV M</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-mouse and goat anti-rabbit antibodies were used as secondary antibodies (Santa Cruz Biotechnology, Dallas, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One million cells were re-suspend in 100 μl PBS and either immediately incubated with 0.25 μg anti-ACE2 antibody (R&D systems, Cat.# AF933) or first incubated at 37 °C for 6 hours with shaking to allow recovery of cell surface proteins after trypsinization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 647 conjugated donkey anti-goat antibody (1:200 dilution, Thermo Fisher Scientific, Waltham, MA, Cat.# A21447) was used as a secondary antibody and ACE2 expression was determined by flow cytometry (Guava easyCyte).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: (Molecular Probes Cat# A-21447, RRID:AB_141844)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">APC-conjugated goat anti-mouse and ducky anti-rabbit antibodies were used as secondary antibodies (1:100 dilution, Invitrogen), and expression was detected by flow cytometry (Guava easyCyte).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Convalescent sera was confirmed to be positive for IgG class antibodies against SARS-CoV-2 Spike using anti-SARS-CoV-2 ELISA (IgG) (EUROIMMUN, Lübeck, Germany) (78).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ELISA (IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: 293T, HeLa, HeLa-ACE2, Vero, VeroE6 and Huh7.5 cells were maintained in Dulbecco’s modified Eagle medium (DMEM), and Calu-3 cells were maintained in Eagle’s Minimum Essential Medium (EMEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_7927)</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa-ACE2 cells were transduced with Spike pseudotyped LV by seeding 1×104 cells per well in 96-well plates and adding 50μl of unconcentrated vector stocks the next day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike protein cell surface expression: VSV pseudovector-producing 293T cells were harvested to examine cell surface expression of the Spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Full-length (S) and 18 amino acid cytoplasmic tail truncated (SΔ18) Spike proteins for the Wuhan-Hu-1 isolate of SARS-CoV-2 (GenBank: MN908947.3) were provided by Dr. James Voss (The Scripps Research Institute) in a plasmid pcDNA3.3 backbone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.3</div><div>suggested: RRID:Addgene_26820)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral vector production, concentration and transduction: Lentiviral vectors were generated by transfection of 10 cm plates of 293T cells at 75% confluency with 2 μg of Spike expression plasmid, 10 μg of packaging plasmid pCMVdeltaR8.2 (Addgene Cat.# 12263) and 10 μg of a GFP-expressing vector genome plasmid FUGW (Addgene Cat.# 14883).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVdeltaR8.2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suitable dose of Spike pseudotyped VSV-Luc vectors was used in the neutralization assays to produce approximately 105 relative light unit (RLU) of luciferase activity on HeLa-ACE2 cells in the absence of serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-Luc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">spike antibody clone [1A9] at 1:1000 (GeneTex, Cat.# GTX632604); HIV-1 p24 was detected using a polyclonal anti-HIV-1 SF2 p24 rabbit antiserum at 1:6000 (obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH: ARP-4250, contributed by DAIDS/NIAID; produced by BioMolecular Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV Reagent Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BioMolecular</div><div>suggested: (Nemours Biomolecular Core Facility, RRID:SCR_018265)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densitometry was measured using ImageJ software (http://rsb.info.nih.gov/ij/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.17.21258371: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Improve Medical Instruments, Guanzhou/China) and washed out with 2 ml 0,9% saline within 12 h of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">RNA extraction: For the first blind test (Figure 1), RNA was extracted from the clinical samples with the QIAamp® Viral RNA Mini kit (Qiagen, #52904) following the manufacturer’s instructions (140μl of swab were extracted and eluted in 60μl).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cas13 purification: Plasmid encoding LwaCas13 (pC013 - Twinstrep-SUMO-huLwCas13a was a gift from Feng Zhang (Addgene plasmid # 90097; http://n2t.net/addgene:90097; RRID:Addgene_90097)39 was transformed into Rosetta cells and purified according to established protocols with substantial modification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_90097)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once the whole reaction volume was absorbed, the dipstick was removed and photographed with a smartphone camera for band intensity quantification performed with the freely available ImageJ image processing program77.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Rapid PCR and antigen-based tests are also available, but there are some limitations for their widespread use, such as the requirement for sophisticated PCR equipment and the standard practice of confirming positive antigen-based test results by RT-qPCR. Therefore, an alternative test that overcomes these limitations is still needed. Here, we have optimised the Cas13a-based diagnostic platform called SHERLOCK39 and developed the improved protocol ADESSO for highly sensitive COVID-19 testing. Overall, we tested 983 samples (496 positive and 487 negative, Supplementary File 1), in parallel comparison with RT-qPCR. To our knowledge, it is the first time that such an extensive study on clinical samples has been reported for CRISPR Dx technologies. ADESSO has a sensitivity of 96% on RNA extracted from swabs and a sensitivity of 77% when performed directly on unextracted swab samples. This drop in sensitivity is due to a decreased LoD at Ct 29, corresponding to low viral titers and minimal infectiousness11,51. However, skipping the RNA extraction step considerably reduces the sample-to-result turnaround time and allows more frequent testing, which is suggested to be essential for efficient identification of viral infections and isolation of carriers to contain the pandemic30. Other advantages are the lower need for RNA extraction kits, whose shortage has been a global issue throughout the pandemic57,58, and the higher test portability, which makes ADESSO appropriate for POC testing...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.17.21259050: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Collection and processing of patient nasal and saliva samples: With informed consent (Columbia University IRB AAAT1974), patients were provided sterile cotton tipped swabs and conical tubes for sample collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">To test the sensitivity of WHotLAMP, patient saliva samples and negative control samples were tested under blind conditions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Saliva RNA spike-in assay: For saliva RNA spike-in tests, a 1.7 mL tube with 100 μL of saliva was combined with 100 μL lysis buffer (0.8 M guanidine hydrochloride (G3272, Sigma), 2% Tween-20 (BP337, Fisher Biotech)), mixed, and incubated at room temperature for 5 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fisher Biotech)</div><div>suggested: (Resource Identification Portal, RRID:SCR_004098)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each sample, 100 μL of saliva was loaded into the tube, followed by 50 μL of RNAlater (R0901, Sigma) and 25 μL of Proteinase K (10 mg/mL) (PB0451, BioBasic; or 25530-049, Ambion), and mixed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioBasic</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.18.21258477: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Material and methods: Patient and cohort characteristics: All clinical studies were conducted after written informed consent in accordance with Good Clinical Practice guidelines and the provisions of the Declaration of Helsinki.<br>IRB: Protocol approval was obtained from an independent ethics committee (ethics protocol number EudraCT No: 2020-001250-21).<br>IACUC: We obtained approval from the local ethical committee and the French ministry of research (DC-2008-64) for handling and conservation of these samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells and antigens were tested negative for Mycoplasma before use.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, specific antibodies of patients are detected with anti-IgG or -IgA or -IgM secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 IHUMI2, IHUMI845, IHUMI846, IHUMI847 (early 2020 episode), IHUMI2096 (20A.EU2, B.1.160) and IHUMI2514 (20C, B.1.367) [80] IHUMI3076 (20I/501Y.V1, B.1.1.7), IHUMI3147 (20H/501Y.V2, B.1.351) and IHUMI3191 (20J/501Y.V3, P.1) strains were isolated from human nasopharyngeal swab as previously described [35] and grown in Vero E6 cells (ATCC CRL-1586) in Minimum Essential Medium culture medium (MEM) with 4% fetal calf serum (FCS) and 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influenza strains H1N1 (0022641132) and H3N2 (8091056304) were isolated then produced from human nasopharyngeal swab in MDCK cells (ATCC CCL-34) in MEM with 10% FCS and 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus OC43 (ATCC vr-1558) was grown in HCT8 cells (ATCC CCL-244) in RPMI with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human biological samples and associated data were obtained from NeuroBioTec (CRB HCL, Lyon France, Biobank BB-0033-00046) and Virginie Pitiot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NeuroBioTec</div><div>suggested: (NeuroBioTec, RRID:SCR_013842)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RNA was detected using one of two available techniques at Gustave Roussy: the GeneFinder COVID-19 Plus RealAmp kit (ELITech Group) targeting three regions (RdRp gene, nucleocapsid and envelope genes) on the ELITe InGenius (ELITech Group) or the multiplex real-time RT-PCR diagnostic kit (the Applied Biosystems TaqPath COVID-19</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneFinder</div><div>suggested: (GENEFINDER, RRID:SCR_009190)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEPES Buffer Solution (catalog reference: 15630-056), MEM NEAA (catalog reference: 1140-035) from GIBCO/ThermoFisher Scientific and Recombinant Human IL-2 (PHAR000306) from Gustave Roussy Institute pharmacy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GIBCO/ThermoFisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquisitions and analyses were performed on CytoFLEX S purchased from Beckman Coulter (catalog reference: B75442)/FACSAria Fusion purchased from BDbiosciences and FlowJo Software from Treestar respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The peptides from the ORF8 and ORF10 proteins were selected by dividing the sequences of the SARS-CoV-2 ORF8 protein (RefSeq ID QHD43422.1) and of the ORF10 protein (RefSeq ID QHI42199.1) in overlapping 15 amino acid segments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04341207</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Epidemiology of SARS-CoV-2 and Mortality to Covid19 Disease …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04341142</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assessment of Serological Techniques for Screening Patients …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT01159288</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial of a Vaccination With Tumor Antigen-loaded Dendritic C…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02528357</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">GSK3174998 Alone and With Pembrolizumab in Participants With…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03334617</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase II Umbrella Study of Novel Anti-cancer Agents in Patie…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02423863</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">In Situ, Autologous Therapeutic Vaccination Against Solid Ca…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03818685</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluate the Clinical Benefit of a Post-operative Treatment …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.15.21258966: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was exempt from obtaining formal institutional review board approval and the requirement to obtain informed patient consent because it is secondary research of publicly available data sets.<br>Consent: This study was exempt from obtaining formal institutional review board approval and the requirement to obtain informed patient consent because it is secondary research of publicly available data sets.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">In National Health Service hospitals in the UK, 4,116 adults with oxygen saturation <92% on room air or receiving oxygen therapy and with C-reactive protein ≥ 75 mg/L were randomized to either usual care or tocilizumab plus usual care in a 1:1 ratio.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">RECOVERY was designed, with 90% power and alpha = 0.01, to detect a 5% absolute risk reduction assuming a control mortality risk of at least 25%.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: Our study has several strengths. Most importantly, Bayesian analyses permit the inclusion of prior beliefs and or prior objective evidence. We only included data from RCTs with a low or moderate risk of bias, as assessed by the living systematic review from which we based our data extraction process.[11] Further, we tried to mitigate potential biases associated with researcher degrees of freedom by pre-registering the data extraction process and part of the analysis plan,[14] and restricting our analyses to RECOVERY specified subgroups. Next, in contrast to P-values and confidence intervals, Bayesian analyses can provide intuitive and understandable probability estimates of each subgroup’s treatment effect. Moreover, these analyses not only inform the probability of any benefit but also calculation of the probabilities of clinically meaningful benefits. This enhances the readers’ ability to distinguish clinical from statistical significance. Lastly, we incorporated most of the high-quality evidence available on tocilizumab and COVID-19 to our prior distributions. Notwithstanding these strengths, our study also has limitations. First, we did not have access to patient-level data for any RCTs included in this article. Subgroup analyses that separate patients by a single baseline characteristic are over-simplified and can bring shortcomings.[2] Lack of patient-level data does not allow analyses using more complex statistical models that incorporate mul...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04381936</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomised Evaluation of COVID-19 Therapy</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.17.448891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ltd (Guangzhou, China) and inserted into plasmid pET-44b(+) and pET-28a(+), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-44b(+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET-28a(+)</div><div>suggested: RRID:Addgene_108949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Protein expression and purification: The plasmids pET-44b-NusA-5HB, pET-28a-5HB, and pCold-NusA containing the gene encoding NusA-5HB, 5HB and NusA (with N-terminal His-tag) were transformed into competent E. coli BL21 (DE3) cells (Invitrogen) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a-5HB</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCold-NusA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant E. coli was cultivated in LB medium with antibiotic (50 mg/L Kan for pET-28a-5HB; 100 mg/L Amp for pET-44b-NusA-5HB and pCold-NusA) at 37 °C and rotary shaking at 200 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-44b-NusA-5HB</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained f values were plotted using GraphPad Prism 8 to calculate the IC50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMOL (Version 1.5, Schrö dinger, LLC) was used to prepare figures of the complexes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.450244: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6, Caco-2, Huh-7, Calu-3 and HEK293+A+T cells(Hart et al., 2017)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were regularly monitored for mycoplasma contamination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were washed with PBS and incubated with secondary antibody, anti-human FITC-IgG (Fc specific) (ThermoFisher Scientific) at a dilution of 1:400 and for 45 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human FITC-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage of cells infected were determined using HarmonyTM high content imaging and analysis software by comparing cells stained positive with anti-N antibody versus Hoechst actin-stained cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently proteins were detected using anti-ACE2 (R&D AF933, RRID:AB_439702), anti-TMPRSS2 (Millipore, MABF2158), anti-CTSL (SantaCruz SC-32320 RRID:AB_626811), ß-Tublin</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CTSL</div><div>detected: (Santa Cruz Biotechnology Cat# sc-32320, RRID:AB_626811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(DSHB E7, RRID:AB_528499), anti-HSP90 (SantaCruz, SC-13119, RRID:AB_675659) or anti-FLAG (Sigma, A8592, RRID:AB_439702) antibodies with an appropriate HRP conjugated secondary antibody, anti-mouse-IgG (Cell Signaling Technologies 7076, RRID:AB_330924)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: (DSHB Cat# E7, RRID:AB_528499)</div></div><div style="margin-bottom:8px"><div>anti-HSP90</div><div>detected: (Santa Cruz Biotechnology Cat# sc-13119, RRID:AB_675659)</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>detected: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div><div style="margin-bottom:8px"><div>anti-mouse-IgG</div><div>suggested: (Proteintech Cat# 10283-1-AP, RRID:AB_2877728)</div></div><div style="margin-bottom:8px"><div>anti-mouse-IgG</div><div>detected: (Cell Signaling Technology Cat# 7076, RRID:AB_330924)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-rabbit-IgG (Cell Signaling Technologies 7074, RRID:AB_2099233) or anti-goat IgG (Jackson ImmunoResearch 805035180, RRID: AB_2340874).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-IgG</div><div>detected: (Cell Signaling Technology Cat# 7074, RRID:AB_2099233)</div></div><div style="margin-bottom:8px"><div>anti-goat IgG</div><div>detected: (Jackson ImmunoResearch Labs Cat# 805-035-180, RRID:AB_2340874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 flow cytometry analysis: For ACE2 labeling, cells were harvested with 5mM EDTA, washed once with FACS buffer (1%BSA in PBS and 5mM EDTA) and incubated for 40 minutes in FACS buffer containing 0.75ug of human ACE2-488 conjugated antibody (R&D Systems FAB9332) and 1:1000 7-AAD (ThermoFisher Scientific)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FAB9332</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3, and UM-UC-4 cells were cultured in EMEM (Wisent) with 10% FBS and 1% penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>UM-UC-4</div><div>suggested: ECACC Cat# 08090501, RRID:CVCL_2749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stocks: SARS-CoV-2/SB3 isolate (Banerjee et al., 2020) used here was propagated in Vero E6 cells at 37°C to generate P4 viral stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6, Caco-2, Huh-7, Calu-3 and HEK293+A+T cells(Hart et al., 2017)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviruses were produced by transfecting HEK-293T cells with pPAX2, pVSVG and pLenti6.2 generated above using Lipofectamine 2000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The conditioned media was collected from transfected cultures, filtered through 0.22um filters and applied to Vero E6, Calu-3 and Huh7 cells at 1:10 ratio of conditioned media : fresh media, in the presence of 8ug/ml polybrene (Sigma)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate protease overexpression lines, Tmprss2-FLAG, FLAG-Tmprss2 or Cathepsin L-FLAG constructs were cloned into pLenti6.2 plasmid with blasticidin resistance marker using gateway cloning system (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti6.2</div><div>suggested: RRID:Addgene_113724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviruses were produced by transfecting HEK-293T cells with pPAX2, pVSVG and pLenti6.2 generated above using Lipofectamine 2000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPAX2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSVG</div><div>suggested: RRID:Addgene_85140)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed using the LSR Fortessa X20 (BD Biosciences) and analyzed with FlowJo v10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-processed paired-end reads were aligned to TKOv3 reference library sequences using Bowtie (v0.12.8) allowing up to two mismatches and one exact alignment (specific parameters: -v2 -m1 -p4 --sam-nohead).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene expression changes were analyzed by pseudo-aligning pre-trimmed reads to GENCODE v29 transcripts using Salmon v0.14.1 #(Patro R et al., Nat Methods 2017)# and aggregated per gene using the R package tximport #(Soneson C et al., F1000Research 2015)#.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Salmon</div><div>suggested: (Salmon, RRID:SCR_017036)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternative splicing was analyzed using Vast-tools v2.2.2 (Tapial et al., 2017) in combination with the VastDB Hs2 library released on Dec. 20, 2019 (https://github.com/vastgroup/vast-tools).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vast-tools</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">QAPA builds the reference library of 3′ UTRs from all annotated protein-coding genes using GENCODE basic gene annotation (v19) for humans (hg19), supplemented by experimentally defined polyA sites archived in the PolyAsite database (Gruber et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div><div style="margin-bottom:8px"><div>PolyAsite</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment and network analysis: Analysis of enriched gene functions was performed as ordered queries with g:Profiler ###Ref: https://doi.org/10.1093/nar/gkz369 ### using the TKOv3 library as a custom background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>g:Profiler</div><div>suggested: (G:Profiler, RRID:SCR_006809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were recorded with Xcalibur software (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human protein reference sequences from the UniProt Swiss-Prot database were downloaded on 18-06-2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.24.449680: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal experiments were approved by the Institutional Animal Care and Use Committee of XXXXXX.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For Ad5-hACE2-transduced BALB/c mice 51, specific pathogen-free 6-10 weeks old male and female BALB/c mice were lightly anesthetized with isoflurane and transduced intranasally with 2.5×108 fluorescence focus units (FFU) of Ad5-ACE2 in 75 μL DMEM.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min at room temperature and stained with anti-His-tag antibodies (Abmart, M30111S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were stained with goat anti-mouse Alexla Fluor 488-conjugated secondary antibodies (Invitrogen, A11001), and were detected with flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In some experiments, LAD2 cells were prior-treated with 0.25% trypsin (without EDTA) for 10 min at 37 °C or prior-blocked with anti-ACE2 antibody (5 μg/mL, R&D Systems, AF933) for 2 h at 37 °C before the incubation with Spike-RBD protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-ACE2 antibody (Abcam, EPR4435), anti-MMP9 antibody (signal antibody, 29091), anti-GAPDH antibody (Abcam, 6C5), and the horseradish peroxidase-conjugated secondary antibody were used in Western blotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MMP9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Abcam Cat# ab92412, RRID:AB_2278693)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detecting tight junction proteins ZO-1, Occludin, Claudin-5 and JAM2 in A549 cells, cells were blocked with 5% BSA in PBS for 1 h at room temperature then incubated with primary antibodies for 2h at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZO-1, Occludin,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Claudin-5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JAM2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against ZO-1 (Invitrogen, 402200), Occludin (Invitrogen, OC-3F10), Claudin-5 (Invitrogen, 4C3C2) and JAM-2 (Abcam, EPR2489), were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZO-1</div><div>suggested: (Thermo Fisher Scientific Cat# 40-2200, RRID:AB_2533456)</div></div><div style="margin-bottom:8px"><div>Occludin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JAM-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus was generated by EZ Trans cell transfection reagent-mediated co-transfection of HEK293T cells with the Spike-expressing plasmid pcDNA3.1-2019-nCoV-S-IRES (strain 2019-nCoV WIV04) and pNL4-3. Luc. ΔR ΔE 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immuno-staining assay, A549 cells were added leukocyte activation cocktail containing BD GolgiPlug (BD, 550583) and cultured for 6 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-humanzied mice and rhesus macaques experiments: 3-4 months old C57BL/6N-Ace2em2(hACE2-WPRE,pgk-puro)/CCLA mice were provided by Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Science 47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6N-Ace2em2(hACE2-WPRE,pgk-puro)/CCLA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Ad5-hACE2-transduced BALB/c mice 51, specific pathogen-free 6-10 weeks old male and female BALB/c mice were lightly anesthetized with isoflurane and transduced intranasally with 2.5×108 fluorescence focus units (FFU) of Ad5-ACE2 in 75 μL DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus was generated by EZ Trans cell transfection reagent-mediated co-transfection of HEK293T cells with the Spike-expressing plasmid pcDNA3.1-2019-nCoV-S-IRES (strain 2019-nCoV WIV04) and pNL4-3. Luc. ΔR ΔE 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike-expressing</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-2019-nCoV-S-IRES</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were detected with BD Accuri C6 and analyzed with FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw RNA sequencing (RNA-seq) reads were filtered using Trimmomatic v0.36 82.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to the human (hg38) reference genomes using HISAT v2.1 with corresponding gene annotations (GRCh38.p13) with default settings 83.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total counts per mapped gene were determined using featureCounts function in SubReads package v1.5.3 with default parameter 84.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, counts matrix obtained from featureCounts was used as input for differential expression gene analysis with the bioconductor package DESeq2 v1.26 in R v4.085.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Filtered counts matrix was normalized using the DESeq2 method to remove the library-specific artifacts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcription-factor enrichment analysis and functional enrichment analysis was performed using Metascape server tool 86 (https://metascape.org/gp/index.html#/main/step1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) were performed using the R package clusterProfiler v3.18.1 87.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interaction (PPI) networks of DEGs were built using STRING v11 with a confidence score threshold of 0.7 and visualized with Cytoscape v3.8.1 88,89.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitation of our study is that the administration of Eba or Lor significantly reduced SARS-CoV-2-induced inflammation and lung injury, but showed limitation in suppressing viral replication in lungs of ACE2 humanized mice. A combination of MC stabilizers with antiviral drugs such as the RNA polymerase inhibitors Remdesivir and Favipiravir 6,78–80, may provide more optimal treatment strategy that dampening inflammation and clearing viruses at the same time. In summary, we demonstrate that SARS-CoV-2 triggers lung MCs degranulation, which induces the remodeling of various cellular signalings in human alveolar epithelial cells, particularly, MCs degranulation induces the alveolar epithelial inflammation and leads to the consequent disruption of tight junction proteins; importantly, we find that the clinically used MC degranulation stabilizers Eba and Lor are potent agents at reducing virus-induced production of pro-inflammatory factors and preventing lung injury. Our finding uncovers a potentially novel mechanism of SARS-CoV-2 infection initiates alveolar epithelial inflammation and induces lung Injury. Significantly, our results suggest a potential off-label use of MC stabilizers as immunomodulators to treat the severe cases of COVID-19.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04324021</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Efficacy and Safety of Emapalumab and Anakinra in Reducing H…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04338958</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ruxolitinib in Covid-19 Patients With Defined Hyperinflammat…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.18.448958: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubating the plate at 37 ℃ for 1 h and washing 3 times with PBST, the HRP-conjugated secondary antibody (goat anti-mouse IgG) at 1:10000 dilution was added into the wells of the plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C149336-10000, RRID:AB_11143677)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the generated plasmids were transfected into the HEK293T cells for transient expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Huh-7 cells were digested and suspended in the culture medium with viable cell density of 2×105 per mL, which were then added into the well with 100 μL per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation at 37 ℃ for 2 h, the serum-and-virus mixed solution was added into the well of the plate containing Vero-E6 cells with density of 2×10 5 per mL, which was then cultured at 37 ℃ for 5 to 7 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to compare the immunogenicity of the mutI tri-RBD with the homo-tri-RBD, another two groups of BALB/c mice (6 mice in each group) were also immunized with the homo-tri-RBD plus aluminum adjuvant by two-shot of high dose (2.0 μg/dose) or three-shot of middle dose (0.5μg/dose).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The trimeric structure generated by Modeller was solvated using TIP3P water molecules in a cubic box, with the protein atoms being at least 1.6 nm away from the box edges.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on the MD simulation trajectories, the changes in the root mean square deviation (RMSD) of the Cα atoms of the system as a function of time were calculated by using the built-in tool of “gmx rms” in Gromacs to evaluate the stability of the trimeric RBD proteins, and the motion movies were generated by using Chimera software to display the intrinsic conformational movements of the trimeric RBD proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chimera</div><div>suggested: (Chimera, RRID:SCR_002959)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS raw data files were processed using BioPharma Finder software (version 3.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPharma Finder</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04869592</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Clinical Trial to Evaluate the Recombinant SARS-CoV-2 Vacc…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.16.21258673: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All blood donors provided written informed consent for participation in the study.<br>IRB: These human sera protocols were approved by the Ethics Committee of Hubei Provincial Center for Disease Control and Prevention, Wuhan, China (No. 2021-012-01).<br>IACUC: The mice sera protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of Center for Animal Experiment, Wuhan University, Wuhan, China (No. WP20210007).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA detection of SARS-CoV-2 S protein antibodies in the sera: The rapid IgG / IgM test was applied by 2019-nCoV IgG / IgM Detection Kit (Colloidal Gold-Based, Vazyme Biotech Co.,Ltd), which is based on the reactivity of IgG / IgM against SARS-CoV-2 S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S protein.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Ltd), which is based on the competition between the neutralizing antibodies in sera and ACE2 to horseradish peroxidase labeled RBD protein (HRP-RBD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 hrs, the transfected cells were inoculated with VSV-dG-fLuc (1×106 TCID50/ml) diluted in DMEM for 5 hrs at 37°C and then replenished with growth medium (DMEM with 10 % FBS) containing anti-VSV-G monoclonal antibody (I1-hybridoma, cultured supernatant, 1:20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I1-hybridoma</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently incubated with a mouse monoclonal antibody targeting SARS-CoV/SARS-CoV-2 Nucleocapsid (40143-MM05, Sino Biological) at 1:500 dilution at 37 °C for 1 h, and then incubated with 2 μg/ml of Alexa Fluor 594-conjugated goat anti-mouse IgG antibody (A-11032, Thermo Fisher Scientific) at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK 293T (ATCC, CRL-1168),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK-21(ATCC, CCL-10) and VERO E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s medium (DMEM; Gibco) supplemented with 10 % fetal bovine serum (FBS), 2.0mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VERO E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero-E6 cells were transfected with plasmids expressing different S proteins through the Lipofectamine 2000 (Biosharp, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50 % tissue culture infectious dose (TCID50) of pseudovirus was determined by a serial-dilution based infection assay on BHK-21-hACE2 cells and calculated according to the Reed-Muench method(22, 23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and protein: The DNA sequences of human codon-optimized S proteins from SARS-COV-2 variants (B.1.1.7, GISAID: EPI-ISL-601443; B.1.351, GISAID: EPI_ISL_678597; P.1, GISAID: EPI_ISL_906075; B.1.525, GISAID: EPI_ISL_1093472) and S protein mutations were commercially synthesized or generated by overlapping-PCR based mutagenesis using pCAGGS-SARS-CoV-2-S-C9 (gifted from Dr. Wenhui Li, National Institute of Biological Science, Beijing,China) as template and cloned into pCAGGS vector with C-terminal 18 aa truncation to improve VSV pseudotyping efficiency(21).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SARS-CoV-2-S-C9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pCAGGS-SARS-CoV-2-RBD-hFc was constructed by inserting the RBD sequence (aa331-525) in to the pCAGGS vector for the expression of RBD-hFc recombinant protein in HEK 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SARS-CoV-2-RBD-hFc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50 % neutralization dilution titer (NT50) was calculated by GraphPad Prism 7 software with nonlinear regression curve fitting (normalized response, variable slope).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We do acknowledge some limitations of our studies. First, we did not determine the NT50 of all the sera because of the limitation of the sample volume, especially for those with lower neutralizing activity. Second. we did not include all the possible mutations that can appear in the B.1.617 and its sub-lineages in consideration of the sequence complexity of the variants circulating in India. Thus, future studies could be done to investigate whether other mutations on spike proteins can result in a leap of the immune escape ability of B.1.617 and other variants. To our knowledge, the current study provides the first direct evidence that the potent anti-SARS-CoV-2 humoral immunity can last for at least one year in most convalescents to protect them against the original virus (WT or WT-D614G), which means the annually re-administration might be a feasible vaccination strategy to maintain the anti-SARS-CoV-2 humoral immunity. However, the convalescents and the vaccinated people are gradually losing protection against the constantly emerging immune escape variants. It remains to be determined whether re-administration of the variant-based or broadly neutralizing epitope-based vaccines can achieve effective cross-variant immunity. Overall, our study suggests that the timely update of the vaccines rather than the durability of the SARS-CoV-2 humoral immunity should be more of our concern.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.29.450133: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were incubated with J2 primary antibody (Scicons 10010200) at 0.5 µg/ml or human anti-N primary antibody (Ey2B clone 1:2000) (Huang et al., 2020) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>J2</div><div>suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: (Wesley CS; J Cell Biol. 2000 Cat# N, RRID:AB_2570096)</div></div><div style="margin-bottom:8px"><div>Ey2B</div><div>suggested: (Krasnov AN; Nucleic Acids Res. 2005 Cat# e(y2b, RRID:AB_2568395)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Vero E6, A549-ACE2 (kind gift from Bartenschlager lab) (Klein et al., 2020) and Huh-7.5 cells were maintained in standard DMEM, Calu-3 cells in Advanced DMEM both supplemented with 10% fetal bovine serum, 2mM L-glutamine, 100 U/mL penicillin and 10μg/mL streptomycin and non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral strains were propagated in Vero-E6 cells as described (Wing et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, HCoV-229E (Andrew Davidson lab (Bristol) and Peter Simmmonds lab (Oxford)) virus was propagated in Vero E6 cells and TCID50 was performed in Huh-7.5 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Candidate sequences were BLAST screened against custom human transcriptome and intron database to score number of off-target base-pair matches, then 35 – 48 sequences with the least match scores were chosen per probe set.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in silico probe sequence specificity analysis, selected oligonucleotide sequences were aligned against SARS-CoV-1 (NC_004718), SARS-CoV-2 (NC_045512), MERS-CoV (NC_019843), HCoV-229E (NC_002645), HCoV-NL63 (NC_005831), HCoV-OC43 (NC_006213), HCoV-HKU1 (NC_006577), Human (GCF_000001405.39), and African green monkey (GCF_015252025.1) RefSeq genome or transcriptome assembly using ‘bowtie2’ (2.4.4) (Langmead and Salzberg, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For 20x stitched images, CellMask channel was deconvolved with constrained iterative module using cellSens (5 iterations, default spinning disk PSF, Olympus), then following Cellpose parameters were used: model_type=cyto, diameter=55, flow_threshold=0, cellprob_threshold=-6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cellSens</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were counted using ImageJ “3D object counter” or manually.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nearest neighbour distances were calculated using the KDtree algorithm (Maneewongvatana and Mount, 1999) implemented in python (scipy.spatial.KDTree).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing libraries were prepared using the Illumina Total RNA Prep with Ribo-Zero Plus library kit (Cat# 20040525) according to manufacturer’s guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ribo-Zero Plus</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-sequencing analysis: Genomes: We downloaded the human genome primary assembly and annotation from ENSEMBL (GRCh38.99) and the SARS-CoV-2 RefSeq reference genome from NCBI (NC_045512.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ENSEMBL</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment and gene counts: We performed a splice-site aware mapping of the sequencing reads to the combined human and SARS-CoV-2 genome and annotation using STAR aligner (2.7.3a) (Dobin et al. 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, we performed library size correction and variance stabilisation with regularized–logarithm transformation implemented in DESeq2 (1.28.1) (Love et al. 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 sub-genomic RNA expression: To assess relative levels of viral sub-genomic and genomic RNA expression, we tallied the alignments (using GenomicRanges and GenomicAlignments R packages (Lawrence et al., 2013)) mapping to the region unique to the genomic RNA and the shared region and normalised for their respective lengths.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GenomicRanges</div><div>suggested: (GenomicRanges, RRID:SCR_000025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics, data wrangling and visualisation: Statistical analyses were performed in R (3.6.3) and RStudio (1.4) environment using an R package “rstatix” (0.7.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Although single cell RNA-seq analyses can overcome some of these issues (Fiege et al., 2021; Ravindra et al., 2021), their low coverage and lack of information regarding the spatial location of cells remains significant limitations. In this study we show smFISH is a sensitive approach that allows the absolute quantification of SARS-CoV-2 RNAs at single molecule resolution. Our experiments show the detection of individual gRNA molecules within the first 2h of infection that most likely reflect incoming viral particles. However, we also observed small numbers of foci comprising several gRNAs that were sensitive to RDV treatment, demonstrating early replication events. We believe these foci represent ‘replication factories’ as they co-stain with FISH probes specific for negative sense viral RNA and sgRNA. These data provide the first evidence that SARS-CoV-2 replication occurs within the first 2h of infection and increases over time. This contrasts to our observations with the J2 anti-dsRNA antibody where viral dependent signals were apparent at 6 hpi (Cortese et al., 2020; Eymieux et al., 2021). We noted that co-staining SARS-CoV-2 infected cells with J2 and ORF1a FISH probe set showed a minimal overlap, suggesting that infection may induce changes in cellular dsRNA. The observation that infection can perturb mitochondrial function provides a possible explanation for these observations (Appelberg et al., 2020; Mullen et al., 2021). Importantly, mitochondrial dsRNAs can engage M...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 42 and 43. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.450214: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments using SARS-CoV-2 were approved by the Institutional Biosafety Committee (IBC) at Texas Biomedical Research Institute. Cells: African green monkey kidney epithelial cells (Vero E6, CRL-1586) were grown and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1X PSG (100 units/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine), and incubated at 37°C in an 5% CO2 atmosphere.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six-to- eight-week-old female K18 human angiotensin converting enzyme 2 (hACE2) transgenic mice were purchased from The Jackson Laboratory and maintained in the Animal Biosafety Laboratory level 3 (ABSL-3) at Texas Biomedical Research Institute.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All experiments using SARS-CoV-2 were approved by the Institutional Biosafety Committee (IBC) at Texas Biomedical Research Institute. Cells: African green monkey kidney epithelial cells (Vero E6, CRL-1586) were grown and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1X PSG (100 units/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine), and incubated at 37°C in an 5% CO2 atmosphere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of pBeloBAC11-SARS-CoV-2 encoding fluorescent proteins (FP): The pBeloBAC11 plasmid (NEB) containing the entire viral genome of SARS-CoV-2 USA/WA1/2020 (WA-1) isolate (accession no. MN985325) has been described 20, 21.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBeloBAC11</div><div>suggested: RRID:Addgene_60342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, confluent monolayers of Vero E6 cells (1.2 x 106 cells/well, 6-well plate format, triplicates) were transfected with 4 µg/well of pBeloBAC11-SARS-CoV-2 (WA-1), -2A/Venus, -2A/mCherry, or - 2A/mCherry-SA-RBD plasmids using Lipofectamine 2000 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>2A/mCherry-SA-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then fixed in 10% neutral buffered formalin overnight and washed with PBS, before fluorescence signal was measured and quantified using a Synergy LX microplate reader and Gen5 data analysis software (Bio- Tek).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mean and SD of viral infections were calculated from individual wells of three independent experiments conducted in quadruplicates with Microsoft Excel software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-linear regression curves and NT50 values were determined using GraphPad Prism Software (San Diego, CA, USA, Version 8.2.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Macroscopic pathological scoring was determined from the percent of total surface area affected by congestion, consolidation, and atelectasis of excised lungs, using NIH ImageJ software as previously described 21, 35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Reporter-expressing recombinant viruses can circumvent limitations imposed by the need for secondary methods to detect the presence of viruses in infected cells. These reporter viruses have been used to evaluate viral infections, identify therapeutics, and to study viral virulence in vivo. Here, we have documented the generation of novel rSARS- CoV-2 to facilitate tracking infection of two different SARS-CoV-2 strains (WA-1 and SA) in vitro and in vivo based on the use of two different FPs (Venus and mCherry, respectively). The FP-expressing rSARS-CoV-2 encode the fluorescent Venus or mCherry proteins from the locus of the N protein, without the need for deletion of any viral protein 20. Notably, the use of this approach to generate FP-expressing rSARS- CoV-2 resulted in higher FP expression levels than those afforded by rSARS-CoV-2 expressing FPs from the locus of the viral ORF7a protein 20. Moreover, rSARS-CoV-2 expressing reporter genes from the N locus are more genetically stable than those expressing reporter genes from the ORF7a locus of the SARS-CoV-2 genome 20. We showed that rSARS-CoV-2 expressing Venus or mCherry from the N locus exhibited similar growth kinetics, peak titers, and plaque phenotype as the parental WT rSARS-CoV-2 WA-1 strain. Importantly, we were able to use these novel reporter rSARS-CoV-2 in bifluorescent-based assays to determine the neutralization efficacy of hMAbs based on FP expression levels. We also generated rSARS-CoV-2 mCherry SA, an mCherry...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 40 and 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.25.449990: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All the experimental protocols involving the handling of virus culture and animal infection were approved by RCGM, institutional biosafety, and IAEC animal ethics committee (IAEC/THSTI/105).<br>Euthanasia Agents: Intra-nasal infection with live SARS-CoV2 105PFU/ 100μl or with DMEM mock control was established with the help of catheter under mild anesthetized by using ketamine (150mg/kg) and xylazine (10mg/kg) intraperitoneal injection inside ABSL3 facility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Assessment for the histological score was carried out through blind scoring for each sample by a professional histologist.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-Related Coronavirus 2, Isolate USA-WA1/2020 virus was grown and titrated in Vero E6 cell line cultured in Dulbecco’s Modified Eagle Medium (DMEM) complete media containing 4.5 g/L D-glucose, 100,000 U/L Penicillin-Streptomycin, 100 mg/L sodium pyruvate, 25mM HEPES, and 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.450211: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp7, nsp8 and nsp12 proteins were subsequently detected using the mouse monoclonal anti-DYKDDDDK M2 antibody (Catalogue number F3165, Sigma-Aldrich) diluted 1:1000 in TBST/5% milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DYKDDDDK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cellular proteins were detected using rabbit polyclonal antibodies anti-GAPDH (Catalogue number GTX100118, GeneTex) diluted 1:4000 in TBST/5% milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (GeneTex Cat# GTX100118, RRID:AB_1080976)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies IRDye 680 goat anti-mouse (Catalogue number 926-68020, Li-cor) and IRDye 800 donkey anti-rabbit (Catalogue number 926-32213, Li-cor) were used to detect western signals with an Odyssey scanner (Li-cor)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (LI-COR Biosciences Cat# 926-68020, RRID:AB_10706161)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-32213, RRID:AB_621848)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (PAN-Biotech) with 10% feral calf serum (FCS) (Sigma-Aldrich), 1% L-Glutamine (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mini genome assay: To measure SARS-CoV-2 polymerase activity in cell culture, approximately 2×105 293T cells were transfected with 200 ng each of pcDNA6.B-nsp7-flag, pcDNA6.B-nsp8-flag, and pcDNA6.B-nsp12-flag, and 25 ng linear pPolI-SARS-CoV2-NLuc-N plasmid using 2µl of Lipofectamine 2000 (Invitrogen) to a DNA:lipofectamine ratio of 1:3 and 100µl Opti-MEM (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase-based IFN expression assay: HEK 293T cells were transfected with SARS-CoV-2 nsp plasmids as described above for the mini-genome assay and co-transfected with 100 ng of a firefly luciferase reporter plasmid under the control of the IFN-β promoter as described previously (48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Plasmids pcDNA6.B-nsp7-flag, pcDNA6.B-nsp8-flag, pcDNA6.B-nsp12-flag, pcDNA6.B-nsp10-flag, pcDNA6.B-nsp14-flag, pcDNA6.B-nsp9-flag, pcDNA6.B-nsp13-flag</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA6.B-nsp8-flag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA6.B-nsp10-flag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA6.B-nsp14-flag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA6.B-nsp9-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, pcDNA6.B-nsp16-flag containing codon-optimized versions of SARS-CoV-2 strain Wuhan-Hu-1 (2019) nsp7,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA6.B-nsp16-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, motif C (DD761-762AA), P323L, P322L), in nsp7 (S25L, S26F), and in nsp8 (M129I, D163L) were introduced by site-directed mutagenesis of pcDNA6.B-nsp12-flag, pcDNA6.B-nsp7-flag or pcDNA6.B-nsp8-flag using primers listed in Table 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA6.B-nsp12-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct the negative-sense RNA reporter, we designed construct PolI-SARS-CoV2-NLuc-N-HDR and ordered this as insert in the pMK-RQ backbone (Invitrogen construct ID 20ACX40P).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMK-RQ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection control pcDNA3-FF-luciferase and IFN-β reporter plasmid pIFΔ(−116)lucter were described previously (48, 49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-FF-luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mini genome assay: To measure SARS-CoV-2 polymerase activity in cell culture, approximately 2×105 293T cells were transfected with 200 ng each of pcDNA6.B-nsp7-flag, pcDNA6.B-nsp8-flag, and pcDNA6.B-nsp12-flag, and 25 ng linear pPolI-SARS-CoV2-NLuc-N plasmid using 2µl of Lipofectamine 2000 (Invitrogen) to a DNA:lipofectamine ratio of 1:3 and 100µl Opti-MEM (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA6.B-nsp7-flag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pPolI-SARS-CoV2-NLuc-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed with GraphPad PRISM 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.22.21258961: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent before enrolment.<br>IRB: The trial was conducted at the National Institute for Infectious Diseases Lazzaro Spallanzani (INMI) in Rome and at Centro Ricerche Cliniche in Verona (CRC-Verona), according to the Declaration of Helsinki, and approved by the Italian Regulatory Drug Agency (AIFA) and the Italian National Ethical Committee for COVID-19 clinical studies (ClinicalTrials.gov NCT04528641; EudraCT 2020-002835-31).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, 96-well tissue culture plates with sub-confluent Vero E6 cell monolayers were infected with 100 μl/well of virus-serum mixtures and incubated at 37 °C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04528641</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">GRAd-COV2 Vaccine Against COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04791423</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of GRAd-COV2 for the Prevention of COVID-19 in Adults</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.23.21259327: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics: all participants gave informed consent to take part in the study.<br>IRB: The study was approved by the North-West Liverpool Central Research Ethics Committee (REC reference 21/NW/0073).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for SARS-CoV-2 antibodies: ELISAs for SARS-CoV-2 antibodies were performed as described previously 17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of neutralising antibody activity using viral pseudotypes: HEK293, HEK293T, and 293-ACE2 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum, 200mM L-glutamine, 100µg/ml streptomycin and 100 IU/ml penicillin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: (Creative Biomart Cat# APOA5-26876TH, RRID:AB_2532021)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of neutralising antibody activity using viral pseudotypes: HEK293, HEK293T, and 293-ACE2 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum, 200mM L-glutamine, 100µg/ml streptomycin and 100 IU/ml penicillin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293-ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the SARS-CoV-2 RBD and S1 constructs, spanning SARS-CoV-2 S (UniProt ID P59594) residues 319-541 (RVQPT…KCVNF) and 1-530 (MFVFL…GPKKS), respectively, were produced with C-terminal twin Strep tags in the mammalian expression vector pQ-3C-2xStrep38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQ-3C-2xStrep38</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with the appropriate SARS-CoV-2 S gene expression vector (wild type or variant) in conjunction with p8.91 18 and pCSFLW 19 using polyethylenimine (PEI, Polysciences, Warrington, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCSFLW 19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S gene of B.1.351 (South Africa) was based on the codon-optimised sequence of the Wuhan-Hu-1 expression construct, synthesised by Genscript (Netherlands) and sub-cloned into the pCDNA6 expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA6</div><div>suggested: RRID:Addgene_134280)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.21.21259010: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Our CP study was given a favourable opinion by the Health Research Authority (HRA) Research Ethics Committee London – (Brighton &</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">‘M’ and ‘F’ of the patient code denotes male or female, with 3 males and 7 females used for this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were regularly tested for mycoplasma contamination (MycoAlert™, Lonza).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">T-cells were stained with LIVE/DEAD™ fixable violet dead stain (ThermoFisher Scientific) and CD3 (BW264/56) and CD8α (BW135/80) antibodies (all from Miltenyi Biotec).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8α</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike transduced cells were firstly checked for with conjugated anti-rCD2 antibody (OX-34, BioLegend), then in follow-up experiments with 1 μg/test of unconjugated anti-SARS Spike glycoprotein antibody (1A9, Abcam, Cambridge, MA, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rCD2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS Spike glycoprotein</div><div>suggested: (Abcam Cat# ab273433, RRID:AB_2891068)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A goat anti-mouse secondary antibody (multiple adsorbed PE conjugated Ig polyclonal; BD Biosciences, Oxford, UK) was used to detect Spike antibody staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, antibody directed against TNF (clone cA2, Miltenyi Biotec) and CD107a antibody (clone H4A3, BD Biosciences) to detect activation-induced degranulation of cytotoxic T-cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TNF</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD107a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An optimised tetramer staining protocol involving pre-incubation with 50 nM protein kinase inhibitor, Dasatinib (Axon Medchem, Reston, VA, USA) and unconjugated anti-PE antibody (PE001, BioLegend) was used as described previously55–57.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PE</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-53749, RRID:AB_630095)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following tetramer staining, T-cells were stained with LIVE/DEAD™ fixable violet dead stain (ThermoFisher Scientific), anti-CD3 and anti-CD8 antibody and analysed using flow cytometry as above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, cells were stained with anti-HLA A2 antibody (clone BB7.2, BioLegend) and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HLA A2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were cultured in RPMI 1640 (A549 and T2) or DMEM (HEK293T) medium supplemented with 10% FBS, 2 mM L-glutamine and 100 U/mL penicillin and 100 μg/mL streptomycin (R10 or D10 respectively; all from Merck Group).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid/PEI mixtures were incubated at room temperature for 15 min, added dropwise to the HEK293T cells (80% confluence in one well of a 6-well plate) and incubated at 37°C in a 5% CO2 humidified atmosphere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: DSMZ Cat# ACC-873, RRID:CVCL_A5EF)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike genes were designed with a rCD2 co-marker: Xba1-Kozak-Spike-Xho1-P2A-rCD2-Sal1-Stop, and cloned in to pSF (Oxgene, Oxford Genetics Ltd, Littlemore, Oxford, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rCD2 co-marker: Xba1-Kozak-Spike-Xho1-P2A-rCD2-Sal1-Stop</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pSF plasmid was modified by removal of a Xho1 site present in the plasmid backbone and insertion of stop codons after the Sal1 site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For transfection, pSF or pELNS (1.52 μg), envelope plasmid (pMD2.G; 0.72 μg) and packaging plasmids (pMDLg/pRRE; 1.83μg and pRSV-REV; 1.83μg) were mixed in 300 μL of Opti-MEM, reduced serum medium (ThermoFisher Scientific) followed by mixing with 1 μg/μl Polyethylenimine (PEI; Merck Group) at a 3:1 PEI: plasmid ratio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSV-REV</div><div>suggested: RRID:Addgene_12253)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a FACSCantoII machine (BD Biosciences, Franklin Lakes, NJ, USA) and analyzed in the FlowJo software (Tree Star Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified products were sequenced on an Illumina MiSeq instrument using the MiSeq v2 reagent kit (Illumina, Cambridge, UK)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data display: Unless stated otherwise, all data were displayed using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.450181: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Study design, intranasal vaccination and virus challenge, and data/sample collection: All experimental procedures were approved by Johns Hopkins University Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">24 golden Syrian hamsters (Mesocricetus auratus, HsdHan®:AURA, 12 females, 12 males, 7-8 weeks old) were purchased from Envigo (Haslett, MI, USA) and were assigned to 3 immunization groups: 1) mock (vehicle) immunization, 2) unconjugated OMV (ctrl-OMV), and 3) RBD-OMV.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pulmonary sections were examined by a pathologist who was blinded to the experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were probed with primary antibodies: human anti-SARS-CoV-2 Spike (S-ECD/RBD) (cat# bcb03, Thermo Fisher, 1:1000, non-reducing conditions), anti-Salmonella typhimurium LPS (cat# ab8274, reducing conditions, 1:1000), and mouse anti-6xHis (ab18184, Abcam, 1:2000, reducing conditions) in 5% blocking buffer in PBS containing 0.1% v/v Tween 20 (PBS-T), incubating overnight at 4°C on a shaker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Salmonella</div><div>suggested: (Abcam Cat# ab8274, RRID:AB_306423)</div></div><div style="margin-bottom:8px"><div>anti-6xHis</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were washed 3x with PBS-T and incubated for 1 h at room temperature with appropriate secondary antibodies: mouse IgGk-BP-HRP (cat# sc-516102, SantaCruz) or goat anti-human-HRP (cat# 31410, Thermo Scientific), diluted 1:10,000 in 5% blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a PBS rinse, grids were blocked in 1% BSA in PBS (30 min), followed by incubation with primary antibodies mouse anti-Spike (clone MM43, Sino Biological, 1:100) and mouse anti-S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: (Sino Biological Cat# 40591-MM43, RRID:AB_2857934)</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-particle interferometric reflectance imaging sensing (SP-IRIS): OMVs were pre-diluted 1:500 in PBS, followed by 1:1 dilution in incubation buffer (IB), and incubated at room temperature on ExoView R100 (NanoView Biosciences, Brighton, MA) custom virus chips printed with SARS-CoV2-Spike antibodies (clones D001, D003, MM43, Sino Biological),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV2-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chips were then incubated for 1 h at RT with fluorescent antibodies against Spike (D001, CF555), (D003, CF647), (MM43, CF488) and LPS (CF647) diluted 1:1000 (final concentration of 500 ng/ml) in a 1:1 mixture of IB and blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>D001</div><div>suggested: (Sino Biological Cat# 40150-D001-H, RRID:AB_2857930)</div></div><div style="margin-bottom:8px"><div>CF555</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>D003</div><div>suggested: (Sino Biological Cat# 40150-D003, RRID:AB_2827982)</div></div><div style="margin-bottom:8px"><div>MM43</div><div>suggested: (Sino Biological Cat# 40591-MM43, RRID:AB_2857934)</div></div><div style="margin-bottom:8px"><div>CF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serology: Hamster antibody ELISA for RBD-specific IgG, IgA and IgM responses was performed as described previously (16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing plates 3x, HRP-conjugated secondary IgG (1:10000, Abcam, MA, USA), IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250, Brookwood Biomedical, AL, USA) antibodies were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated secondary IgG</div><div>suggested: (Creative Diagnostics Cat# LAB-22, RRID:AB_2489589)</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day 44, hamsters were challenged intranasally with 10^7 TCID50 of SARS-CoV-2 USA/Washington-1/2020, NR-52281 [BEI Resources, virus prepared as described previously (16)] diluted in 100 μl DMEM in an animal biosafety level 3 (ABSL3) facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NR-52281</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 1-h incubation at room temperature, the mixtures were added to VeroE6-TMPRSS2 cells in 96 well plates in sextuplet for 6 hours at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, tissue homogenates were 10-fold serially diluted in infection medium (Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2.5% fetal bovine serum, 1 mM glutamine, 1 mM sodium pyruvate, and penicillin (100 U/mL) and streptomycin (100 μg/mL) antibiotics), transferred in sextuplicate into 96-well plates containing confluent Vero-E6-TMPRSS2 cells (National Institute of Infectious Diseases,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both constructs were synthesized by IDT (Coralville, IA, USA) and cloned into the pIRESpuro3 vector (cat# 631619, Takara Bio, USA) using EcoRI and BamHI restriction enzymes (R0101S and R0136S respectively, New England Biolabs) and a Rapid Ligation Kit (cat# K1423, Thermo Fisher, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRESpuro3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of OMV-RBD vaccine platform: OMVs were produced from S. typhimurium SL3261 ΔtolRA ΔmsbB cells harboring the expression plasmid pHbpD(Δd1)-SpyCatcher as described previously (14) and resuspended in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHbpD(Δd1)-SpyCatcher</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gels were scanned on a GS-800 calibrated densitometer (Bio-Rad), and the intensities of protein bands were determined using ImageJ (http://imagej.nih.gov/ij/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

  2. Jun 2021
    1. Reviewer #1 (Public Review):

      Summary of the paper

      The authors' model is an extension of standard disease models (Kermack & McKendrick, 1927; Yang & Brauer, 2008) that track the spread of an infectious disease within a host population. The authors consider the possibility that individuals' level of activity (and thus their probability of contacting others and potentially transmitting or contracting the infectious disease) may vary in time. Importantly, individual activity levels vary according to a stochastic processes that is not in any way affected by the current disease dynamics in the population or by the individuals' own disease states.

      The authors' key result is that if individual social activity levels can spike or crash but then tends to return to their mean value, then synchronous spikes and/or crashes among many individuals' activity levels can lead to corresponding transient changes in the epidemiological dynamics. Waves take off when many individuals are active, but may peak well before herd immunity is reached, because individual activity levels regress to the mean.

      Nowhere in the authors' model does individual behavior depend upon individual disease state or population-level disease dynamics. There are many epidemiological models featuring adaptive host behavior; in these, individuals respond behaviorally to the disease. Those adaptive behavior models show disease dynamics that would not be seen in the standard (i.e. constant contact rate) Susceptible-Infectious-Recovered (SIR) model (see for instance Epstein et al., 2008; Fenichel et al., 2011; see Bauch et al., 2013 for an extensive review).

      This, then, is the authors' key result: behavioral change that is not responsive to the disease itself can still produce transient plateaus, sub-herd immunity peaks, etc. The authors thus offer a valuable null model that should be considered when responsive behavioral change models are proposed to explain observed epidemiological dynamics.

      I believe that this is an important result, especially in light of the explosion of adaptive behavior epidemiology that has accompanied the COVID-19 pandemic thanks to an unprecedented wealth of both epidemiological (e.g. case / hospitalization / death) and behavioral (e.g. Google Mobility) data (Nouvellet et al., 2021). Claims that responsive behavior explains observed epidemiology will need to improve upon this null model in some way in order to be persuasive. My principal reservation about the paper is that the model is presented less as such a null model and more as a mechanistic explanation of observed COVID-19 dynamics. I did not find the case for this interpretation sufficiently convincing, for reasons I will explain below.

      The authors find a number of other interesting results, including that stochastically time-varying behavior can reduce the likely "overshoot" of the disease attack rate beyond the herd immunity threshold, and can produce states of "Transient Collective Immunity". These results are a property of a previously-presented model developed by the same authors, in which individual activity levels may vary in time but not necessarily according to a defined stochastic process (Tkachenko et al., 2021). In general, given that this paper builds on that work, I would encourage the authors to be clearer about distinguishing their current results from their prior findings.

      The authors characterize the potential endemic state for a pathogen under their model (in the case that previously-exposed individuals can become once again susceptible on some timescale), and show that time-varying heterogeneous contact behavior again alters the dynamics of the approach to endemicity. Notably, they find that behavioral variation can reduce the amplitude of peaks and troughs on the way to endemicity, potentially avoiding stochastic extinction of the disease during troughs.

      The authors compare their analytical results to stochastic simulations based on the underlying stochastic process, and find good agreement. Finally, the authors fit their model to COVID-19 death data from United States geographical regions and compare predicted model trajectories to observed deaths.

      Key contribution of the paper

      In my view, the greatest strength of the paper is in providing a plausible null model for how adaptive behavior can modulate epidemiology even when it does not respond directly to disease, and in developing analytical results that give further insight into the origin and magnitude of these effects given the underlying model parameters.

      Concerns regarding the paper

      My principal concern about the paper is the implicit claim that the model explains the epidemiological patterns of COVID-19 in the United States during summer and fall 2020.

      The authors fit their model to US death data by estimating parameters related to the degree of mitigation as a function of time M(t), as well as some seasonality parameters affecting R0 as a function of time. It is not clear whether baseline R0 was also estimated, since it is not listed as a fixed.

      As the authors point out,monotonically increasing R0M(t) in a standard well-mixed SIR far from herd immunity would result in a single peak that overshoots the (ever-increasing) HIT. In the authors' fitted model, deaths in fact initially decline in the northeast and midwest before rising again, and the epidemic in the south displays two peaks separated by a trough.

      But I am not sure this is a particularly convincing demonstration of the correctness of a model as an explanation for the observed dynamics. Official distancing policies may have monotonically become more lax over the period June 1 through to, e.g., the fall. But restrictions were tightened in winter in response to surges, and there was clear signal of behavioral response to incresasing transmission that seems unlikely to have been mere regression to the mean.

      In the model, the mitigation function is fitted; no actual data on deliberate versus randomly-varying behavior change is used. Given clear empirical signals of synchronous and delibate response to epidemiology, modulated by social factors (Weill et al., 2020), a persuasive demonstration that consideration of random behavioral variation is necessary and/or sufficient to explain observed US COVID-19 dynamics would need to start from mobility data itself, and then find some principled way of partitioning changes in mobility into those attributable to random variation versus deliberate (whether top-down or bottom-up) action.

      My other main concern is that the central result of transient epidemiological dynamics due to transient concordance of abnormally high versus low social activity-stems from the choice to model social behavior as stochastic but also mean-seeking. While I find this idealization plausible, I think it would be good to motivate it more.

      In other words, the central, compelling message of the paper is that if collective activity levels sometimes spike and crash, but ultimately regress to the mean, so will transmission. The more that behavioral model can be motivated, the more compelling the paper will be.

      References

      Bauch, C., d'Onofrio, A., & Manfredi, P. (2013). Behavioral epidemiology of infectious diseases: An overview. Modeling the interplay between human behavior and the spread of infec- tious diseases, 1-19.

      Epstein, J. M., Parker, J., Cummings, D., & Hammond, R. A. (2008). Coupled contagion dy- namics of fear and disease: Mathematical and computational explorations. PLoS One, 3(12), e3955.

      Fenichel, E. P., Castillo-Chavez, C., Ceddia, M. G., Chowell, G., Parra, P. A. G., Hickling, G. J., Holloway, G., Horan, R., Morin, B., Perrings, C., et al. (2011). Adaptive human behav- ior in epidemiological models. Proceedings of the National Academy of Sciences, 108(15), 6306-6311.

      Kermack, W. O., & McKendrick, A. G. (1927). A contribution to the mathematical theory of epidemics. Proceedings of the Royal Society of London, Series A, 115(772), 700-721.

      Nouvellet, P., Bhatia, S., Cori, A., Ainslie, K. E., Baguelin, M., Bhatt, S., Boonyasiri, A., Brazeau, N. F., Cattarino, L., Cooper, L. V., et al. (2021). Reduction in mobility and covid-19 transmission. Nature communications, 12(1), 1-9.

      Tkachenko, A. V., Maslov, S., Elbanna, A., Wong, G. N., Weiner, Z. J., & Goldenfeld, N. (2021). Time-dependent heterogeneity leads to transient suppression of the covid-19 epidemic, not herd immunity. Proceedings of the National Academy of Sciences, 118(17).

      Weill, J. A., Stigler, M., Deschenes, O., & Springborn, M. R. (2020). Social distancing responses to covid-19 emergency declarations strongly differentiated by income. Proceedings of the National Academy of Sciences, 117(33), 19658-19660.

      Yang, C. K., & Brauer, F. (2008). Calculation of R0 for age-of-infection models. Mathematical Biosciences & Engineering, 5(3), 585.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Responses to reviewers’ comments

      We thank the reviewers for their encouraging comments and helpful suggestions.

      Reviewer #1

      (Evidence, reproducibility and clarity (Required)):

      Sanchez et al report several new findings about the adhesive protrusions on Plasmodium falciparum infected erythrocytes. Using super resolution microscopy and correlation analysis, they tracked associations between the knob protein KAHRP and erythrocyte membrane cytoskeleton proteins. They have expanded on and improved previous work on the unusual spiral structure of the knobs, which appears to be a spiral ribbon or blade and have shown a developmental pathway for the association of KAHRP with the cytoskeleton. They have localised KAHRP close to the spiral and determined its abundance in the knobs. They have also used cryo electron tomography and subtomogram averaging to get an improved 3D view of the knob structure.

      The work appears to be carefully and thoroughly done, and the paper is clearly written, though non specialists in the optical methods may find it challenging to navigate through the many super resolution images and correlation plots.

      Comment 1: The writing needs minor editing to fix a variety of small linguistic errors and typos. For example, line 97 "sideway positions" (they presumably mean lateral location), line 980 typo overlay, line 366 "then could reorganizes", line 435, "a predict volume".

      We apologize for the linguistic errors and typos. These have been corrected in the revised manuscript.

      (Significance (Required)):

      Comment 2: The study provides a distinct advance on the previous state of knowledge of the structure and biochemistry of the knobs. The knobs play a key role in virulence of P. falciparum and they are quite poorly understood. Although this paper does not represent a major breakthrough in determining the molecular structure or mechanistic role of the knobs, e.g. the biochemical identity of the spiral remains unknown, the new information is valuable and likely to be important in understanding the pathogenic actions of P falciparum.

      We thank the reviewer for appreciating the importance of our study. We believe that our first-time observations on the dynamics of KAHRP are a very important advance in the field and that revealing the mechanistic basis is a great challenge that at the current stage has to be left to future work.

      Comment 3: The interpretation shown in Figure 7 seems fine, except for the proposal that the actin cytoskeleton is reorganised. There is no evidence for that. The cryo tomograms of the cytoskeleton in Watermeyer et al addressed this point and did not find any evidence for reorganisation of the cytoskeleton other than the insertion of the knobs.

      In two previous studies we could show that actin is indeed reorganized by the parasite. It is mined from the protofilaments to generate long actin filaments that connect the knobs with the Maurer’s clefts and which are used for trafficking of cargo vesicles from the Maurer’s clefts to the erythrocyte plasma membrane (Cyklaff et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 2011 334:1283-1286; Cyrklaff et al. Oxidative insult can induce malaria-protective trait of sickle and fetal erythrocytes. Nat Commun. 2016 7:13401). Moreover, a life-cycle resolved AFM-study of the cytoplasmic side of iRBCs by the group of CT Lim has demonstrated dramatic coarsening of the spectrin network, which must be accompanied by changes to the actin component of the skeleton (Shi, Hui, et al. "Life cycle-dependent cytoskeletal modifications in Plasmodium falciparum infected erythrocytes." PLoS One 8.4 (2013): e61170). Coarsening of the actin-spectrin network would imply a decrease of the amount of actin in the network, which is consistent with its use in the parasite-derived long actin filaments.

      \*Referee Cross-commenting***

      I also agree with the other 2.

      Reviewer #2

      (Evidence, reproducibility and clarity (Required)):

      Malaria parasites replicate within circulating red blood cells (RBC). During parasite maturation, the parasite coordinates extensive modification of the host cell, including structural modifications of the RBC cytoskeleton and surface membrane. These host cell alterations play crucial roles in the pathology of malaria, including vascular adhesion by parasitised cells and avoidance of splenic clearance, and so are of great interest. This interesting manuscript describes a detailed examination of the role in these RBC modifications of a well-described parasite protein called KAHRP. Using a combination of cutting-edge super-resolution microscopy, cryo-electron tomography, immuno-EM, SEM and parasite mutagenesis, the authors provide evidence that KHARP localisation alters during parasite maturation but eventually becomes closely associated with the previously-described spiral structures that underlie infected RBC surface membrane protrusions called knobs. The authors provide improved resolution of the spiral formations, generate a quantitative estimate of the number of KAHRP molecules per knob, and provide a model for the role of KAHRP in attaching other proteins to the spirals based on their observations.

      In general, this study is thorough and well-performed, and the conclusions drawn are well-supported by the data. Although the work does not advance understanding of knob function or the parasite components that form the bulk of the spirals, it provides an interesting and useful contribution to understanding of the manner in which this important pathogen manipulates its host cell.

      We thank the reviewer for appreciating the importance of our study and in acknowledging that it is an important intermediate step towards a complete understanding of skeleton remodelling by the parasite.

      I have just a few minor suggestions that should improve the manuscript.

      Comment 1: Line 91 (Page 2 paragraph 2). It would be greatly helpful here if the authors could provide a more detailed background on the makeup of the RBC cytoskeleton, and in particular the interactions between beta-spectrin and the actin protofilaments of the junctional complexes. The authors should make it clear that the actin-binding domain of beta-spectrin comprises 2 calponin like domains, and that these are attached to the end of the tandem spectrin repeat domains that make up the bulk of the molecule.

      We thank the reviewer for this helpful suggestion and have added a new paragraph to the results section providing detailed background information on the makeup of the RBC membrane skeleton. The new text reads as follows:

      “Major components of the red blood cell membrane skeleton are spectrin and actin filaments (Fig. 1B). The spectrin filaments consist of α- and ß-spectrin, which form α2ß2 heterotetramers by head-to-head association of two αß dimers (Lux, 2016; Machnicka et al., 2014). The N-termini of the ß-spectrin subunits are positioned at the tail ends of the heterotetramer and contain two calponin homology (CH) domains for binding to actin protofilaments consisting of 6 to 8 actin monomers in each of the two strands (Lux, 2016; Machnicka et al., 2014). Protein 4.1R strengthens the spectrin actin interaction (Lux, 2016; Machnicka et al., 2014). Groups of up to six spectrin heterotetramers can attach to an actin protofilaments, resulting in a pseudohexagonal meshwork (Lux, 2016). Ankyrin binds to the C-terminal domain of ß-spectrin and connects integral membrane proteins with the actin spectrin network in an ankyrin complex (Lux, 2016; Machnicka et al., 2014).”

      Comment 2: Line 97 "These values are slightly larger than the reported physical dimension of the protofilament...". Please provide these reported dimensions here, as well as relevant references.

      The requested information is now provided. The sentence now reads as follows:

      “These values are slightly larger than the reported physical dimension of the protofilaments of ~37 nm (Lux, 2016) and might be explained by the lateral localization of the spectrin binding sites and the additional sizes of the primary and secondary antibody trees used to detect the two targets.”

      Comment 3: Line 366 "reorganize"

      The spelling mistake has been corrected.

      (Significance (Required)):

      Comment 4: This is a useful technical advance in understanding of the structure of the P. falciparum-infected red blood cell, and builds on the work of Watermeyer et al. (2016). The study should certainly be of interest to most malaria researchers, particularly those interested in the pathobiology of the organism.

      We thank the reviewer for supporting our study.

      \*Referee Cross-commenting***

      I fully agree with and endorse the comments of the other 2 reviewers.

      Reviewer #3

      (Evidence, reproducibility and clarity (Required)):

      The binding of P. falciparum infected erythrocyte (iRBCs) to the endothelium is mediated by protuberances (knobs). These knobs are assembled by a multi-protein complex at the iRBC surface. It acts as a scaffold for the presentation of the major virulence antigen, P. falciparum Erythrocyte Membrane Protein-1 (PfEMP1). The knob-associated histidine-rich protein (KAHRP) is an essential component of the knobs and therefore essential for the binding of iRBC to the endothelium under physiological conditions. This manuscript focusses on the knob architecture and KAHRP localization.

      Comment 1: It is, at least for this reviewer - hard to assess how the "preparation of exposed membranes by hypotonic shock" and the analysis of the "inverted erythrocyte membrane ghosts" is i) reflective of the physiological architecture within the iRBC and ii) how the authors exclude remnants from Maurers clefts (MCs) in their preparation. The latter appears especially important for the interpretation of dynamic KAHRP repositioning, as MCs are mobile in early stages and non-mobile later on (e.g. McMilian et al. 2013, Grüring et al. 2011) and the authors observed at least some MAHRP1 signal (Figure S8), which is hard to interpret by the single representative image provided.

      We understand the reviewer’s concerns, but are convinced that we have done the necessary controls to evaluate our approaches. For example, we evaluated the exposed membrane approach by investigating uninfected erythrocytes and comparing the findings with literature reports (see Figure 1). A high degree of agreement was observed. We further would like to point out that the exposed membrane approach has been successfully used by several other studies referenced in the manuscript (Dearnley et al., 2016; Looker et al., 2019; Shi et al., 2013). Please also allow us to explain why we have used exposed membranes instead of whole cells. The reason is that the hemozoin produced by the parasite interferes with STED microscopy, resulting in a quick and strong build-up of resonance energy in the specimen and, eventually, in the disruption of the cell.

      With regard to the question of whether remnants of Maurer’s clefts are present in our preparations, we do not think so, at least we never observed membrane profiles reminiscent of Maurer’s clefts in SEM images of exposed membranes (see figure at the end of the response letter). Irrespectively, we will double check this result using STED imaging of exposed membranes treated with an antibody against the established Maurer’s clefts marker SBP1. These data could be added to a revised manuscript.

      Comment 2: line 173: Please provide a detailed description about parasite synchronization (also absent in the methods section).

      A detailed description including references are now added to the methods section:

      “For synchronization of cultures, schizont-infected erythrocytes were sterile purified using a strong magnet (VarioMACS, Miltenyi Biotec) (Staalsoe et al., 1999) and mixed with fresh erythrocytes to high parasitaemia. 5000 heparin units (Heparin-sodium 25000, Ratiopharm) were added and the cells were returned to culture for 4 hrs (Boyle et al., 2010). Following the treatment with heparin, cells were washed with pre-warmed supplemented RMPI 1640 medium and then returned to culture for 2 hrs to allow for re-invasion of erythrocytes. Subsequently, cells were treated with 5% sorbitol to remove late parasite stages (Lambros and Vanderberg, 1979).”

      Comment 3: line 136: Please re-check nomenclature of "PHIS1605w" (mixed nomenclature used throughout the manuscript). I suggest to use either LyMP or the up-to-date ID PF3D7_0532400.

      We apologize for the oversight and now consistently use the ID PF3D7_0532400.

      Comment 4: Please provide source and references for PfEMP1, MAHRP1 and "PHIS1605w" antibodies that are used. I cannot find them in the methods section or in Table S1.

      We apologize for the oversight and now provide the requested information in the amended Table S1.

      Comment 5: line 165: Warncke et al. (2016) appears to be misplaced as an appropriate MAHRP1 reference.

      We now cite the original MAHRP1 publication by Spycher et al. 2003.

      Comment 6: line 159: the sentence "The strong cross-correlation between KAHRP and actin is consistent with previous cryo-electron tomographic analysis showing long actin filaments connecting the knobs with Maurer's clefts in trophozoites (Cyrklaff et al., 2012; Cyrklaff et al., 2011; Cyrklaff et al., 2016)" could be moved to the discussion section.

      The sentence was indeed redundant with a section in the discussion and was removed.

      Comment 7: line 199: The text refers to Fig. 9AB - but should refer to 4AB or suppl. 11.

      We are sorry for this mistake and now refer to the correct figures in the revised manuscript.

      Comment 8: Fig. 4: A solid average for the number of subtomograms, but please provide information about what the arrowheads (4E) indicate.

      Thank you for this comment. The arrowheads indicate peripheral crown-like densities. We have updated the figure legend to clarify this issue.

      Comment 9: The "flexible periphery" is likely a combination of flexibility and occupancy as the average was made from subtomograms with varying number of turns in the spiral. As occupancy is likely a significant contributing factor to the average that should be discussed or at least mentioned.

      Thank you for this important comment. Indeed, a significant variation was observed between the individual knobs. The spirals have variable diameter, and the number of peripheral proteins also varied. We added measurements to the supplementary figure 11D. In addition, we update the text and extended the discussion.

      Comment 10. On that note, did the authors try and classify based on number of turns prior to averaging and if so did the authors see any differences in structures between few turn and many turn spirals?

      We attempted several classifications on the full knobs with variable masks. However due to a limited number of particles in the dataset we could not converge to stable solutions. Instead, we decided to adopt the subboxing strategy where locally ordered segments at the periphery could be analyzed. This showed several structural snapshot at the periphery of the knobs.

      Comment 11. What size mask was used? Was it a soft sphere around the core or big enough for the knobs with multiple spiral turns?

      While we attempted several alignments and classifications with variable masks, the final refinement and measurement of FSC was performed with a soft contour mask mask. We overlaid it with the structure in Figure S11F and uploaded it as a part of the EMDB deposition. We further show the masks used in this study in a new Figure S14.

      Comment 12. It might be useful for readers who are not familiar with Dynamo to provide a little bit more information about how the initial reference was produced. Additionally more information about the sub-boxing strategy ie: spacing etc. would helpful.

      Thank you very much for the suggestion. For the initial reference we manually aligned all the particles, summed them up and low-pass filtered them. We now describe it in the methods section.

      For the subboxing procedure we added more description to the main text:

      “40 segments were extracted at the radius of the 2nd and 3rd spirals followed by their classification into structural classes.”

      We further extended and simplified the description in the results section (line ~221).

      Comment 13: Fig. 5 Additional (earlier) maturation stages of the iRBC with Ni2+NAT-gold-labelling would be a nice add on - this could help confirm the model and would itself be a control for the later stage labelling.

      We thank the reviewer for this insightful suggestion. We are currently performing the proposed experiment and will include it in a revised version of the manuscript.

      Comment 14: line 637: DMSI typo and please provide the supplier for DMSI (DSM1).

      We corrected the typographic error and now provide the name of the supplier.

      Comment 15: Figure 7: Please provide what the purple arrows indicate.

      The figure legend has been updated.

      Comment 16: Fig S11D: The labels X, Y and Z are confusing, describing the slicing axis as "XZ, YZ and XY" view is more intuitive.

      Done as suggested by the reviewer.

      Comment 17: Figure S13 B: WBs are cropped. Please provide un-cropped WB.

      Uncropped Western blots will be provided in the revised manuscript.

      (Significance (Required)):

      In general, I highly appreciated the solid data and its thorough analysis of the microscopy data. The authors investigate the structural organization of knobs in iRBCs using high-resolution imaging techniques including STED and PALM super-resolution microscopy-based approaches and electron tomography. The beauty of this paper is that it does nicely re-investigate knob architecture in iRBC (e.g. Watermeyer et al., 2016, Cutts et al., 2017, Looker et al., 2019, McHugh et al., 2020) and provides some intriguing KHARP co-localization with cytoskeleton components. The downside of it is that - by nature - it is descriptive (and the data rather confirmative) and as it stands does not provide us with a deeper molecular dissection of the knob associated structure and its cellular function.

      We thank the reviewer for appreciating our study and would like to emphasize the following novelties in our study:

      • We show that the association of KAHRP with membrane skeletal components is highly dynamic and changes as the parasite matures. Our results on the dynamics of KAHRP organization reconciles conflicting reports in the literature, and establish for the first time a dynamical model for KAHRP organization.
      • We further show that KAHRP finally assembles at remnant actin-junctional complexes devoid of the actin-capping factors adducin and tropomodulin.
      • We further quantified the number of KAHRP molecules per knob and show that KAHRP is present as 60 copies per knob, a number one order of magnitude greater than previously thought.
      • Last but not least, we provide a 35 Å map of the spiral scaffold underlaying knobs and show that KAHRP associates with the spiral scaffold.
      • We conclude by providing a novel model on the biological function of KAHRP by proposing that KAHRP acts as a glue that connects spectrin and parasite-remodeled actin filaments with the knob spiral.

        \*Referee Cross-commenting***

      Fully agreed.

      Boyle, M.J., Wilson, D.W., Richards, J.S., Riglar, D.T., Tetteh, K.K., Conway, D.J., Ralph, S.A., Baum, J., and Beeson, J.G. (2010). Isolation of viable Plasmodium falciparum merozoites to define erythrocyte invasion events and advance vaccine and drug development. Proc Natl Acad Sci U S A 107, 14378-14383.

      Lambros, C., and Vanderberg, J.P. (1979). Synchronization of Plasmodium falciparum erythrocytic stages in culture. J Parasitol 65, 418-420.

      Lux, S.E.t. (2016). Anatomy of the red cell membrane skeleton: unanswered questions. Blood 127, 187-199.

      Staalsoe, T., Giha, H.A., Dodoo, D., Theander, T.G., and Hviid, L. (1999). Detection of antibodies to variant antigens on Plasmodium falciparum-infected erythrocytes by flow cytometry. Cytometry 35, 329-336.

    1. Knock, E. S., Whittles, L. K., Lees, J. A., Perez-Guzman, P. N., Verity, R., FitzJohn, R. G., Gaythorpe, K. A. M., Imai, N., Hinsley, W., Okell, L. C., Rosello, A., Kantas, N., Walters, C. E., Bhatia, S., Watson, O. J., Whittaker, C., Cattarino, L., Boonyasiri, A., Djaafara, B. A., … Baguelin, M. (2021). Key epidemiological drivers and impact of interventions in the 2020 SARS-CoV-2 epidemic in England. Science Translational Medicine, eabg4262. https://doi.org/10.1126/scitranslmed.abg4262

    1. Bolze, A., Cirulli, E. T., Luo, S., White, S., Cassens, T., Jacobs, S., Nguyen, J., Ramirez, J. M., Sandoval, E., Wang, X., Wong, D., Becker, D., Laurent, M., Lu, J. T., Isaksson, M., Washington, N. L., & Lee, W. (2021). Rapid displacement of SARS-CoV-2 variant B.1.1.7 by B.1.617.2 and P.1 in the United States [Preprint]. Infectious Diseases (except HIV/AIDS). https://doi.org/10.1101/2021.06.20.21259195

    1. Reviewer 2 (Public Review):

      The work by Ji et al is an interesting and rather comprehensive analysis of the trend of developing data-driven methods for developing brain-symptom dimension biomarkers that bring a biological basis to the symptoms (across PANSS and cognitive features) that relate to psychotic disorders. To this end, the authors performed several interesting multivariate analyses to decompose the symptom/behavioural dimensions and functional connectivity data. To this end, the authors use data from individuals from a transdiagnostic group of individuals recruited by the BSNIP cohort and combine high-level methods in order to integrate both types of modalities. Conceptually there are several strengths to this paper that should be applauded. However, I do think that there are important aspects of this paper that need revision to improve readability and to better compare the methods to what is in the field and provide a balanced view relative to previous work with the same basic concepts that they are building their work around. Overall, I feel as though the work could advance our knowledge in the development of biomarkers or subject level identifiers for psychiatric disorders and potentially be elevated to the level of an individual "subject screener". While this is a noble goal, this will require more data and information in the future as a means to do this. This is certainly an important step forward in this regard.

      Strengths:

      - Combined analysis of canonical psychosis symptoms and cognitive deficits across multiple traditional psychosis-related diagnoses offers one of the most comprehensive mappings of impairments experienced within PSD to brain features to date<br> - Cross-validation analyses and use of various datasets (diagnostic replication, pharmacological neuroimaging) is extremely impressive, well motivated, and thorough. In addition the authors use a large dataset and provide "out of sample" validity<br> - Medication status and dosage also accounted for<br> - Similarly, the extensive examination of both univariate and multivariate neuro-behavioural solutions from a methodological viewpoint, including the testing of multiple configurations of CCA (i.e. with different parcellation granularities), offers very strong support for the selected symptom-to-neural mapping<br> - The plots of the obtained PC axes compared to those of standard clinical symptom aggregate scales provide a really elegant illustration of the differences and demonstrate clearly the value of data-driven symptom reduction over conventional categories<br> - The comparison of the obtained neuro-behavioural map for the "Psychosis configuration" symptom dimension to both pharmacological neuroimaging and neural gene expression maps highlights direct possible links with both underlying disorder mechanisms and possible avenues for treatment development and application<br> - The authors' explicit investigation of whether PSD and healthy controls share a major portion of neural variance (possibly present across all people) has strong implications for future brain-behaviour mapping studies, and provides a starting point for narrowing the neural feature space to just the subset of features showing symptom-relevant variance in PSD

      Critiques:

      - Overall I found the paper very hard to read. There are abbreviation everywhere for every concept that is introduced. The paper is methods heavy (which I am not opposed to and quite like). It is clear that the authors took a lot of care in thinking about the methods that were chosen. That said, I think that the organization would benefit from a more traditional Intro, Methods, Results, and Discussion formatting so that it would be easier to parse the Results. The figures are extremely dense and there are often terms that are coined or used that are not or poorly defined.<br> - One thing I found conceptually difficult is the explicit comparison to the work in the Xia paper from the Satterthwaite group. Is this a fair comparison? The sample is extremely different as it is non clinical and comes from the general population. Can it be suggested that the groups that are clinically defined here are comparable? Is this an appropriate comparison and standard to make. To suggest that the work in that paper is not reproducible is flawed in this light.<br> - Why was PCA selected for the analysis rather than ICA? Authors mention that PCA enables the discovery of orthogonal symptom dimensions, but don't elaborate on why this is expected to better capture behavioural variation within PSD compared to non-orthogonal dimensions. Given that symptom and/or cognitive items in conventional assessments are likely to be correlated in one way or another, allowing correlations to be present in the low-rank behavioural solution may better represent the original clinical profiles and drive more accurate brain-behaviour mapping. Moreover, as alluded to in the Discussion, employing an oblique rotation in the identification of dimensionality-reduced symptom axes may have actually resulted in a brain-behaviour space that is more generalizable to other psychiatric spectra. Why not use something more relevant to symptom/behaviour data like a factor analysis?<br> - The gene expression mapping section lacks some justification for why the 7 genes of interest were specifically chosen from among the numerous serotonin and GABA receptors and interneuron markers (relevant for PSD) available in the AHBA. Brief reference to the believed significance of the chosen genes in psychosis pathology would have helped to contextualize the observed relationship with the neuro-behavioural map.<br> - What the identified univariate neuro-behavioural mapping for PC3 ("psychosis configuration") actually means from an empirical or brain network perspective is not really ever discussed in detail. E.g., in Results, "a high positive PC3 score was associated with both reduced GBC across insular and superior dorsal cingulate cortices, thalamus, and anterior cerebellum and elevated GBC across precuneus, medial prefrontal, inferior parietal, superior temporal cortices and posterior lateral cerebellum." While the meaning and calculation of GBC can be gleaned from the Methods, a direct interpretation of the neuro-behavioural results in terms of the types of symptoms contributing to PC3 and relative hyper-/hypo-connectivity of the DMN compared to e.g. healthy controls could facilitate easier comparisons with the findings of past studies (since GBC does not seem to be a very commonly-used measure in the psychosis fMRI literature). Also important since GBC is a summary measure of the average connectivity of a region, and doesn't provide any specificity in terms of which regions in particular are more or less connected within a functional network (an inherent limitation of this measure which warrants further attention).<br> - Possibly a nitpick, but while the inclusion of cognitive measures for PSD individuals is a main (self-)selling point of the paper, there's very limited focus on the "Cognitive functioning" component (PC2) of the PCA solution. Examining Fig. S8K, the GBC map for this cognitive component seems almost to be the inverse for that of the "Psychosis configuration" component (PC3) focused on in the rest of the paper. Since PC3 does not seem to have high loadings from any of the cognitive items, but it is known that psychosis spectrum individuals tend to exhibit cognitive deficits which also have strong predictive power for illness trajectory, some discussion of how multiple univariate neuro-behavioural features could feasibly be used in conjunction with one another could have been really interesting.<br> Another nitpick, but the Y axes of Fig. 8C-E are not consistent, which causes some of the lines of best fit to be a bit misleading (e.g. GABRA1 appears to have a more strongly positive gene-PC relationship than HTR1E, when in reality the opposite is true.)<br> - The authors explain the apparent low reproducibility of their multivariate PSD neuro-behavioural solution using the argument that many psychiatric neuroimaging datasets are too small for multivariate analyses to be sufficiently powered. Applying an existing multivariate power analysis to their own data as empirical support for this idea would have made it even more compelling. The following paper suggests guidelines for sample sizes required for CCA/PLS as well as a multivariate calculator: Helmer, M., Warrington, S. D., Mohammadi-Nejad, A.-R., Ji, J. L., Howell, A., Rosand, B., Anticevic, A., Sotiropoulos, S. N., & Murray, J. D. (2020). On stability of Canonical Correlation Analysis and Partial Least Squares with application to brain-behavior associations (p. 2020.08.25.265546). https://doi.org/10.1101/2020.08.25.265546<br> - Given the relatively even distribution of males and females in the dataset, some examination of sex effects on symptom dimension loadings or neuro-behavioural maps would have been interesting (other demographic characteristics like age and SES are summarized for subjects but also not investigated). I think this is a missed opportunity.

    1. Reviewer #2 (Public Review):

      This manuscript describes a new method for estimating signal and noise correlations from two-photon recordings of calcium activity in large neuronal networks. Unlike existing methods that first require inferring spikes from calcium transients before estimating the correlations, the proposed method performs the correlation estimation directly from the fluorescence traces. It treats the different inputs to each neuron as latent variables to be inferred from its observed fluorescence activity, and divides these inputs according to whether they are provided by stimulus-dependent (signal) or stimulus-independent (noise) inputs. The authors showed with simulations that proper definitions of signal and noise correlations based on these inferred variables converge with trial repetition much faster to the true correlations than conventional estimates. They are not sensitive to blurring produced by inaccurate spike deconvolution and are less prone to erroneously mixing the signal and noise components of the correlations. By applying this new method to real optical recordings from the auditory cortex of awake mice, the authors shed new light on the structure of the circuitry underlying the processing of sound information in this brain region. Circuits processing sound-related and sound-independent information appear to be more orthogonal than previously thought, with a spatial signature that changes between thalamorecipient layer 4 and supragranular layers 2/3.

      This is a mathematical manuscript that introduces a promising new analysis approach. It is designed to be applied to two-photon experiments, that typically produce recordings of calcium activity of several hundred of neurons simultaneously. Because of their massive parallel recordings, which do not rely on spike sorting to identify single units, these optical techniques naturally provide access to correlation between units. They have given rise to a field of active research that attempts to link these correlations to elementary functional circuits in the brain. However, as the authors point out, the low efficiency of spike inference from calcium traces raises the need for correlation estimation approaches that circumvent this problem, as the method presented here does. As such, it could have a significant impact if the community succeeds in using it (see below).

      Weaknesses and strengths

      1) Public availability of the code implementing the new method is clearly necessary for the two-photon microscopy community to adopt it, and this is indeed the case at https://github.com/Anuththara-Rupasinghe/Signal-Noise-Correlation. However, it is also crucial that any end-user be able to get a clear picture of the conditions under which the method can or cannot be applied before diving in. The fact that such an applicability domain is not well defined is a major concern. Notably, each Real Data Study presented in the paper uses a preliminary selection of "highly active cells" (1rst study: N = 16; 2nd study: N = 10; 3rd study: N~20 per field), as the authors succinctly discuss that performance is expected to degrade "in the regime of extremely low spiking rate and high observation noise" (l. 518-519). But no precise criteria are provided to specify what is meant by "highly active cells". On the other hand, the authors also assume that there is at most one spiking event per time frame for each neuron, which seems to exclude bursting neurons. The latter assumption seems to be a challenge with respect to the example traces shown on Fig. 4C (F/F reaches 400%) and on Fig. 6C (F/F reaches 100%), considering that the GCaMP6s signal for a single spike is expected to peak below 10-20%. This forces the authors to take a scaling factor of the observations A = 1 x I (Real Data Study 1 and 3) or A = 0.75 x I (Real Data Study 2) compared to the A = 0.1 x I taken in the Simulation Studies. Therefore, it looks like if the Real Data Studies were performed on mainly bursting cells and each burst was counted as one spiking event. A detailed discussion of the usable range of firing rates, whether in spike or burst units, as well as the usable range of SNR should be added to the main text to allow future users to assess the suitability of their data for this analysis.

      2) Another parameter seems to be set by the authors on a criterion that is unclear to me: the number of time lags R to be included in the sound stimulus vector st. It seems to act as a memory of the past trajectory of the stimulus and probably serves to enhance the effect of stimulus onset/offset relative to the rest of the sound presentation. It is consistent with the known tendency of neurons in the primary auditory cortex to respond to these abrupt changes in sound power. However, this R is set at 2 in the Simulation Study 1, whereas it is set at 25, in the Real Data Studies 1 and 3, and to 40 in the Real Data Study 2. What leads to these differences escaped to me and should be explained more clearly.

      3) This memory of the past stimulus trajectory appears to be specific to the proposed method and is not accounted for in the 2-stage Pearson estimation, for example. Since it probably helps to reflect the common sensitivity of neurons to onset/offset, it alone provides an advantage to the proposed method over the 2-stage Pearson estimation. It would be instructive to also perform this comparison with R set to 1 to get an idea of the magnitude of this advantage.

      4) Finally, although the example of ground truth signal and noise correlation matrices taken to illustrate the method in the simulation study on Fig. 2A have been chosen to be with almost no overlap in their non-zero coefficients, there is no fundamental reason why this separation should be the rule for real data. These coefficients reflect the patterns of stimulus-dependent and stimulus-independent functional connectivity in the recorded network. As such, these patterns could have different degree of overlap, depending on the brain areas recorded. It is therefore particularly striking that the authors find in their data a strong dissimilarity and almost no covariance between signal and noise correlation coefficients, throughout all the different sets of experiments they present here (Fig. 4E, Table 1, 2, 3, and Fig. 6A&B). This makes a strong and compelling statement on the likely separation of the corresponding circuits in the primary auditory cortex of the mouse.

      Likely impact on the field

      It is now well established that sound processing is modulated, even at the level of primary auditory cortex, by locomotion (Schneider et al. Nature 2018), task engagement (Fritz et al. Nat. Neurosci. 2003), or several other factors. Applying the proposed method to these situations could help understand how sound processing circuits are remodeled, without confounding other coexisting processes. In general, whenever a brain structure makes associations between multiple processes within the same network, the presence of multiple circuits makes the observation of correlations difficult to attribute to the signature of a single circuit. By significantly improving the estimation of signal and noise correlations, the proposed method should help distinguish the boundaries of these circuits as well as their intersections. The exploration of the role of many secondary sensory and associative cortical structures could be renewed by this work.

    1. Author Response:

      Reviewer #1 (Public Review):

      This work described a novel approach, host-associated microbe PCR (hamPCR), to both quantify microbial load compared to the host and describe interkingdom microbial community composition with the same amplicon library preparation. The authors used the host single (low-copy) genes as PCR targets to set the host reference for microbial amplicons. To handle the problem that in many cases, the host DNA is excessive compared to the microbiome DNA, the authors adjusted the host-to-microbe amplicon ratio before sequencing. To prove the concept, hamPCR was tested with the synthetic communities, was compared to the shotgun metagenomics results, was applied in the biological systems involving the interkingdom microbial communities (oomycetes and bacteria), or diverse hosts, or crop hosts with large genomes. Substantial data from diverse biological systems confirmed the hamPCR approach is accurate, versatile, easy-to-setup, low-in-cost, improving the sample capacity and revealing the invisible phenomena using regular microbial amplicon sequencing approaches.

      Since the amplification of host genes would be the key step for this hamPCR approach, the authors might also include more strategy discussions about the selection of single (low copy) genes for a specific host and the primer design for the host genes to guarantee the hamPCR usage in the biological systems other than those mentioned in the manuscript.

      A deeper discussion about the design of suitable host primers has been added to the Supplementary Information as Supplementary Discussion 3, and is now mentioned in the main text in the first section of the Methods.

      Reviewer #2 (Public Review):

      Lundberg and colleagues provide a detailed set of data showing the utility of host-associated microbe PCR. By simultaneously amplifying microbial community and host DNA, hamPCR provides an opportunity to measure the microbial load of a sample. I was largely convinced about the robustness of this approach after seeing the many different optimization datasets that were presented in the paper. I also appreciated the various applications of hamPCR that were demonstrated and compared to other standard approaches (CFU counting and shotgun metagenomics, for example). As clearly illustrated in Figure 6f, hamPCR could dramatically improve our understanding of interactions within microbiomes as it helps remove issues of relative abundance data.

      One challenge about the approach presented is that it cannot be quickly adapted to a new system. Unlike most primers for 'standard' microbial amplicon sequencing, considerable time will be required to determine which host gene to target, how to make that host gene size larger than the size of the microbial amplicon, etc. This may limit wide adoption of hamPCR in the field. I do appreciate the authors providing some details in the Supplement on how they developed hamPCR for the several different systems described in this paper. The helpful tips may make it easier for others to develop hamPCR for their own systems.

      Additional strategy of primer design was addressed in the response to Reviewer #1 Public Review.

      An issue that repeatedly came up is that at high and low ends of host:microbe ratios, inaccurate estimates can occur. For example, with high levels of microbial infection, the authors note that hamPCR has reduced accuracy. The authors propose three solutions to this problem (1. altering host:microbe amplicon ratio, 2. use a host gene with higher copy number, 3. and adjust concentrations of host primers), but only present data for #1 and 3. Do they have any data to show that #2 would actually work?

      One instance of potential unreliable load that sticks out in the paper is in Figure 5b. The authors note that this is likely due to unreliable load calculation. Is this just one of 4 replicates? What are other potential reasons this would be an outlier and how can the authors rule this out? Did they repeat the hamPCR for this outlier to confirm the striking difference from the other three samples in the eds1-1 Hpa + Pto sample?

      Both qPCR and amplicon sequencing can be used to detect copy number variation in genomes [1]. Because amplicon-based methods are known to be sensitive to small differences in gene copy number, we are confident, without generating additional data on the topic, that #2 would work.

      Furthermore, bacterial genomes from different taxa are known to vary slightly in their copy number of 16S rDNA, usually from between 1 to about 15 copies [2]. These variations are reflected in sequence counts from amplicon sequencing, biasing the counts towards taxa with more 16S rDNA gene copies [2, 3, 4]. This phenomenon has been well documented, distorts the accurate description of microbial communities, and therefore has led to some efforts to correct 16S rDNA gene amplicon data by dividing the counts from each taxon by the (estimated) 16S rDNA copy number of that taxon, so that the counts better reflect the numbers of bacterial cells.

      Because amplicon methods are sensitive to copy number variation (whether those copies are from inside the same cell, or coming from different cells), we reasoned that choosing a host gene with a higher copy number, similar to the effects of copy number variation on 16S rDNA gene counts, will increase the representation of that host amplicon in the final library (because there will be more template host DNA molecules available to amplify). We did not test this explicitly - we think the evidence from literature is strong support on its own. We have added to the paper a statement that now references the Kembel 2012 paper, which we hope adequately supports our claim:

      “Second, a host gene with a higher copy number could be chosen for HM-tagging throughout the entire project, which would increase host representation by a factor of that copy number (Kembel et al., 2012).”

      1) Martins, W.F.S., Subramaniam, K., Steen, K. et al. Detection and quantitation of copy number variation in the voltage-gated sodium channel gene of the mosquito Culex quinquefasciatus . Sci Rep 7, 5821 (2017). https://doi.org/10.1038/s41598-017-06080-8

      2) Kembel, S. W., Wu, M., Eisen, J. A., & Green, J. L. (2012). Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology, 8(10), e1002743. https://doi.org/10.1371/journal.pcbi.1002743

      3) Starke, R., Pylro, V. S., & Morais, D. K. (2021). 16S rRNA Gene Copy Number Normalization Does Not Provide More Reliable Conclusions in Metataxonomic Surveys. Microbial Ecology, 81(2), 535–539. https://doi.org/10.1007/s00248-020-01586-7

      4) Louca, S., Doebeli, M., & Parfrey, L. W. (2018). Correcting for 16S rRNA gene copy numbers in microbiome surveys remains an unsolved problem. Microbiome, 6(1), 41. https://doi.org/10.1186/s40168-018-0420-9

      Could the DNA extraction method used cause biases in hamPCR for/against either the host or the microbiome? If two different labs study the same system (let's say bacterial communities growing on Arabidopsis leaves) but use different DNA extraction approaches, would we expect them to obtain different answers using hamPCR? Did the authors try several different DNA extraction methods to see if this is an issue? Or has another team of researchers considered this and addressed it in a separate paper? I would appreciate seeing either data to address this or a discussion paragraph that reasons through this.

      Differences in DNA extraction method will certainly change the results, not only of the microbe-to-plant ratio, but also in the representation of microbes, because microbes differ in their sensitivity to different lysis methods. This is a well-documented concern in microbiome studies and has been demonstrated by using different methods on the same mock community in papers such as the following:

      Yuan, S., Cohen, D. B., Ravel, J., Abdo, Z., & Forney, L. J. (2012). Evaluation of methods for the extraction and purification of DNA from the human microbiome. PloS One, 7(3), e33865. https://doi.org/10.1371/journal.pone.0033865

      Albertsen, M., Karst, S. M., Ziegler, A. S., Kirkegaard, R. H., & Nielsen, P. H. (2015). Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities. PloS One, 10(7), e0132783. https://doi.org/10.1371/journal.pone.0132783

      In short, if the DNA is not extracted because plant or microbial cells are not lysed, it cannot be amplified in PCR. However, there is a good overall strategy to minimize the problem, as also proposed in the above papers, and that is to err on the side of a harsher lysis (using strong bead beating, as we have done), since this will leave fewer cells unlysed (and thus less information will be hidden). We note that similar concerns about lysis methods changing results also apply to DNA extraction for qPCR and live bacterial isolation for CFU counting (for which too harsh a lysis will kill bacteria, but too gentle a lysis will not release them from host tissue).

      We addressed this in two places. First, in the results section we mention briefly the following:

      “All DNA preps employed heavy bead beating to ensure thorough lysis of both host and microbes, as an incomplete DNA extraction can lead to underrepresentation of hard-to-lyse cells (Albertsen et al., 2015; Yuan et al., 2012).”

      Second, we added a paragraph to the discussion about sample selection and DNA extraction as follows:

      “Because hamPCR can only quantify the DNA available in the template, choice of sample and appropriate DNA extraction methods are very important. In particular, the sample must in the first place include a meaningful quantity of host DNA. For example, although there is some host DNA in mammalian fecal samples or in plant rhizosphere soil samples, this host DNA does not accurately represent the sample volume, and therefore relating microbial abundance to host abundance probably has less value in these cases. Further, the DNA extraction method chosen must lyse both the host and microbial cell types. An enzymatic lysis suitable for DNA extraction from pure cultures of E. coli may not lyse host cells or even other microbes. Appropriate DNA preparation methods for metagenomics have been thoroughly evaluated elsewhere (Albertsen et al., 2015; Yuan et al., 2012), and a common point of agreement is that strong bead-beating increases the yield and completeness of the DNA extraction, but comes at the cost of some DNA fragmentation. Especially for short reads, as we have used here, this fragmentation is not a problem, and we recommend to err on the side of a harsher lysis, using strong bead beating potentially preceded by grinding steps using a mortar and pestle as necessary for tougher tissue.”

      One emerging theme in microbiome science is to have consistent methodologies that are used across studies/labs to allow direct comparisons of microbiome datasets. Standardization of approaches may make microbiome science more robust in the long-term. Given much of the nuance in developing hamPCR for different systems, my impression is that this method is best for comparing samples within a particular host-microbe system and not across systems. For example, it may be challenging to directly compare my bacterial load hamPCR data from Arabidopsis to another lab's if we used different Arabidopsis host genes or if we used different 16S gene regions. Can the authors unpack this a bit in a discussion paragraph? If it is widely adopted, is there a way to standardized hamPCR so that it can be consistently used and compared across datasets? Or should that not be the goal?

      There appears to be considerable non-specific amplification or dimers in the gels presented throughout the manuscript. Could this non-specific amplification vary across host-microbe primer combinations? Would this impact quantification of host and microbial amplicons?

      Non-specific amplification / dimers do vary across host-microbe primer combinations. Indeed, they also vary between common 16S rRNA primer pairs used on their own (not shown). Fortunately non-specific amplicons amplified during the exponential PCR step do not, at least with our method, seem to impact quantification of host and microbial amplicons.

      One reason is that non-specific amplicons can be recognized by their sequence and ignored. After the sequences of the amplicons have been extracted from the short read data, only those that match expected length and sequence patterns of the targeted amplicons need to be counted. Non-specific amplicons are certainly a nuisance because they represent wasted sequencing resources, but they can be excluded bioinformatically and therefore do not change the accuracy of the microbial load measurement. This is in contrast to ddPCR/qPCR, for which any off-target amplicons are also quantified!

      A second reason is that the sensitive exponential amplicon step of hamPCR is done with a single primer pair. Off-target sequences do squander PCR reagents including primers and dNTPs, such that they become limiting at earlier cycles than without off-target sequences, but because the exponential PCR step is done with a single primer pair, such inferior amplification conditions are shared by all molecules, and therefore do not differentially affect the host or microbial amplicon. Any off-target binding occurring in the initial tagging reaction (before the PCR step) would certainly be a concern if the reaction was carried on long enough, because for example the microbial primer pair might become limiting at an earlier cycle number, leading to underestimates of microbial load. However, limiting the tagging cycle to a low number of cycles ensures that – should primers targeting a particular host or microbial amplicon be non-specific – the fraction still available to bind the correct sequence remains in excess.

    1. SciScore for 10.1101/2021.06.16.448754: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The Institutional Review Board from the Yale University Human Research Protection Program determined that the RT-qPCR testing and sequencing of de-identified remnant COVID-19 clinical samples conducted in this study is not research involving human subjects (IRB Protocol ID: 2000028599).<br>IACUC: All procedures used in this study (sex-matched, age-matched) complied with federal guidelines and the institutional policies of the Yale School of Medicine Animal Care and Use Committee.<br>Euthanasia Agents: Animals were anaesthetized using a mixture of ketamine (50 mg/kg) and xylazine (5 mg/kg), injected intraperitoneally.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies for flow cytometry: Anti-mouse antibodies used in this study, together with vendors and dilutions, are listed as follows: FITC anti-mCD11c (N418) (1:400) (BioLegend), PerCP-Cy5.5 anti-mLy6C (HK1.4) (1:400) (BioLegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mCD11c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mLy6C</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following L a wash, cells were blocked with anti-mouse CD16/32 antibodies (BioXCell) for 30 min at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD16/32</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For determination of infectious titer, plaque assays were performed using lung homogenates in Vero E6 cells cultured with MEM supplemented with NaHCO3, 4% FBS, and 0.6% Avicel RC-581.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE2), B6(Cg)-Ifnar1tm1.2Ees/J (Ifnar1−/−), B6.129S7-Rag1tm1Mom/J (B6J Rag1−/−), and C.129S7(B6)-Rag1tm1Mom/J (BALB/c Rag1−/−) mice were purchased from the Jackson Laboratories and were subsequently bred and housed at Yale University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE2)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6.129S7-Rag1tm1Mom/J</div><div>suggested: RRID:IMSR_JAX:002216)</div></div><div style="margin-bottom:8px"><div>B6J Rag1−/−</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C.129S7(B6)-Rag1tm1Mom/J</div><div>suggested: RRID:IMSR_JAX:003145)</div></div><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div><div style="margin-bottom:8px"><div>Rag1−/−</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rag2−/− mice were generously gifted from R. Flavell (Yale University).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rag2−/−</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethics: The Institutional Review Board from the Yale University Human Research Protection Program determined that the RT-qPCR testing and sequencing of de-identified remnant COVID-19 clinical samples conducted in this study is not research involving human subjects (IRB Protocol ID: 2000028599).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0) (BD Biosciences), and Pacific Blue anti-mI-A/I-E (M5/114.15.2) (1:400) (BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo software version 10.6 software (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical tests were calculated using GraphPad Prism (GraphPad software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.17.448814: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Approval of animal experiments was obtained from the Institutional Animal Care and Use Committee of the Rocky Mountain Laboratories.<br>Euthanasia Agents: Inoculation experiments: After 16 weeks, animals were then inoculated intranasally (I.N.) under isoflurane anaesthesia. I.N. inoculation was performed with 40 µL sterile Dulbecco’s Modified Eagle Medium (DMEM) containing 8×104 TCID50 SARS-CoV-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">High-fat high-sugar diet: Four to six-week-old male Syrian Golden hamsters (ENVIGO) were randomly assigned to either regular rodent chow (Teklad Global 16%</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">High-fat high-sugar diet: Four to six-week-old male Syrian Golden hamsters (ENVIGO) were randomly assigned to either regular rodent chow (Teklad Global 16%</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Novus Biologicals #NBP2-38790) were detected using the Vector Laboratories ImPress VR anti-rabbit IgG polymer (# MP-6401) as the secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-specific antibodies were detected with goat anti-hamster IgG Fc (horseradish peroxidase (HRP)-conjugated, Abcam) for 1 h at RT and visualized with KPL TMB 2-component peroxidase substrate kit (SeraCare, 5120-0047).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hamster IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytokine analysis: Cytokine concentrations were determined using a commercial hamster ELISA kit for TNF-α, INF-γ, IL-6, IL-4, and IL-10 available at antibodies.com, according to the manufacturer’s instructions (antibodies.com; A74292, A74590, A74291, A74027, A75096).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TNF-α</div><div>suggested: (Bio-Rad Cat# M6000007NY, RRID:AB_2784537)</div></div><div style="margin-bottom:8px"><div>INF-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A74590</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A74291</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A75096</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus propagation was performed in VeroE6 cells in DMEM supplemented with 2% foetal bovine serum (FBS), 2 mM L-glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One hundred nanograms of RNA was used as input for rRNA depletion and NGS library preparation following the Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus workflow (Illumina).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining reads were aligned to the Mesocricetus auratus genome assembly version 1.0 using Hisat2 (Kim et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hisat2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed using the Bioconductor package DESeq2 (Love et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathway analysis was performed using Ingenuity Pathway Analysis (QIAGEN) and gene clustering was performed using Partek Genomics Suite (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining reads were mapped to the SARS-CoV-2 2019-nCoV/USA-WA1/2020 genome (MN985325.1) using Bowtie2 version 2.2.928 with parameters --local --no-mixed -X 1500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR duplicates were removed using picard MarkDuplicates (Broad Institute) and variants were called using GATK HaplotypeCaller version 4.1.2.029 with parameter -ploidy 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Morphometric analysis: IHC stained tissue slides were scanned with an Aperio ScanScope XT (Aperio Technologies, Inc.) and analyzed using the ImageScope Positive Pixel Count algorithm (version 9.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All univariate and multivariate analysis was performed using GraphPad Prism or MarkerView (AB Sciex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All graphs were designed in GraphPad Prism software (version 8.0.1; GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Taking the limitations of the model into account, our data further suggests the possible suitability of the Syrian hamster model to assess immunomodulatory therapies. While dietary advice for those suffering from metabolic diseases is proposed to reduce burden of severe COVID-19 (Demasi, 2021), it remains doubtful if any change in diet can impact disease outcome favorably after infection has occurred. Targeted immunomodulatory therapies, such as anti-IL-6 therapies, may be more efficient (Zhong et al., 2020). The Syrian hamster model may also be applied to further studies of selected aspects of NAFLD, which the model recapitulates. This model seems to present with an absences or limited amount of liver fibrosis; further work is needed to demonstrate how faithfully it assesses the direct effect of liver fibrosis on acute disease. However, it may be useful to assess long term post-COVID-19 NAFLD, to document further deterioration of liver damage (Portincasa et al., 2020) and the relation to infection sequelae.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.16.448642: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The THP-1 cells were seeded in 96-well V-bottom cell culture plates (Greiner Bio-One GmbH, Frickenhausen, Germany) at a density of 4×104 cells in 100 μL growth medium per well and allowed to settle for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cultivation of HUVEC Cells: HUVEC cells (Lonza) were cultivated in endothelial cell medium (EGM-2; Lonza) containing 2% fetal bovine serum (FBS) and vascular endothelial growth factor (VEGF) for rapid proliferation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUVEC</div><div>suggested: KCB Cat# KCB 200648YJ, RRID:CVCL_2959)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CCE was diluted 1:10 in Dulbecco’s Phosphate Buffered Saline (DPBS -/-) (Thermo Fisher Scientific Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DPBS -/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using Gen5 software (Biotek), the reference wavelength values were subtracted from the absorbance wavelength values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis and corresponding graphs were generated with Prism 9 software (GraphPad Software, San Diego, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-strand cDNA was synthesized from 500 ng RNA per sample using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following the standard protocol. cDNA (2.1 ng) served as template for a qPCR reaction using SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, USA) and forward and reverse primers in a final concentration of 333 nM each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primer sequences were designed with Primer-BLAST software (NCBI) (Table 1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer-BLAST</div><div>suggested: (Primer-BLAST, RRID:SCR_003095)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed with CFX Manager software 3.1 (Bio-Rad) using the 2-ΔΔCT method to calculate gene expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CFX Manager</div><div>suggested: (CFX Manager, RRID:SCR_017251)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.15.448611: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Bronchoscopy brushings were collected into collection media (RMPI (ThermoFisher) + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris)) and transported on ice to Draper (Cambridge, MA)19.<br>IRB: All research involving human subjects was approved by the MGH and Partners Healthcare System Institutional Review Board, and adhered to all applicable institutional and sponsor ethical guidelines, including but not limited to anonymization of donors for personal identity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were used to stain basal cells (CK5, Thermo Fisher), goblet cells (Muc5A, Thermo Fisher), ciliated cells (acetylated-tubulin, Abcam) and SARS-CoV-2 (Spike and Nucleocapsid proteins, GeneTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CK5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>acetylated-tubulin, Abcam</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 (Spike and Nucleocapsid proteins, GeneTex).</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 Spike and Nucleocapsid protein antibodies were combined when added to the PREDICT96-ALI airway tissues during primary antibody incubation steps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used were Alexa Fluor 488 goat anti-mouse IgG (Thermo Fisher) and Alexa Fluor 555 goat anti-rabbit IgG (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DH01 cells were thawed and plated at 15,000 cells per device in a 3 μL volume directly onto the membrane.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DH01</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells (ATCC) were plated in 6-well plates and incubated at 37°C and 5% CO2 until confluent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mean Fluorescence Intensity Quantification: 10x tile scans of the middle of each PREDICT96-ALI tissue device were captured on a Zeiss LSM700 laser scanning confocal microscope with Zen Black software (Zeiss).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen Black</div><div>suggested: (Black Zen software, RRID:SCR_018163)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MFI of the signal from the red channel, or the Nucleocapsid and Spike protein expression, of these regions was measured via ImageJ Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data are presented as mean ± standard deviation or standard error of the mean (indicated in figure legends) and were analyzed using Graphpad Prism version 9.0.0 for Windows (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Organ-on-chip technologies have the potential to overcome these limitations by offering human-relevant physiological fidelity in infection-based assays. However, these platforms have historically been challenged by excessive complexity and difficulty in direct application in pharmaceutical laboratory environments. Further, in the case of SARS-CoV-2 research, these models have so far been limited to the study of pseudovirus entry into cells rather than direct investigations of infection by the live virus. Here, we report the first SARS-CoV-2 infection study in a human primary cell-based airway-on-a-chip model. Further, we utilize human airway epithelial cells isolated from living donors via research bronchoscopies, a capability that provides the opportunity for evaluating mechanisms of infection for specific patient subpopulations. Our high throughput PREDICT96-ALI platform was successfully adapted to operation in a BSL-3 environment while retaining key biological attributes of functional respiratory tissue. Importantly, PREDICT96-ALI has the demonstrated capacity for use in high-throughput assays, a critical capability for practical drug discovery and therapeutic screening applications. Further development of this platform technology can enable the study of respiratory infections across large numbers of independent human cell donors, spanning a wide-range of demographics and co-morbidities in order to capture natural variability in the population. Leveraging all of its featur...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.16.448525: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: At study termination 6 DPC, all animals were terminally anesthetized by ketamine/xylazine, followed by exsanguination by cardiac puncture (for terminal blood collection) and euthanasia.<br>IACUC: Animal protocols and procedures were reviewed and approved by the Animal Care and Use Committee of both the US Army Medical Research and Development Command (USAMRDC) Animal Care and Use Review Office as well as the Institutional Animal Care and Use Committee of Bioqual, Inc. (protocol number 20-144).<br>Field Sample Permit: Oversight of all research was approved and conducted by the WRAIR Institutional Biological Safety Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Syrian golden hamster immunizations: Male and female Syrian golden hamsters (6-8 week-old, n = 55) were acquired from Charles River Laboratories and housed at Bioqual, Inc., for the duration of the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All tissue slides were evaluated by a board-certified veterinary anatomic pathologist blinded to study group allocations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection, Expression and Purification of SpFN 1B-06-PL: Expi293 cells (Gibco, Cat No. A14527) were maintained and passaged as per manufacturer’s guidelines in Expi293 Expression Media (Gibco, Cat No. A1435101) at 37°C, 8% CO2, 120 RPM, ≥ 60% RH.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stock propagation and preparation: B.1.1.7 viral stocks were generated from seed stock (USA/CA_CDC_5574/2020), obtained from BEI resources (Cat # NR-54011, Lot # 70041598) and expanded in Calu-3 cells (incubated at 37°C for 3 days).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral stock lot used for this study (Lot # 012921-1230) was titrated in Vero-TMPRSS2 cells, with viral titers of 1.375 × 106 PFU/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, hCoV-19/USA/MD-HP01542/2021 (B.1.1.351) was derived from the seed stock (Lot# MD-HP JHU P2) and propagated in in VeroE6-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293F-Spike-S2A cells were incubated with 100 μl of plasma diluted 100-fold in RPMI containing 10% FBS (R10) for 30 minutes at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F-Spike-S2A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectivity and neutralization titers were determined using ACE2-expressing HEK293 target cells (Integral Molecular).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero TMPRSS2 cells were plated at 25,000 cells per well in DMEM supplemented with 10% FBS and gentamicin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the transfection reaction consisted of 1mg of purified, cGMP sourced plasmid DNA (Aldevron, pCoV 1B-06-PL) plus 3mL of Turbo 293 Transfection Reagent (Speed Biosystems, Cat No. PXX1001) mixed in 1X PBS per liter of transfected cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCoV 1B-06-PL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-1 and SARS-CoV-2 pseudovirus neutralization assay: Pseudovirions were produced by co-transfection of HEK293T/17 cells with either the SARS-CoV-1 (Sino 1-11, GenBank # AY485277) or SARS-CoV-2 (WA1/2020 GenBank # MT246667) S expression plasmid and an HIV-1 pNL4-3 luciferase reporter plasmid (pNL4-3.Luc.R-E-, NIH AIDS Reagent Program).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The design, production, stability, and initial characterization of SpFN adjuvanted with ALFQ has been described previously 20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALFQ</div><div>suggested: (aLFQ, RRID:SCR_005925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay equivalency for SARS-CoV-2 was established by participation in the SARS-CoV-2 Neutralizing Assay Concordance Survey (SNACS) run by the Virology Quality Assurance Program and External Quality Assurance Program Oversite Laboratory (EQAPOL) at the Duke Human Vaccine Institute, sponsored through programs supported by the National Institute of Allergy and Infectious Diseases, Division of AIDS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Assurance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Quality Assurance Program Oversite Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All statistical analysis were performed using GraphPad Prism version 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04784767</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SARS-COV-2-Spike-Ferritin-Nanoparticle (SpFN) Vaccine With A…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Woolf, K., McManus, I. C., Martin, C. A., Nellums, L. B., Guyatt, A. L., Melbourne, C., Bryant, L., Gogoi, M., Wobi, F., Al-Oraibi, A., Hassan, O., Gupta, A., John, C., Tobin, M. D., Carr, S., Simpson, S., Gregary, B., Aujayeb, A., Zingwe, S., … Pareek, M. (2021). Ethnic differences in SARS-CoV-2 vaccine hesitancy in United Kingdom healthcare workers: Results from the UK-REACH prospective nationwide cohort study [Preprint]. Public and Global Health. https://doi.org/10.1101/2021.04.26.21255788

    1. Hall, V. J., Foulkes, S., Saei, A., Andrews, N., Oguti, B., Charlett, A., Wellington, E., Stowe, J., Gillson, N., Atti, A., Islam, J., Karagiannis, I., Munro, K., Khawam, J., Group, T. S. S., Chand, M. A., Brown, C., Ramsay, M. E., Bernal, J. L., & Hopkins, S. (2021). Effectiveness of BNT162b2 mRNA Vaccine Against Infection and COVID-19 Vaccine Coverage in Healthcare Workers in England, Multicentre Prospective Cohort Study (the SIREN Study) (SSRN Scholarly Paper ID 3790399). Social Science Research Network. https://doi.org/10.2139/ssrn.3790399

    1. SciScore for 10.1101/2021.06.10.21258580: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cts were called from raw fluorescence data using the Cy0 algorithm from the qpcR package (v1.4-1) in R (Guescini et al., 2008), and manually inspected for agreement with the raw traces in the native BioRad Maestro software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRad Maestro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the L-BFGS method in the scipy.optimize.minimize function to find parameters α, β, c of the beta distribution that minimized the SSE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MCMC simulation was done with python 3.6.5, numpy 1.14.3, pandas 0.23.0, and scipy 1.1.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Wastewater surveillance is not subject to these social and logistical limitations and can therefore serve as a more instantaneous and unbiased readout of new cases during the pandemic. We and others have shown that wastewater likely detects a short period of high viral shedding early in infection (Hoffmann and Alsing, 2021; Wu et al., 2020a), whereas patients can test positive during PCR testing of respiratory samples for longer periods of time (Wölfel et al., 2020; Zheng et al., 2020), suggesting that wastewater could be more specific to newly infected patients. However, wastewater surveillance does not necessarily provide a readout of hospitalizations or deaths because these numbers also depend on who is infected and their access to healthcare, which cannot be distinguished via wastewater monitoring (Olesen et al., 2021). Therefore, wastewater should be used in conjunction with additional clinical data streams when making public health decisions related to hospitalizations and mortality. This study has several limitations. First, the interpretation of the WC ratio relies on the assumption that the viral shedding rate did not drastically change over the course of the pandemic. While some variants of SARS-CoV-2 have been reported to have higher shedding rates or longer shedding duration (Frampton et al., 2021; Kissler et al., 2021), the B.1.1.7 variant did not make up a large proportion of wastewater viral titers in the Boston Area until March 2021, well past the periods in t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.11.21258769: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Biological samples and chemicals: The study was performed in accordance with standard ethical principles and approved by the LifeBridge Health local institutional review board under Protocol # 1707882 and clinical trials # 04910971.<br>Consent: All patients provided written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">nLF assay for SARS-CoV-2 IgG antibody detection: To test a saliva sample, 200 μl of saliva was mixed with 10 μl Au-S1 and 50 μl Tris buffer in a 1.5 ml microcentrifuge tube.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test line image intensity and background intensity were read and analyzed by ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our work is that rigorous immunity assessments require serological neutralizing antibody quantification, raising the question of relevance of anti-SARS-CoV-2 spike protein levels in saliva and blood. However, neutralization assays are time-consuming and employ live viruses, which are unsuitable for mass vaccination studies. Several simplified neutralization assays have been developed without using live viruses20,40-42. Importantly, there have been mounting evidence that neutralizing antibody levels in COVID-19 patients are well correlated with antibodies against spike protein on the surface of SARS-CoV-214,16,20-22. Further, our results here showed that salivary anti-S1 IgG was well correlated with that in the blood for the mRNA vaccinated cohort as a whole (Figure 4) and at the individual level (Figure 5, Figure S4, and Figure S5). Such correlation has been seen recently for COVID-19 patients23,24,27 and in various other infectious diseases in the past few decades30,31. All of these results present a compelling case for monitoring salivary IgG against spike protein in vaccinated population as a non-invasive approach to assessing antibody levels and immunity. We clearly observed similar evolution trends and patterns for anti-S1 IgG in saliva and in blood. Since these antibodies are resulted entirely from vaccination, and when immunity wanes, salivary antibodies could also diminish. Continual monitoring of antibody persistence is crucial as COVID-19 vaccines ci...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.15.448497: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">NA oil objective lens at 30-35 random positions for each sample.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.3 Antibodies: All the antibodies used in this study are reported in the tables below:

      4.4 Cells and Viruses: Vero cells (ATCC CCL-81) were cultured under standard conditions (37°C and 5% CO2) in Dulbecco-modified MEM (Sigma Aldrich) supplemented with 10% heat-inactivated foetal bovine serum (Gibco), antibiotics/antimycotics (100 units/mL penicillin, 100 μg/mL streptomycin, 0.025 μg/mL Gibco Amphotericin B, Gibco) and 2 mM L-glutamine (GlutaMAX, Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibiotics/antimycotics</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The day before transfection, Vero cells were seeded at 30% confluence in 8-well Ibidi μ-slides (catalogue n. 80826) in antibiotic-free medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.5 Transfection of Vero cells: The four structural proteins of SARS-CoV-2 were expressed in Vero cells using a pEVAC vector backbone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEVAC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate RNA standards for qRT-PCR, a 97 nucleotide fragment of the spike ORF was cloned into the pJET1.2 vector (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJET1.2</div><div>suggested: RRID:Addgene_117131)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results of this experiment were reviewed and approved by the biosafety committee of the Department of Chemical Engineering of the University of Cambridge. 4.2 Chemicals: Methanol-free formaldehyde was purchased from Thermo Fisher Scientific; the ampoules were used immediately after opening and any leftover formaldehyde discarded.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The microscope was controlled using the Zen software (version 2.6) and for acquisition of 16-bit images a pinhole size of 1.0 Airy unit (AU) for each channel, a scan speed of 5 (1.47 μs / pixel) and 4x averaging were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.12 Deconvolution: Confocal images and deskewed light sheet microscopy data of expanded samples were deconvolved using the PSF Generator and DeconvolutionLab2 plugins in Fiji (47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spearman’s rank coefficients were computed by ColocAnalyzer as:

      Here d = rank(I1(q)) – rank(I2(q)) is the difference between ranks computed for pixel q in channel 1 and in channel 2 independently.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ColocAnalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.17 Spot detection and analysis: Nucleocapsid protein, dsRNA and lysosome spot detection and analysis from microscopy images were performed by a customized MatLab routine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MatLab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The OpenCV and scikit-image Python libraries were used for the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OpenCV</div><div>suggested: (OpenCV, RRID:SCR_015526)</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>


      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 5. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Rebuttal letter – Response to Reviewers

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      This study focused on P. vivax, which is an important neglected human malaria killer. The reported evidence will have a significant impact on diagnosing infectious diseases. The language in the manuscript is very good. However, some typos were reported. Some paragraphs might need particular attention to punctuation. Overall, the work is very good. The statistics are straight forward. However, there are a couple of major points that must be addressed before publication. Some of my comments are just recommendations to clarify some sections of the text.

      **Major comments:**

      The statistical methods can be improved by using generalised mixed models (GLMM).

      1- PCA graphs need to be organised in more descriptive ways. Dim1 and Dim2 in each axis need to be defined clearly in the figures. PCA in Fig2 c is very difficult to follow, and it needs to be organised.

      Answer: Figures have been amended to be more self-explanatory and clearer to the reader.

      2- In this study, patients were male and female, and we know already male and female haematological parameters are hugely different, specially Hb level, and so on. My question is how the sex variable is treated in this study? Did your control group were from both sexes? Sex could be treated as a random variable in all studies if GLMM models were used.

      Answer: Information in how the sex variable was treated in the study has been added to the methods section. In our cross-sectional study with uncomplicated P. vivax malaria patients seen at FMT-HVD in Manaus, Brazil, patients and healthy donors (controls) were matched by age and sex. In both groups, frequency of female individuals was 30% and male individuals 70%.

      We think sex is better fitted as fixed effect since only two levels for this factor are possible. Thus, we used linear models with age and sex as fixed variables for statistical testing and to ensure that the differences observed between P.vivax- infected patients and controls, as well as between the clusters, were only due to disease status. This analysis showed that red blood cells count, hemoglobin, hematocrit, MXD and neutrophils counts (this parameter only when comparing the clusters) needed to be corrected only due to sex influence. For these parameters, estimates of predicted sex influence were subtracted from the raw parameter values and residuals were used for statistical testing. We have added this information in the Methods section as indicated below:

      Page 6, line 128: Patients and healthy donors were age and sex-matched, with a frequency of 30% female and 70% male individuals in both groups.

      Page 14, line 336:

      To ensure that differences observed between P. vivax - infected patients and controls, as well as between the clusters, were due to disease status and not confounded by age or sex, the clinical parameters were fitted as response variables in a linear model with sex and/or age fitted as explanatory variables. Age and sex were included in the model if their coefficients were estimated as different from zero with p-value The residuals from the linear model were then used as age and/or sex corrected parameters in subsequent analyses.

      3- Why 6h and 18h used for the HUVEC evaluation?

      Answer. We ran several optimization experiments with individual plasma samples where we observed maximal mRNA expression changes after 6h of stimulation. For experiments detecting protein expression (IFA and flow cytometry), we increased the stimulation time to 18h. Preliminary experiments suggested this to be the optimal duration without compromising cellular viability.

      4- It is mentioned only neutrophil enriched in this study, if myelopoiesis is affected, why the other granulocytes were not showed significant enhancement?

      Answer: Our data reveal no change in the number of circulating neutrophils in the different clusters of individuals. However, mixed cell counts (MXD), a parameter representing monocytes, basophils and eosinophils numbers, was significantly reduced in Vivaxhigh patients. As a result, there was a significant enrichment of neutrophils in the leukocyte fraction in the blood of Vivaxhigh patients as well as a higher Neutrophil:Lymphocyte count ratio (NLCR) (Figure 4). In hematopoietic progenitors, stochastic changes in each factor’s concentration could result in one factor’s becoming more abundant and committing a hematopoietic progenitor to a particular lineage. To generate each mature granulocyte population (e.g. basophils, eosinophils and neutrophils), common myeloid precursor cells (CMPs) and later precursors for granulocytic and monocytic lineages (GMPs) follow in the BM different lineage commitment programs, tightly-regulated or instructed by a specific set of soluble factors, cell-cell interactions and transcription factors, that define cell fate decisions and lineage restrictions. For instance, differential PU.1 activity can specify different cell fates during haematopoiesis regulating monocyte and neutrophils differentiation. Genetic and biochemical analyses have shown that G-CSF can direct granulocyte differentiation by changing the ratio of C/EBPα to PU.1 (Zhu et al., Oncogene 2002; Friedman Oncogene 2002; Dahl et al., Nat Immunol 2003). High expression levels of PU.1 and C/EBPa, stimulated by G-CSF, promote GMP differentiation to neutrophils and inhibits monocyte differentiation, while only PU.1 expression, IRF-8 and lower expression/activity of C/EBPs induce GMP differentiation to monocytes (Zhu et al., Oncogene 2002; Friedman Oncogene 2002; Dahl et al., Nat Immunol 2003). Meanwhile, a combination of PU.1, C/EBPb and low levels of GATA-1 differentiates GMPs to eosinophil lineage (Kulessa et al., 1995; McDevitt et al., 1997; Yamaguchi et al., 1999) and PU.1 must also cooperate with GATA2 to direct mast cell differentiation (Walsh et al., Immunity 2002). In addition, eosinophil and basophil differentiation are induced by a different set of cytokines, usually produced in prevalent T-helper 2 response, such as IL-5, which should be inhibited in the strong Th1 environment evidenced by our and previous Luminex data in Pv patients. The enrichment of activated neutrophils in the peripheral circulation of P. vivax patients could be due to a response that specifically enhances neutrophil production and release from the bone marrow (BM). This hypothesis is supported by emerging evidence for enrichment of P. vivax parasites in the hematopoietic niche of BM, our Luminex data showing significant increase in pro-inflammatory cytokines associated with emergency myelopoiesis (e.g., TNF-a, IL-1a, IL-1b, IL-6, IL-8), and increased circulating levels of G-CSF, the major inducer of neutrophils production in the BM. Likewise, increased activation-induced cell death (AICD) in T cells, splenic T-cell and platelet accumulation or decreased lymphopoiesis due to myeloid-biased HSC differentiation induced by inflammatory cytokines and EC activation in the BM (refs 36,37,39) might explain the neutrophil enrichment in vivax patients.

      5- I would also ask the authors to speculate a bit on, What could be the mechanism behind the different function of P. vivax compared to P. falciparum? From an evolutionary perspective, the parasite should rather become softer and keep the host alive for its own benefit.

      Answer: One of the characteristics of P. vivax that could play an important role in immunity is its restriction to invade immature reticulocytes. For example, the infected reticulocyte could play a role in the presentation of parasite antigens as reticulocytes (but not mature RBCs) express MHC-I and are capable to process and present antigens on their surface for recognition by T cells. Indeed, it has been shown that reticulocytes act directly as an antigen-presenting cell, emphasizing the importance of erythrocyte surface antigens both in the induction as well as the target of a protective immune response (Burel et al 2016, Junqueira et al 2018). Recent investigations comparing P. vivax and P. falciparum controlled human infection models (CHMIs) also revealed marked differences in the immune profiles generated following infection with the two species and postulated that protective immune responses to Plasmodium are species-specific. It has been hypothesized that this difference is due to strict P. vivax tropism for MHC-I-expressing reticulocytes that, unlike mature red blood cells, can present antigen directly to CD8+T cells. Specifically, P. vivax but not P. falciparum infection led to the expansion of a specific subset of CD38+CD8+ T cells which were associated with an activated phenotype and cytotoxic potential. Corroborating Burel et al findings in the CHMI model, Junqueira et al showed that P. vivax–infected reticulocytes express HLA-I. In P. vivax-infected patients, CD8+ T cells in the peripheral blood express high levels of cytotoxic proteins, recognize and form immunological synapses with P. vivax–infected reticulocytes in HLA–dependent manner. Next, it was showed that P. vivax-specific CD8+ T cells release their cytotoxic granules to kill both host cell and intracellular parasite, which prevented reinvasion (Junqueira et al 2018). Although these data indicate a protective role of cytotoxic CD8+ T cells during P. vivax blood-stage malaria, it is not clear whether these lymphocytes would always be beneficial because they might contribute to anemia, inflammation or other pathological sequelae of infection, which needs to be further investigated.

      **Minor comments:**

      • It is important to have a reference, version, and date for the R software, packages and GraphPad.

      Answer: We have added version and date for the R and GraphPad software.


      2- In Fig 5, E missed to report. This figure can be better organised. It is very hard to read and follow.

      Answer: There is no E in Figure 5. We will organize the figure to make it easier to read and follow.

      Reviewer #2 (Significance (Required)):

        • vivax remains endemic in 51 countries across Central and South Americas, the Horn of Africa, Asia and the Pacific islands. In most areas it is co-endemic with P. falciparum, which has been the priority species to address for national malaria control programmes. Malaria related deaths are mostly attributable to the more pathogenic P. falciparum, but over the last decade these have declined, however there has been a consistent rise in the proportion of malaria cases due to P. vivax. However, because it is difficult to diagnose resistant strains, strategies to detect and track drug resistant P. vivax* are limited. In this context it is vital to develop better tools to assess diagnostic, antimalarial efficacy and drug susceptibility so that emerging drug resistance can be tracked, and novel treatment strategies explored. From my viewpoint, despite some statistical problems to understand the complex nature of data (mixed interactions among multiple variables), these findings seem to be very interesting and (after a major revision) worth to be published. As said before, the story told by the authors could become interesting.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The manuscript titled: "Total parasite biomass but not peripheral parasitaemia is associated with endothelial and haematological perturbations in Plasmodium vivax patients" by Silva-Filho et al., reinforce the original observation and data by the group of Nicholas Anstey and coworkers, who first proposed the use of plasma parasite lactate dehydrogenase and PvLDH as a marker of parasite biomass. In that work, it was already demonstrated that P. vivax biomass is related to plasma concentration of LDH levels. As such, the present work cannot be considered of high novelty. Yet, through a meticulous approach including clinical data, computational approaches, machine learning, LDH measurement, multiplex analysis and quantitave RT-PCR, the authors here have extended the original observations that a large biomass of P. vivax parasites is out of blood circulation. In contrast, unlike the original observations of Anstey´s group, a correlation between total parasite biomass and systemic levels of markers of endothelial cells activation, was observed. The manuscript is very well written and the discussion brings new knowledge in this key topic for elimination of malaria. This manuscript is therefore recommended for publication after the following comments are addressed.

      **Major comments:**

      1. The vascular endothelium plays a pivotal role in malaria. Therefore, to test whether cell and/or parasite factors affect the vascular endothelium, HUVEC cells were used in this study. This is of major concern as endothelial cells from the bone marrow, where most hematological disturbances, notoriously thrombocytopenia, occur, were not used instead. HUVEC cells seems the only endothelial cell that does not express ABO blood group antigens, thus suggesting that surface expression on these cells is highly altered (O´Donnell et al., 2000 J Vasc Res). Moreover, significant functional differences between HUVEC cells and adult vascular endothelium have been reported (Chan et al., 2004). Together, this indicates that results obtained with HUVEC cells might not reflect responses of the bone marrow vascular endothelium. As one of the corresponding authors have ample experience with working with human bone marrow endothelial cells (Mantel et al., 2016 Nat Comm), it is suggested to perform some experiments with these cells to assure extrapolation of the results obtained with HUVEC cells.

      Answer: We agree with the reviewer that performing ex vivo assays with primary human bone marrow endothelial cells would be an excellent alternative. However, we would like to argue that HUVECs are also suitable for our purposes. HUVECs are widely used to study endothelial barrier function, for example in the context of angiogenesis and inflammatory responses/barrier disruption. To emphasise this point, we have now referenced examples where HUVECs were used in the context of endothelial barrier biology and in different inflammatory conditions (see also lists a, b, c below).

      1. Papers showing the use of HUVECs in studies yielding important insights about endothelial barrier function
      • Krispin S et al. Growth Differentiation Factor 6 Promotes Vascular Stability by Restraining Vascular Endothelial Growth Factor Signaling. Arterioscler Thromb Vasc Biol. 2018.
      • Aranda JF et al. MYADM controls endothelial barrier function through ERM-dependent regulation of ICAM-1 expression. Mol Biol Cell. 2013.
      • Orsenigo F et al. Phosphorylation of VE-cadherin is modulated by haemodynamic forces and contributes to the regulation of vascular permeability in vivo. Nat Commun. 2012.
      • *
      1. Papers that used HUVECs in studies about endothelial barrier function in inflammatory conditions
      • Dickinson CM et al. Leukadherin-1 ameliorates endothelial barrier damage mediated by neutrophils from critically ill patients. J Intensive Care. 2018.
      • Kuck JL et al. Ascorbic acid attenuates endothelial permeability triggered by cell-free hemoglobin. Biochem Biophys Res Commun. 2018.
      • Tramontini Gomes de Sousa Cardozo F et al. **Serum from dengue virus-infected patients with and without plasma leakage differentially affects endothelial cells barrier function in vitro. PLoS One. 2017.
      • Fox ED et al. Neutrophils from critically ill septic patients mediate profound loss of endothelial barrier integrity. Crit Care. 2013.
      • Rahbar E et al. Endothelial glycocalyx shedding and vascular permeability in severely injured trauma patients. J Transl Med. 2015.
      • *
      1. Papers showing that HUVECs behave similarly to other endothelial cell types in regard to barrier function, except when the comparison is with blood brain barrier models
      • *

      • Totani L et al. Mechanisms of endothelial cell dysfunction in cystic fibrosis. Biochim Biophys Acta Mol Basis Dis. 2017, Dec;1863(12):3243-3253.

      • Gündüz D et al. Effect of ticagrelor on endothelial calcium signalling and barrier function. **Thromb Haemost. 2017 Jan 26;117(2):371-381.
      • Deitch EA et al. Mesenteric lymph from rats subjected to trauma-hemorrhagic shock are injurious to rat pulmonary microvascular endothelial cells as well as human umbilical vein endothelial cells. ** 2001 Oct;16(4):290-3. Importantly, we were able to reproduce in the HUVEC ex vivo assays a phenotype of endothelial perturbations that is inferred based on the in vivo Luminex data using the same plasma sample. These data also support our hypothesis that patients with higher parasite biomass present higher endothelial cell perturbations, corroborating the associations between parasite accumulation in deep tissues (total parasite biomass represented by PvLDH levels) and endothelial cell activation as demonstrated in the Figure 6.

      Strikingly, the authors stated that "P. vivax infection results in different ranges of EC alterations without massive cytoadhesion". This statement has no data supporting it. In fact, their own flow cytometry data convincingly demonstrated that exposure of HUVEC cells to plasma of vivax-high patients significantly increased the surface expression of ICAM-1 and VCAM. ICAM-1 expression is a well know receptor for cytoadhesion in malaria and Dr. Costa first demonstrated the importance of this receptor in cytoadherence of P. vivax (Carvalho et al., 2010). Moreover, these data are in some contradiction with the original observations of Anstey and collaborators who demonstrated that parasite LDH concentration did not correlate with markers of endothelial activation (Barber et al., 2015 PLoS Path). Therefore, this sentence should be modified to accommodate the alternative possibility of cytoadherence, deleted from the manuscript or binding functional assays should be performed to sustain it.

      Answer: We agree with the reviewer and have removed this statement.

      Page 22, line 543: The association between endothelial activation, Syndecan-1 and parasite biomass (PvLDH) indicates a positive feedback loop between glycocalyx breakdown, activation of endothelial receptors such as ICAM-1and VCAM-1 and parasite accumulation in deep tissues9,12.

      Extracellular vesicles are key players in pathology of malaria and this includes P. vivax where concentration of circulating microparticles were associated with acute infections (Campos et al., 2010 Mal J). Moreover, Dr. Marti has pioneered this field since the original manuscript describing the role of EVs in malaria as intercellular communicators (Mantel et al., 2013 Cell). More recently, his group also demonstrated that interaction of EVs with bone marrow endothelial cells induce expression of IL-6 and IL-1 as well as vascular endothelium perturbations after trans-endothelial electrical resistance experiments (Mantel et al., 2016 Nat Comm). Furthermore, another recent report showed the physiological role of EVs in vivax malaria by demonstrating that EV uptake by human spleen fibroblast induced nuclear translocation of the NF-kB transcriptional factor, concomitant with surface expression of ICAM-1, thus facilitating cytoadherence of infected reticulocytes from P. vivax patients (Toda et al., 2020 Nat Comm). This growing evidence indicates that plasma circulating EVs are key communicators in malaria infections potentially explaining some of the findings reported in this work. Neglecting the importance of EVs in the discussion of this article is not reasonable and weakens this manuscript. Including a paragraph on EVs and accurate references in the discussion is thus strongly recommended.


      Answer: We agree with the reviewer that extracellular vesicles are key communicators in malaria infection. We have not measured them in our study, however, and therefore can only speculate about their impact on our observations. We have added a phrase in the discussion:

      Page 27, line 661: It is likely that other circulating factors that we have not directly measured in our study are also contributing to EC activation and vascular permeability. In particular, extracellular vesicles (EV) originating from ECs, platelets, and RBCs are present during malaria infection and are known to modulate the host immune response to the parasite54-56 . In P. falciparum, infected RBCs release EVs containing immunogenic parasite antigens, that activate macrophages, induce neutrophil migration and alter endothelial barrier function54,55. In P. vivax, plasma-derived EVs from iRBCs are taken up by human spleen fibroblasts (hSFs). This event signals NF-kB translocation and upregulation of ICAM-1 expression, facilitating cytoadherence of P. vivax-infected reticulocytes56.

      **Minor comments:**

      1. The lack of a group including severe vivax malaria patients is a drawback of this article as this group would have firmly validated the predictor of severe disease.

      Answer: This study was investigating a cohort of uncomplicated P. vivax malaria compared to controls. We agree that it will be important to extent our analysis to severe vivax malaria in future studies.

      In the selection criteria of the patients to be included in the study, no information on other co-infections were mentioned. Is this information available? If so, this should be mentioned.

      Answer: As described in the Methods sections, Page 6, line 132, mono infection by P. vivax was confirmed by analysis of blood smears and quantitative PCR (qPCR) for both P. vivax and P. falciparum. We agree that excluding other coinfections could have been of interest. However, the differential diagnosis for an acute febrile illness is very broad and it would be impractical to track all other possible diseases. In addition, the patients included in the present work had mild disease, and therefore were discharged from hospital after a positive malaria diagnosis. No further investigation on other infections was done.

      The main coinfection to be considered for an acute febrile illness with no localizing signs in our context is Dengue Fever. Although Dengue coinfection in our cohort is possible, the incidence at the Hospital is only 2.8% (P. vivax/Dengue coinfection) (Magalhães et al, Plos NTD 2014). Thus, it is unlikely that such a coinfection would have a major impact on our findings.

      This work determined the levels of PvLDH in a cohort of uncomplicated P. vivax patients as well as healthy volunteers using a double-sandwich ELISA assay: (i) are the clones to determine PvLDH values freely available to facilitate similar studies by independent groups? (ii) How was the cut-off of positivity defined? This is not evident, neither in the materials and methods, nor in the results.

      Answer: Clones are commercially available and were purchased from Vista Diagnostics International LLC, WA, USA. Information has been amended to the text in the Methods section.

      Page 8, line 186: “Cut-off of positivity was defined by correcting absorbance values generated in the plasma samples from healthy donors (controls) by blank values (plate controls), with both values being in the same range. Absorbance values higher than controls were considered positive. In parallel, we used schizont extracts to perform standard curves and lower absorbance values were in the range of O.D = 0.03-0.04. All positive patient samples gave O.D. values equal or higher than 0.05. This information has also been added in the Methods section.:

      It is not clear why varying percentages of pooled plasma (30% for imaging and flow cytometry, and 20% for impedance changes) from the different clusters were used for the functional EC assays. Moreover, no information about the concentration of plasma used for transcriptional analysis is available. Please clarify.

      Answer: The concentration of 30% pooled plasma was also used for transcriptional analysis, as indicated in the Methods section, page 11, line 250. This information was also added in the legend of Figure 5B. We had run several optimisation time-course and titration experiments with individual plasma samples, testing concentrations of plasma varying from 10% up to 30% v/v and we did not observe differences in mRNA expression between 20% and 30% v/v plasma conditions.

      As for the ECIS, our collaborators (Erich V de Paula group) have optimised this assay and they use a range of 15 to 20% (Santaterra et al 2020). Higher concentrations of plasma reduces the reproducibility, probably to fibrin formation.

      Reference 9 is a nonhuman primate study where no LDH is used. Please remove it.

      Answer: Reference 9 has been removed following the reviewer suggestion.

      Reference 39 is a review on the subject and cannot be included in the sentence on line 556 "In agreement with a previous study8,39, where reference 8 is accurate. Please remove reference 39 from here.

      Answer: The text has been amended as suggested.

      Reviewer #3 (Significance (Required)):

      This paper further contributes to explain the conundrum of low peripheral blood parasitemia and clinical severity in P. vivax. Moreover, by including new human markers and solidly applying computational tools, this paper further contributes to advance clinical research in P. vivax.

      Clinical diagnosis of hematological disorders including anemia, lymphopenia and thrombocytopenia, are routinely obtained from a complete blood count. Therefore, I believe the major significance of this work is to raise public health awareness of including in these clinical examinations, the determination of PvLDH levels. They might prognose, as suggested by the authors, better diagnosis and treatment of P. vivax,

      My main expertise is the biology of host-pathogen interactions with a focus on P. vivax.


      Reviewer #4 (Evidence, reproducibility and clarity (Required)):

      The study evaluates P. vivax biomass (serum LDH) versus peripheral parasitemia with multiple variables. From the biomass Vivax high vs. Vivax low, they compare multiple determination in patients with uncomplicated P. vivax. This raises questions about disease and the presence of parasites in various organs. The question is if P. vivax sequesters and the answer is yes in the bone marrow and spleen. Does it sequester like P. falciparum that causes disease by sequestration by binding endothelium in various organs. That is less clear. As P. vivax is rarely fatal, the sequestration has not been studied. The presence of parasites in organs of P. vivax infected splenectomized squirrel and Aotus monkeys has been found in bone marrow and liver (note: splenecotomized monkeys so parasitemia can rise to higher levels than in non-splenectomized monkeys). There are studies of binding of schizonts infected red cells to lung endothelium in vitro does not answer the question of whether sequestration occurs in vivo.

      The most important complication of P. vivax is generally anemia. This did not correlate with vivax biomass, but this raises the question of the length of infection and the possibility that parasite biomass may vary at different times of infection. Anemia was seen in P. vivax infected patients, but it did not relate to biomass at the time of study. Note the caveat mentioned in the previous sentence on long term effects of infection on anemia.

      The finding of biomass with reduced platelet counts and endothelial effects that may be related to a serum factor and not sequestration. This is the main limitation of the paper besides the unknown long term effect infection. If one could identify an effect of P. vivax infected human serum, this may be worth a study in the future on what is in serum causing the effects.

      Reviewer #4 (Significance (Required)):

      This study is unique with the caveats mentioned above. It has a good review of the literature.

      Answer: We appreciate the reviewer comments. In our cohort, the frequency of anaemia was not as high or severe as the frequency of thrombocytopenia and lymphopenia. However, we still find associations between endothelial cell activation marker Ang-2 and the pro-inflammatory cytokine IL-1 IL-1 negatively associated with several markers of anaemia, such as haemoglobin, haematocrit and RBC numbers. Although we did not further investigate this association, it may indicate indirect effects of parasite biomass on anaemia mediated by inflammation and EC activation, which will be further investigated in other current longitudinal cohort studies.

    1. SciScore for 10.1101/2021.06.12.448196: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments performed under Animal User Document H-20-006, approved by the Animal Care Committee at the Canadian Science Center for Human and Animal Health in accordance with the guidelines provided by the Canadian Council on Animal Care.<br>Euthanasia Agents: All procedures were performed under inhalation anesthesia using isoflurane.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster challenge and re-challenge experiments: Groups of male or female golden Syrian hamsters were anaesthetized and exposed to 1×105 TCID50 SARS-CoV-2 by an intranasal route of inoculation with the inoculum distributed evenly into both nares in a volume of 20 µl (intranasal low volume) or in a volume of 100 µl to allow for inhalation of the inoculum (intranasal high volume), or by an intragastric route of infection via oral gavage.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Viruses: Vero cells (ATCC) were cultured in Minimal Essential Medium (MEM) (Hyclone) supplemented with 5% Bovine Growth Serum Supplemented Calf (Hyclone) and L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 (Canada/ON-VIDO-01/2020; EPI_ISL_425177) was isolated from a positive patient sample and stocks of virus were grown in VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: Results were analyzed and graphed using Prism 8 software (Graphpad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of the routes of administration described in this work is that i.n. adminstration results in some inoculum being swallowed and entering the gastrointestinal tract54. Even with low volume i.n. administration, there may be a small amount of virus that become deposited within the lower respiratory tract shortly after infection. With the i.g. instillation by oral gavage some inoculum is also expected to be introduced to the respiratory tract52 or oral cavity when the feeding tube is inserted or withdrawn. We questioned whether the differential pathogenesis observed with an i.g. route versus an high-volume intranasal route administration was due to the alimentary tract exposure or rather a small viral dose seeding the airway during gavage; however, a recent report describes that low dose SARS-CoV-2 inoculation of the hamster airway results in diminished pathogenesis55. Given that the i.n.L inoculation may also be expected to result in a low dose delivery of virus to the lower respiratory tract, the milder clinical signs of illness that we observed are consistent with the reduced pathogenesis reported by others upon low dose exposure. Given our findings that all routes of infection resulted in similar timing and extent of virus replication in the respiratory and digestive tract tissues (Fig. 1), it is possible that disease outcome is more directly related to the nature of the immune responses that are established at the initial site of greatest virus exposure and that ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.14.448343: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experimental animal procedures were approved by the Institutional Animal Committee of the San Raffaele Scientific Institute and all infectious work was performed in designed BSL-3 workspaces.<br>Field Sample Permit: All experimental work was conducted under the authority of a UK Home Office approved project license that had been subject to local ethical review at PHE Porton Down by the Animal Welfare and Ethical Review Body (AWERB) as required by the Home Office Animals (Scientific Procedures) Act 1986 Vaccination: Mice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sixteen, 7-week-old female Sprague-Dawley rats, with a body weight range of 140-155 grams, were purchased from Envigo (Italy).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoparticles were harvested after 16-24 hours: the supernatant was centrifuged at 1200 rpm 5 min to pellet debris, the supernatant of anti-VSV-G expressing hybridoma cells (Anti-VSV-G antibody (I1, produced from CRL-2700 mouse hybridoma cells, ATCC) added to virus stocks at 1:10 (v/v) to block residual VSV-G containing particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, slides were stained with Alexa Fluor 568 Goat Anti-Rabbit antibody for 2h RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression of recombinant SARS-CoV-2 Spike proteins and Western Blotting: HEK293 cells were transiently transfected with SARS-CoV-2-S fragments expression vectors using Lipofectamine 2000 Transfection reagent (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK293T cells were seeded and the next day, transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In EDA, Vero E6 cells were seeded into 96 wells plates and infected at 95% of confluency with base 10 dilutions of virus stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization experiments with SARS-CoV-2 VSV-based pseudoparticles, Caco-2 cells were seeded in 96-well plates in 180 μl medium at 10,000 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293TN-hACE2 were generated by transduction of HEK293TN with a lentiviral vector engineered to stably express hACE2 (described elsewhere, paper submitted).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293TN-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: BALB/c (H-2d) and C57Bl/6 mice (H-2b) were purchased from Envigo (Italy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B6.Cg-Tg(K18-ACE2)2Prlmn/J mice were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sixteen, 7-week-old female Sprague-Dawley rats, with a body weight range of 140-155 grams, were purchased from Envigo (Italy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague-Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were immunized with 10 ug of COVID-eVax or saline solution twice 21 days apart intra-muscularly followed by electroporation as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to identify immunodominant RBD epitopes (here highlighted in yellow), Elispot assay was performed by stimulating splenocytes from RBD vaccinated Balb/c mice for 20h with RBD peptide pools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the construction of RBD, N/R and S1 constructs, the cDNA corresponding to each region was amplified via PCR by using sequence-specific primers and directionally cloned into the linearized pTK1A-TPA vector by enzymatic restriction PacI/NotI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTK1A-TPA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FL expression vector was generated by In-fusion Cloning System (Takara), amplifying the cDNA by using specific primers overlapping both the synthetic gene and the acceptor empty vector pTK1A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTK1A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK293T cells were seeded and the next day, transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG1-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, medium was removed, 15 ml fresh medium and then VSV(Fluc_eGFP)-VSV-G added to deliver the defective viral reporter genome (ΔVSV-G, kindly provided by Gert Zimmer, Institute of Virology and Immunology, Mittelhäusern, Switzerland) (33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ΔVSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, 32 μg of reporter plasmid pLenti CMV-GFP-TAV2A-LUC Hygro, 12.5 μg of pMDLg/pRRE (Addgene #12251), 6.25 μg of pRSV-Rev (Addgene #12253), and 9 μg pcDNA3.1_ Spike_del19 were cotransfected following a calcium phosphate transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti CMV-GFP-TAV2A-LUC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMDLg/pRRE</div><div>suggested: RRID:Addgene_12251)</div></div><div style="margin-bottom:8px"><div>pRSV-Rev</div><div>suggested: RRID:Addgene_12253)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.1_ Spike_del19 (Addgene #155297) was generated by deletion of last 19aa of Spike starting from pcDNA3.1-SARS2-Spike (a gift from Fang Li, Addgene plasmid # 145032). pLenti CMV-GFP-TAV2A-LUC Hygro was generated from pLenti CMV GFP Hygro (Addgene #17446) by addition of T2A-Luciferase by PCR cloning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1_ Spike_del19</div><div>suggested: RRID:Addgene_155297)</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS2-Spike</div><div>suggested: RRID:Addgene_145032)</div></div><div style="margin-bottom:8px"><div>pLenti CMV</div><div>suggested: RRID:Addgene_140746)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum dilution inhibiting 50% of the CPE (IC50) was calculated using Prism 7 (GraphPad Software, San Diego, CA, USA) as described (36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Brightfield images were acquired through an Aperio Scanscope System CS2 microscope and an ImageScope program (Leica Biosystem) following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were collected using FlowJo Version 10.5.3 (Treestar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with GraphPad Prism software version 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04642638</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Immunogenicity, and Efficacy of INO-4800 for COVID-1…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. try { if ( localStorage.getItem(skinItemId ) ) { var _g1; _g1 = document.getElementById('g1-logo-inverted-img'); _g1.classList.remove('lazyload'); _g1.setAttribute('src', _g1.getAttribute('data-src') ); _g1 = document.getElementById('g1-logo-inverted-source'); _g1.setAttribute('srcset', _g1.getAttribute('data-srcset')); } } catch(e) {} Sciences Technologie Planète Espace Histoire Santé Société Insolite Mystère Search Search for: Search Définitions Biographies Archimède Charles Darwin Claude Ptolémée Dimitri Mendeleïev Elon Musk Galilée Isaac Newton Lénonard de Vinci Louis Pasteur Marie Curie Nicolas Copernic Nikola Tesla Stephen Hawking Steve Jobs Thomas Edison Thomas Pesquet Objets scientifiques Menu try { if ( localStorage.getItem(skinItemId ) ) { var _g1; _g1 = document.getElementById('g1-logo-mobile-inverted-img'); _g1.classList.remove('lazyload'); _g1.setAttribute('src', _g1.getAttribute('data-src') ); _g1 = document.getElementById('g1-logo-mobile-inverted-source'); _g1.setAttribute('srcset', _g1.getAttribute('data-srcset')); } } catch(e) {} Login Latest stories En réalité, le mégalodon était plus gros qu’on ne le pensait Climat : la survenue d’un “effet domino” est-elle déjà engagée ? Pollution à l’ozone : voici l’impact qu’a eu la pandémie en 2020 EnVision : l’ESA se prépare aussi à rejoindre Vénus Sur Mars, Perseverance entame ses opérations scientifiques Relativity Space dévoile une fusée entièrement réutilisable et imprimée en 3D Cette île flottante fabriquée à partir de déchets devrait accueillir des touristes en 2025 ! Cette éruption aurait détruit la couche d’ozone et changé le cours de l’évolution humaine Jeff Bezos s’envolera pour l’espace le mois prochain Retour Suite googletag.cmd.push(function() { googletag.display('div-gpt-ad-1587732802961-0'); }); googletag.cmd.push(function() { googletag.display('div-gpt-ad-1587733203789-0'); }); #g1-background-media-60c4fd38bbb3f { background-image: url( https://sciencepost.fr/wp-content/uploads/2016/03/Vantablack_01.jpg ); } in Insolite Vantablack : le noir le plus noir du monde est désormais la propriété d’un seul homme Crédits Surrey NanoSystems par Yohan Demeure, rédacteur scientifique 19 mars 2016, 0 h 02 min PartagerTweeter Un artiste britannique est désormais le seul propriétaire du pigment de couleur le plus noir existant sur Terre. Ce dernier a été baptisé Vantablack par la société qui le produit, tandis que le monde de l’art s’indigne. Le Vantablack est fabriqué depuis 2014 par la société britannique Surrey Nanosystems, et représente à ce jour le pigment de couleur le plus noir n’ayant jamais existé. En effet, ce matériau absorbe précisément 99,96% de la lumière, ce qui fait que tout objet qui s’en trouve recouvert devient quasiment invisible. Cet “ultra-noir” a tout d’abord été développé pour l’industrie militaire, destiné à dissimuler des avions furtifs et des satellites, mais a rapidement attiré le monde de l’art, qui y a vu une source d’inspiration intarissable. Cependant, le brevet déposé pour l’exclusivité du Vantablack vient d’être racheté par l’artiste britannique d’origine indienne Anish Kapoor. Il est devenu le seul propriétaire de l’ultra-noir et détient donc l’exclusivité la plus totale quant à son utilisation. « C’est si noir que vous ne pouvez presque rien voir. Imaginez un espace si sombre qu’en y pénétrant vous perdez toute idée de qui vous êtes, d’où vous êtes et la conscience du temps. Votre état émotionnel en est affecté et, sous le coup de la désorientation, il faut que vous trouviez, à l’intérieur de vous, quelque chose d’autre » a déclaré l’artiste Anish Kapoor. Mais qu’est-ce que réellement le Vantablack ? Il s’agit d’un matériau qu’il faut comprendre par sa structure nanométrique : il est formé d’un tapis de nanotubes de carbones, c’est-à-dire de minuscules surfaces composées d’une seule couche d’atomes enroulées sur elles-mêmes. La lumière, dans sa majorité, pénètre ces multitudes de nanotubes et se trouve réfléchie tellement de fois qu’elle finit par être totalement absorbée. Ainsi, seulement 0,04 % du rayonnement lumineux est renvoyé par les nanotubes à la surface : il s’agit donc de ce qu’il nous est donné de voir à l’œil nu. Le rachat des droits sur le Vantablack représente une grande première dans le monde de l’art, car jamais personne n’avait jamais eu l’exclusivité totale sur un matériau, et fait naturellement polémique. Certains qualifient cette acquisition comme étant abusive, par exemple Christian Furr, peintre de la reine Elizabeth II : « Je n’ai jamais entendu parler d’un artiste qui monopolise un matériau » déclarait-il. Alors qu’Anish Kapoor n’a pas encore réagi à la polémique, il est opportun de rappeler que le plasticien français Yves Klein, qui avait par le passé demandé la création d’un bleu profond unique au marchand de couleurs Édouard Adam, ne l’a jamais breveté, laissant à quiconque la liberté de le travailler. Sources : Sciences et Avenir – RFI Crédit photos : Surrey Nanosystems window._taboola = window._taboola || []; _taboola.push({article:'auto'}); !function (e, f, u) { e.async = 1; e.src = u; f.parentNode.insertBefore(e, f); }(document.createElement('script'), document.getElementsByTagName('script')[0], '//cdn.taboola.com/libtrc/citizenpost-network/loader.js'); par Taboolapar TaboolaContenus SponsorisésContenus SponsorisésContenus SélectionnésContenus SélectionnésÀ Découvrir AussiWorldemandLes géants de la guitareWorldemandAnnulerPourquoi les hommes sont-ils obsédés par les seins des femmes ?AnnulerÀ 26 ans, elle souffre d’une maladie lui en faisant paraître le doubleAnnulerLa ménopause tue t-elle la libido des femmes ?La ménopause tue t-elle la libido des femmes ?AnnulerLe corps d’un homme disparu depuis 22 ans retrouvé grâce à Google MapsAnnulerLes rats-taupes nus kidnappent les bébés des autres pour les transformer en "esclaves"Les rats-taupes nus kidnappent les bébés des autres pour les transformer en "esclaves"Annuler window._taboola = window._taboola || []; _taboola.push({ mode: 'thumbnails-a', container: 'taboola-below-article-thumbnails', placement: 'Below Article Thumbnails', target_type: 'mix' }); window._taboola = window._taboola || []; _taboola.push({flush: true}); Plus d'articles dans : Insolite En Alsace, un retraité et son chien ont été attaqués par des corneilles ! 10 juin 2021, 14 h 54 min Mexique : un trou géant apparu au milieu des champs ne cesse de s’agrandir 8 juin 2021, 11 h 28 min Une “IA artiste” génère des visuels psychédéliques en s’inspirant d’un poème 4 juin 2021, 15 h 42 min Mangez des muffins bleus pour évaluer votre microbiote ! 31 mai 2021, 11 h 17 min Voici Höga, le véhicule électrique en kit de IKEA ! 31 mai 2021, 11 h 16 min Victor Enrich, le designer des constructions impossibles ! 29 mai 2021, 10 h 00 min Actualités : Ils rendent des plantes fluorescentes pour détecter leurs problèmes ! Faut-il craindre le nouveau cycle d’éruptions solaires dans lequel la Terre est entrée ? Sans convection atmosphérique, la Terre serait une véritable étuve ! Le Paratéthys : comment a disparu le “plus grand lac” de l’histoire En réalité, le mégalodon était plus gros qu’on ne le pensait L’avenir de l’éolien offshore pourrait passer par ces gigantesques structures googletag.cmd.push(function() { googletag.display('div-gpt-ad-1587745322361-0'); }); Magazine de vulgarisation scientifique, Sciencepost vous dévoile chaque jour les dernières découvertes et avancées en terme de sciences et nouvelles technologies. Ne ratez pas : En réalité, le mégalodon était plus gros qu’on ne le pensait Climat : la survenue d’un “effet domino” est-elle déjà engagée ? Pollution à l’ozone : voici l’impact qu’a eu la pandémie en 2020 Suivez-nous sur les réseaux ! Nos valeurs et engagements Gestion des cookies Mentions légales Contact Publicité Flux RSS Back to Top Un magazine Close Sciences Technologie Planète Espace Histoire Santé Société Insolite Mystère Définitions Biographies Archimède Charles Darwin Claude Ptolémée Dimitri Mendeleïev Elon Musk Galilée Isaac Newton Lénonard de Vinci Louis Pasteur Marie Curie Nicolas Copernic Nikola Tesla Stephen Hawking Steve Jobs Thomas Edison Thomas Pesquet Objets scientifiques Search for: Search (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','//www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-55506623-1', 'auto'); ga('send', 'pageview'); window.impactifyTag = window.impactifyTag || []; impactifyTag.push({ appId: 'sciencepost.fr' ,format: 'screen' }); (function(d, s, id) { var js, ijs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) return; js = d.createElement(s); js.id = id; js.src = 'https://ad.impactify.io/static/ad/tag.js'; ijs.parentNode.insertBefore(js, ijs); }(document, 'script', 'impactify-sdk')); var _qevents = _qevents || []; (function() { var elem = document.createElement('script'); elem.src = (document.location.protocol == "https:" ? "https://secure" : "http://edge") + ".quantserve.com/quant.js"; elem.async = true; elem.type = "text/javascript"; var scpt = document.getElementsByTagName('script')[0]; scpt.parentNode.insertBefore(elem, scpt); })(); _qevents.push({ qacct:"p-2wk5TvYXYE76H", source:"wp" }); <div style="display:none;"> <img src="//pixel.quantserve.com/pixel/p-2wk5TvYXYE76H.gif" border="0" height="1" width="1" alt="Quantcast"/> </div> var mejsL10n = {"language":"fr","strings":{"mejs.download-file":"T\u00e9l\u00e9charger le fichier","mejs.install-flash":"Vous utilisez un navigateur qui n\u2019a pas le lecteur Flash activ\u00e9 ou install\u00e9. Veuillez activer votre extension Flash ou t\u00e9l\u00e9charger la derni\u00e8re version \u00e0 partir de cette adresse\u00a0: https:\/\/get.adobe.com\/flashplayer\/","mejs.fullscreen":"Plein \u00e9cran","mejs.play":"Lecture","mejs.pause":"Pause","mejs.time-slider":"Curseur de temps","mejs.time-help-text":"Utilisez les fl\u00e8ches droite\/gauche pour avancer d\u2019une seconde, haut\/bas pour avancer de dix secondes.","mejs.live-broadcast":"\u00c9mission en direct","mejs.volume-help-text":"Utilisez les fl\u00e8ches haut\/bas pour augmenter ou diminuer le volume.","mejs.unmute":"R\u00e9activer le son","mejs.mute":"Muet","mejs.volume-slider":"Curseur de volume","mejs.video-player":"Lecteur vid\u00e9o","mejs.audio-player":"Lecteur audio","mejs.captions-subtitles":"L\u00e9gendes\/Sous-titres","mejs.captions-chapters":"Chapitres","mejs.none":"Aucun","mejs.afrikaans":"Afrikaans","mejs.albanian":"Albanais","mejs.arabic":"Arabe","mejs.belarusian":"Bi\u00e9lorusse","mejs.bulgarian":"Bulgare","mejs.catalan":"Catalan","mejs.chinese":"Chinois","mejs.chinese-simplified":"Chinois (simplifi\u00e9)","mejs.chinese-traditional":"Chinois (traditionnel)","mejs.croatian":"Croate","mejs.czech":"Tch\u00e8que","mejs.danish":"Danois","mejs.dutch":"N\u00e9erlandais","mejs.english":"Anglais","mejs.estonian":"Estonien","mejs.filipino":"Filipino","mejs.finnish":"Finnois","mejs.french":"Fran\u00e7ais","mejs.galician":"Galicien","mejs.german":"Allemand","mejs.greek":"Grec","mejs.haitian-creole":"Cr\u00e9ole ha\u00eftien","mejs.hebrew":"H\u00e9breu","mejs.hindi":"Hindi","mejs.hungarian":"Hongrois","mejs.icelandic":"Islandais","mejs.indonesian":"Indon\u00e9sien","mejs.irish":"Irlandais","mejs.italian":"Italien","mejs.japanese":"Japonais","mejs.korean":"Cor\u00e9en","mejs.latvian":"Letton","mejs.lithuanian":"Lituanien","mejs.macedonian":"Mac\u00e9donien","mejs.malay":"Malais","mejs.maltese":"Maltais","mejs.norwegian":"Norv\u00e9gien","mejs.persian":"Perse","mejs.polish":"Polonais","mejs.portuguese":"Portugais","mejs.romanian":"Roumain","mejs.russian":"Russe","mejs.serbian":"Serbe","mejs.slovak":"Slovaque","mejs.slovenian":"Slov\u00e9nien","mejs.spanish":"Espagnol","mejs.swahili":"Swahili","mejs.swedish":"Su\u00e9dois","mejs.tagalog":"Tagalog","mejs.thai":"Thai","mejs.turkish":"Turc","mejs.ukrainian":"Ukrainien","mejs.vietnamese":"Vietnamien","mejs.welsh":"Ga\u00e9lique","mejs.yiddish":"Yiddish"}}; /* <![CDATA[ */ var _wpmejsSettings = {"pluginPath":"\/wp-includes\/js\/mediaelement\/","classPrefix":"mejs-","stretching":"responsive"}; /* ]]> */ /* <![CDATA[ */ var macegallery = "{\"i18n\":{\"of\":\"of\"},\"html\":\"\\n<div class=\\\"g1-gallery-wrapper g1-gallery-dark\\\">\\n\\t<div class=\\\"g1-gallery\\\">\\n\\t\\t<div class=\\\"g1-gallery-header\\\">\\n\\t\\t\\t<div class=\\\"g1-gallery-header-left\\\">\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-logo\\\">\\n\\t\\t\\t\\t\\t\\t\\t\\t<\\\/div>\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-title g1-gamma g1-gamma-1st\\\">{title}<\\\/div>\\n\\t\\t\\t<\\\/div>\\n\\t\\t\\t<div class=\\\"g1-gallery-header-right\\\">\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-back-to-slideshow\\\">Back to slideshow<\\\/div>\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-thumbs-button\\\"><\\\/div>\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-numerator\\\">{numerator}<\\\/div>\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-close-button\\\"><\\\/div>\\n\\t\\t\\t<\\\/div>\\n\\t\\t<\\\/div>\\n\\t\\t<div class=\\\"g1-gallery-body\\\">\\n\\t\\t\\t<div class=\\\"g1-gallery-frames\\\">\\n\\t\\t\\t\\t{frames}\\n\\t\\t\\t<\\\/div>\\n\\t\\t\\t<div class=\\\"g1-gallery-thumbnails32\\\">\\n\\t\\t\\t\\t<div class=\\\"g1-gallery-thumbnails-collection\\\">\\n\\t\\t\\t\\t\\t{thumbnails32}\\n\\t\\t\\t\\t<\\\/div>\\n\\t\\t\\t<\\\/div>\\n\\t\\t\\t<div class=\\\"g1-gallery-sidebar\\\">\\n\\t\\t\\t\\t\\t<div class=\\\"g1-gallery-shares\\\">\\n\\t\\t\\t\\t\\t<\\\/div>\\n\\t\\t\\t\\t\\t<div class=\\\"g1-gallery-ad\\\"><\\\/div>\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t<div class=\\\"g1-gallery-thumbnails\\\">\\n\\t\\t\\t\\t\\t\\t\\t<div class=\\\"g1-gallery-thumbnails-up\\\"><\\\/div>\\n\\t\\t\\t\\t\\t\\t\\t<div class=\\\"g1-gallery-thumbnails-collection\\\">{thumbnails}<\\\/div>\\n\\t\\t\\t\\t\\t\\t\\t<div class=\\\"g1-gallery-thumbnails-down\\\"><\\\/div>\\n\\t\\t\\t\\t\\t\\t<\\\/div>\\n\\t\\t\\t\\t\\t\\t\\t\\t<\\\/div>\\n\\t\\t<\\\/div>\\n\\t<\\\/div>\\n<\\\/div>\\n\",\"shares\":\"<script type=\\\"text\\\/javascript\\\">\\n\\t\\t\\t(function () {\\n\\t\\t\\t\\tvar triggerOnLoad = false;\\n\\n\\t\\t\\t\\twindow.apiShareOnFB = function() {\\n\\t\\t\\t\\t\\tjQuery('body').trigger('snaxFbNotLoaded');\\n\\t\\t\\t\\t\\ttriggerOnLoad = true;\\n\\t\\t\\t\\t};\\n\\n\\t\\t\\t\\tvar _fbAsyncInitGallery = window.fbAsyncInitGallery;\\n\\n\\t\\t\\t\\twindow.fbAsyncInitGallery = function() {\\n\\t\\t\\t\\t\\tFB.init({\\n\\t\\t\\t\\t\\t\\tappId : '',\\n\\t\\t\\t\\t\\t\\txfbml : true,\\n\\t\\t\\t\\t\\t\\tversion : 'v3.0'\\n\\t\\t\\t\\t\\t});\\n\\t\\t\\t\\t\\twindow.apiShareOnFB_mace_replace_unique = function() {\\n\\t\\t\\t\\t\\t\\tvar shareTitle \\t\\t = \\\"mace_replace_noesc_title\\\"; \\\/\\\/ Double quotes to allow ' chars.\\n\\t\\t\\t\\t\\t\\tvar shareDescription\\t= '';\\n\\t\\t\\t\\t\\t\\tvar shareImage\\t = 'mace_replace_noesc_image_url';\\n\\n\\t\\t\\t\\t\\t\\tFB.login(function(response) {\\n\\t\\t\\t\\t\\t\\t\\tif (response.status === 'connected') {\\n\\t\\t\\t\\t\\t\\t\\t\\tvar objectToShare = {\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t'og:url': 'mace_replace_noesc_shortlink', \\\/\\\/ Url to share.\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t'og:title': shareTitle,\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t'og:description': shareDescription\\n\\t\\t\\t\\t\\t\\t\\t\\t};\\n\\n\\t\\t\\t\\t\\t\\t\\t\\t\\\/\\\/ Add image only if set. FB fails otherwise.\\n\\t\\t\\t\\t\\t\\t\\t\\tif (shareImage) {\\n\\t\\t\\t\\t\\t\\t\\t\\t\\tobjectToShare['og:image'] = shareImage;\\n\\t\\t\\t\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\t\\t\\t\\tFB.ui({\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\tmethod: 'share_open_graph',\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\taction_type: 'og.shares',\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\taction_properties: JSON.stringify({\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\tobject : objectToShare\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t})\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t},\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\\/\\\/ callback\\n\\t\\t\\t\\t\\t\\t\\t\\t\\tfunction(response) {\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t});\\n\\t\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t\\t});\\n\\t\\t\\t\\t\\t};\\n\\n\\t\\t\\t\\t\\t\\\/\\\/ Fire original callback.\\n\\t\\t\\t\\t\\tif (typeof _fbAsyncInitGallery === 'function') {\\n\\t\\t\\t\\t\\t\\t_fbAsyncInitGallery();\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\t\\\/\\\/ Open share popup as soon as possible, after loading FB SDK.`\\n\\t\\t\\t\\t\\tif (triggerOnLoad) {\\n\\t\\t\\t\\t\\t\\tsetTimeout(function() {\\n\\t\\t\\t\\t\\t\\t\\tapiShareOnFB();\\n\\t\\t\\t\\t\\t\\t}, 1000);\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t};\\n\\n\\t\\t\\t\\t\\\/\\\/ JS SDK loaded before we hook into it. Trigger callback now.\\n\\t\\t\\t\\tif (typeof window.FB !== 'undefined') {\\n\\t\\t\\t\\t\\twindow.fbAsyncInitGallery();\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\tjQuery('body').on('maceGalleryItemChanged', function(){\\n\\t\\t\\t\\t\\twindow.fbAsyncInitGallery();\\n\\t\\t\\t\\t});\\n\\t\\t\\t})();\\n\\t\\t<\\\/script>\\n\\n<a class=\\\"g1-gallery-share g1-gallery-share-fb\\\" href=\\\"#\\\" title=\\\"Share on Facebook\\\" onclick=\\\"apiShareOnFB_mace_replace_unique(); return false;\\\" target=\\\"_blank\\\" rel=\\\"nofollow\\\">Share on Facebook<\\\/a><a class=\\\"g1-gallery-share g1-gallery-share-twitter\\\" href=\\\"https:\\\/\\\/twitter.com\\\/intent\\\/tweet?text=mace_replace_title&url=mace_replace_shortlink\\\" title=\\\"Share on Twitter\\\" target=\\\"_blank\\\" rel=\\\"nofollow\\\">Share on Twitter<\\\/a><a class=\\\"g1-gallery-share g1-gallery-share-pinterest\\\" href=\\\"https:\\\/\\\/pinterest.com\\\/pin\\\/create\\\/button\\\/?url=mace_replace_shortlink&description=mace_replace_title&media=mace_replace_image_url\\\" title=\\\"Share on Pinterest\\\" target=\\\"_blank\\\" rel=\\\"nofollow\\\">Share on Pinterest<\\\/a>\"}"; /* ]]> */ /* <![CDATA[ */ var superpwa_sw = {"url":"\/superpwa-sw.js","disable_addtohome":"0","enableOnDesktop":""}; /* ]]> */ /* <![CDATA[ */ var bimber_front_config = "{\"ajax_url\":\"https:\\\/\\\/sciencepost.fr\\\/wp-admin\\\/admin-ajax.php\",\"timeago\":\"off\",\"sharebar\":\"off\",\"i18n\":{\"menu\":{\"go_to\":\"Go to\"},\"newsletter\":{\"subscribe_mail_subject_tpl\":\"Check out this great article: %subject%\"},\"bp_profile_nav\":{\"more_link\":\"More\"}},\"comment_types\":[\"wp\"],\"auto_load_limit\":0,\"auto_play_videos\":false,\"use_gif_player\":true,\"setTargetBlank\":true,\"useWaypoints\":true,\"stack\":\"original-2018\"}"; /* ]]> */ ( 'fetch' in window ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-fetch.min.js?ver=3.0.0"></scr' + 'ipt>' );( document.contains ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-node-contains.min.js?ver=3.42.0"></scr' + 'ipt>' );( window.DOMRect ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-dom-rect.min.js?ver=3.42.0"></scr' + 'ipt>' );( window.URL && window.URL.prototype && window.URLSearchParams ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-url.min.js?ver=3.6.4"></scr' + 'ipt>' );( window.FormData && window.FormData.prototype.keys ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-formdata.min.js?ver=3.0.12"></scr' + 'ipt>' );( Element.prototype.matches && Element.prototype.closest ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-element-closest.min.js?ver=2.0.2"></scr' + 'ipt>' );( 'objectFit' in document.documentElement.style ) || document.write( '<script src="https://sciencepost.fr/wp-includes/js/dist/vendor/wp-polyfill-object-fit.min.js?ver=2.3.4"></scr' + 'ipt>' ); wp.i18n.setLocaleData( { 'text direction\u0004ltr': [ 'ltr' ] } ); ( function( domain, translations ) { var localeData = translations.locale_data[ domain ] || translations.locale_data.messages; localeData[""].domain = domain; wp.i18n.setLocaleData( localeData, domain ); } )( "default", {"translation-revision-date":"2021-06-07 21:07:25+0000","generator":"GlotPress\/3.0.0-alpha.2","domain":"messages","locale_data":{"messages":{"":{"domain":"messages","plural-forms":"nplurals=2; plural=n > 1;","lang":"fr"},"Notifications":["Notifications"]}},"comment":{"reference":"wp-includes\/js\/dist\/a11y.js"}} ); /* <![CDATA[ */ var uiAutocompleteL10n = {"noResults":"Aucun r\u00e9sultat.","oneResult":"Un r\u00e9sultat trouv\u00e9. Utilisez les fl\u00e8ches haut et bas du clavier pour les parcourir. ","manyResults":"%d r\u00e9sultats trouv\u00e9s. Utilisez les fl\u00e8ches haut et bas du clavier pour les parcourir.","itemSelected":"\u00c9l\u00e9ment s\u00e9lectionn\u00e9."}; /* ]]> */ function b2a(a){var b,c=0,l=0,f="",g=[];if(!a)return a;do{var e=a.charCodeAt(c++);var h=a.charCodeAt(c++);var k=a.charCodeAt(c++);var d=e<<16|h<<8|k;e=63&d>>18;h=63&d>>12;k=63&d>>6;d&=63;g[l++]="ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=".charAt(e)+"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=".charAt(h)+"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=".charAt(k)+"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=".charAt(d)}while(c< a.length);return f=g.join(""),b=a.length%3,(b?f.slice(0,b-3):f)+"===".slice(b||3)}function a2b(a){var b,c,l,f={},g=0,e=0,h="",k=String.fromCharCode,d=a.length;for(b=0;64>b;b++)f["ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/".charAt(b)]=b;for(c=0;d>c;c++)for(b=f[a.charAt(c)],g=(g<<6)+b,e+=6;8<=e;)((l=255&g>>>(e-=8))||d-2>c)&&(h+=k(l));return h}b64e=function(a){return btoa(encodeURIComponent(a).replace(/%([0-9A-F]{2})/g,function(b,a){return String.fromCharCode("0x"+a)}))}; b64d=function(a){return decodeURIComponent(atob(a).split("").map(function(a){return"%"+("00"+a.charCodeAt(0).toString(16)).slice(-2)}).join(""))}; /* <![CDATA[ */ ai_front = {"insertion_before":"AVANT","insertion_after":"APR\u00c8S","insertion_prepend":"METTRE LE CONTENU AVANT","insertion_append":"AJOUTER LE CONTENU","insertion_replace_content":"REMPLACER LE CONTENU","insertion_replace_element":"REMPLACER L\u02bc\u00c9L\u00c9MENT","visible":"VISIBLE","hidden":"MASQU\u00c9","fallback":"FALLBACK","automatically_placed":"Plac\u00e9 automatiquement par le code d\u02bcannonces automatiques AdSense","cancel":"Annuler","use":"Utilisation","add":"Ajouter","parent":"Parent","cancel_element_selection":"Annuler la s\u00e9lection d\u02bc\u00e9l\u00e9ments","select_parent_element":"S\u00e9lectionnez l\u02bc\u00e9l\u00e9ment parent","css_selector":"S\u00e9lecteur CSS","use_current_selector":"Utiliser le s\u00e9lecteur de courant","element":"\u00c9L\u00c9MENT","path":"CHEMIN","selector":"S\u00c9LECTEUR"}; /* ]]> */ (function(a){if("function"===typeof define&&define.amd){define(a);var c=!0}"object"===typeof exports&&(module.exports=a(),c=!0);if(!c){var e=window.Cookies,b=window.Cookies=a();b.noConflict=function(){window.Cookies=e;return b}}})(function(){function a(){for(var e=0,b={};e<arguments.length;e++){var f=arguments[e],d;for(d in f)b[d]=f[d]}return b}function c(e){function b(){}function f(h,k,g){if("undefined"!==typeof document){g=a({path:"/"},b.defaults,g);"number"===typeof g.expires&&(g.expires=new Date(1* new Date+864E5*g.expires));g.expires=g.expires?g.expires.toUTCString():"";try{var l=JSON.stringify(k);/^[\{\[]/.test(l)&&(k=l)}catch(p){}k=e.write?e.write(k,h):encodeURIComponent(String(k)).replace(/%(23|24|26|2B|3A|3C|3E|3D|2F|3F|40|5B|5D|5E|60|7B|7D|7C)/g,decodeURIComponent);h=encodeURIComponent(String(h)).replace(/%(23|24|26|2B|5E|60|7C)/g,decodeURIComponent).replace(/[\(\)]/g,escape);l="";for(var n in g)g[n]&&(l+="; "+n,!0!==g[n]&&(l+="="+g[n].split(";")[0]));return document.cookie=h+"="+k+l}} function d(h,k){if("undefined"!==typeof document){for(var g={},l=document.cookie?document.cookie.split("; "):[],n=0;n<l.length;n++){var p=l[n].split("="),m=p.slice(1).join("=");k||'"'!==m.charAt(0)||(m=m.slice(1,-1));try{var q=p[0].replace(/(%[0-9A-Z]{2})+/g,decodeURIComponent);m=(e.read||e)(m,q)||m.replace(/(%[0-9A-Z]{2})+/g,decodeURIComponent);if(k)try{m=JSON.parse(m)}catch(r){}g[q]=m;if(h===q)break}catch(r){}}return h?g[h]:g}}b.set=f;b.get=function(h){return d(h,!1)};b.getJSON=function(h){return d(h, !0)};b.remove=function(h,k){f(h,"",a(k,{expires:-1}))};b.defaults={};b.withConverter=c;return b}return c(function(){})});AiCookies=Cookies.noConflict(); ai_check_block=function(a){if(null==a)return!0;var c=AiCookies.getJSON("aiBLOCKS");ai_debug_cookie_status="";null==c&&(c={});"undefined"!==typeof ai_delay_showing_pageviews&&(c.hasOwnProperty(a)||(c[a]={}),c[a].hasOwnProperty("d")||(c[a].d=ai_delay_showing_pageviews));if(c.hasOwnProperty(a)){for(var e in c[a]){if("x"==e){var b="",f=document.querySelectorAll('span[data-ai-block="'+a+'"]')[0];"aiHash"in f.dataset&&(b=f.dataset.aiHash);f="";c[a].hasOwnProperty("h")&&(f=c[a].h);var d=new Date;d=c[a][e]- Math.round(d.getTime()/1E3);if(0<d&&f==b)return ai_debug_cookie_status=a="closed for "+d+" s = "+Math.round(1E4*d/3600/24)/1E4+" days",!1;ai_set_cookie(a,"x","");c[a].hasOwnProperty("i")||c[a].hasOwnProperty("c")||ai_set_cookie(a,"h","")}else if("d"==e){if(0!=c[a][e])return ai_debug_cookie_status=a="delayed for "+c[a][e]+" pageviews",!1}else if("i"==e){b="";f=document.querySelectorAll('span[data-ai-block="'+a+'"]')[0];"aiHash"in f.dataset&&(b=f.dataset.aiHash);f="";c[a].hasOwnProperty("h")&&(f=c[a].h); if(0==c[a][e]&&f==b)return ai_debug_cookie_status=a="max impressions reached",!1;if(0>c[a][e]&&f==b){d=new Date;d=-c[a][e]-Math.round(d.getTime()/1E3);if(0<d)return ai_debug_cookie_status=a="max imp. reached ("+Math.round(1E4*d/24/3600)/1E4+" days = "+d+" s)",!1;ai_set_cookie(a,"i","");c[a].hasOwnProperty("c")||c[a].hasOwnProperty("x")||ai_set_cookie(a,"h","")}}if("ipt"==e&&0==c[a][e]&&(d=new Date,b=Math.round(d.getTime()/1E3),d=c[a].it-b,0<d))return ai_debug_cookie_status=a="max imp. per time reached ("+ Math.round(1E4*d/24/3600)/1E4+" days = "+d+" s)",!1;if("c"==e){b="";f=document.querySelectorAll('span[data-ai-block="'+a+'"]')[0];"aiHash"in f.dataset&&(b=f.dataset.aiHash);f="";c[a].hasOwnProperty("h")&&(f=c[a].h);if(0==c[a][e]&&f==b)return ai_debug_cookie_status=a="max clicks reached",!1;if(0>c[a][e]&&f==b){d=new Date;d=-c[a][e]-Math.round(d.getTime()/1E3);if(0<d)return ai_debug_cookie_status=a="max clicks reached ("+Math.round(1E4*d/24/3600)/1E4+" days = "+d+" s)",!1;ai_set_cookie(a,"c","");c[a].hasOwnProperty("i")|| c[a].hasOwnProperty("x")||ai_set_cookie(a,"h","")}}if("cpt"==e&&0==c[a][e]&&(d=new Date,b=Math.round(d.getTime()/1E3),d=c[a].ct-b,0<d))return ai_debug_cookie_status=a="max clicks per time reached ("+Math.round(1E4*d/24/3600)/1E4+" days = "+d+" s)",!1}if(c.hasOwnProperty("G")&&c.G.hasOwnProperty("cpt")&&0==c.G.cpt&&(d=new Date,b=Math.round(d.getTime()/1E3),d=c.G.ct-b,0<d))return ai_debug_cookie_status=a="max global clicks per time reached ("+Math.round(1E4*d/24/3600)/1E4+" days = "+d+" s)",!1}ai_debug_cookie_status= "OK";return!0}; ai_check_and_insert_block=function(a,c){if(null==a)return!0;var e=document.getElementsByClassName(c);if(e.length){e=e[0];var b=e.closest(".code-block");if(ai_check_block(a)){if(ai_insert_code(e),b){var f=b.querySelectorAll(".ai-debug-block");b&&f.length&&(b.classList.remove("ai-list-block"),b.classList.remove("ai-list-block-ip"),b.style.visibility="",b.classList.contains("ai-remove-position")&&(b.style.position=""))}}else{f=e.closest("div[data-ai]");if(null!=f&&"undefined"!=typeof f.getAttribute("data-ai")){var d= JSON.parse(b64d(f.getAttribute("data-ai")));"undefined"!==typeof d&&d.constructor===Array&&(d[1]="",f.setAttribute("data-ai",b64e(JSON.stringify(d))))}f=b.querySelectorAll(".ai-debug-block");b&&f.length&&(b.classList.remove("ai-list-block"),b.classList.remove("ai-list-block-ip"),b.style.visibility="",b.classList.contains("ai-remove-position")&&(b.style.position=""))}e.classList.remove(c)}e=document.querySelectorAll("."+c+"-dbg");b=0;for(f=e.length;b<f;b++)d=e[b],d.querySelector(".ai-status").textContent= ai_debug_cookie_status,d.querySelector(".ai-cookie-data").textContent=ai_get_cookie_text(a),d.classList.remove(c+"-dbg")};function ai_load_cookie(){var a=AiCookies.getJSON("aiBLOCKS");null==a&&(a={});return a}function ai_get_cookie(a,c){var e="",b=ai_load_cookie();b.hasOwnProperty(a)&&b[a].hasOwnProperty(c)&&(e=b[a][c]);return e} function ai_set_cookie(a,c,e){var b=ai_load_cookie();if(""===e){if(b.hasOwnProperty(a)){delete b[a][c];a:{c=b[a];for(f in c)if(c.hasOwnProperty(f)){var f=!1;break a}f=!0}f&&delete b[a]}}else b.hasOwnProperty(a)||(b[a]={}),b[a][c]=e;0===Object.keys(b).length&&b.constructor===Object?AiCookies.remove("aiBLOCKS"):AiCookies.set("aiBLOCKS",b,{expires:365,path:"/"});return b} ai_get_cookie_text=function(a){var c=AiCookies.getJSON("aiBLOCKS");null==c&&(c={});var e="";c.hasOwnProperty("G")&&(e="G["+JSON.stringify(c.G).replace(/"/g,"").replace("{","").replace("}","")+"] ");var b="";c.hasOwnProperty(a)&&(b=JSON.stringify(c[a]).replace(/"/g,"").replace("{","").replace("}",""));return e+b}; ai_insert=function(c,h,t){for(var p=-1!=h.indexOf(":eq")?jQuery(h):document.querySelectorAll(h),u=0,y=p.length;u<y;u++){var b=p[u];selector_string=b.hasAttribute("id")?"#"+b.getAttribute("id"):b.hasAttribute("class")?"."+b.getAttribute("class").replace(RegExp(" ","g"),"."):"";var v=document.createElement("div");v.innerHTML=t;var m=v.getElementsByClassName("ai-selector-counter")[0];null!=m&&(m.innerText=u+1);m=v.getElementsByClassName("ai-debug-name ai-main")[0];if(null!=m){var l="";"before"==c?l= ai_front.insertion_before:"after"==c?l=ai_front.insertion_after:"prepend"==c?l=ai_front.insertion_prepend:"append"==c?l=ai_front.insertion_append:"replace-content"==c?l=ai_front.insertion_replace_content:"replace-element"==c&&(l=ai_front.insertion_replace_element);-1==selector_string.indexOf(".ai-viewports")&&(m.innerText=l+" "+h+" ("+b.tagName.toLowerCase()+selector_string+")")}m=document.createRange();l=!0;try{var w=m.createContextualFragment(v.innerHTML)}catch(r){l=!1}"before"==c?l?b.parentNode.insertBefore(w, b):jQuery(v.innerHTML).insertBefore(jQuery(b)):"after"==c?l?b.parentNode.insertBefore(w,b.nextSibling):jQuery(v.innerHTML).insertBefore(jQuery(b.nextSibling)):"prepend"==c?l?b.insertBefore(w,b.firstChild):jQuery(v.innerHTML).insertBefore(jQuery(b.firstChild)):"append"==c?l?b.insertBefore(w,null):jQuery(v.innerHTML).appendTo(jQuery(b)):"replace-content"==c?(b.innerHTML="",l?b.insertBefore(w,null):jQuery(v.innerHTML).appendTo(jQuery(b))):"replace-element"==c&&(l?b.parentNode.insertBefore(w,b):jQuery(v.innerHTML).insertBefore(jQuery(b)), b.parentNode.removeChild(b))}}; ai_insert_code=function(c){function h(m,l){return null==m?!1:m.classList?m.classList.contains(l):-1<(" "+m.className+" ").indexOf(" "+l+" ")}function t(m,l){null!=m&&(m.classList?m.classList.add(l):m.className+=" "+l)}function p(m,l){null!=m&&(m.classList?m.classList.remove(l):m.className=m.className.replace(new RegExp("(^|\\b)"+l.split(" ").join("|")+"(\\b|$)","gi")," "))}if("undefined"!=typeof c){var u=!1;if(h(c,"no-visibility-check")||c.offsetWidth||c.offsetHeight||c.getClientRects().length){u= c.getAttribute("data-code");var y=c.getAttribute("data-insertion"),b=c.getAttribute("data-selector");if(null!=u)if(null!=y&&null!=b){if(-1!=b.indexOf(":eq")?jQuery(b).length:document.querySelectorAll(b).length)ai_insert(y,b,b64d(u)),p(c,"ai-viewports")}else{y=document.createRange();b=!0;try{var v=y.createContextualFragment(b64d(u))}catch(m){b=!1}b?c.parentNode.insertBefore(v,c.nextSibling):jQuery(b64d(u)).insertBefore(jQuery(c.nextSibling));p(c,"ai-viewports")}u=!0}else v=c.previousElementSibling, h(v,"ai-debug-bar")&&h(v,"ai-debug-script")&&(p(v,"ai-debug-script"),t(v,"ai-debug-viewport-invisible")),p(c,"ai-viewports");return u}}; ai_insert_list_code=function(c){var h=document.getElementsByClassName(c)[0];if("undefined"!=typeof h){var t=ai_insert_code(h),p=h.closest("div.code-block");if(p){t||p.removeAttribute("data-ai");var u=p.querySelectorAll(".ai-debug-block");p&&u.length&&(p.classList.remove("ai-list-block"),p.classList.remove("ai-list-block-ip"),p.style.visibility="",p.classList.contains("ai-remove-position")&&(p.style.position=""))}h.classList.remove(c);t&&ai_process_elements()}}; ai_insert_viewport_code=function(c){var h=document.getElementsByClassName(c)[0];if("undefined"!=typeof h){var t=ai_insert_code(h);h.classList.remove(c);t&&(c=h.closest("div.code-block"),null!=c&&(t=h.getAttribute("style"),null!=t&&c.setAttribute("style",c.getAttribute("style")+" "+t)));setTimeout(function(){h.removeAttribute("style")},2);ai_process_elements()}}; ai_insert_code_by_class=function(c){var h=document.getElementsByClassName(c)[0];"undefined"!=typeof h&&(ai_insert_code(h),h.classList.remove(c))};ai_insert_client_code=function(c,h){var t=document.getElementsByClassName(c)[0];if("undefined"!=typeof t){var p=t.getAttribute("data-code");null!=p&&ai_check_block()&&ai_check_and_insert_block()&&(t.setAttribute("data-code",p.substring(Math.floor(h/19))),ai_insert_code_by_class(c),t.remove())}};ai_process_elements_active=!1; function ai_process_elements(){ai_process_elements_active||setTimeout(function(){ai_process_elements_active=!1;"function"==typeof ai_process_rotations&&ai_process_rotations();"function"==typeof ai_process_lists&&ai_process_lists(jQuery(".ai-list-data"));"function"==typeof ai_process_ip_addresses&&ai_process_ip_addresses(jQuery(".ai-ip-data"));"function"==typeof ai_adb_process_blocks&&ai_adb_process_blocks()},5);ai_process_elements_active=!0} var Arrive=function(c,h,t){function p(r,d,e){b.addMethod(d,e,r.unbindEvent);b.addMethod(d,e,r.unbindEventWithSelectorOrCallback);b.addMethod(d,e,r.unbindEventWithSelectorAndCallback)}function u(r){r.arrive=l.bindEvent;p(l,r,"unbindArrive");r.leave=w.bindEvent;p(w,r,"unbindLeave")}if(c.MutationObserver&&"undefined"!==typeof HTMLElement){var y=0,b=function(){var r=HTMLElement.prototype.matches||HTMLElement.prototype.webkitMatchesSelector||HTMLElement.prototype.mozMatchesSelector||HTMLElement.prototype.msMatchesSelector; return{matchesSelector:function(d,e){return d instanceof HTMLElement&&r.call(d,e)},addMethod:function(d,e,f){var a=d[e];d[e]=function(){if(f.length==arguments.length)return f.apply(this,arguments);if("function"==typeof a)return a.apply(this,arguments)}},callCallbacks:function(d,e){e&&e.options.onceOnly&&1==e.firedElems.length&&(d=[d[0]]);for(var f=0,a;a=d[f];f++)a&&a.callback&&a.callback.call(a.elem,a.elem);e&&e.options.onceOnly&&1==e.firedElems.length&&e.me.unbindEventWithSelectorAndCallback.call(e.target, e.selector,e.callback)},checkChildNodesRecursively:function(d,e,f,a){for(var g=0,k;k=d[g];g++)f(k,e,a)&&a.push({callback:e.callback,elem:k}),0<k.childNodes.length&&b.checkChildNodesRecursively(k.childNodes,e,f,a)},mergeArrays:function(d,e){var f={},a;for(a in d)d.hasOwnProperty(a)&&(f[a]=d[a]);for(a in e)e.hasOwnProperty(a)&&(f[a]=e[a]);return f},toElementsArray:function(d){"undefined"===typeof d||"number"===typeof d.length&&d!==c||(d=[d]);return d}}}(),v=function(){var r=function(){this._eventsBucket= [];this._beforeRemoving=this._beforeAdding=null};r.prototype.addEvent=function(d,e,f,a){d={target:d,selector:e,options:f,callback:a,firedElems:[]};this._beforeAdding&&this._beforeAdding(d);this._eventsBucket.push(d);return d};r.prototype.removeEvent=function(d){for(var e=this._eventsBucket.length-1,f;f=this._eventsBucket[e];e--)d(f)&&(this._beforeRemoving&&this._beforeRemoving(f),(f=this._eventsBucket.splice(e,1))&&f.length&&(f[0].callback=null))};r.prototype.beforeAdding=function(d){this._beforeAdding= d};r.prototype.beforeRemoving=function(d){this._beforeRemoving=d};return r}(),m=function(r,d){var e=new v,f=this,a={fireOnAttributesModification:!1};e.beforeAdding(function(g){var k=g.target;if(k===c.document||k===c)k=document.getElementsByTagName("html")[0];var n=new MutationObserver(function(x){d.call(this,x,g)});var q=r(g.options);n.observe(k,q);g.observer=n;g.me=f});e.beforeRemoving(function(g){g.observer.disconnect()});this.bindEvent=function(g,k,n){k=b.mergeArrays(a,k);for(var q=b.toElementsArray(this), x=0;x<q.length;x++)e.addEvent(q[x],g,k,n)};this.unbindEvent=function(){var g=b.toElementsArray(this);e.removeEvent(function(k){for(var n=0;n<g.length;n++)if(this===t||k.target===g[n])return!0;return!1})};this.unbindEventWithSelectorOrCallback=function(g){var k=b.toElementsArray(this);e.removeEvent("function"===typeof g?function(n){for(var q=0;q<k.length;q++)if((this===t||n.target===k[q])&&n.callback===g)return!0;return!1}:function(n){for(var q=0;q<k.length;q++)if((this===t||n.target===k[q])&&n.selector=== g)return!0;return!1})};this.unbindEventWithSelectorAndCallback=function(g,k){var n=b.toElementsArray(this);e.removeEvent(function(q){for(var x=0;x<n.length;x++)if((this===t||q.target===n[x])&&q.selector===g&&q.callback===k)return!0;return!1})};return this},l=new function(){function r(f,a,g){return b.matchesSelector(f,a.selector)&&(f._id===t&&(f._id=y++),-1==a.firedElems.indexOf(f._id))?(a.firedElems.push(f._id),!0):!1}var d={fireOnAttributesModification:!1,onceOnly:!1,existing:!1};l=new m(function(f){var a= {attributes:!1,childList:!0,subtree:!0};f.fireOnAttributesModification&&(a.attributes=!0);return a},function(f,a){f.forEach(function(g){var k=g.addedNodes,n=g.target,q=[];null!==k&&0<k.length?b.checkChildNodesRecursively(k,a,r,q):"attributes"===g.type&&r(n,a,q)&&q.push({callback:a.callback,elem:n});b.callCallbacks(q,a)})});var e=l.bindEvent;l.bindEvent=function(f,a,g){"undefined"===typeof g?(g=a,a=d):a=b.mergeArrays(d,a);var k=b.toElementsArray(this);if(a.existing){for(var n=[],q=0;q<k.length;q++)for(var x= k[q].querySelectorAll(f),z=0;z<x.length;z++)n.push({callback:g,elem:x[z]});if(a.onceOnly&&n.length)return g.call(n[0].elem,n[0].elem);setTimeout(b.callCallbacks,1,n)}e.call(this,f,a,g)};return l},w=new function(){function r(f,a){return b.matchesSelector(f,a.selector)}var d={};w=new m(function(){return{childList:!0,subtree:!0}},function(f,a){f.forEach(function(g){g=g.removedNodes;var k=[];null!==g&&0<g.length&&b.checkChildNodesRecursively(g,a,r,k);b.callCallbacks(k,a)})});var e=w.bindEvent;w.bindEvent= function(f,a,g){"undefined"===typeof g?(g=a,a=d):a=b.mergeArrays(d,a);e.call(this,f,a,g)};return w};h&&u(h.fn);u(HTMLElement.prototype);u(NodeList.prototype);u(HTMLCollection.prototype);u(HTMLDocument.prototype);u(Window.prototype);h={};p(l,h,"unbindAllArrive");p(w,h,"unbindAllLeave");return h}}(window,"undefined"===typeof jQuery?null:jQuery,void 0); var $jscomp=$jscomp||{};$jscomp.scope={};$jscomp.createTemplateTagFirstArg=function(a){return a.raw=a};$jscomp.createTemplateTagFirstArgWithRaw=function(a,m){a.raw=m;return a};$jscomp.arrayIteratorImpl=function(a){var m=0;return function(){return m<a.length?{done:!1,value:a[m++]}:{done:!0}}};$jscomp.arrayIterator=function(a){return{next:$jscomp.arrayIteratorImpl(a)}};$jscomp.makeIterator=function(a){var m="undefined"!=typeof Symbol&&Symbol.iterator&&a[Symbol.iterator];return m?m.call(a):$jscomp.arrayIterator(a)}; jQuery(function(a){function m(d){d=d.match(F);return null!=d&&1<d.length&&"string"===typeof d[1]&&0<d[1].length?d[1].toLowerCase():null}function A(d){try{var k=Date.parse(d);isNaN(k)&&(k=null)}catch(L){k=null}if(null==k&&d.includes(" ")){d=d.split(" ");try{k=Date.parse(d[0]);if(d[1].includes(":")){var u=d[1].split(":");k+=1E3*(3600*parseInt(u[0])+60*parseInt(u[1])+parseInt(u[2]))}isNaN(k)&&(k=null)}catch(L){k=null}}return k}function p(){(jQuery("#ai-iab-tcf-bar").length||jQuery(".ai-list-manual").length)&& "function"==typeof __tcfapi&&"function"==typeof ai_load_blocks&&"undefined"==typeof ai_iab_tcf_callback_installed&&(__tcfapi("addEventListener",2,function(d,k){k&&"useractioncomplete"===d.eventStatus&&(ai_tcData=d,ai_load_blocks(),jQuery("#ai-iab-tcf-status").text("DATA LOADED"),jQuery("#ai-iab-tcf-bar").addClass("status-ok").removeClass("status-error"))}),ai_iab_tcf_callback_installed=!0)}Array.prototype.includes||(Array.prototype.includes=function(d){return!!~this.indexOf(d)});var F=/:\/\/(.[^/:]+)/i; ai_process_lists=function(d){function k(c,b,h){if(0==c.length){if("!@!"==h)return!0;b!=h&&("true"==h.toLowerCase()?h=!0:"false"==h.toLowerCase()&&(h=!1));return b==h}if("object"!=typeof b&&"array"!=typeof b)return!1;var f=c[0];c=c.slice(1);if("*"==f)for(b=$jscomp.makeIterator(Object.entries(b)),f=b.next();!f.done;f=b.next()){if(f=$jscomp.makeIterator(f.value),f.next(),f=f.next().value,k(c,f,h))return!0}else if(f in b)return k(c,b[f],h);return!1}function u(c,b,h){if("object"!=typeof c||-1==b.indexOf("["))return!1; b=b.replace(/]| /gi,"").split("[");return k(b,c,h)}function L(){"function"==typeof __tcfapi&&(a("#ai-iab-tcf-status").text("DETECTED"),__tcfapi("getTCData",2,function(c,b){b?(a("#ai-iab-tcf-bar").addClass("status-ok"),"tcloaded"==c.eventStatus||"useractioncomplete"==c.eventStatus?(ai_tcData=c,c.gdprApplies?a("#ai-iab-tcf-status").text("DATA LOADED"):jQuery("#ai-iab-tcf-status").text("GDPR DOES NOT APPLY"),a("#ai-iab-tcf-bar").addClass("status-ok").removeClass("status-error"),setTimeout(function(){ai_process_lists()}, 10)):"cmpuishown"==c.eventStatus&&(ai_cmpuishown=!0,a("#ai-iab-tcf-status").text("CMP UI SHOWN"),a("#ai-iab-tcf-bar").addClass("status-ok").removeClass("status-error"))):(a("#ai-iab-tcf-status").text("__tcfapi getTCData failed"),a("#ai-iab-tcf-bar").removeClass("status-ok").addClass("status-error"))}))}function H(c){"function"==typeof __tcfapi?("undefined"==typeof ai_iab_tcf_callback_installed&&p(),"undefined"==typeof ai_tcData_requested&&(ai_tcData_requested=!0,L(),url_parameters_need_tcData=!0)): c&&(a("#ai-iab-tcf-bar").addClass("status-error").removeClass("status-ok"),a("#ai-iab-tcf-status").text("MISSING: __tcfapi function not found"))}d=null==d?a("div.ai-list-data, meta.ai-list-data"):d.filter(".ai-list-data");if(d.length){d.removeClass("ai-list-data");var G=document.cookie.split(";");G.forEach(function(c,b){G[b]=c.trim()});var R=getAllUrlParams(window.location.search);if(null!=R.referrer)var r=R.referrer;else r=document.referrer,""!=r&&(r=m(r));var M=window.navigator.userAgent,N=M.toLowerCase(); if("undefined"!==typeof MobileDetect)var S=new MobileDetect(M);d.each(function(){var c=a(this).closest("div.code-block"),b=!0,h=a(this).attr("referer-list");if("undefined"!=typeof h){h=b64d(h).split(",");var f=a(this).attr("referer-list-type"),y=!1;a.each(h,function(v,g){if(""==g)return!0;if("*"==g.charAt(0))if("*"==g.charAt(g.length-1)){if(g=g.substr(1,g.length-2),-1!=r.indexOf(g))return y=!0,!1}else{if(g=g.substr(1),r.substr(-g.length)==g)return y=!0,!1}else if("*"==g.charAt(g.length- 1)){if(g=g.substr(0,g.length-1),0==r.indexOf(g))return y=!0,!1}else if("#"==g){if(""==r)return y=!0,!1}else if(g==r)return y=!0,!1});switch(f){case "B":y&&(b=!1);break;case "W":y||(b=!1)}}if(b&&(h=a(this).attr("client-list"),"undefined"!=typeof h&&"undefined"!==typeof S))switch(h=b64d(h).split(","),f=a(this).attr("client-list-type"),n=!1,a.each(h,function(v,g){if(""==g.trim())return!0;var I=g.split("&&");a.each(I,function(W,e){var t=!0;e=e.trim();"!!"==e.substring(0,2)&&(t=!1,e=e.substring(2));var l= !1;"*"==e.charAt(0)?"*"==e.charAt(e.length-1)?(e=e.substr(1,e.length-2).toLowerCase(),-1!=N.indexOf(e)&&(l=!0)):(e=e.substr(1).toLowerCase(),N.substr(-e.length)==e&&(l=!0)):"*"==e.charAt(e.length-1)?(e=e.substr(0,e.length-1).toLowerCase(),0==N.indexOf(e)&&(l=!0)):S.is(e)&&(l=!0);n=l?t:!t;if(!n)return!1});if(n)return!1}),f){case "B":n&&(b=!1);break;case "W":n||(b=!1)}var O=h=!1;if(b&&(f=a(this).attr("parameter-list"),"undefined"!=typeof f)){f=b64d(f).split(",");var w=a(this).attr("parameter-list-type"), T=[];G.forEach(function(v){v=v.split("=");try{var g=JSON.parse(decodeURIComponent(v[1]))}catch(I){g=decodeURIComponent(v[1])}T[v[0]]=g});var n=!1,J=a(this);a.each(f,function(v,g){var I=g.split("&&");a.each(I,function(W,e){var t=!0;e=e.trim();"!!"==e.substring(0,2)&&(t=!1,e=e.substring(2));var l=e,z="!@!",U=-1!=e.indexOf("["),V=(0==e.indexOf("tcf-v2")||0==e.indexOf("euconsent-v2"))&&-1!=e.indexOf("[");-1!=e.indexOf("=")&&(z=e.split("="),l=z[0],z=z[1],U=-1!=l.indexOf("["),V=(0==l.indexOf("tcf-v2")|| 0==l.indexOf("euconsent-v2"))&&-1!=l.indexOf("["));if(V)a("#ai-iab-tcf-bar").show(),"object"==typeof ai_tcData?(a("#ai-iab-tcf-bar").addClass("status-ok"),l=l.replace(/]| /gi,"").split("["),l.shift(),n=(l=k(l,ai_tcData,z))?t:!t):(J.addClass("ai-list-data"),O=!0,"function"==typeof __tcfapi?H(!1):"undefined"==typeof ai_tcData_retrying&&(ai_tcData_retrying=!0,setTimeout(function(){"function"==typeof __tcfapi?H(!1):setTimeout(function(){"function"==typeof __tcfapi?H(!1):setTimeout(function(){H(!0)},3E3)}, 1E3)},600)));else if(U)n=(l=u(T,l,z))?t:!t;else{var P=!1;"!@!"==z?G.every(function(X){return X.split("=")[0]==e?(P=!0,!1):!0}):P=-1!=G.indexOf(e);n=P?t:!t}if(!n)return!1});if(n)return!1});switch(w){case "B":n&&(b=!1);break;case "W":n||(b=!1)}a(this).hasClass("ai-list-manual")&&(b?(J.removeClass("ai-list-data"),J.removeClass("ai-list-manual")):(h=!0,J.addClass("ai-list-data")));if(!h&&!O&&(f=a(this).data("debug-info"),"undefined"!=typeof f&&(f=a("."+f),0!=f.length))){var q=f.parent();q.hasClass("ai-debug-info")&& q.remove()}}q=a(this).prevAll(".ai-debug-bar.ai-debug-lists");f=""==r?"#":r;q.find(".ai-debug-name.ai-list-info").text(f).attr("title",M);q.find(".ai-debug-name.ai-list-status").text(b?ai_front.visible:ai_front.hidden);f=!1;if(b){w=a(this).attr("scheduling-start");var B=a(this).attr("scheduling-end"),C=a(this).attr("scheduling-days");if("undefined"!=typeof w&&"undefined"!=typeof B&&"undefined"!=typeof C){f=!0;var Q=parseInt(a(this).attr("scheduling-fallback")),x=parseInt(a(this).attr("gmt"));w=A(b64d(w))+ x;B=A(b64d(B))+x;C=b64d(C).split(",");q=a(this).attr("scheduling-type");var D=(new Date).getTime()+x,K=new Date(D),E=K.getDay();0==E?E=6:E--;x=D>=w&&D<B&&C.includes(E.toString());switch(q){case "B":x=!x}x||(b=!1);K=K.toISOString().split(".")[0].replace("T"," ");q=a(this).prevAll(".ai-debug-bar.ai-debug-scheduling");q.find(".ai-debug-name.ai-scheduling-info").text(K+" "+E+" current_time:"+D.toString()+" start_date:"+w.toString()+" ="+(D>=w).toString()+" end_date:"+B.toString()+" =:"+(D<B).toString()+ " days:"+C.toString()+" =:"+C.includes(E.toString()).toString());q.find(".ai-debug-name.ai-scheduling-status").text(b?ai_front.visible:ai_front.hidden);b||0==Q||(q.removeClass("ai-debug-scheduling").addClass("ai-debug-fallback"),q.find(".ai-debug-name.ai-scheduling-status").text(ai_front.fallback+"="+Q))}}if(h||O)return!0;a(this).css({visibility:"",position:"",width:"",height:"","z-index":""});b?(c.css({visibility:""}),c.hasClass("ai-remove-position")&&c.css({position:""}),"undefined"!=typeof a(this).data("code")&& (b=b64d(a(this).data("code")),0!=a(this).closest("head").length?(a(this).after(b),a(this).remove()):a(this).append(b),ai_process_element(this))):f&&!x&&0!=Q?(c.css({visibility:""}),c.hasClass("ai-remove-position")&&c.css({position:""}),a(this).next(".ai-fallback").removeClass("ai-fallback"),"undefined"!=typeof a(this).data("fallback-code")?(b=b64d(a(this).data("fallback-code")),a(this).append(b),ai_process_element(this)):(a(this).hide(),c.find(".ai-debug-block").length||c.hide()),b=c.attr("data-ai"), "undefined"!==typeof b&&!1!==b&&(b=a(this).attr("fallback-tracking"),"undefined"!==typeof b&&!1!==b&&c.attr("data-ai",b))):(a(this).hide(),c.find(".ai-debug-block").length||c.hide(),c.removeAttr("data-ai").removeClass("ai-track"),c.find(".ai-debug-block").length?(c.css({visibility:""}).removeClass("ai-close"),c.hasClass("ai-remove-position")&&c.css({position:""})):c.hide());a(this).attr("data-code","");a(this).attr("data-fallback-code","");c.removeClass("ai-list-block")})}};a(document).ready(function(d){setTimeout(function(){ai_process_lists(); setTimeout(function(){p();if("function"==typeof ai_load_blocks){var k=function(u){"cmplzEnableScripts"!=u.type&&"all"!==u.consentLevel||ai_load_blocks()};jQuery(document).on("cmplzEnableScripts",k);jQuery(document).on("cmplz_event_marketing",k)}},50);jQuery("#ai-iab-tcf-bar").click(function(){document.cookie="euconsent-v2=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;";document.cookie="__lxG__consent__v2=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;";document.cookie="__lxG__consent__v2_daisybit=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;"; document.cookie="__lxG__consent__v2_gdaisybit=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;";document.cookie="complianz_consent_status=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;";document.cookie="cmplz_marketing=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;";document.cookie="cmplz_stats=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;";jQuery("#ai-iab-tcf-status").text("COOKIE DELETED")})},5)})}); function ai_process_element(a){setTimeout(function(){"function"==typeof ai_process_rotations_in_element&&ai_process_rotations_in_element(a);"function"==typeof ai_process_lists&&ai_process_lists(jQuery(".ai-list-data",a));"function"==typeof ai_process_ip_addresses&&ai_process_ip_addresses(jQuery(".ai-ip-data",a));"function"==typeof ai_adb_process_blocks&&ai_adb_process_blocks(a)},5)} function getAllUrlParams(a){var m=a?a.split("?")[1]:window.location.search.slice(1);a={};if(m){m=m.split("#")[0];m=m.split("&");for(var A=0;A<m.length;A++){var p=m[A].split("="),F=void 0,d=p[0].replace(/\[\d*\]/,function(k){F=k.slice(1,-1);return""});p="undefined"===typeof p[1]?"":p[1];d=d.toLowerCase();p=p.toLowerCase();a[d]?("string"===typeof a[d]&&(a[d]=[a[d]]),"undefined"===typeof F?a[d].push(p):a[d][F]=p):a[d]=p}}return a}; ai_js_code = true; Notifications.impactify-player-container,.impx-reset{backface-visibility:visible;background:0;background-attachment:scroll;background-clip:border-box;background-color:transparent;background-image:none;background-origin:padding-box;background-position:0 0;background-position-x:0;background-position-y:0;background-repeat:repeat;background-size:auto auto;border:0;border-style:none;border-width:medium;border-color:inherit;border-bottom:0;border-bottom-color:inherit;border-bottom-left-radius:0;border-bottom-right-radius:0;border-bottom-style:none;border-bottom-width:medium;border-collapse:separate;border-image:none;border-left:0;border-left-color:inherit;border-left-style:none;border-left-width:medium;border-radius:0;border-right:0;border-right-color:inherit;border-right-style:none;border-right-width:medium;border-spacing:0;border-top:0;border-top-color:inherit;border-top-left-radius:0;border-top-right-radius:0;border-top-style:none;border-top-width:medium;bottom:auto;box-shadow:none;box-sizing:content-box;caption-side:top;clear:none;clip:auto;color:inherit;content:normal;cursor:auto;float:none;font:400;font-family:roboto,arial,tahoma,sans-serif;font-size:medium;font-style:normal;font-variant:normal;font-weight:400;height:auto;hyphens:none;left:auto;letter-spacing:normal;line-height:normal;list-style:none;list-style-image:none;list-style-position:outside;list-style-type:disc;margin:0;margin-bottom:0;margin-left:0;margin-right:0;margin-top:0;max-height:none;max-width:none;min-height:0;min-width:0;opacity:1;orphans:0;outline:0;outline-color:invert;outline-style:none;outline-width:medium;overflow:visible;overflow-x:visible;overflow-y:visible;padding:0;padding-bottom:0;padding-left:0;padding-right:0;padding-top:0;page-break-after:auto;page-break-before:auto;page-break-inside:auto;perspective:none;perspective-origin:50% 50%;position:static;right:auto;tab-size:8;table-layout:auto;text-align:left;text-align-last:auto;text-decoration:none;text-decoration-color:inherit;text-decoration-line:none;text-decoration-style:solid;text-indent:0;text-shadow:none;text-transform:none;top:auto;transform:none;transform-style:flat;transition:none;transition-delay:0s;transition-duration:0s;transition-property:none;transition-timing-function:ease;unicode-bidi:normal;vertical-align:baseline;visibility:visible;white-space:normal;widows:0;width:auto;word-spacing:normal;z-index:auto}#impactify-ad-container,#impactify-splash-overlay,.impactify-full-block,.impactify-player-container,.impactify-player-container .impactify-content-player{position:absolute;top:0;left:0;bottom:0;right:0;width:100%;height:100%}._impx-silentw{bottom:-30vh!important}#impactify-splash-overlay{position:fixed;background:rgba(255,255,255,.97);display:none}#impactify-splash-overlay #impactify-splash-title{color:#777;font-size:1.6rem;padding:1rem;text-align:center}#impactify-splash-overlay._impx-in{display:block}.impactify-in{border-radius:0!important}.impactify-in.impactify-skin-chromeless{box-shadow:0 0 0 1px #aaa,0 0 0 2px #999!important;border-radius:2px!important}.impactify-in.impactify-skin-generic{box-shadow:none!important;border-radius:0!important;background:0 0!important}.impactify-in.impactify-skin-generic .impactify-footer,.impactify-in.impactify-skin-generic .impactify-progress-bar{display:none!important}.impactify-in.impactify-skin-rounded{border-radius:3px!important}.impactify-in.impactify-skin-rounded .impactify-video-ad-player{border-radius:3px!important}.impactify-in.impactify-skin-rounded .impactify-progress-bar{border-radius:0 0 3px 3px!important;bottom:0!important}.impactify-in.impactify-cont-in{background:#000!important}.impactify-in.impactify-wl .impactify-copyright{display:none}._impx-exp-pe:not(.impactify-in):not(._impx-launcher){pointer-events:none}.impactify-py.impactify-style-impact,.impactify-py.impactify-style-rising{box-shadow:0 0 5px 1px rgba(0,0,0,.05),5px 5px 10px rgba(0,0,0,.1)!important}.impactify-py.impactify-skin-flat{box-shadow:none!important}.impactify-cont-in .impactify-copyright{display:none}.impactify-player-container{overflow:hidden;position:absolute!important;width:100%!important;height:100%!important}.impactify-in .impactify-player-container{overflow:visible}.impactify-player-container .impactify-progress-bar{display:none;position:absolute!important;left:0!important;right:0!important;height:3px!important;z-index:3!important;overflow:hidden!important;bottom:0!important}.impactify-wrap-mobile .impactify-player-container .impactify-progress-bar{height:2px!important}.impactify-player-container .impactify-progress-bar span{background:#fff!important;background:linear-gradient(150deg,#62aaff 0,#1f8cff 50%)!important;width:0;height:100%!important;position:absolute!important;left:0!important}.impactify-content-loaded .impactify-player-container .impactify-progress-bar span{width:100%}.impactify-show-progress-bar .impactify-player-container .impactify-progress-bar{display:block!important}.impactify-player-container .impactify-footer{display:none;z-index:3!important;font-family:arial,verdana,tahoma,sans-serif!important;position:absolute!important;left:0!important;right:0!important;width:auto!important;height:20px!important;font-size:8px!important;line-height:20px!important;color:#ddd!important;background:0 0!important;bottom:0!important}.impactify-wrap-mobile .impactify-player-container .impactify-footer{font-size:8.5px!important}.impactify-player-container .impactify-footer .impactify-title{box-sizing:border-box!important;padding:0 5px 0 10px!important;float:left!important;width:60%!important;overflow:hidden!important;text-overflow:ellipsis!important;white-space:nowrap!important}.impactify-player-container .impactify-footer .impactify-copyright{box-sizing:border-box!important;padding:0 10px 0 5px!important;text-align:right!important;float:right!important;width:40%!important;overflow:hidden!important;text-overflow:ellipsis!important;white-space:nowrap!important;opacity:.9}.impactify-player-container .impactify-footer a{color:#ddd!important;text-decoration:none!important}.impactify-player-container .impactify-footer a:hover{color:#ddd!important}.impactify-show-footer .impactify-player-container .impactify-footer{display:block!important}.impactify-style-splash .impactify-player-container .impactify-footer{bottom:-30px!important;font-size:1.4rem!important}.impactify-player-container .impactify-ad-player,.impactify-player-container .impactify-video-ad-player{top:0;position:absolute!important;bottom:0!important;left:0!important;width:100%!important;height:100%!important;overflow:hidden!important}.impactify-VJS-player .impactify-player-container .impactify-ad-player,.impactify-VJS-player .impactify-player-container .impactify-video-ad-player{height:100%}.impactify-player-container .impactify-ad-player iframe,.impactify-player-container .impactify-video-ad-player iframe{max-width:100%!important;max-height:100%!important}.impactify-wrap-mobile.impactify-style-impact:not(._impx_force-ratio) .impactify-player-container .impactify-ad-player iframe,.impactify-wrap-mobile.impactify-style-impact:not(._impx_force-ratio) .impactify-player-container .impactify-video-ad-player iframe,.impactify-wrap-mobile.impactify-style-inline:not(._impx_force-ratio) .impactify-player-container .impactify-ad-player iframe,.impactify-wrap-mobile.impactify-style-inline:not(._impx_force-ratio) .impactify-player-container .impactify-video-ad-player iframe{max-width:none!important;max-height:none!important}.impactify-player-container .impactify-video-ad-player{z-index:2!important}.impactify-wrap-mobile._impx-v-centered .impactify-player-container .impactify-video-ad-player,.impactify-wrap-mobile._impx-v-centered.impactify-cont-in .impactify-player-container .impactify-video-ad-player,.impactify-wrap-mobile._impx-v-cov-centered .impactify-player-container .impactify-video-ad-player{display:flex;align-items:center}.impactify-player-container .impactify-video-ad-player video{background:0 0!important}.impactify-player-container .impactify-ad-player{z-index:1!important}.impactify-player-container .impactify-content-player{display:none;z-index:2}.impactify-player-container .impactify-caption-title{display:none;z-index:2!important;position:absolute!important;bottom:3rem!important;background:rgba(0,0,0,.3)!important;max-width:35%!important;width:180px!important;padding:10px!important;max-height:25%!important;font-size:11px!important;color:#ccc!important;border-radius:0 2px 2px 0!important;text-align:center!important}.impactify-commands{z-index:4!important;position:absolute!important;right:0!important;cursor:pointer!important;top:0!important}.impactify-commands *{outline:0}.impactify-align-left .impactify-commands{right:auto!important;left:0!important}.impactify-commands>div{float:left!important;width:30px!important;height:30px!important;background-repeat:no-repeat!important;background-position:center!important}.impactify-wrap-desktop .impactify-commands>div:hover{background-color:rgba(0,0,0,.1)!important}.impactify-commands.ext-commands{top:-25px!important;z-index:1!important;padding-bottom:8px!important}._impx-square-btn .impactify-commands.ext-commands{top:-20px!important;padding:0!important;border-radius:10px 0 0!important;background-color:rgba(0,0,0,.1)!important}._impx-square-btn.impactify-align-left .impactify-commands.ext-commands{border-radius:0 5px 0 0!important}.impactify-commands.ext-commands>div{border-radius:100%!important;margin:0 5px!important;width:20px!important;height:20px!important;background-color:rgba(0,0,0,.05)!important}._impx-square-btn .impactify-commands.ext-commands>div{border-radius:0!important;margin:0 0 0 5px!important;width:20px!important;height:20px!important;background-color:transparent!important}._impx-strict:not(._impx-square-btn) .impactify-commands.ext-commands>div{background-color:rgba(0,0,0,.9)!important}._impx-strict._impx-square-btn .impactify-commands.ext-commands{background-color:rgba(0,0,0,.9)!important}.impactify-close-btn{display:none!important;background-image:url(data:image/svg+xml,%3Csvg%20xmlns%3D%22http%3A%2F%2Fwww.w3.org%2F2000%2Fsvg%22%20viewBox%3D%22-388.5%20313.5%2014%2014%22%3E%3Cpath%20fill%3D%22%23fff%22%20d%3D%22M-388.5%20327.281v-1.181l5.709-5.709-5.709-5.709v-1.182h1.181l5.709%205.709%205.708-5.709h1.182v1.182l-5.708%205.709%205.708%205.709v1.182h-1.182l-5.708-5.709-5.709%205.709h-1.181z%22%2F%3E%3C%2Fsvg%3E);background-size:60%!important}.impx-close .impactify-close-btn{display:block!important}.impactify-speaker-btn{width:30px!important;height:30px!important;background-repeat:no-repeat!important;background-position:center!important;display:none;background-size:90%!important;background-image:url(data:image/svg+xml,%3Csvg%20xmlns%3D%27http%3A%2F%2Fwww.w3.org%2F2000%2Fsvg%27%20viewBox%3D%270%200%2024%2024%27%20fill%3D%27%23CCC%27%20width%3D%2718px%27%20height%3D%2718px%27%3E%3Cpath%20d%3D%27M0%200h24v24H0z%27%20fill%3D%27none%27%2F%3E%3Cpath%20d%3D%27M16.5%2012c0-1.77-1.02-3.29-2.5-4.03v2.21l2.45%202.45c.03-.2.05-.41.05-.63zm2.5%200c0%20.94-.2%201.82-.54%202.64l1.51%201.51C20.63%2014.91%2021%2013.5%2021%2012c0-4.28-2.99-7.86-7-8.77v2.06c2.89.86%205%203.54%205%206.71zM4.27%203L3%204.27%207.73%209H3v6h4l5%205v-6.73l4.25%204.25c-.67.52-1.42.93-2.25%201.18v2.06c1.38-.31%202.63-.95%203.69-1.81L19.73%2021%2021%2019.73l-9-9L4.27%203zM12%204L9.91%206.09%2012%208.18V4z%27%2F%3E%3C%2Fsvg%3E);position:absolute!important;bottom:20px!important;right:20px!important;z-index:2;opacity:.5!important}.impx-speaker .impactify-speaker-btn{display:block!important}.impactify-speaker-btn.active{background-image:url(data:image/svg+xml,%3Csvg%20xmlns%3D%27http%3A%2F%2Fwww.w3.org%2F2000%2Fsvg%27%20viewBox%3D%270%200%2024%2024%27%20fill%3D%27%23CCC%27%20width%3D%2718px%27%20height%3D%2718px%27%3E%3Cpath%20d%3D%27M0%200h24v24H0z%27%20fill%3D%27none%27%2F%3E%3Cpath%20d%3D%27M3%209v6h4l5%205V4L7%209H3zm13.5%203c0-1.77-1.02-3.29-2.5-4.03v8.05c1.48-.73%202.5-2.25%202.5-4.02zM14%203.23v2.06c2.89.86%205%203.54%205%206.71s-2.11%205.85-5%206.71v2.06c4.01-.91%207-4.49%207-8.77s-2.99-7.86-7-8.77z%27%2F%3E%3C%2Fsvg%3E);opacity:1!important}.impactify-saso .impactify-speaker-btn{display:none!important}.impactify-meta-wrapper{opacity:0}.impactify-in.impactify-native .impactify-copyright,.impactify-in.impactify-native .impactify-footer{display:block!important}.impactify-in.impactify-native .impactify-reduce-btn,.impactify-in.impactify-native .impactify-speaker-btn{display:none!important}#impactify-nv-container{display:block!important;min-height:100%!important}._impx-dmp_far .impactify-dm-container{width:100%!important;height:100%!important}._impx-dmp .impactify-player-container .impactify-ad-player{display:flex;align-items:center}._impx-dmp:not(._impx-dmp_far) .impactify-player-container .impactify-ad-player iframe{max-width:none!important;max-height:none!important}@keyframes impx-anim-slides{0%{right:0;opacity:0;background:0 0}5%{right:25%;opacity:1;background:rgba(0,0,0,.75)}100%,50%{right:0;opacity:1;background:rgba(0,0,0,.5)}}.impactify-gray{filter:grayscale(90%)!important}#impactify-screen-inline,#impactify-screen-static{width:100%;margin-right:auto;margin-left:auto}#impactify-screen-inline._impx-ph,#impactify-screen-inline._impx-started,#impactify-screen-static._impx-ph,#impactify-screen-static._impx-started{margin-bottom:20px}div+#impactify-screen-inline._impx-ph,div+#impactify-screen-inline._impx-started,div+#impactify-screen-static._impx-ph,div+#impactify-screen-static._impx-started,p+#impactify-screen-inline._impx-ph,p+#impactify-screen-inline._impx-started,p+#impactify-screen-static._impx-ph,p+#impactify-screen-static._impx-started{margin-top:20px}body>#impactify-screen-inline,body>#impactify-screen-static{max-width:1024px;max-height:576px}.impactify-transition{transition:width .25s ease,height .25s ease,min-width .3s ease,min-height .3s ease!important}.impactify-standard,.impactify-style-impact{margin:0 30px 40px!important}.impactify-wrap-mobile.impactify-standard,.impactify-wrap-mobile.impactify-style-impact{margin:0!important}.impactify-style-black{background:#000!important}.impactify-style-inline{margin:auto!important}.impactify-style-inline-active{position:absolute!important;left:0!important;right:0!important;top:0!important;bottom:auto!important;transition:none!important}.impactify-style-inline-active .impactify-commands .impactify-close-btn{display:none!important}.impactify-style-inline-absolute{position:absolute!important}.impactify-wrap-mobile.impactify-style-inline{left:50%!important;transform:translate(-50%,0)!important}.impactify-wrap-mobile.impactify-style-inline-active .impactify-commands{right:auto!important;left:0!important}.impactify-style-impact,.impactify-style-inline{transition:max-height 3s ease-out;max-height:40vh!important}.impactify-style-impact._impx_force-ratio.impactify-in._impx-strict,.impactify-style-inline._impx_force-ratio.impactify-in._impx-strict{min-height:146px!important}.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape){max-height:36vw!important}.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape).impactify-cont-in{max-height:38vw!important}._impx-downscroll.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape){max-height:38vw!important}.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_cnt-ap.impactify-cont-in{max-height:36vw!important}.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_size_l:not(._impx-launcher),.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_size_m:not(._impx-launcher){max-height:22vh!important;height:auto!important}.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_size_l:not(._impx-launcher):before,.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_size_m:not(._impx-launcher):before{content:''!important;display:block!important;height:0!important;width:0!important;padding-bottom:calc(41%)!important}._impx-downscroll._impx_size_m.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape),._impx-downscroll._impx_size_s.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape){max-height:22vh!important}.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_size_m:not(._impx-launcher):before,.impactify-wrap-mobile._impx_soc.impactify-style-impact:not(._impx-landscape)._impx_size_s:not(._impx-launcher):before{padding-bottom:calc(56.25%)!important}.impactify-style-impact._impx_size_full:not(.impactify-standard){left:0!important;bottom:0!important}.impactify-style-inline-active{max-height:none!important}.impactify-style-impact.impactify-align-center{left:50%!important;transform:translate(-50%,0)!important}.impactify-style-static{box-shadow:none!important;margin:0 auto!important;overflow:hidden}.impactify-style-static .impactify-progress-bar{height:5px!important}.impactify-style-splash{margin:0!important}.impactify-wrap-desktop.impactify-style-rising{min-width:0;min-height:0;top:50%;transform:translateY(-50%)!important;bottom:auto!important;margin:0 10px 10px!important}.impactify-style-native .impactify-copyright a{display:none!important}.impactify-style-native .impactify-progress-bar{height:1px!important}.impactify-style-native .impactify-progress-bar span{background:0 0!important}.impactify-style-notify{background:0 0!important;border-radius:0!important;top:auto!important;bottom:0!important;transform:translateY(0)!important}.impactify-style-notify .impactify-progress-bar,.impactify-style-notify .impactify-reduce-btn,.impactify-style-notify .impactify-speaker-btn{display:none!important}.impactify-in.impactify-style-notify{box-shadow:none!important}.impactify-in.impactify-style-notify .impactify-footer{display:block!important}.impactify-in.impactify-style-notify .impactify-footer .impactify-title{text-align:right!important}.impactify-in.impactify-standard,.impactify-standard{background:0 0!important;bottom:0!important;box-shadow:none!important;border-radius:0!important;min-height:0!important}.impactify-in.impactify-standard .impactify-footer .impactify-copyright,.impactify-in.impactify-standard .impactify-progress-bar,.impactify-in.impactify-standard .impactify-reduce-btn,.impactify-in.impactify-standard .impactify-speaker-btn,.impactify-standard .impactify-footer .impactify-copyright,.impactify-standard .impactify-progress-bar,.impactify-standard .impactify-reduce-btn,.impactify-standard .impactify-speaker-btn{display:none!important}.impactify-in.impactify-standard{background:#fff!important}#impactify-resume-container{display:none!important;justify-content:center!important;align-items:flex-end!important;background:rgba(0,0,0,.9)!important;position:absolute!important;top:0!important;right:0!important;width:100%!important;height:100%!important;z-index:10!important}#impactify-resume-container .impactify-resume-cover{position:absolute!important;width:100%!important;height:100%!important;background-size:cover!important;opacity:.4!important}.impactify-style-impact #impactify-resume-container .impactify-resume-cover{display:none}#impactify-resume-container .impactify-resume-button{color:#eee!important;border:1px solid #aaa!important;padding:9px!important;border-radius:5px!important;width:100%!important;background:rgba(0,0,0,.9)!important;margin:5px!important;z-index:10!important;text-align:center!important}._impx-launcher.impactify-style-impact{height:50px!important;overflow:hidden!important;transition:none!important}._impx-launcher.impactify-style-impact.impactify-wrap-desktop{border-radius:5px!important}._impx-launcher #impactify-resume-container{display:flex!important}._impx-launcher._impx-dmp #impactify-resume-container{pointer-events:none!important}.impactify-no-transition{transition:none!important}.impactify-screen-placeholder{position:absolute;top:0;left:0;width:100%;height:100%;background:#000;display:flex;align-items:center;justify-content:center}.impactify-sticky-std{position:fixed!important;left:auto!important;right:0!important;bottom:0!important;display:flex!important;justify-content:center!important;align-items:center!important}.impactify-sticky-std .impactify-ad-txt{position:absolute!important;bottom:0!important;left:0!important;font-size:11px!important;padding:1px 3px!important;background:rgba(238,238,238,.14)!important;color:#777!important;display:none!important}.impactify-sticky-std:not(.impx-has-ad){pointer-events:none!important}.impactify-sticky-std.impx-has-ad{z-index:2147483647!important;bottom:0!important}.impactify-sticky-std.impx-has-ad .impactify-ad-txt{display:block!important}.impactify-sticky-std.impx-hide{bottom:-2000px!important}@media only screen and (min-width:600px){.impactify-d-mpu,.impactify-d-native-footer{margin:40px!important}}.impactify-d-footer,.impactify-d-native-footer{transition:bottom .4s ease-out!important}.impactify-d-footer.impx-hide,.impactify-d-native-footer.impx-hide{bottom:-30vh!important}.impactify-d-footer.impx-has-ad,.impactify-d-native-footer.impx-has-ad{background:#fff!important}.impactify-display-creative{max-height:100%!important;overflow:hidden!important}.impactify-loader-sp{display:inline-block;position:relative;width:80px;height:80px}.impactify-loader-sp div{position:absolute;top:33px;width:13px;height:13px;border-radius:50%;background:#fff;animation-timing-function:cubic-bezier(0,1,1,0)}.impactify-loader-sp div:nth-child(1){left:8px;animation:impactify-loader-sp1 .3s infinite}.impactify-loader-sp div:nth-child(2){left:8px;animation:impactify-loader-sp2 .3s infinite}.impactify-loader-sp div:nth-child(3){left:32px;animation:impactify-loader-sp2 .3s infinite}.impactify-loader-sp div:nth-child(4){left:56px;animation:impactify-loader-sp3 .3s infinite}@keyframes impactify-loader-sp1{0%{transform:scale(0)}100%{transform:scale(1)}}@keyframes impactify-loader-sp3{0%{transform:scale(1)}100%{transform:scale(0)}}@keyframes impactify-loader-sp2{0%{transform:translate(0,0)}100%{transform:translate(24px,0)}}

      Le Vantablack est une couleur qui est tres noir, seulement 0,04% de limuere peut reflecter sur la surface, et quand tu le vois, on dirait que c'est un petit trou noir sur Terre.

    1. SciScore for 10.1101/2021.06.09.447760: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For simultaneous staining of gRNA and dsRNA, cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM AF647-labled RNA FISH probes and 1:1000 anti-dsRNA antibodies (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then cells were incubated with 1:20000 CF™ 568 Donkey anti-mouse antibody for 30 min at 37°C, washed with Wash Buffer A containing DAPI for 30 min at 37°C in the dark, and stored in Wash Buffer B for imaging.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production: To produce lentivirus, HEK293T cells were transiently transfected with the lentiviral plasmid, and packaging plasmids pCMV-dR8.91 and PMD2.G.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">229E production: Human coronavirus 229E (Cat# VR-740, ATCC) is amplified once by inoculating one T75 flask of fully confluency MRC-5 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: ICLC Cat# HL95001, RRID:CVCL_0440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of the cells by 229E: MRC-5 cells or MRC-5-ER-GFP cells were seeded at 4-4.5 × 104 cells per well into poly-D-lysine-treated 8-well μ-slides (Cat# 80826, IBIDI) one day before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5-ER-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confocal image analysis: To quantify the number of infected MRC5 cells at different stages of the infection in Fig 4C and Fig 6A, we counted cells with both gRNA and dsRNA staining as infected cells in FIJI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production: To produce lentivirus, HEK293T cells were transiently transfected with the lentiviral plasmid, and packaging plasmids pCMV-dR8.91 and PMD2.G.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of stable cell lines: MRC-5-ER-GFP stable cells were constructed by transducing the MRC-5 cells with lentivirus expressing pLV-ER-GFP (Cat# 80069, Addgene, a gift from Pantelis Tsoulfas), followed by sorting for cells expressing GFP using a SONY SH800S sorter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-ER-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantify the number of dsRNA puncta in each cell in Fig 4D and Fig 6B, the Trackmate plugin in FIJI was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FIJI</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SR data analysis: We processed approximately 40000 frames of single-molecule images for 2D Gaussian fitting by ThunderSTORM (ImageJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clustering analysis: To calculate the sizes of gRNA and dsRNA clusters as well as the number of molecules within each cluster, we used Voronoi tessellation on the single molecules from the previous step using a custom MATLAB script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.09.447656: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Protein production: Animal immunization: All animal studies were approved by the institutional Committee for Ethical Conduct in the Care and Use of Laboratory Animals and abided by guidelines set forth by the Animal Welfare Law</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Assessment of humoral immune response: Assessment of cell-mediated immunity: Safety assessment of oral vaccine: Vaccine safety was determined by Envigo, Ness Ziona, Israel. Sprague Dawley rats (10-14 per treatment group, 8-weeks-old, equal number of male and females) were orally immunized 2 or 3 times at 14-day intervals with 100 μL MigVax-101 or with DP buffer as negative control.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of humoral immune response: Assessment of cell-mediated immunity: Safety assessment of oral vaccine: Vaccine safety was determined by Envigo, Ness Ziona, Israel. Sprague Dawley rats (10-14 per treatment group, 8-weeks-old, equal number of male and females) were orally immunized 2 or 3 times at 14-day intervals with 100 μL MigVax-101 or with DP buffer as negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitations of this study included relatively diverse immune responses between animals, which may be attributed to the technical and physiological differences between animals at the time of administration, e.gsaliva conditions, technical oral delivery to the rodents, and others. Overcoming such obstacles may be achieved by improved formulation of the vaccine, enabling longer exposure to the vaccine. Taken together, the oral multi-epitope SARS-CoV-2 vaccine triggered versatile adaptive immune responses, which are expected to provide protection against viral infection and which should be useful for boosting immunity in those immunized with injected vaccines.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.08.21258284: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical Approval: Ethical approval was obtained from the Ethics Committee at OPBG, Bambino Gesù Children Hospital.<br>Consent: According to the guidelines on Italian observational studies as established by the Italian legislation about the obligatory occupational surveillance and privacy management; Health Care Wokers (HCWs) confidentiality was safeguarded, and informed consent was obtained from all the participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Given the limiting amount of blood available for the study, we randomly selected 74 HCWs samples for the ELISpot and 34 for FACs (Table 2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were coated with 50 µl PBS containing either isotype-specific AffiniPure F(ab’)2 Fragment Goat anti-Human antibody (Jackson ImmunoResearch Laboratories) (anti-IgM final concentration 2.5 µg/mL, anti-IgG 15 µg/mL, anti-IgA 10 µg/mL); or Trimeric Spike at a final concentration of 1 µg/ml to detect specific responses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were discarded and after washing with PBS + 0,05% Tween (5 x 200 µl/well), plates were incubated for 1 h at 37 °C with peroxidase-conjugated goat anti-human IgM, IgG or IgA antibodies (Jackson ImmunoResearch Laboratories) diluted in PBS + 0,05% Tween + 1% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM , IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for specific IgA and IgM detection: A semi-quantitative in vitro determination of human IgA antibodies against the SARS-CoV-2 was evaluated on serum, saliva and breast milk samples by using the Anti-SARS-CoV-2 ELISA (Euroimmun), according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA ( Euroimmun)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing again, plates were incubated for 1 h at 37°C with peroxidase-conjugated goat anti-human IgM antibody (Jacksons ImmunoResearch Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Absorbance at 450 nm was measured, and IgM concentrations were calculated by interpolation from the standard curve based on serial dilutions of monoclonal human IgM antibody against SARS-CoV-2 Spike-RBD (Invivogen)43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Spike-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative determination of anti-N, anti-S, Trimeric Spike and RBD antibodies: Serum samples were tested by two different methods and analytical platforms.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Qualitative detection of antibodies direct against the nucleocapsid (N) protein and semi-quantitative detection of total antibodies (IgA, IgM, IgG) directed against the RBD of the virus Spike (S) protein of SARSxxxxx-CoV-2 were tested by an electro-chemiluminescence sandwich immunoassay (ECLIA), using Elecsys-anti SARS-CoV-2 and Elecsys-anti SARS-CoV-2 S (Roche Diagnostics) test on a Cobas e801 analyzer following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA , IgM , IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Elecsys-anti SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Elecsys-anti SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quantitative determination of anti-Trimeric spike protein specific IgG antibodies to SARS-CoV-2 was run on LiaisonXL platform by a new generation of chemiluminescence immunoassay (CLIA) TrimericS IgG assay (DiaSorin) with a quantification range between 4.81 BAU/mL and 2080 BAU/mL (dilution factor 1:20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimeric spike protein specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen probes prepared individually as above were then mixed in Brilliant Buffer (BD). ∼5x106 previously frozen PBMC samples were prepared and stained with 85μL antigen probe cocktail containing 100ng Spike per probe (total 200ng), 27.5ng RBD and 20ng SA-PE-Cy7 at 4°C for 30min to ensure maximal staining quality before surface staining with antibodies as listed in table S1 was performed in Brilliant Buffer at 4°C for 30min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>30min</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 IgG II kit, a chemiluminescence microparticle antibody assays detecting antibodies against the RBD of SARS-CoV-2, (CMIA, IgG antibody concentrations expressed as arbitrary units, AU/mL ≥ 50 are considered positive, ARCHITECT® i2000s Abbott Diagnostics) was used according to manufacturer’s protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with GraphPad Prism 8.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 40, 38 and 39. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.09.447527: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of hybridoma cell lines producing monoclonal antibodies specific to SARS-CoV-2 spike protein and RBD: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound monoclonal antibodies were detected with goat anti-mouse immunoglobulin (Ig) conjugated with horse radish peroxidase (HRP, Dako, Denmark).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse immunoglobulin ( Ig )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Typically, 10 000 RU (response units) of polyclonal anti-mouse antibody (No. Z 0420; Dako, Denmark) or polyclonal anti-human antibody (I2136, Merck, Germany) was coupled simultaneously in four flow cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The equilibrium dissociation constants KD of antibody-RBD complexes were calculated from the averaged association and dissociation rate constants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-ACE2 binding inhibition assay: With the aim to select the antibodies blocking the interaction of receptor binding domain (RBD) with angiotensin-converting enzyme 2 (ACE2) receptor, ELISA-based inhibition test was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 4% paraformaldehyde and labelled with anti-human ACE2 antibody at 10 μg/ml (cat. # 600-401-X59; Rockland Immunochemicals), followed by goat anti-rabbit IgG secondary antibody at 1/500 dilution (green; cat. # A-11008; Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C347-500, RRID:AB_1271966)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11008, RRID:AB_143165)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stable cell line HEK293T/17-hACE2 were maintained in selection medium: Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine (GIBCO), 5μg/ml gentamicin (SIGMA) and 100μg/ml hygromycin B (Invitrogen) at 37°C in 5%CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In PRNT, Vero E6 cells (Vero C1008, ATCC CRL 1586) were cultured in Eagle’s minimal essential medium (EMEM, Lonza) supplemented with 5% FBS (GIBCO), Penicillin-Streptomycin-Amphotericin B Solution (10ml/l, Lonza, Switzerland).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div><div style="margin-bottom:8px"><div>C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids that drive protein expression from the CMV promoter were either transfected with polyethyleneimine (PEI) or by electroporation into Expi293 cells that were in exponential growth phase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-ACE2 binding inhibition assay: HEK 293T/17 cells stably expressing human ACE2 protein (HEK 293T/17-hACE2) were seeded at 60-70% plating density in 48-well plates and cultivated O/N at 37°C, 5% CO2 in a humidified incubator in DMEM supplemented with 10% (v/v) fetal calf serum, 2 mM L-glutamine, 100 units/mL penicillin/streptomycin (all from Life Technologies Invitrogen, Carlsbad, CA, USA) and 100 μg/ml</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268G-1, RRID:CVCL_UE07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the recipient cells HEK293/17-hACE2 were seeded in 96-well plate and cultured overnight in a humidified CO2 incubator (at 5% CO2 and 37°C) in 100 μL of normal growth medium (DMEM) with 10% of FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293/17-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MAb–virus mixtures were then added to Vero E6 cell monolayer in 24-well plates and incubated at 37°C for additional 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of hybridoma cell lines producing monoclonal antibodies specific to SARS-CoV-2 spike protein and RBD: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/cN</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Human embryonic kidney HEK293T/17-hACE2 cells with stable expression of human angiotensin-converting enzyme ACE2 (AXON Neuroscience SE) were prepared by stable transfection of pDUO2-hACE2-TMPRSS2a (InvivoGen) with transfection reagent Lipofectamine 3000 (Thermo Fisher Scientific), according the to the manufacturer’s recommendations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDUO2-hACE2-TMPRSS2a</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins: The prefusion-stabilized SARS-CoV-2 S protein ectodomain (residues 1−1208 from GenBank: MN908947, with proline substitutions at residues 986 and 987, a “GSAS” substitution at the furin cleavage site residues 682–685, a C-terminal T4 fibritin trimerization motif, an HRV3C protease cleavage site, a TwinStrepTag and an 8XHisTag), the receptor binding domain (RBD) fragment of the S protein (amino acids 319-591), containing the His-tag and Twin-Strep-tag and modified ACE2 (angiotensin-converting enzyme 2), containing tags for purification were synthesized at BioCat Co. (BioCat GmbH, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid DNA was isolated using PureLink®</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PureLink®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers for mutagenesis were designed using The QuickChange® Primer Design Program provided by manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer Design Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values for particular experiments were calculated by nonlinear regression analysis using GraphPad Prism (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted to logistic 4-parameter sigmoidal dose response curve using GraphPad Prism (GraphPad Software Inc.), the goodness of fit was R2>0.9, except for AX266 on B1.1.7 (R2=0.7888), AX96 on B.1.1.7 (R2=0.8766), AX290ch on B1.1.7 (R2=0.8730) and AX677ch on B.1.351 (R2=0.8598).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using the ARTIC pipeline (https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html), which internally filters reads based on quality and length, aligns them to the reference (Wuhan-Hu-1 isolate, NC_045512) using minimap2 (https://github.com/lh3/minimap2), trims primers, and calls variants using Nanopolish (https://github.com/jts/nanopolish).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To avoid this therapeutic limitation, we screened and selected the antibodies showing neutralization activity against several variants of SARS-CoV-2. We took advantage of the mouse immunoglobulin repertoire 18 through the hybridoma technology to isolate monoclonal antibodies neutralizing live authentic SARS-CoV-2 virus. The in vitro and live virus screening assays allowed us to identify two neutralizing antibodies, AX290 and AX677, each of them neutralizing live authentic SARS-CoV-2 virus circulating in Europe in the spring of 2020 and two fast-spreading authentic variants of concern B.1.1.7 and B.1.351. It is important to emphasize that the antibodies were resistant to the E484K mutation, which has been recently shown to endow the S-typed VSV pseudovirus with resistance to several human convalescent sera 33. The authors have suggested that the repertoire of antigenic sites on RBD is limited in some individuals and that this amino acid is a part of a dominant neutralizing epitope. The use of a live authentic SARS-CoV-2 virus to identify the escape mutations, as opposed to other studies that employed an S-typed pseudovirus 10,33,35–38, allowed to eliminate a potential bias from an inadequate infection and replication machinery of a model virus. It has been noted that only some of the spike escape mutations identified in SARS-CoV-2 S-typed infectious vesicular stomatitis virus were found so far in the context of authentic SARS-CoV-2 virus isolates, it is possible that those not...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.09.447484: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All mice were bred and maintained under pathogen-free condition at the Scripps Research Institute and were handled according to Institutional Animal Care and Use Committee guidelines.<br>Consent: Patients provided written informed consent to the use of their tissue samples for research purposes (Ethical Approval SA250)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">After deparaffinization, antigen retrieval in pH8 buffer was brought to a boil at 100% power, followed by 20% power for 15 minutes using microwave technology (MWT).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For multiple-marker immunostainings, sections were incubated with ACE2 and TTF-1 primary antibodies and the binding of the primary antibodies to their respective antigenic substrates was revealed by made-specific secondary antibodies conjugated with Alexa-488 (Life Technologies, 1:250) and Alexa-568 (Life Technologies, 1:300) fluorochromes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TTF-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: The following primary antibodies were adopted for IHC and IF on mouse and human tissues: rabbit polyclonal ACE2 (1:500 pH8, ab15348, Abcam), rabbit polyclonal Prosurfactant Protein C (1:200 pH9, AB3786, Merck Millipore)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C347-500, RRID:AB_1271966)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA extraction from cultured cells: For MEFs, HeLa, and BJ cells total RNA was extracted using Maxwell® RSC Instrument, with Maxwell® RSC simplyRNA Tissue Kit (AS134, Promega), following manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primer sequences (5−3′ orientation): Luciferase assay: HeLa shTRF2 cells were transfected with ACE2(−1119)-luc plasmid, a gift from Gerhart Ryffel (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa shTRF2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rosa26-CreERT2 Trf2F/F MEFs (Okamoto et al, 2013), a kind gift from Eros Lazzerini Denchi (National Cancer Institute, NIH, Bethesda, USA), were grown in DMEM supplemented with 10% fetal bovine serum and 1% glutamine; for CreER activation, cells were treated with 600nM 4 hydroxytamoxifen (4OHT, H7904, Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rosa26-CreERT2 Trf2F/F MEFs</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the analysis of young and old mice, C57BL/6 J mice were purchased from the Charles River Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6 J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Terc mice (B6.Cg-Terctm1Rdp/J Stock No: 004132 | mTR−/−)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Terctm1Rdp/J</div><div>suggested: RRID:IMSR_JAX:004132)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Terc+/− mice were intercrossed to generate first-generation (G1) homozygous Terc−/− knockout mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Terc+/−</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second-generation (G2) Terc−/− mice were generated by successive breeding of G1 Terc−/− and then G3 Terc−/− mice by crosses between G2 Terc−/− mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Terc−/−</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, wild type C57BL/6J and G3 Tert−/− mice were used for the experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tert−/−</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rosa26-CreERT mice (Jackson Laboratory) and TRF2 conditional knockout mice (Celli & de Lange, 2005) and mice carrying a p53 conditional allele (Jackson Laboratory) were crossed to generate Trf2/p53/Rosa26 mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rosa26-CreERT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Trf2/p53/Rosa26</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice were maintained in 129/c57Bl6 genetic background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>129/c57Bl6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primer sequences (5−3′ orientation): Luciferase assay: HeLa shTRF2 cells were transfected with ACE2(−1119)-luc plasmid, a gift from Gerhart Ryffel (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>−1119)-luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid # 31110; http://n2t.net/addgene:31110; RRID:Addgene_31110), 5 days after doxycycline treatment to induce shTRF2 expression or 1 day after the ionizing radiations treatment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_31110)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC staining was revealed using Novolink Polymer Detection Systems (Leica Novocastra) or IgG (H#L) specific secondary antibodies (Life Technologies, 1:500) and DAB (3,3’-Diaminobenzidine</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Novolink Polymer Detection Systems</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microphotographs were collected using a Zeiss Axiocam 503 Color digital camera with the Zen 2.0 Software (Zeiss).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NanoDrop spectrophotometer was used to detect RNA quantity and purity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NanoDrop</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TFBS motifs for the human Ace2 gene (refseq ID: NM_021804) were searched around −450 +50 of the TSS, using the Jaspar 2018_NR matrix as a descriptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jaspar</div><div>suggested: (JASPAR, RRID:SCR_003030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EnrichR tool (Kuleshov et al, 2016) was used to perform a gene set enrichment analysis of the resulting Top100 significantly over-represented transcription factors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EnrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P value was calculated by the indicated statistical tests, using Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.07.447437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocols for human specimen collection were approved by the institutional review board of City of Hope.<br>Euthanasia Agents: Mice were euthanized using ketamine (100 mg/kg)/xylazine (10 mg/kg) when body weights dropped below 20% of their original body weights.<br>IACUC: Experiments and handling of mice were conducted under federal, state, and local guidelines and with approvals from the Northern Arizona University (20-005) and City of Hope Animal Care and Use Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 viral nucleocapsid protein (NP) was detected using the anti-NP protein antibody (PA5-81794, Thermo Fisher) diluted 1:10000 in 0.1% tween-20/1%BSA/PBS solution as a primary antibody, followed by detecting with an anti-rabbit secondary antibody (ab6721, Abcam) at a 1:20,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 viral nucleocapsid protein ( NP )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 viral nucleocapsid protein ( NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PA5-81794</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-81794, RRID:AB_2788968)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Abcam Cat# ab6721, RRID:AB_955447)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FXa-HRP conjugated anti-human Fc antibody (05-4220, Invitrogen) was used as a detecting antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc</div><div>suggested: (Thermo Fisher Scientific Cat# 05-4220, RRID:AB_2532922)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then washed and incubated with an anti-S protein antibody for 20 minutes at room temperature, followed by staining with a FITC-labeled secondary antibody (111-605-045, Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HRP-conjugated anti-His tag antibody (ab1187, Abcam) was used as a detecting antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>An HRP-conjugated anti-His tag antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC staining with an anti-FXa protein antibody (PIPA529118, Invitrogen), an anti-furin antibody (ab183495, Abcam), an anti-trypsin antibody (ab200997, Abcam), or an anti-plasmin antibody (LS-C150813-1, LSBio) as a primary antibody was performed by the Pathology Shared Resource Core at City of Hope Beckman Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FXa protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-furin</div><div>suggested: (Abcam Cat# ab183495, RRID:AB_2801581)</div></div><div style="margin-bottom:8px"><div>anti-trypsin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-plasmin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H&E staining and IHC with anti-NP protein antibody (NB100-56576, Novus) as the primary antibody were performed by the Pathology Shared Resource Core at City of Hope Beckman Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NP protein antibody</div><div>suggested: (Creative Diagnostics Cat# DPAB-DC4728, RRID:AB_2501850)</div></div><div style="margin-bottom:8px"><div>anti-NP protein</div><div>suggested: (Creative Diagnostics Cat# DPAB-DC4728, RRID:AB_2501850)</div></div><div style="margin-bottom:8px"><div>NB100-56576</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monkey kidney epithelium-derived Vero cells, Vero E6 cells, human embryonic kidney-derived HEK293T cells, and Chinese hamster ovary (CHO) cells were cultured in DMEM with 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary (CHO)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral production, Vero cells were pre-seeded for 24 hours and infected with the supernatants collected from MA104 cells infected by VSV-SARS-CoV at 24 or 48 hpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and purification of FXa: CHO cells were transduced with a pCDH lentiviral vector expressing FXa to produce the FXa-Fc fusion protein for functionality assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus isolates were passaged in Vero E6 cells (ATCC CRL-1586) as previously described3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of binding between S protein and FXa using flow cytometry: HEK293T cells were transduced with lentiviral vector expressing FXa for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo infection model: 6-8-week-old K18-hACE2 mice were anesthetized with ketamine (80 mg/kg)/xylazine (8 mg/kg) and intranasally infected with 5×103 PFU wild type SARS-CoV-2 or B.1.1.7 variant in 25 μl DMEM, followed by intranasal treatment with PBS, FXa-Fc (200 μg), or Fc (200 μg) in 25 μl DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pull-down assay: HEK293T cells were transduced with a pCDH lentiviral vector expressing the full-length spike (S) protein for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH</div><div>suggested: RRID:Addgene_102325)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prism software v.8 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.05.447221: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures were performed according to the animal study protocols approved by the FDA White Oak Animal Program Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Hemizygous B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE) female mice (JAX Stock No. 034860) and noncarrier c57BL/6J male mice (JAX Stock No. 000664) were mated to maintain live colonies at the ABSL2 facility of FDA White Oak Vivarium</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">At the age of 8-10 weeks, K18-hACE mice of both sexes were randomly assigned to experimental groups at approximately 1:1 ratio and were transferred to the ABSL3 facility for infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Only hACE2 (+) offspring as confirmed by genotyping (Transnetyx) were retained and were used for experiments.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation at 37 °C, 5% CO2 for two days, virus-infected cells were detected using an in-house rabbit polyclonal antibody specific for SARS-CoV-2 N/M/E followed by horseradish peroxidase-conjugated goat anti-mouse IgG (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using peroxidase-conjugated goat anti-mouse IgM heavy chain (Southern Biotech) or IgG (H+L) antibodies (Invitrogen) followed by One-step TMB substrate (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>peroxidase-conjugated goat anti-mouse IgM heavy chain ( Southern Biotech )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG ( H+L ) antibodies ( Invitrogen ) followed by One-step TMB substrate ( ThermoFisher)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus-infected cells were detected using in-house raised rabbit anti-S polyclonal antibody along with peroxidase-conjugated goat anti-rabbit IgG (H+L) secondary antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were then added to Vero E6 cells (2X104 cells/well) pre-seeded in 96-well tissue culture plates and were incubated at 37°C, 5% CO2 for 2 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Hemizygous B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE) female mice (JAX Stock No. 034860) and noncarrier c57BL/6J male mice (JAX Stock No. 000664) were mated to maintain live colonies at the ABSL2 facility of FDA White Oak Vivarium</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the age of 8-10 weeks, K18-hACE mice of both sexes were randomly assigned to experimental groups at approximately 1:1 ratio and were transferred to the ABSL3 facility for infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In separated experiments, K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins: The DNA sequences encoding the full-length S (residues 1-1213) and RBD (residues 319-541) of WA (GenBank: MN985325.1) with a T4 trimerization domain and a 6xHis tag at the C-terminus were codon-optimized and were subcloned into pcDNA5/FRT mammalian expression vector (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA5/FRT</div><div>suggested: RRID:Addgene_31983)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Threshold cycle (Ct) values were calculated using MxPro qPCR software (Agilent) and the N gene copies in individual tissues were interpolated from a standard curve constructed by serial dilutions of a pCC1-CoV2-F7 plasmid expressing SARS-CoV-2 N57.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCC1-CoV2-F7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The copies of expressed hACE2 were interpolated from a standard curve created by serial dilutions of a pSBbi-bla ACE2 plasmid expressing hACE2 (kindly provided by J Yewdell, NIAID/NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSBbi-bla ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hACE2</div><div>suggested: RRID:Addgene_1786)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmap was generated using Prism 8.4.3 (GraphPad, San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissue sections were visualized using a Leica Aperio AT2 slide scanner with Aperio ImageScope DX clinical viewing software (Histoserv).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R version 4.0.3 (https://www.r-project.org/) was used to perform all the above analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.06.446781: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approval: All human samples were obtained from patients, deceased transplant organ donors or liver explants with informed consent for use in research, and ethical approval (Research Ethics Committee - REC 09/H0305/68; 14/NW/1146; 15/EE/0152; 15/WA/0131; 18/EE/0269; and Papworth Hospital Research Tissue Bank project number T02233).<br>IRB: Ethical approval: All human samples were obtained from patients, deceased transplant organ donors or liver explants with informed consent for use in research, and ethical approval (Research Ethics Committee - REC 09/H0305/68; 14/NW/1146; 15/EE/0152; 15/WA/0131; 18/EE/0269; and Papworth Hospital Research Tissue Bank project number T02233).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Blood sample collection and processing: Blood samples were collected from patients as part of the UK-PBC Nested Cohort study after obtaining informed consent, anonymised and analysed by a blinded researcher.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, following pre-clearing, the lysate was incubated overnight with the FXR antibody (Santa Cruz sc-25309 X) (Supplementary Table S1) or non-immune IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FXR</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-25309, RRID:AB_628039)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells (ATCC™ CRL – 1586) were grown on tissue culture plates or T25 flasks in 10% FBS DMEM supplemented with L-glutamine and Penicillin-streptomycin as previously described52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10X raw data (fastq files) have been deposited in the repository ArrayExpress with the accession number E-MTAB-8495.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArrayExpress</div><div>suggested: (ArrayExpress, RRID:SCR_002964)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Imagej 2.0.0 software (Wayne Rasband</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imagej</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All flow cytometric analyses were performed on a BD LSR-II flow cytometer from BD Biosciences and analysed using FlowJo v.10.4.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral infection primary organoids were passaged and incubated with SARS-CoV-2 in suspension at a multiplicity of infection (MOI) of 1 for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 50. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.03.21258315: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It follows a prescribed dynamic pattern (shown in Figure 2(A)); specifically we use function B(t) = t ke−kt of steepness k, and define b(d) = bM B(d/L) where bM is peak infectivity and L is the mean duration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A))</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. ringed sea (circular pool?) hot _____________where the baths were.

      Scholars believe that the poem is based on the roman city of Bath which now looks like this

      “The Ruin: a Poem from the Exeter Book • Multicultural York: the Anglo-Saxons.” The Ruin: a Poem from the Exeter Book • Multicultural York: the Anglo-Saxons • MyLearning, www.mylearning.org/stories/multicultural-york-the-anglosaxons-ad400866/117.

      “The Ruin.” Wikipedia, Wikimedia Foundation, 19 Apr. 2021, en.wikipedia.org/wiki/The_Ruin.

      https://upload.wikimedia.org/wikipedia/commons/thumb/b/ba/Roman_Baths_and_Abbey_Circular_Bath_Bath_England.jpg/300px-Roman_Baths_and_Abbey_Circular_Bath_Bath_England.jpg

      data:image/jpeg;base64,/9j/4AAQSkZJRgABAQAAAQABAAD/2wCEAAoHCBcWFRgWFhYZGRgaGiMeHBwaHRokHBofGhwaGhwaHB4dIS4nHB4rIR0eJjgmKzAxNTU1HCQ7QDs0Py40NTEBDAwMEA8QHhISHzQrJCs0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NDQ0NP/AABEIALcBEwMBIgACEQEDEQH/xAAbAAACAwEBAQAAAAAAAAAAAAAEBQADBgIBB//EAEAQAAIBAgQEAwUFBgUEAwEAAAECEQAhAwQSMQVBUWEicYEGEzKRoUJSscHRFBVicuHwI4KSovEWssLSBzNDJP/EABgBAAMBAQAAAAAAAAAAAAAAAAABAgME/8QAIxEAAwACAgIDAAMBAAAAAAAAAAERAhIhMUFRAxNhBCJxof/aAAwDAQACEQMRAD8AYPlWFcDDNaLHQGhTgxW6yOfUWrl2iYqxEPOjHxDQb4lOhAhCBXRcUvONXPvqoQy1UPitehDmKnvqYi8Pe5mrBjjrQTYlVlqBDLWDzqxcUClQLVYuqgYyXMwZovDzppMoar8MmpaQ1R5h5knerji9KTYfnRaKY3rPJI1xbGKZp6Ny7k7zS/KqALmiBmACAT/Ss3kWsQxj2rmTVOYzYVQRcfhV+HddUiOvKlRw9ipFBY+cAsDJqpcVj9qIqhB2M4UEnYUGnFMM7mPShsyxa00OmTTnvTqnIo7wPUx0IswNcnGGwpQqxyq1cXSLVFLgcz14cUDnSvFzJ61QcerSM3wM8TNChcTNUEXJqxMOqWInkXpinlROGriCR86HFhXaMee1DFjKFHMxyqnEzpNcYgHWqWFSkWzv9pNSqtQqVc/Cb+gaZnrROHig0Y3s+/QfOuk4C/MfUVDyQ1ixbixQeJg96f8A7mj4g0VH4SneO5o3QaMy7YRqtsKtMeDodtX1P5VVjcFP2ST5g018iDRmb9ya590a0Q4W67rRGHwyfigelP7UL62Zf3VdDDPStZ+6krl+HLyDUvtQ/qM7h4Jo7L5InemiZODtRgwOQFRl8hWPxoTYmSMeGqFybjcVo/2WBuBUbCQbkk1K+RlPBC/KcOtJo0YaC0T512AYsYoLHQ6oJNLZvses6O8RosoivcLh7Pcj15V6mRcyVMxReUd9ntB59OlLadDhTiZNR4WYwf75V4+CyLpDDTyqzO4ZYyppc4fmDTTvkGoU4mTeZkVMTNLhKCzAeILPcnah+MY+ImEWQS5IA7Tcn5A1nsyr5jJ+NpfDd9Xo4ImJ+zMeQ9W8vAlj5NiSTXBQ9aSYftbhH7GJ5gJ/7Crm9qMCJh55DSLnpOq1VqxVDZVIrh3BMSJiY5x1is1xL2iL4YCasNy8EwTCRYgi+55XtXnBMrpzQPvNYxMMmepBBgXuYBNQ00y01B7iih2pm2Vqp8qK1xyRlljQJGq8Y1ctg1BhVqmYtFi4oq7WSKoXDjlXd6GkwTh1Brhk715pJqe76miBSaR1r2vNAqUwNtUoPh2d95hJiEQXEwPMiiBjCJrmpvC2vIqjDzOowBVmJiRbnSo4e4zwKBbGPSr3LHcUNiNUtlJFpWdj86qbCPavVzJIi1c++NAHg1DlXa41q7L2EVWznmIqRnjOKqbFPWvWg7VTi4RHfyIog6dftB7Gr1zGGR4hB7bUvKNOxrlsNvum3OLU9RUYM+Hut6qdkbkaDw8UG1daSSQOW46c79KIkFfgKTMFRAgDtXL50neqVSlnHHdFQpMhgSsxqEgQTyF6OA5GSZrUSFIJUw3Y7welXISaw3F+NYuWeEJGoAuSqmSVWDcE9arw/bDHNtSEx9wT/fpVY4pqibaZt+J4OpFB31T8gQfxFLOG5UQ40gDUZtFwxBPcmOlVez/FDjl3cLrQhZUEDQwlTueYPyphkEADQZ8bE9fiPpyrPJclJ8GEfCXDTFRkh1chGgnUC1tugB361TkAjKRiOwPiIAHIKmgDw8zqppnuGKzFi2ISWP2ybTyB2H60C/Dk1AB3vJ+J9gCTcHtWyychDxVpM6iBBpYl9Ckgj7RLal+EbAA+tA5fNNhujgmEYMOkzdduYmmz8H1gFGfrIZ/L7UGbdKHzXCSquhdw0izMYvEdZN6ezkYlirUag+1OAXcBwECSjEPd+hGna4+RoPgvtHgrh6cZ5bUxBVHIKkzM3m81m8vw1GVZcgnECHaxjfbrb8659m80UctIKDDJ8i6/D59uopPXFWgq3GbLE9pcrB8ZJ+7oefK4A+tDZX2mwXcIFOpiAgJgGerR4enOsthcOQuxZ/AJg2vz28prrGyGESW1soNwYEDy5nas3/IxTlH9aZszxZUxHw8bSkKrDS2qZ3EkDa3LmKVZn2jcFSqLp1DUJklTuROmGHId70s4k+tsIzqIlXYiCQRAY+gFADDAuzjaYF946HlzqMv5DTUYLHFeBtxXM5jEAxcMaUBgIHBDGCSGgC9udbFMXCgHWl4+2u55b183XPOkBCGVmFp6dbdzVGSwdeL7sEKTzYW3iJ866PizqrfZOSXg+pak++n+pf1qV83Xhim/v8MdiGtUq98fZGobkPaXHwzCMfANOl5KgGGHhPPa9Mv+ssyeaeiCleVfCDMMPBVXRmGI3hGrWdYMqSbC1xuCOVNExlZSSQAB1tfas1z4NKF4PtBmtGoOoLfCAi+K3P8AKhsD2vzTAleRgzhgX8zSfF1YuIoYNoSwAG3Im9vXvTxs4iXZGN+Qm/KYNUsV5JeTO045mn1Atpt9lFkzzBi1BoMVZKYjoTexMEnmQbGoeKIZ8GJfeFM/KapyHEy+IQyFVItvCgAnp0B8zQ/j9DWfsLy/tNmU+NExFiZjSxHXp8hRGJ7YqZV8JlVhBuQb2MG35edXZZVxEDhVIYHeAeQg7RcGvH4ahk6SPI2+1/e/OpiHWFZP2jw2II1wAZDMNO0gljMfD15mu8x7QupKrhqSBqI18jziLilGBw5AXWZGoWtEQLeVX4uQQsX0DUBpBG+k/ZneL7UnB8vyWD2kxWIC4SKWuNRNh3g1w/tDirqn3VhMDVO8Wvegs7w9Eks2m9pgk7EQDvzobDVdGoaWCAkwWDCI8RWfyFFx8BGFYXtbjEy2GoQG5IcEjopv4rirMz7RY/utQfBQmbiW1RaFmwMg/OhhmyEOkAhjEqZI2FwTA58r35UNlcIOpHur+KTA2J1aiCec02iaWYHtJm2UIAt4GsATcwT0mO1C5PP5uGc4jA6g0eGXMAXBiRAAvQ+ImNo91r0JIPiQyL3AtsBBjnVXC8/i4YAZkdDvqkkA76THKJiqiQkm/Y5xParMroED4pJVZkb6SJ6dIPeiOAI7YWI7li74ky28KLTPmaV4/EcRC4IRttJgfa59vXaa0PAMRmy6sRdpsOVyoEbCYms8prwXimnyKPabJasYMFdgUE6NFokD4yJsKpy+Z0Kq+4chdMFsPCYwvUh+fOnnHHCsJViNOy77nnIoLEx18PgcztE22gkTcfOknlEU1jT32QQIcX4zOj41C/f2hjO9aHJuYJ5Fmjr8Tbg7UBwoAs9iLC8EA/FYA8/1FG5FYSI+2++/xtUNtuscS4Rkc051Hwubm4Fr3+VdYTbHS3P4kY2IIOxiI61e7z1t3b/j5Uoz+ZdcRwrkAZcsAGAAaGkwdotc2sKtEsaBhKlREAgQmJA1SDz7mqM23iAhh8N9DbCOvl1pVls5iFFnEaTmNE61nT7pniemq8b7cq0CzrsDA2ufS9NgoAZgIFLQ5gWXSl+RHwSLd+VJszmi4QggL92OV+Q5mjM5gFcXGYyqFVKllbQSwBaG+0ZknpekOM9tIljcWEAWmdt65vkX9hthr5pwSPCE2nfboOt6DxM0ykXLau8i3KIF4iq8PEXmQpHIiQSCDp7Teq8zjyRCgcwAG085iaFgvRLyodls+RIYEzeTfyEV3CGSwZD/AAk26yDtvQYDkBgUkx5jsDz3ojiOXQPhhXRmYQ4EgSOrTRpQobls2EUqPEbcge3MW3386I/eVg0JqG/hWesAxNJccaGKOIMAm8wSJ2HzvVSm3vASqfDN4tFgaI6FGP7+YbNHYQIm+0WqUl/bz9xT3jf6VKrR+yaaFMVA+LCkq7AyjEbTHO/W1MOH5RnDAY8wRqUoRcgGCdRO0GR1rJHiZGwW1HZLiuIh1ogAY3mYbYWkjpuOldFfgpS8jnMOV1aWHkjFVJHKd5t1rzJ47FbsUN4AbUOxvb/iruGMMdCXVEPUrsAdxJMkkDmb0R7hRGk4bobTpXUImAYAkWt5UVjiF+lvvP6MP0rwYeJeS4v1Qz3tP1pkx1N/9aRtJVZ38vWvcsUMwiSDBlQLijfIemIu908E63HL4FP1irkyeJuzkchAQzymwtvzpj7tGN0Ve2gDe9VPgoynwLINpTSbdIFx3o3Ya4gmZwXXZn+Sntb9KvymRckh3Yb7RJi8mNqiZNDcooA5Rv8AXl18+lMMH3IVyqAKA4c6Tsqye55belLZ9C1x7BWy+8EwBeANTbE352qvDyokETpMKdW66vDqvER6VbmsLCQ60BA93MR1KwYcTMGIqnCy6OUYaiTNjZTBAMhYuJ+tKeQ/CZvBdACjsZJsBJ33kH9a5yrYvN2mJAMTG0ybbz8qLy+ChTWFBSJkyIAMEQRUx8JFGphAJj7RknYU9spA1xAjmsa5DM4Ak+HYd7iq2zzMDCCY3IPITaD0EUx0qpUQBqMXDfl+dcvhwbL8qe7DVAJzbHxFJPMwYP5T6zVi8RxFICnSANgW6zyNEDTJWCSBJ+Lnsd6mHhK0kr9T+dG7DVA2NxHFMMYIjTfVNt+dWZvPMRpldPwwAbjYTYgk1ZmMIQAyeV2E+k2/pVRyqHYODEnTPrz2pNsFiNfZjiDM7o2nwqsEbn4hBHLatDkfhJsZd4/1v86xns4oTGbSWMrHiM85HlWu4WkLPR3EW++4F4moaKRnFS+x8/7/ADobNZLUzOSPFhlDLMDpYXMXWR1ijNHPYHsP0oHOY0HESZK4TYg8Ijwi0mTNyLaeVV5J4hVkskpUAQQuJrB1gw2nREhIiOt6Zq0nl3jb+tKstmCuECxJdsb3asRqJBRXhri0k9YrzN8RGG4UzbeLfKf7vU5PXsE1C5MXNN9hHQMY1e7kw1rO89INAPwzMDDxNSzeSdWD4EANoVz1Nc57NIUUq5JJmCtpsIHI1SmpEbUQpe7AfE0GfFO9yfnWeXzJqNEx+xTlMozrAImbTPKecfWrM8yKVGGSVMEyt5A6nqSZHarsLETRqKnf0JmBvt60NmczqYQBY7iIHLnSWd4SF4CssuCUhi5YzAUWWJFy24NrAdar4nwwBpRwUOiJnX8N45kTqnvVCYjGIluREG4F9udvwqvGzUHxC0xBi0bRO29CbXSDsJfMOqymJf7IgaRbxfFvf5mKVspnxPY7jcXPTYbmqsRiSfDBmOlpv3n9TXRw1sdczeADa8XPI/rWiTE3S/Rh8lT5NUonD4cSAfeBexDGPVbH0qVM/f8ApJoW9l0TxKmuOkSPRrVSczhAeBAxHcQOx0m39a1JkHae2x9DWU4hkAMRgoKqx1R3Jkzew3vW+UNcaM+E42rDYAgqH+G8CwmDNEphKpI8KgAnZuUtzbuaRcLCo7EabCJPO4PrzG1PMbDR2RyqyBJgW2gjud7RU3gpJFnvcL4taG02UkeVn3+tTAfDI+KCTsVbmJ5GwoTPcbyyGyrIEHSoPmPDb61Th+0OAZASFH8AEfIn8KCW17NBhlDI1qNtlb8Sa892rR/iISPvcgfWhspmsJ/h0nlYDmQb8wfMCmqogk6VsDFhQPhgHuyg8BVr8yJIO5F+21WKi6SispVg0mRuwCwDNrT8q7yzHQdWGEOpoFmmTMgx3iO1dDMIniYLAHOBHmTYDuaIwqBHyRYLqgSuloaYAiOdzYX+lVpldDoFIiGgk2vFjG9hO9u9e43HsPkyEX+Aa+d9hQR47hjFV+SqRLIQBPpT5CjRsNQnu9YiLRvvJ8Rt9NqmLgDFEMyrpYEAXmBuTqv5DpXjZ8OyMukje0EEdQRuO9EYz6SoXD1AsASsQoN9Rtt+hogqD5kBmXU48DSNKG+29/wNcZnG1EGVmfusLfOqXxDqLAiPIdIFAZziSIBrYA9N29enrFIKM9KAE6jJgHwmLdLz9apwmUAnUvyPL1pIvtPhCfAxGxOhZE/5vwmmOQzODjqdDA325ieoMET5RT7BMMz2Z1QV0kDlBH1/KvMtilZkpAUgXP16eVXvl1VS2lXa8KYuT/xSniqODh6FEMwBIEgAi5tsLbmk+xrot4S5bE1EJKlbK029OdafLZjCw7K7MSzEApAu7aoIkm9Z7VoZICyzoGt3PTztTnho1ISwBIxGjbm79PKkxitc2ukEmAecN26964x8HXqN/FhskgsAAxWWspuNP1qF9KKvKB0/AbUu4kGbEdlDkfszQdJ+KAsDSsTcwJntVIT6CGwJ0CDCYuuzG5ChNJGna3zpVxfElmJBJLWBkRb8PTlVeHlHKISriceCsOLaVufD8NzvaaJxH1Bg/iifUjp6ip+THYSEyZt1ITDOmJNiIvv5bn6Vxmc4wYHUW5lAJWRf+tG5PLLOtRA8QM8gALyOcj60KcEkork6LliIO4HiAmGJjntasP6txsmgj8UDALBib2An5XgdK4zOMuiQFWfumCR4gRA/PtVGIml2BuJOmBAF/DIJ2iLTTDioRnD4ahdahmDEQhtqA3gT+NaJYroKL8tjthyVJLHv5m/zoXMZjU5LWmATHzPc0WGkgAg9Jj+/UVXmsHaI7wLAcr1Sy9k8g5xZtaOo3NM8tjYawQJLDxWMAk7X5UuTB3MSBzHLzq3Lkkzq25dvzpvrgLBvi5l5MOQOQB2HL6VKWtinr9B+tSstWKH1R2PWR0O9LuJKSupbMOokEGxEgbfpRRx+U/1/Wqy42Bj8x/c10Png0Mzh5f8AxCNoEb7QoMnrc0n43xNmLIjHQPDv8fWTuRTrHRvesNXoYgA2ABncgVmc4gVBtOob+RNJcDfQNg4jhvCD5Uxy7EvpHhnmPzmlmHiHUKIy73E3Avvb+tEM4XHOPh4ngedNtQMg9QYswr6BwHifvsMHZhYidjG3leRP5V84zPxajF+SlTFugNOPZnNMDiqvh8K35m5HPnBNEKx7PomNmfik7bHl3rHZ3OviamYFVF1Eb3iT3j5bUdh4zeNWcmNO4XeR0F6BxM1/gljcAkT316fxplMD/ayIIA23jy60RmOKOApDXj7q9e4pxwzhzYoDIgYedaDKcBfWpOEkDq0f+N6OUTKfOeEZ58B0dp0O51L0n7Sjl5cxbpH0bCdWWSd/rbl2/Wsp/wDIZ/8A6URlCkItgZBBLXmBRaudCKGYQgMA2sIA270kVArjWa0A6VMQfEASAeRJ3HbyrAcRltRJkm5Pnzre5wA5c+IeIEHmRci9q+f57AIcqDJ2qZ/YnJAmD42VFESQCekn+tXnEbDxdSSpH16z58xtXeVfQw1ICQwIuRBBnkYPrXeJiK+KSbSNj+FX5BLg3eTzevBV13YQQDte4nz+kVl0wmDlAzKAxAIO8AzO3SmWVREwgJjmIJ5k9KAy2LLqzeHxxbuYJ+dKlMKTBITW+I24g2m039CRtRmR48yAprJGrVaLAknnzmjMtlQcKWEwxmbg3jaKTZzLsMcqiqECseVwBaAQbj63ooQZrxFdCg6juJEWgwLTelWfxkWH1gWG83PP17UBlsTEZkExKgmQLyd7C1VZvDDsNYfVdQEKxKkgm9HA+YM8vnMN9Wll1QTBkb6fvRtHLrXOEy6gHYqvMgAnbYCRImBSjDyYRgSHkGR8In0JvXeJnYJ8BBI6Df50NJ9MSbXYxzWZOkooAaTAkyYJkilbM5GokwG06TzgGTq87X61wud1QdBMTBgSJM/e78qZYvElfDVDgCV1HXaTqvtM1n9eKsJdYDhYOoqSN5iADO4kWFuXnUzrqZExHOBE+n4dq8bHEqSGGnb4vTkarZ1JkSCTeZ/9f7mlo7Rai/CxLwIK7TF/PtVwRoOkEjrHe/41dlcdUnVvqnbptyoluJJET15frWkKgIcN1BJECJJiwH51xgZ4QysWJmVgCLDqDarczm1dSARcdv1tVfBsFTigEqF1DU0SApImO8T6mrSTJyXo81dPxNeVbj4RLNpVguo6QQZCydM26RUpa4hqfTcVFYHtzIPrflQ7YR5bdDMHlvterS4DeFis99vpBFWNIGkCSOYi/OCOUUyhBxkFNLqpm6m/YkGwnrWIzbyO5M/Q19JzGECrC5J2jYxef6V80zPxNAIAJsdx29KQN8Q5TAYweR/u1GpliCNpIn8d/ltR+DhhxhAHYie9hTrJcIVncm0b+poJ1FGW4SXw2xSY0zI8hQ+RxSpJS8gTc9a03F81hYWA6KbsIAFyZUgz2uKyvCkZtZA6D8TSg+mNsLPvqkgd9yeg3MfSrhlWbLaIMl5/3TQGIjKrtEGxHoQa0HBuM4WLoRyEaftWX50dFds44XlMZFH+I48W2o7Vp+FPmGxUU4jlS3i8vWmmDg4KrfFTfkZ/PelntH7VYeXTTg+J+RMQve34VO1KiSMj/wDJLq2bKgyUVVY97sf+4UuXFcADV9kchtbnFKHdncsxlmYkk8yTJNPxliVXyg/KmRRzgIf2ZNQMOJ1Wi2LHL0rL+0eScYjsRuxg9pMfStpicTwxkEwm+NMS+22st1npSbjHFEZI0zfmR0qeaPLlGLw8IghrwCPpVjxrM0dm8cMulVAA32negNMmrTIGiYZKDSzAR1Mc6qy2N4hrGpZ6wdzzjy36UZlsCEE0EEGqOU0UqmsyvGECaDIlp2a21rSKHbMYZctr+yRFgOt5FAYBGg9ZoZ3hyLbGpHQhc1h61YHYQbD6RtsKFZwzoFLF9ZIPIaiSPqaoDjUAOlc4OKQ6G1nn5GgdCMzw91bxqzc5Uco9fwqYWXXSQGgxF7nanbcTUjxpe11JFpkeFpHyNd4uYwXAkR/Mk/VSRRahRCf9hXm/ygdq5PDk6k+v9KLxcFLFXS521EfQkRVgypaBGr+VwajV+x6i18on3mPrVD5aLibd/wClNv3b/A4AP8X5Vwcsg3DfT9ac/Q1Ea4bLed+3OuTiPt4J8hNP3ya7qSPOfymgXyT6tQf0lufYjtVoJBYyuQfCltzp2oYYLCtEvvlV1XRpaJ2m2xBIkG5+dC/sbn7M/wAon8BT6BqiiDz/ADqU6VMcWCW/lapWlxM/7ejbl9W6wQPKR1qBmZbKHi+nY8vhvejGyaumqCerCGg9CFMxQQwHtoIgDfn3ja3zqZCqctiIQGA0k7i9r9SJHnesR7S8NZMUuB4X8Q8/tD539a2gzQQgkAk3lRt2Kn4WmbgxVPE8p7zBcQxdW1KdJk2ErIHQ8+1ID51hOUgyQZo5eJtLeI371Zj5VZNjXiZBe9KihSrnEMQD6U8yeW0LFcZfDVdh/c0YH3FDY0jl8MQe9LMXLvPhYAd/+KYg+EDmTTT2eyAxcwik89UQbgRz7H8KEqD4AMnwnHIAZyqmCVAhiJvuZB6HSd6s/wCjMUmSuM87aUt6lytfVM4VwkKoqKALxAO25uKzAzr6wdbM1raoHlGnUem9aar0ZPJiTC9jGUq37O4O8M+HaLXGvcxPSTy2on9zHZUMDq+FPrDxNa7L4maxBOhFWLTIntvb5GqMTgmYdvG+EFEgaBLHaD4lOnnbvTeKBZMx2d9mWePA/wDqwyfTSTS3G9jnGy4gPdWI/wBq1v8A/pkL8WNHki/pU/c2gyuOk/xSD5WvRqg2Z83b2UcDxMB8/wAG0/jXuD7MOLxMc7f+LMfpX0w5XHFhioT01X/3bVx+zY/28JHHcKx+m1LRBszAYvDXUREnkNj/ALgKSvk3BBClgfu3/wC2vrK4aideAyn+AletwCYih34ZgOZ1kcoxEVifoCaNB7HzEEqsEEX2INUkEnUCY2jlX1BfZ5Dq0thk9FZkNoiQJE+dAZn2TO/juLx7tryfU8rmoeDGskfN0wog3rnGw62Gc9mnH2lBPJ0ZPoBApbmOAYojSmq1yrKbydhvtH1qdWOoRAN941c+IwAJIgjtNjHLb1o3Gy7osMmjzQyRa+oi23XnQSYJYwIk9x+dD47GuThnY8+e5NXNgEIHJU8thNW4GEDpA3LEf7ZH51QgJ0zIBJHqomiBWdYeM6ixYDszD8DXjZx5+NvUzznmKoGYIlQdj+deYmGbE96XA9mFpnnG5Vh3RT+EVfh8SafgQ+RdbfWkY6zzr33h5GnB7Dn96nmrR2cHn/EKuXi66bqekFFPLeRSjCxJVpNxsI3qJi8oFEDYbrxHD6j/AEP+tSlY/l+tSiMNkfR8TLIi68DEJMbagCR3E7+dc4eYlzqRybAEABu8AX/GucvklcEeFDFiI0tzPl86uzmA6rOGp7rpBQxtzJsOnOtF0QU42ibENcglxDLG3w/F8q6xMuWGsELGxEjUDECVEDpfrQuWzroxsAsgyQSR5bnrROXzCuzIzr4jJYGPTSRv3McxT/wDIcXypw8V1MwfEJmYN+YBkXFUHDIAP5iflWl9p8i4UeFiUIMwdUHwxIt3tWdwnBB1D5xHP1HpWbRVIrVdiPDRVMkxpUTO4Jv5SdqvGTZzZlkb9BbmaIFK8R4Np25AE+k71peB4oTFwXlQQ0EaHDeIQBJETfyrNNl2BBE3tsbH039JpvlMi/hdnKlWB0Mrkgi8GBA2p4ifKPq+Zww46dPWk+X4X/jjVcb7z5g+n40yymJqw1Pp8rVdlh4wa2MuyZ3NBLX9BSV+KOHJFx0JMHtdbfOn+cQEEEf36XrJZvB1OV2Aiwm/brFJIGwke1BBh0HkrFj6hVMeteYXtLgu2ko83nw7FeRkWNXZT2aDDU5KCLKsSPypinAsGZIZj3Y/lFJ/gKmQzPGGMFcF0nbUyao2+HUAu9V4ObcGVRxP8akC193nfvW2xOBYDfFhgmIuW/Wuf3FgCB7v6tz9adCMzeHxzHQRDd9SltxP2Sf7+dWN7TWGvCRjzlGT5FhT7G4LgkRDCYFmPKIEnyoXF9nk2XFcHyB3tyj+xSoRgGHxjLHdCpNzoOr+96YYZwmnRiwYtqmL3HYihcT2cYsfGj9Qy7fjQmJ7NuBfDVh/Ax6/dMcqdCDwpiL8DK143H12+VUY+GD/APZgqY5lSN+4H1mkjZXFXV4cZLKAYkWG9wbDaik4liqfC6kHkwIi8naeVr9KdEXnKYJ5OkiPCxP4k7TNBZngGG5jXhna2JhgtzgagQfpTFOJk/FhIxsbRMNzvB9I7VarYLn7aHVJBNpuOcg7UQKZbM+xwmVw0YTb3bkEej2pbnvZdyL++UDsHUf6IH/NfQEyI+ziBvQfOR866OVcSbnyM9TYGpeK9FbM+Qt7MYisdDox5gyp+TDeh85wzMG/uyRG6eIedia+vsGPxpP86ec77xANB4uVwjvhBf5DB6bA7XA9aT+ND2Z8TxMsy2YEfzAj8amDlySABvtX2jH4bhEfG6dmAYcuoE7R6mleP7Ko7TGCwm5ClGNjER6Xml9bDZHy5VgkHkYqx0vW3zXsUNwmIn8pD8ue/PvSjMeyrgwrg9A6svXpzsah45D2Qj9z3qUxbgWOLQlv4xXtOMKjQjCNj4gfs2Jn8b0RgZsixInqDB/zRY+tDcOzpRxqYELtc3n1pvjouINQ0+n4Ch/hp/oGcMtpUMCOhALLa+3TvXj5YIRr8aDmIle4FifQ0LjYTYbjS+rzF55g1W/EWJMkra67D0HIUUIHYOA7Fh77WjWMuTAO4gnftS7C4AwOxYTzBgi/ax2t+O9erjapCEAm1vCQD1JgVo/Zp9aMrEMwM73v18j+NXjH2Z5cdCLD4HBnSZG0bCOU7xRQ4N2Ig2tG8zaBG/K1a8ZcdK9/ZxFVERWYDP8ABoRnLLbxamPwidiTuO/eiMpw9cRHZ/ESbnDulhYKLENEcorXZvKyji4lSJBvtytXKZO+oWDoAT1Yfb/mIi/YUPFDWTC/Z7G1YQS/hA3BDdLg85BppgnxcqScBGh3QsWItMzNle5gX8Z5U3Uw1UIPx9jSREnHURb+zFOQbUNpHvATvypIGGYlDnFAsbdt6tzDgXJA8zFL87jkQNSf5tR/DepSG2FNnADBB+tdpmlPP50lfNkrdgB1AgdrNvQeYzMW1ws7hSeWwi3/ABTgqafEY7qAaDzmsKSJmLxHz60lwuLaFHiN9rQLTKkAb+dOcrxXDchS0MeRtMfjRAtFCZ3RIDtLDdjq0sOq/mTVeHx7Qty+K6nxaQoSC0AryMGB6+tOM/wpHkhRqPcgXEE228xe1ZvN+zeIgLIit1927au3xATFDDka4ntLofQyNA3YXAkTcxc+U0zfNodIZQ2oSCV8J7AmskmGse9xCU0jSPeBgUsJIG2/lzmqMTOhFlXLM4JXExGSw5hQIMH8hRwKs2L5HAaZQLNyVJGxt5GaqThKX0YjRM8uoMEjfaPI1gU42iMCiB3GzvMXuWVSYW/IAU14VxJiC7uYB+CZaTyCCI9e1JRjNRicOdQxUKxOxBAPzO0Cg8AvhqAyuh0zLEsAd4JMzzpa/tJivp0IEWY1HxCBY/ARB7/80xHtOisqatbn7KRJtPU7CqFwWZbi7MJkRaAd4MbxMHtVj8QQzrwpjpBvO3hvPOrhmkf48O8wIWTHxST9n1O9V4nDMAwZOHeQS1iepDH+5oA7RcJyCNSEgxeN94B5zXn7ECCUdWJ5nf5jvXmPw55Gl1YAC1wW6zNtqCbK4gPiRxzLL2sRabmZ7x2oAM/ZnHJtx8Jn+xb61y+I1gwBmbMvTrIodOIFTAYkKJJK+ZH07dKuHFHg6kBANr9pk6tj+opgUlMHnhCexqVd+8cHmhnyNSiCPna46kGwMGJKifpR4YKABIt2jyA5fOpUrE6CnN5iChKgnfUN79Z3NVjM4akq66gR8XMVKlT4G+wbEwcNpALcosPrNN/ZnPaMZVYyG8O2x6/QVKlNdifRu5r0i1SpWpiVMOVK+K4OMxUYYWP/ANHLFWUcgIBmdjY+lSpTA5yeX9y+GBYWiTP8JvFh4hyp/iTNqlSmhBuGbVVii4PSpUpDCMY2pZnVkHxNIv8AEwj5VKlCBiLMQL+8Kn/Mx25kxVJSRJdo6czfnuOVSpVEFAC3YE2MGd9u3pzqpfEw1NCm4EAmJkwY6db15UpDNDwLJggt7x97AEiPON539a0Ci25Pn/SpUpMpGV9p8hhgM7O4AAlfs7/ZA+EnYmspj5Jlg6WAxJ06mQ+Ezsbldp2mpUpMQr4flvePpLkHkBN/Innzv9KbY2KMUMb4a4bfCIkkXhiJkTAifWpUqV0NlGFjtj+FFTCWZ8K8gDJaCLRyAvXD5zCSCsuyzqCqEUkiJ25chUqUCKkzmNiKzqxGkwSCoIEapEKNu0b0w4bnRgf4mO72JAk6lk84Ckzz+dSpVIQZlvaou5XCVWZrS5bSf8oCxt386e5L2jOv3bMC4ALQrBAtrC5MwRe/kKlSmugC8vxXAzEj3eoGRqKgatJgjedzzirsfJ4RCqC2GbQBcCOo5/OpUoKPcDhQCgBpgRJUSalSpUgf/9k=

      https://lh3.googleusercontent.com/proxy/E0a9DcaqfRhFiudlHc56XpFy6FcaR2wPbjKtVcUX7W05smeVDPrGTMolclPVzpIYFxu_DEG22ZuaPkoh_fQCfnEZedHcum02UMOPKUiYVwYeT9aw

    1. SciScore for 10.1101/2021.06.04.21258182: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.1 Study population: This study was approved by the Alcala Pharmaceutical Inc. Institutional Review Board (IORG0010127) in consideration of the Code of Ethics of the World Medical Association (Declaration of Helsinki).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Healgen® lateral flow rapid cassette kits for COVID-19 IgG and IgM antibody detection were used for testing individuals by whole blood finger-stick at the Alcala Labs collection site or San Diego Comprehensive Pain Management Clinic by a certified phlebotomist/nurse.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test results indicate the presence of both IgM and IgG anti-SARS-CoV-2 antibodies (Fig 1c).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For IgG 100 μL HRP-labeled Anti-hIgG tracer antibody was added into the microwells, for IgM 100 μL of HRP-labeled COVID-19 antigen was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-hIgG</div><div>suggested: (Antibodies-Online Cat# ABIN288163, RRID:AB_10795674)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.03.447021: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S was detected using a rabbit anti-S2 subunit mouse monoclonal antibody (GeneTex, GTX632604;1:2000 dilution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S2 subunit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseraddish peroxidase-linked goat anti-mouse IgG antibody (Proteintech, CHI, USA, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were permeabilized using PBS with 0.2% Triton X-100 for 15 min and blocked with 5% FBS (Gibco), followed by treatment with the primary antibody anti-SARS-CoV-2 NP (GeneTex GTX635678, USA) at a 1:500 dilution overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After six rinses with PBS, the cells were stained with DyLight 488-labeled antibody against rabbit IgG (KPL, Gaithersburg, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: HEK 293T, Vero E6, Caco-2, and BHK-21 cells were cultured in Dulbecco’s modified Eagle medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells transfected with pcDNA3.1-SARS-CoV-2 S (ct19), pcDNA3.1-SARS-CoV-2 S (wt), or pcDNA3.1-MERS-CoV S (ct16) for 48 h were infected with pseudotype VSV (described below), in which the G gene was replaced with the luciferase gene, at an MOI of 0.1 for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 h, the supernatants were filtered to remove the vaccinia virus and inoculated into BHK-21 cells that had been transfected with pCAGGS-VSV G 24 h previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drug-drug interactions of remdesivir with hits: Caco-2 cells were seeded at a density of 2.4×104 cells per well in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells transfected with pcDNA3.1-SARS-CoV-2 S (ct19), pcDNA3.1-SARS-CoV-2 S (wt), or pcDNA3.1-MERS-CoV S (ct16) for 48 h were infected with pseudotype VSV (described below), in which the G gene was replaced with the luciferase gene, at an MOI of 0.1 for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-MERS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 45 min, the cells were transfected with 11 μg of mixed plasmids with a 5:3:5:8:1 ratio of pVSVΔG-eGFP-GPC (pVSVΔG-Rluc to generate pseudotype VSV), pBS-N, pBS-P, pBS-G, and pBS-L.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVΔG-eGFP-GPC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSVΔG-Rluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-P</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 h, the supernatants were filtered to remove the vaccinia virus and inoculated into BHK-21 cells that had been transfected with pCAGGS-VSV G 24 h previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-VSV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The titer of the pseudotype virus was measured by infecting BHK-21 cells previously transfected with pCAGGS-VSV G and determined by plaque assay 24 hours post-infection (h.p.i).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-VSV G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All point mutants (D614G, K417N/E484K/N501Y/D614G) were made from pcDNA3.1-SARS-CoV-2 S (ct19) by using a fast mutagenesis system (Transgene Biotech), and mutations were confirmed by sequencing (Sangon, Shanghai).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membrane fusion assay: Vero E6 cells were co-transfected with pcDNA3.1-SARS-CoV-2S (ct19) (0.25 μg) and pEGFP-N1 (0.25 μg) by using lipo2000 in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEGFP-N1</div><div>suggested: RRID:Addgene_111933)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Wall, E. C., Wu, M., Harvey, R., Kelly, G., Warchal, S., Sawyer, C., Daniels, R., Hobson, P., Hatipoglu, E., Ngai, Y., Hussain, S., Nicod, J., Goldstone, R., Ambrose, K., Hindmarsh, S., Beale, R., Riddell, A., Gamblin, S., Howell, M., … Bauer, D. L. (2021). Neutralising antibody activity against SARS-CoV-2 VOCs B.1.617.2 and B.1.351 by BNT162b2 vaccination. The Lancet, 0(0). https://doi.org/10.1016/S0140-6736(21)01290-3

    1. SciScore for 10.1101/2021.05.28.21258025: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human Research Ethics: The study was reviewed and approved by the Oregon Health & Science University Institutional Review Board (IRB# 21230).<br>Consent: Informed consent was obtained from subjects on initiation of their participation in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 4 times with wash buffer, and 100µL (plasma) or 50 μL (LDA) of 1:3000 dilution of anti-human IgG-HRP (BD Pharmingen, 555788) detection antibody was added and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For subjects with low frequency of antigen-specific antibody secreting cells frequency was determined by number of positive wells divided by the total number of IgG positive secreting wells, multiplied by one million, giving a frequency per million PBMCs stimulated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, His-tagged VoC-RBD bearing lentivirus was produced in HEK 293-T cells and used to infect HEK 293-F suspension cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293-T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analysis was done in Prism version 9.1.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Breakthrough infections and the emergence of VoC highlight the limitations of SARS-CoV-2 S specific plasma antibodies alone to recognize and protect against VoC, and work by our group and others, [9, 28-30] has shown that serum or plasma antibodies elicited by natural infection are less potent overall against several VoC. However, serologic studies do not capture the antibodies that will be secreted by MBCs when they are stimulated, expand, and differentiate into a new population of antibody secreting cells. Here we characterized the SARS-CoV-2 specific MBC derived antibodies, with three critical findings: 1) SARS-CoV-2 RBD specific MBCs can be detected in asymptomatic, seronegative, PCR-positive subjects, 2) MBC populations elicited following primary infection appear relatively stable over time, up to nearly one-year post-infection, and 3) the antibodies these MBCs are programmed to secrete recognize both parental and VoC RBDs at roughly equivalent frequencies. These results are consistent with MBC studies of other pathogens that show MBCs retain pathogen specific antibody diversity that is different from LLPC-derived Abs [11-12, 31]. Because of this additional line of antibody defense latent in SARS-CoV-2 specific MBCs, we contend there is reason for optimism regarding the capacity of vaccination, prior infection, and/or both, to limit disease severity and transmission of VoC as they inevitably emerge in the setting of ongoing transmission. The observation that the high ELI...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.03.446959: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HLA molecules were purified from lysates of EBV transformed homozygous cell lines by affinity chromatography by repeated passage over Protein A Sepharose beads conjugated with the W6/32 (anti-HLA-A, -B, -C) antibody, following separation from HLA-B and -C molecules by pre-passage over a B1.23.2 (antiHLA B, C) column.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HLA-A, -B, -C</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antiHLA B</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following Huddelston et.al. (Huddleston et al., 2020) who used SANTA-SIM to simulate influenza A/H3N2 that has a yearly substitution rate approximately twice as high as SARS-CoV-2 [∼48,824 substitutions/year (https://nextstrain.org/flu/seasonal/h3n2/ha/2y?l=clock) vs. ∼24.5 substitution/year (https://nextstrain.org/ncov/global?l=clock)], we chose 400 generations/year, with the mutation rate per position per generation set to 2.04E-6 (yearly substitution rate/(generations in one year * genome size)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      LIMITATIONS AND FUTURE DIRECTIONS: Our analyses focused on class I molecules for which predictors are established to be more accurate in comparison with class II. HLA-C and non-classical HLA were not included in this study. Predictions were performed on the most common HLA class I alleles and rare HLA alleles were not included. Study has been performed using the GISAID dataset available in December 31st 2020, i.e. first year of the pandemic, before mass vaccination. Our epitope binding results rely on in silico predictions using a method that has been widely benchmarked, but is designed to predict peptide presentation rather than immunogenicity. Follow up experiments would need to be performed to further validate the proposed model. Priority follow up studies are 1) to investigate T cell response to SARS-CoV-2 mutants in large cohorts of B7 supertype-positive versus negative patients, and 2) to determine the direct role of APOBEC family proteins in modulation of SARS-CoV-2-specific T cell immunity. Moreover, this study lays the foundation to understand the evolutionary dynamics of pandemic viruses with a time 0 / no vaccine-induced immune pressure start point. Employing SARS-CoV-2 as model provides an opportunity in future studies to look at the dynamic of the relationship between mutational patterns and HLA-restricted T cell immunity in real-time. Kinetic analyses using the latest GISAID datasets, which now include 1.7M SARS-CoV-2 genomes as of May 2021, may lead to addition...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.02.446468: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were approved by the Emory Institutional Review Board (IRB) under protocol numbers IRB00058507, IRB00057983 and IRB00058271.<br>Consent: Informed consent was obtained from the patients when they had decision making ability or from a legal authorized representative (LAR) if the patient was unable to provide consent.<br>Field Sample Permit: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.<br>IACUC: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell surface antibody-derived tag (ADT), encapsulation, and library generation: Leukocytes from whole blood and ETA samples were incubated with oligo-conjugated Ig-A/D/G/M for 10 mins at 4°C followed by the addition of Human TruStain FcX™ (BioLegend) and 10 min incubation at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Single-cell surface antibody-derived tag ( ADT) , encapsulation</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>library generation: Leukocytes from whole blood and ETA samples</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ADT reads were aligned to a feature reference file containing the antibody-specific barcode sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-specific barcode sequences .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays: Vero E6 cells were seeded in a 6-well plates (Falcon) with 5 x 105 cells/well in 5% DMEM 24 h prior to infection and checked to verify ≥80% confluency. 10-fold dilutions of virus, respiratory secretions, and/or scRNA-seq emulsion in serum-free DMEM (200 μL) were incubated on Vero E6 monolayers for 1 h absorption at 37°C with rocking at 15 min intervals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed in ~4 mL FACS buffer, then resuspended in 200-1000 μL for acquisition using BD FACSDiva™ Software on the Emory Pediatric/Winship Flow Cytometry Core BD FACSymphony™ A5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with FlowJo™ v10.7 (FlowJo LLC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To recover neutrophils, scRNA-seq UMI count matrices were imported to R 4.0.2, and data analyses were performed using Seurat v4.042.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R package Slingshot was used to infer the trajectories of neutrophils recruited to the lungs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Slingshot</div><div>suggested: (Slingshot, RRID:SCR_017012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed using GraphPad Prism9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.26.21256092: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Centre, location AMC, the Netherlands and approved by the local ethical committee (NL 73281.018.20).<br>Consent: All individuals provided written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All other proteins were produced in HEK293F cells (Invitrogen) maintained in Freestyle medium (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells expressing the SARS-CoV-2 receptor ACE2 were seeded in poly-L-lysine coated 96-wells plates and the next day triplicate serial dilutions of heat-inactivated serum samples were prepared, mixed 1:1 with SARS-CoV-2 pseudovirus, incubated for 1 h at 37°C and then added in a 1:1 ratio to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, a gene encoding amino acids 1-1276, in which the furin cleavage site (amino acids 752-756) was replaced with a GGSGS sequence and amino acids at position 1067 and 1068 were mutated to prolines, was ordered and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mann-Whitney U-tests for unpaired comparisons, Wilcoxon matched-pairs signed rank test for paired comparisons and Spearman correlations were performed in GraphPad Prism 8.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis was performed in Matlab 9.6 (R2019a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.01.446676: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Placental Samples: Placental tissues from SARS-CoV-2 positive women and controls were obtained at delivery at Weill Cornell-NY Presbyterian by the Department of Pathology and Laboratory Medicine at Weill Cornell Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 and A549 (adenocarcinomic human alveolar basal epithelial cell line)-ACE2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin and 100 μg/mL streptomycin, and maintained at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>cells</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM Non-essential amino acids, 1 mM sodium pyruvate and 10 mM HEPES using a passage-2 stock of virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(https://www.atcc.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.atcc.org/</div><div>suggested: (ATCC, RRID:SCR_001672)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2-N Forward 5’ CTCTTGTAGATCTGTTCTCTAAACGAAC 3’ Reverse 5’ GGTCCACCAAACGTAATGCG 3’ GAPDH Forward 5’ CATCACCATCTTCCAGGAGCGAGAT 3’ Reverse 5’ GAGGCATTGCTGATGATCTTGAGGC 3’ qRT-PCR graphs were generated using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clusters were washed once in MACS buffer, examined for viability with Trypan Blue (GIBCO) and plated onto Matrigel-coated 96-well dishes and μ-slide 8-well chamber slides (ibidi GmbH, Germany) at confluent density in DMEM/F12 supplemented with 10% FBS and penicillin/streptomycin/ fungizone, and were incubated at 37°C with 5% CO2 for 24 hours prior to infection with pseudovirus to allow for attachment, For infection with SARS-CoV-2, Sections of fresh chorionic villi (2g) were minced with sterile scalpels, digested in Accutase (Innovative Cell Technologies) for 7 min or isolated using a human umbilical cord dissociation kit (Millitenyi Biotec 130-105-737), and filtrated through a 100 μm cell strainer (Falcon) to obtain cell clusters of ∼50-100 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Millitenyi Biotec</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.02.446813: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific B Cell Sorting: Cells were stained and mixed with DNA-barcoded antigens and other antibodies, and then sorted using fluorescence activated cell sorting (FACS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, synthesized antibody-encoding DNA (~2 μg per transfection) was added to OptiPro serum free medium (OptiPro SFM), incubated with ExpiFectamine CHO Reagent and added to 800 μL of ExpiCHO cell cultures into 96-deep-well blocks using a ViaFlo 384 liquid handler (Integra Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-encoding DNA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody, goat anti-human IgG conjugated to peroxidase, was added at 1:10,000 dilution in 1% milk in PBS-T to the plates, which were incubated for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T, and bound ACE2 was detected using HRP-conjugated anti-mouse Fc antibody and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RTCA Method for Initial Screening of Antibody Neutralizing Activity: To screen for neutralizing activity in the panel of recombinantly expressed antibodies, we used a high-throughput and quantitative RTCA assay and xCelligence RTCA HT Analyzer (ACEA Biosciences) that assesses kinetic changes in cell physiology, including virus-induced cytopathic effect (CPE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CPE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An antibody was classified as fully neutralizing if it completely inhibited SARS-CoV-2-induced CPE at the highest tested concentration, while an antibody was classified as partially neutralizing if it delayed but did not fully prevent CPE at the highest tested concentration2, 22. Real-time Cell Analysis (RTCA) Neutralization Assay: To determine neutralizing activity of IgG, we used real-time cell analysis (RTCA) assay on an xCELLigence RTCA MP Analyzer (ACEA Biosciences Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>determine neutralizing activity of IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody expression, microscale transfection was performed (~1 mL per antibody) of CHO cell cultures using the Gibco ExpiCHO Expression System and a protocol for deep 96-well blocks (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of antibody) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque Reduction Neutralization Test (PRNT): The virus neutralization with live authentic SARS-CoV-2 virus (USA-WA1) was performed in the BSL-3 facility of the Galveston National Laboratory using Vero E6 cells (ATCC CRL-1586) following the standard procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) sequencing core at an appropriate target concentration for 10X Genomics library preparation and subsequent sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genomics</div><div>suggested: (UTHSCSA Genomics Core, RRID:SCR_012239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, synthesized antibody-encoding DNA (~2 μg per transfection) was added to OptiPro serum free medium (OptiPro SFM), incubated with ExpiFectamine CHO Reagent and added to 800 μL of ExpiCHO cell cultures into 96-deep-well blocks using a ViaFlo 384 liquid handler (Integra Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibodies, the inhibitory concentration at 50% (IC50) values were calculated in Prism software (GraphPad) by plotting the midway point between the upper and lower plateaus of the neutralization curve among dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryogenic Electron Microscopy (Cryo-EM): Motion correction, CTF estimation, particle picking, and 2D classification were performed using cryoSPARC v3.2.026.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ANOVA analysis was performed for neutralization potency comparisons using GraphPad Prism version 8.0.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.02.446343: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A working concentration of 1 μg/ml human ACE2 biotinylated antibody (R&D Systems, Minneapolis, MN) was prepared, and 100 μL of this solution was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins produced in human T293 cells were obtained as follows: Recombinant Human Angiotensin Converting Enzyme 2 (ACE2) (Cat # 230-30165; lot 04U06020TW) was purchased from RayBiotech (Peachtree Corners, GA,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T293</div><div>suggested: RRID:CVCL_T293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, 100 μL of the mixture was transferred to a semi-confluent culture of A549 human alveolar basal epithelial cells growing at a density of 20,000 cells/well in a 96-well white cell culture plate with a flat clear bottom.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: To determine the significance of changes in kinetic parameters of ACE2 binding to SARS-CoV-2 Spike or RBD mutants we have applied least-squares regression to the linearized Eadie-Hoffstee plot of the binding data, and determined the statistical significance of the difference between the slopes (i.e., KD’s) and between the intercepts (i.e., Bmax) using R or Stata statistical packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Stata</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      It is a limitation of our study that we have not tested whether changes in spike conformation in response to ACE2 binding might also be occurring. Certainly infectivity enhancing mutations such as Mink [Y453F], UK [N501Y] and S.Africa [E484K] profoundly affect ACE2 binding kinetics. But whether RBD conformation intrinsically changes in response to ACE2 binding is a study for the future. An additional limitation of our study is that we have utilized a luc-loaded, SARS-CoV-2 pseudotyped virus as a test for biological activity rather than a native SARS-CoV-2 virus. However, it was only with a viral particle model that we could unambiguously demonstrate that cardiac glycosides inhibited viral entry. As mentioned above, ouabain itself has also been previously demonstrated to block infectivity by native SARS-CoV-2 virus, albeit in a green monkey Vero cell 22. Conclusion: Ouabain and digitoxin competitively inhibit ACE2 binding to the SARS-CoV-2 Receptor Binding Domain (RBD), and also block virus penetration into human lung cells. Clinical concentrations of cardiac glycosides are relatively safe for subjects with normal hearts, and it is therefore possible that these drugs could be repurposed for COVID-19 therapy.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.28.446009: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: 4.5 In vivo experiments: All experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of New York University Grossman School of Medicine.<br>Field Sample Permit: high-containment research facility under the responsibility of the Office of Science & Research and its Director of High-Containment Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six to 12-week old female C57BL/6J albino mice (B6(Cg)-Tyr<c-2J>/J,Cat#000058) and Hemizygous (B6(Cg)-Tg(K18-ACE2)2Prlmn/J; Cat#034860) (hACE2-Tg) mice expressing the human ACE2 receptor or non-carrier controls were purchased from Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After incubation, five fields were randomly selected in each well to count the number of fused and unfused cells under an inverted fluorescence microscope (Nikon Eclipse Ti-S)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) and anti-rabbit hACE2 (Thermo Fisher,1:100) were applied overnight at 4 °C followed by incubation of appropriate secondary antibodies conjugated with fluorophores.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorochrome-conjugated antibodies against mouse CD3, CD4, CD44, CD38, ICOS, OX40, CD62L, Perforin, Granzyme B and Tbet, CXCR5 were purchased from Biolegend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (RayBiotech Cat# CS-11-0133, RRID:AB_1228052)</div></div><div style="margin-bottom:8px"><div>CD44</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD38</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ICOS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD62L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorochrome-conjugated antibodies against mouse CD8a were purchased from BD Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorochrome-conjugated antibodies against CXCR3 and Ki67 were purchased from Thermofisher.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ki67</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies to SARS-CoV-2 spike (GTX, 1:1000) and p24 (Abcam, 1:1000) were added overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p24</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T/ACE2 cell line was obtained from BEI Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Helper and replicon RNAs were then electroporated into BHK cells and incubated at 37°C in αMEM supplemented with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparing effector cells expressing SARS-CoV-2 spike, 293T cells were transiently co-transfected with pCDNA3.1-Spike and pMAX-GFP or with pMAX-GFP only as control, and applied onto 293T/ACE2 cells after 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.8 In vivo delivery of nLacZ-SARS-CoV-2 pseudotype and X-Gal histochemistry: Isoflurane-anesthetized 4-week-old young adult hACE2-Tg mice were dosed intranasally with a 70-μl volume of nLacZ-encoding lentiviral vector (titer 5.18×103 TU/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-Tg</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified T-cells from C57BL/6J immunized or control mice were plated at 6×105 cells/well in a Seahorse XF24 cell culture microplate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids carrying the replicon (pT7-SV-Spike) orT7-DMHelper RNAs were linearized with XhoI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pT7-SV-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.3 Pseudotyped Lentivirus Production: SARS CoV-2 pseudotyped lentiviruses were produced by transfecting the 293T cells with the pLenti-Puro vectors (Addgene) expressing Luciferase or β-Galactosidase, with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-Puro</div><div>suggested: RRID:Addgene_39481)</div></div><div style="margin-bottom:8px"><div>pcDNa3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector, respectively (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparing effector cells expressing SARS-CoV-2 spike, 293T cells were transiently co-transfected with pCDNA3.1-Spike and pMAX-GFP or with pMAX-GFP only as control, and applied onto 293T/ACE2 cells after 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMAX-GFP</div><div>suggested: RRID:Addgene_16007)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis was performed on a LSR II machine (BD Bioscience) and data were analyzed using FlowJo (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing reads were mapped to the reference genome (mm10) using the STAR aligner (v2.6.1d)[89].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mean read insert sizes and their standard deviations were calculated using Picard tools (v.2.18.20) (http://broadinstitute.github.io/picard).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The read count tables were generated using subread (v1.6.3)[90], (normalized based on their library size factors using DEseq2[91], and differential expression analysis was performed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DEseq2</div><div>suggested: (DESeq2, RRID:SCR_015687)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the downstream statistical analyses and generating plots were performed in R environment (v4.0.3) (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results of gene set enrichment analysis were generated by GSEA software[92; 93].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The network of Gene Ontology terms was generated by Enrichment Map in Cytoscape.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional protein–protein functional associations used in this study for bar graphs were retrieved from STRING (http://www.string-db.org/, version 11)[94], a well-known public database on several collected associations between proteins from various organisms.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using GraphPad Prism 7, Adobe Photoshop and ImageJ Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software) to naïve mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 38, 44, 46, 47 and 49. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.01.446516: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: Nasopharyngeal/oropharyngeal swab samples and plasma samples were obtained from 11 hospitalized adults with PCR-confirmed SARS-CoV-2 infection enrolled in a prospective cohort study approved by the Biomedical Research Ethics Committee (BREC) at the University of KwaZulu-Natal (reference BREC/00001275/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus or antibody-donor cell mixtures were incubated for 1 hour at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-virus</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For staining of foci, a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with ACE2 antibody overnight at 4°C with rocking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed three times with DPBS and incubated with secondary antibody, goat anti-rabbit IgG Alexa Fluor 555 (Abcam ab150078) at a concentration of 4 μg/mL in an antibody staining solution made up of 1% Bovine Serum Albumin (Sigman-Aldrich) in DPBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Abcam Cat# ab150078, RRID:AB_2722519)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: Vero E6 cells (ATCC CRL-1586, obtained from Cellonex in South Africa) were propagated in complete DMEM with 10% fetal bovine serum (Hylone) containing 1% each of HEPES, sodium pyruvate, L-glutamine, and non-essential amino acids (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H1299 and H1299 subclones were propagated in complete RPMI with 10% fetal bovine serum containing 1% each of HEPES, sodium pyruvate, L-glutamine, and non-essential amino acids and and passaged every second day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293 (ATCC CRL-1573) cells were propagated in complete DMEM with 10% fetal bovine serum containing 1% each of HEPES, sodium pyruvate, L-glutamine, and non-essential amino acids and and passaged every second day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: ATCC Cat# CRL-1573, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell cloning to create H1299-ACE2 clones: The H1299-H2AZ clone with nuclear labelled YFP was constructed to overexpress ACE2 as follows: VSVG-pseudotyped lentivirus containing the human ACE2 was generated by co-transfecting 293T cells with the pHAGE2-EF1alnt-ACE2-WT plasmid along with the lentiviral helper plasmids HDM-VSVG, HDM-Hgpm2, HDM-tat1b and pRC-CMV-Rev1b using TransIT-LT1 (Mirus) transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 transduced H1299-H2AZ cells were then sub-cloned at the single cell density in 384-well plates (Greiner Bio-One) in conditioned media derived from H1299 confluent cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299-H2AZ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LVNA using focus forming assay: To quantify neutralization of virus either in cell-free or cell-to-cell infections, H1299-C7 cells were plated in an 96-well plate (Corning) at 30,000 target cells per well 1 day pre-infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299-C7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell cloning to create H1299-ACE2 clones: The H1299-H2AZ clone with nuclear labelled YFP was constructed to overexpress ACE2 as follows: VSVG-pseudotyped lentivirus containing the human ACE2 was generated by co-transfecting 293T cells with the pHAGE2-EF1alnt-ACE2-WT plasmid along with the lentiviral helper plasmids HDM-VSVG, HDM-Hgpm2, HDM-tat1b and pRC-CMV-Rev1b using TransIT-LT1 (Mirus) transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE2-EF1alnt-ACE2-WT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis of multinucleated H1299-ACE2 cells in time lapse microscopy images: Timelapse microscopy images were analysed using custom Matlab script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data generated in this way was graphed in R using the ggplot2 package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A caveat to our results is that we used a human cancer cell line, and modified it to express ACE-2. However, syncytia are a common feature of SARS-CoV-2 lung pathology [11, 12, 13], showing that the cell fusion mechanism of cell-to-cell spread operates in this environment. We used infected cells after they already expressed the SARS-CoV-2 spike protein on the cell surface, providing a target for neutralization. Despite this, there was no appreciable neutralization. Both the earlier D614G variant and the B.1.351 variant showed similar insensitivity of cell-to-cell spread in D614G and B.1.351 elicited plasma, indicating that the insensitivity of cell-to-cell spread to neutralization is not specific to the infecting variant or the elicited neutralizing antibodies. We have also verified previous observations about the drop in B.1.351 neutralization by non-B.1.351 elicited plasma in the H1299-ACE2 human lung cell system, as well as the cross-neutralization of D614G by B.1.351-elicited plasma. Interestingly, in these experiments, neutralization of B.1.351 by its matched plasma was weaker than neutralization of D614G by its matched plasma. Despite the overall weaker neutralization capacity, the B.1.351-elicited plasma could still effectively cross-neutralize, showing that cross-neutralization is not necessarily linked to absolute neutralization capacity. Like with other viruses, cell-to-cell spread of SARS-CoV-2 may prove to play a role in pathology and possibly persistence. Future ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.26.21257441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Both studies were conducted at the Amsterdam University Medical Centers in the Netherlands and approved by the local ethical committee.<br>Consent: All individuals included in this study gave written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All S constructs were verified by Sanger sequencing and subsequently produced in HEK293F cells (ThermoFisher) and purified as previously described (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: HEK293T/ACE2 cells kindly provided by Dr. Paul Bieniasz (44) were seeded at a density of 20,000 cells/well in a 96-well plate coated with 50 μg/mL poly-L-lysine 1 day prior to the start of the neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were added in a concentration of 20,000 cells/well and incubated for 72 h at 35°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were ordered as gBlock gene fragments (Integrated DNA Technologies) and cloned PstI/NotI in a pPPI4 expression vector containing a hexahistidine (his) tag with Gibson Assembly (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2-SΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHIV-1NL43 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inhibitory concentration (IC50) and neutralization titers (ID50) were determined as the NAb concentration and serum dilution at which infectivity was inhibited by 50%, respectively using a non-linear regression curve fit (GraphPad Prism software version 8.3) (45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While our study aims to provide an overview of many different aspects of pre-existing immunity against VOC, there are some limitations. In this study, we present a vaccinee population that consists of primary health care workers that are generally of middle age, with only four (8%) participants being older than 60 (Table 1). However, we found no correlation between age and titers in convalescent patients against any of the VOC tested. Moreover, we have focused on the neutralization potential of immune sera and did not examine antibody effector functions which have been implicated previously in the control of SARS-CoV-2 infection (41). Similar to other studies, our convalescent and vaccinee sera samples were collected four to six weeks after infection and four weeks after vaccination (i.e. at the peak of immunity), respectively. While we present findings that may have implications for additional booster vaccines and the monitoring of VOC, we did not examine the aspect of waning antibody titers and how those might influence VOC binding and neutralization. Finally, we have merely examined an early line of defense against infection with SARS-CoV-2 (i.e. serum antibody levels), while we expect memory B cells to play an important part in re-infections with SARS-CoV-2 VOC. Indeed, swift re-activation of memory compartments may lead to reduced transmissibility, a milder course of disease and a more potent immune response. In conclusion, we observed a substantial reduction in binding ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.01.446623: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Isolation and propagation of SARS-CoV-2: Human samples were obtained under the Helsinki University Hospital laboratory research permit 30 HUS/32/2018 § 16. Isolation of SARS-CoV-2 from a COVID-19 Briefly, a nasopharyngeal swab in 500 μl of Copan UTM® Universal Transport Medium was inoculated on Calu-3 cells (P1) and incubated for 1 h at 37°C, after which the inoculum was removed and replaced with Minimum Essential Medium supplemented with 2% FBS, L-glutamine, penicillin and streptomycin.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The media was changed in all cell types every 2 days and regularly tested for presence of mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H6021, Sigma-Aldrich), and Alexa 647 fluorescently labelled goat anti-rabbit antibody (Thermo Fisher, cat. A32733)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A32733, RRID:AB_2633282)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, viral NP was detected with an in house developed rabbit polyclonal antibody (31) counterstained with Alexa-647-conjugated goat anti rabbit secondary antibody, and nuclear staining done using Hoechst DNA dye.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti rabbit secondary antibody,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture: VeroE6 (ATCC CRL-1586)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6, VeroE6+TMPRSS2, Caco-2, and Calu-3 cells were maintained in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BSR-T7 cells were derived from BHC cells (42) and grown in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BSR-T7</div><div>suggested: CCLV Cat# CCLV-RIE 0583, RRID:CVCL_RW96)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells stably expressing human ACE2 were generated by transduction with third generation lentivirus pLenti7.3/V5 DEST ACE2-EmGFP (prepared by the cloning facility Dream-Lab, Institute of Biotechnology, University of Helsinki, Helsinki, Finland; the expression of Emerald GFP is driven by the SV40 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In all experiment’s cells were kept at 37oC and 5% (for Vero, Vero+TMRPSS2, and Caco-2 cells) or 7% CO2 (for Calu-3 cells) and media was pre warmed to 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titers were determined by plaque assay in VeroE6+TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6+TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For statistical analysis of the data in Figures 2 B, C and Figure 4 each replicate titration was fitted separately using IgorPro to determine the EC550 for each experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgorPro</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04446377</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of LAM-002A for the Prevention of Progression of COV…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04608266</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">CAMOVID : Evaluation of Efficacy and Safety of Camostat Mesy…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04623021</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study Evaluating the Efficacy and Safety of CKD-314 (Nafab…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04418128</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Efficacy of Nafamostat Mesylate for COVID-19 Pneumo…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.30.21257971: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Collection of serum and PBMC samples: Blood samples from individuals were obtained after recruitment of participants and written informed consent as approved by the ethics committee of Ulm university (99/21).<br>IRB: Collection of serum and PBMC samples: Blood samples from individuals were obtained after recruitment of participants and written informed consent as approved by the ethics committee of Ulm university (99/21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell culture: Vero E6 (African green monkey, female, kidney; CRL-1586, ATCC, RRID:CVCL_0574) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS), 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1x non-essential amino acids.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Longitudinal antibody measurements were analyzed by means of a mixed linear regression model including a random intercept in order to account for the repeated measures structure of the underlying data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Determination of antibody titers: IgG and IgA levels in serum were determined by anti-SARS-CoV-2 assay (Euroimmun), an ELISA which detects antibodies against the SARS-CoV-2 S1 spike domain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 assay ( Euroimmun)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture medium containing anti-VSV-G antibody (I1-hybridoma cells; ATCC no. CRL-2700) was then added to block residual VSV-G-containing particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (LSBio (LifeSpan Cat# LS-C51092-40, RRID:AB_1277788)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Without washing, cells were incubated with surface antibody cocktail (prepared in 1:1 of FACS buffer and brilliant staining buffer) for 30 minutes at room temperature with BV510-anti-human CD14 (clone M5E2), BV510-anti-human CD19 (clone HIB19),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BV510-anti-human CD14</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BV510-anti-human CD19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Vero E6 (African green monkey, female, kidney; CRL-1586, ATCC, RRID:CVCL_0574) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS), 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1x non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>detected: (IZSLER Cat# BS CL 87, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T (human, female, kidney; ACC-635, DSMZ, RRID: CVCL_0063) cells were grown in DMEM with supplementation of 10% FCS, 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day after transfection of HEK293T cells to express the viral glycoprotein, they were inoculated with VSV*ΔG-FLuc and incubated for 1-2 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A replication-deficient VSV vector in which the genetic information for VSV-G was replaced by genes encoding two reporter proteins, enhanced green fluorescent protein and firefly luciferase (FLuc), VSV*ΔG-FLuc 24 (kindly provided by Gert Zimmer, Institute of Virology and Immunology, Mittelhäusern, Switzerland) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results are given as serum dilution resulting in 50% virus neutralization (NT50) on cells, calculated by nonlinear regression ([Inhibitor] vs. normalized response -- Variable slope) in GraphPad Prism Version 9.1.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Up to 100,000 live CD3+ T cells were acquired on a LSRFortessa flow cytometer (BD Biosciences), equipped with FACS Diva software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the acquired data was performed using FlowJo software (version 10.7.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were done by GraphPad Prism version 9.1.1 for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com, R (version 4.0.1) and SAS (version 9.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. the best deal. The Current ... IoT devices. Zapier Database.pythonanywhere whitelistpythonanywhere pricingpythonanywhere uptimepythonanywhere forumpythonanywhere web apphow does pythonanywhere workPeople also search for(function(){var uer=false;(function(){ var a=uer,b=Date.now();if(google.timers&&google.timers.load.t){for(var c=window.innerHeight||document.documentElement.clientHeight,d=window.pageYOffset,e=!1,f=!1,g=document.getElementById("fld"),h=g?g.getBoundingClientRect().top+d:0,k=document.getElementsByTagName("img"),l=0,m=void 0;m=k[l++];){var n=google.c.setup(m,!1,h);if(n&1){if(!google.c.datfo||m.hasAttribute("data-deferred"))e=!0}else n&4&&(f=!0)}a&&(h>=c||!google.c.btfi&&e&&f)&&google.c.ubr(!1,b,h)};}).call(this);})(); function _setImagesSrc(e,d){function f(b){b.onerror=function(){b.style.display="none"};b.src=d}for(var g=0,a=void 0;a=e[g++];){var c=document.getElementById(a)||document.querySelector('img[data-iid="'+a+'"]');c?(a=void 0,(null==(a=google.c)?0:a.setup)&&google.c.setup(c),f(c)):(google.iir=google.iir||{},google.iir[a]=d)}}"undefined"==typeof window.google&&(window.google={});(function(){var s='data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAALgAAAC4CAYAAABQMybHAAAWd0lEQVR4nO2debRcRZ2Av6p7e3vdb23eCyEJL7ImJBIUCLsKAyoGWRxgPEdxRBblyBx1FpVxmBlEBPVkODIedFAP5ogzzjAjIsvIMmM4KEEghAAvCS8MZiN7v/31em/V/NF5I2ZI8vptfau6Pk7zD5x3q+/9+nerflX1K5H97OgIDoel+EC63o1wOKYLWe8GOBzTiRPcYTVOcIfVOMEdVuMEd1iNE9xhNU5wh9U4wR1W4wR3WI0T3GE1TnCH1TjBHVbjBHdYjRPcYTVOcIfVOMEdVuMEd1iNE9xhNU5wh9X49W5AVAg1FBUUAXS9WzNBBCSBpARP1Lsx0aAhBQ80DAZAQNVsDTIjuOAIQUdakE7Uu4W1ozXky5Ab1azcqSkPaxBUTfeh1Qe/AaVvGMGVhv4KUNbE04IvneFx9kKPE7ol3bOkdREv1LBll6Jns+Lp9SF3Ph9SGdEQF7THQFr2fQ+EyH521NQX8rioaBgqAgJuPd/j8rNiLJjXmEOPDVsV9/+6wt8+GQLQkoSY5aJbK7jS0F+EVBJWfDTGFefE6t2kSPHvT1e44f4Ke0ehPWlvRLdS8FwFqMB9H4/xsfOc2Afjvv+ucNV9FYhB1sJbZdW7WgO5Yc2nFkvy32tyco+Dj58XI/+9Jq5eLMkNa2MTSAfCmgheUjAyonn4xgTLljbM2HlKeeS5gIu+UyKTESQsCX1WfI1cAFLCluUpJ/ckWLbUZ8vyFAjIhfVuzdRgvOC5AE5oFuz8hybmdRr/derOvE7J7jubWJgR5IJ6t2byGG1ELoDFLYK130iRite7NfaQisPL30ixuMV8yY0VvKCgKw4v3p7CN/ZbRBdfVu9tV7x6r03FSDWUhnxB8+qtKWJevVtjLzEPXrk1Rb6gUYamIowckfUPaZ7+cpLO1qmbnSiXy+TzecrlMmEYIoTA8zwSiQRNTU34vpG3atJ0tQp+/ZdJzr6jSHYK7/dMYdxTy5Xgpgt8zl40+dA9PDzMnj176O/vJwgChBAI8YcPUWuN1pp4PE5HRwddXV2kUqlJX9skzlrk8dcX+Hz96ZCsYQvRjMqDVzRoAUPfaZrU3+nv72fz5s2Uy2WklP9P6gOhlEIpRSaTobu7m0wmM6l2mEbrjXnQZq1fMaoPPjSq+cV1E0+XhGHIunXr6O3tJQgCPM8bt9wAUkp836dQKNDT08Prr78+4baYyM+vizNkTjwEDBJ8NISzj5S8b8nEelVDQ0OsXr2afD6P7/s1ib0/Qgh836e/v5/Vq1dTKpUm/LdM4twlPu/tlowYNAlkjODFgmb5xyYWvXO5HOvXr685Yh8KKSVaa9auXcvo6OiU/d0o862PxSkVzIniRgheVHDiLMnS42sfWA4MDLBx48Zpy4KMZVt6enooFovTco0ocepxHksOlxQNyY0bIfhoGW6+qHZBy+Uyvb29xGLTv6pQSklPTw9amxPdJsrfLPMZLde7FePDCMEpaS46vXZJN2zYgJQz8xWFECil6O3tnZHr1ZOLTo9ByYwfcuQF7wvhiiUeyRr93rVrF8VicUr73IdCSsnAwABDQ0Mzds16kIzBlUs8+gwYbEZecF2Bj5xSe99769ateN7Mz+N7nsemTZtm/LozzUdO9dCVerfi0ERecALN0gW1ibp7926Uqs8oSAhBoVBgZGSkLtefKU45zqvW34g4kRZcA0jBUYfX1sxdu3bNWN/77fA8j927d9ft+jPB0bMlSBH5LW6RFryo4Kw5tfWhwzAkn8/PaN97f4QQ9PX11e36M8U5c0Xk04WRFjyv4OQaa5gMDQ3VVe4xwjC0Pi/+rrmSvBN8Eig48rDaZB0dHY2E4EII8vl8vZsxrRx5mAAn+CTQ0J6pTdZSqRQZwW1fo9KeEZEvVBp5wZtrXH8chtFJzgaB4RsaD0FzAif4ZKk1GEdpqjxKbZkOTCj3Fm3BRbUkcC3UY3LnQESpLdPBaJlqieYIE3nBB/K1RcF4PB6ZyBmP213LYiCvneCTQsCO/tpkbWqa3Ha2qUJrHZm2TBc7+53gkyIuoWd7bYJnMpm6TdPvTzqdrncTppV1OzSxSBsUccGbJDy0uTZZk8nkjKz/Phhaa5qbm+vahpngwU2KdKQNirjgngDymr2DtUXxzs7OukZxpRRdXV11u/5MsGdQQ15H/uiXSAsOQEywemNtue3Zs2fXVXApJdlstm7XnwlefD00on5E9AX34Ym1tQnu+37dongYhsybN2/GrzvTPPFSaETZqMgL3u7D8lW1z07Onz9/6htzCMYqYM2aNWvGrz3TLF8V0u4EnzxSAKHmmXW1SS6l5JhjjpnR6fIwDFmwYMGMXa9e/KYnhFC7mcwpIyG4+7Ha90e1t7dz+OGHz8j6lCAIOOqoo0gmk9N+rXrz3ccrkDDAbgwRPOvDT9aEbO+rfYayu7ubjo6OaZU8CALmzp1LZ2fntF0jKuzo0/zkxZCsAd0TMERwAFKCb/7HxIpxHHPMMcyaNWtauitBEDB//nzmzJkz5X87inzrZ2VoMiN6g0GCZ2Pw7acCtu6dWGaku7ubY489ljAMpyS7MvY3Fi9e3BCDSoCtexR3rgyMOk/TGMEBvGbBDfdMfBNBR0cHp5xyCh0dHQRBULPoWmuUUgRBwKxZszj55JOtn45/Kzd8v4TXbE70BsPqgwPkRjQPXJ/g0jMn1wmsVCrs2LGDPXv2/N+JDsDbFsCHasROJBJ0dnYye/bsuu7arwc/fybgsntKZGvcYVVvjBNcAf3Dmtx3muiYomiSz+cZHh7+gyNMoDphNHaESUtLC4mEYccbTBF9w5rsjXnam4VZr3wMFBxgJIQFrYKX7miso0TqxUlfKrBhSJMxcP+GaT9IADIerO3TfPLbdpdliAKfvKvI2n4z5QZDBQfIxmHFy4qbVti9c72efHlFiRVrFVmDNyYZKzhANgV3rAyc5NPATStKfGNlQNbwXqDRggNk04I7ngq5+i7XXZkqrr6ryB1PhWTTZmVM3g7jBQfINsGPXlW8+6YCfSPGjZkjQ9+I5t03FfjRq4qsJdtJrRAcqn3ynoFqOuuR5+wuuDMdPLgqIHtjvnoPDe5z74+RacKDoTT0j2ouPt7ju9cnOCJr/mt2Otnep7nhnhK/2BDSnhZGLIGtBesEH6MvBD2s+fIFPl+4NE6XgeesTye7BzTf/FmZ5b8KICPIGpoGPBTWCj5GrgLkNVcv9fjM+2MTOorQJp57LeR7j1W494UQUsKohVMTwXrBx8gFVE8Giwm+crbHHy3xeNcxHm0WZAoOxsCoZs3rIU+uDfn6b0Ioa0gIY9ZzT5aGEXyMUMNAAFSAQJNpEXz4KMnC2YLZ7ZK2NMR8UXPRz3qjgUpFMzAKO/oVG3ZqHvwfxeiwrtbfiEGbT+TLPEw1DSf4/gQaBhXVVVyKqimm3hGx7yOrn1YJfoMJvT8N8qI6ML6gOsBq7K65tViTB3c43g4nuMNqnOAOq3GCO6zGCe6wGie4w2qc4A6rcYI7rMYJ7rAaJ7jDapzgDqtxgjusxgnusBonuMNqnOAOq3GCO6zGCe6wmobe0RNoGAwBJf5wy5rJvGXLGlLT6jX2trWGE3w4hHJFQAXmdmguPS7guLkhRxym6GhRNCU1CUMrO5UqkC8IcoOSnTlJ7zaPJ3t9tvUL8CEe0zQ32Na8hhA80DBYFlCGy5YEfGhpmZOOr3B4VqFUtRqWVqIavLW5QVzs+5cAhKwe1HqrhJ05yUsbYjz6fJwH1voQh9a4bojIbvWu+kDDYFHQldZ88cISHzizRFtGUQkFKqyK3QhIAdKDmKcZGJE8tirB7Y8kyOUFbUltdSkJKwXXQF9J0JbQ3H5FkQ+eUUQIqAQCbd23rQ0hIOZXb8ITv03w+X9JMVoWdCQ0NnpuneAlBSOjgpsvLvHJiwpIoQkCYWy3YzqJ+RqlBSseSfHVBxNk0pqEZXk1qwTPlQQL2xX/9GcjzD8ipFR2EftQCAGJuGbTDo/r78qwoV+STdhz06z5veZGBdecWuHR2waZ06kolpzc40FrKJYEcw5T/Odtg1xzaoXcqD2dFSsEzw0Kbr+8yC3XjRAEgnDyJ3U3HKGCIBDccu0It19eJDdoh+TGpwlzQ4J7rs/zobNK5At2PJR6oTXki4KrLiyQbVFc//0msi1mvwaNjuC5IcHdnypw4Zkl8kUn91SRLwouPLPE3Z8qkBsy+74aK3guL/j7y0pc/J4ihZLZDyGKFEqCi99T5O8vK5HLm3t/jeyi5Cpw5ZKAay/JN1zkFgikEEghEQhA75uB1QhRrZ+s0SitUVqN/dcJkS8Krr0kT88Wj/vXeUaeBmFcmrCiISbh2W8OAjRMpkQKSUx4DAajbBx5k02F3Wwr95GrjFBUFTSQkB4dfpoj4h3MT3VybHoOh8VbCXRIqCc28h47COC0L7YSKvMWbhkneG5Y8NBNIyx6R0AQ1rs1048Ugpjw6R19k6f6XmVjcSc+Hp6QSCEQ++L4GGoseqOo6JC58Q7e276IE1veQajVhET3PVi/yWfZbRnjBp1GCZ6rwHWnBPzdNSMN0TWJSZ89pQHu3/kbtpT7SAofT9Q2bFJoSiqgzU9xRddZHJ2eTUlVam5LKqn56g8zfP8F36iuijGCa6AvL3jlzkGScW191yQhYzyVe4WHcy+SkrGaxd4fhSYfljmz5VguOfx0AlVb/1wIKJYF7/x8Kx1pc9atGJNF6SsLbl5WoiWtrJZbUI3c/7x9JY/2rSHjJSYtN4BEkPESPD/yBndvfhSN3q9zc3C0hpa04uaLSvSVTdHbEME1QAX+5PxidbOCxcRkjBXbnuTV0W00yanfeZEQPrsqg/zjlocBapK8XBFceX4RKuasmTdC8L4KfOacMi0Zu6N3QsZ4YOcz9BZ2kpDTl8H1hcdAkOfeN58gVsN1tIbWjOIz55Tpq70bXxeMEJyS4JJzSlQsjt6+8Hhl+HesGtpIUk7/KC4mPDYV9/Lk3jXEa5C8UhFcek4JDJlci7zggYauFs3iowNrF1EJBCVV4V93PUPaS8zYdZMyxuN9L7O7NIgc58m3oYJFRwd0tWgCA96mkRd8MICrTqsQWpzz9qXHf+VeApjx7ERKxnhw97PExPijeBjCJ04vMxhMY8OmiMgLTiBYekIFpcx4JdaKQFAIS/x68DViYua3vHtCsrGwi23FveOO4koJTl0YQBD9ZxJ9wUM4vtve7oknJGsGX8efglTgRElKn98OvIY3zh9YqKrPBAPeqpEWPNTQ2aLpaLU3e+IJyerhN/DrEL1/3waPNSOb0OO8yVpDR6uis0UTRvy5RFrwgoIzjjQgTEwQgWAkLPBmeQBZx7lBAVR0WFM3BeCMeSGFiL9ZIy14ScH8TsUEF8JFHiEEO4v9dZV7DF9IthdziHEqoRXM71KUIv5sIi04GjpalDGzZrUiEOwtD9UUNae9LeP8/zXVZxP1hxNxwQXNKXvXfAtgNCxEIoILBMNh4fcLwA+B1tCcAnT9234woi04kIhZavc+yjoaYwwBlFVtiW0Tnk3kBbd9U4MfoUdQa6rShGcTnbv7dggYLojxvjWNJOUlJrVvcqrQaJpqWCYgBAwXxcxPvdZIxAXXDI5Gu4mTQaPJxptRERhkKDTZWPO4c+EAgyMSRP3bfjAibY8vYOteaW0EV1ozK9FOSP1zbaHWHJHMMt6clRCwba+I/CbkSAveJOGlbRIZ6VZOHI2mPdZMu5euezdFo5mX6kSPc9JBSnhhi0dTxJ9NpJvnS3htj2Q4b28/XGnFu5rnE9RxNivUigWp2SRkfFw/MyFgOC94PSfxI21QxAUfO5Ljja2+tVE81IqTW4+lWGOKbiop64DT244nHGfKUsrqMyH6Y8xoCw6Ar1nT6+PJaA9mJopG0xlvZXF6zoSL80wGhabNT7MgM2/c1/ek5sXXfPCj/0wiL3jGhweei+NbfDpYRQUs6zyVgp75jY4FVebSzqU1/bh8D37+fJyMAYX/Ii94QsKLWyVbd3nWdlMUmsPiLZzftpjiBIryTJSKDlncNLem6C0lbN3l8eJWacRxJwY0EUhqHns2ge9F/5U4Ucoq4P2d72ZOvH1GBpwKTUL4XDn7PTVN0fue5perEpA041kYIXhbDG55PE6ooj+omQwVFXLN3PeTlLFp7Y8rNBUdcsO8C/GEHHeKUgBKwe1PxmkzpHybEYJ7AnRZ8PizSXwDBjYTRaPxpeRz3R+myYtTmYaFWKFWKK353LxltMXSqFr63r7ml6uSlEvCmLM1jalNGOhqXvyF5QPWHwsohUBpzX3bf0VvYScpGZ+SN1dJBWRjGa6dewFpL1nTW0IAfkxz0hfaQJtTRtmICA7VG5orCH76eIp43Ga9q1P4AsE1cz/AH3eeRlkHlHUw4R91RYeMqhLntp/AF+ZfQpNM1NwFisc1P30sxWAx+tPzb8WYCA77KsyOCl741iBtGY2q/xKOaccXHmVV4em+HlYOrkNrjS88PLF/ZfDfM3bCQ6AVAYrTm4/m3OwSWmNpKhOYUJISBkcEJ/+VWZVlwTDBAYZDOPMIxY+/MkShAWqEQ3W3jS8kIZoNI1vZMLKV3sJOBsM8by2Br9EoNM0yyVGpLham53JCczcJGSNQ4YTXu6SSmqtua+GZ7ZJmw+YjDEjV/yHNHqzc5HHvQymu/nChISTX+7IeAAsz81jU3I0ACmGZ4SC/L3euiYsYzX6KJj8JVNe5KK0nFLXHSCU19z6UYuUmj2zKqFgIGBjBx8gNCf7tz0dZuqhsfUnlAzEWud+6EE1rpmxlYjymeb4nzhXL02RbjdTEnEHm/nS0aK68M80b23xiFqcOD4be90/1RLXqZ6rkjvmaN970ueLONB2Gyg0GCy6AtozmvK81s2m7T9yADbCmEI9pNu3wOe/WZtoyZg0q98dYwaE6AdSa1Jz71WbW/84nYXn6cCZIxDXrf+dz7i3NtCa1MRM6B8JowaGaH29LaS78WjO/XJWgKaWt3RwxnQgBTanqOpMLv9ZMW0oble8+EMYLDtVI3tGi+fQPm7jlBxmEwOrltVON71UFv+UHGT79wyY6WsyP3GMYm0U5ELkydCXhnk+PcsrCCsWyaIgJoYkgJSTjmhfWx7jhnjQ7CpCd+nOv6op1gkP1uO+hEcHlJwX8xUfzzJ0VUi4La2uM14onqwPJzTs9vn1/E/ev8WnJaGKWRO23YqXgY/QHoPKCj59W4RMfLHLCOwIqAYSq8aK6lNWtZjEf1r3h8+PHkvz4tzFkk6bduOm+8WO14GPkAqAoOHG24k/fV+KMEyvM7QrRurq+WWmB3lcoNQI1eCaF2LcRWEiQQiPlvhomuz1WrY2x4qkEL++QkNRkLRZ7jIYQfIyyguGKgDIc2aFY9s6ARfNDumeHdHUoWtKKpqTGM3ToHSrIlwRDI5LdfZLNOzzWbfJ4+FWfLTkJccjEtBFbzaaKhhL8rQS6eoIboQBF9SP2fUzdGheKfa8hqvkxCXiaVt+c9dtTTQO8pN4eX0A2Buw3A2qo2vswe9ZxOmhYwQ+EE8QuGqg35mhEnOAOq3GCO6zGCe6wGie4w2qc4A6rcYI7rMYJ7rAaJ7jDapzgDqtxgjusxgnusBonuMNqnOAOq3GCO6zGCe6wGie4w2qc4A6rcYI7rMYHNte7EQ7HPqZ8z/f/Ag/1T1USnr5xAAAAAElFTkSuQmCC';var ii=['tsuid11'];_setImagesSrc(ii,s);})();.hlcw0c{margin-bottom:44px}.oIk2Cb{margin:0}.y6Uyqe{margin-left:-8px;margin-right:-8px;padding:6px 0 0 0}.O3JH7{color:#202124;font-size:20px;margin-bottom:16px;}#center_col .O3JH7{font-size:22px;line-height:28px;margin-bottom:8px}#botstuff .O3JH7{font-size:22px}#botstuff .O3JH7{line-height:28px}.EIaa9b{display:flex}.AJLUJb{display:flex;flex:1;flex-direction:column}.k8XOCe{align-items:center;background-color:#f1f3f4;border-radius:100px;box-sizing:border-box;display:flex;margin:4px 8px;max-height:none;min-height:48px;padding:0 17px;position:relative}.k8XOCe:hover,.k8XOCe:active{color:#202124}.s75CSd{-webkit-box-orient:vertical;color:#202124;display:-webkit-box;flex:1;font-size:16px;-webkit-line-clamp:2;max-width:227px;overflow-wrap:break-word;overflow:hidden}.aXBZVd{background-image:url("data:image/svg+xml,%3Csvg xmlns='http://www.w3.org/2000/svg' width='24' height='24' viewBox='0 0 24 24'%3E%3Cpath fill='rgba(0,0,0,.54)' d='M20.49 19l-5.73-5.73C15.53 12.2 16 10.91 16 9.5 16 5.91 13.09 3 9.5 3S3 5.91 3 9.5 5.91 16 9.5 16c1.41 0 2.7-.47 3.77-1.24L19 20.49 20.49 19zM5 9.5C5 7.01 7.01 5 9.5 5S14 7.01 14 9.5 11.99 14 9.5 14 5 11.99 5 9.5z'/%3E%3C/svg%3E");background-position:center;background-repeat:no-repeat;background-size:20px;border-radius:4px;height:20px;padding:10px;width:20px}.AaVjTc a:link{display:block;color:#4285f4;font-weight:normal}.AaVjTc td{padding:0;text-align:center}.d6cvqb{font-weight:bold}.YyVfkd{color:rgba(0,0,0,.87);font-weight:normal;}.SJajHc{background:url(/images/nav_logo323_hr.webp) no-repeat;background-size:167px;overflow:hidden;background-position:0 0;height:40px;display:block}.NVbCr{cursor:pointer}

      @phil

    1. SciScore for 10.1101/2021.05.28.446065: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Further ethics approvals were provided by the Mater Health Services Human Research Ethics Committee (Reference: HREC-15-MHS-52) and the University of Queensland Medical Research Review Committee (Reference:</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hepatocellular carcinoma patient samples: Liver tumour and non-tumour tissue were previously obtained from a HBV-positive patient (HCC32, male, 73yrs) who underwent surgical resection at the Centre Hepatobiliaire, Paul-Brousse Hospital, and made available for research purposes with approval from the French Institute of Medical Research and Health (Reference: 11-047).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Viral titration was determined by immuno-plaque assay (iPA), as previously described54.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection of HEK293T cells: HEK293T cells and African green monkey kidney cells (Vero E6) were maintained in standard Dulbecco’s Modified Eagle Medium (DMEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T viral infection was undertaken as follows: 3×106 HEK293T cells were seeded onto 6-well plates pre-coated with polylysine one day before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">350-500ng of each prepared library was sequenced separately on one PromethION (Oxford Nanopore Technologies) flow cell (FLO-PRO002, R9.4.1 chemistry) (Supplementary Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PromethION</div><div>suggested: (PromethION, RRID:SCR_017987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data were deposited in the Sequence Read Archive (SRA) under project PRJEB44816.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequence Read Archive</div><div>suggested: (DDBJ Sequence Read Archive, RRID:SCR_001370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ONT bioinformatic analyses: To call non-reference insertions with TLDR23, ONT reads generated here, by Zhang et al.29, and by our previous ONT study of human tissues23 (Supplementary Table 1) were aligned to the human reference genome build hg38 using minimap255 version 2.17 (index parameter: -x map-ont; alignment parameters: -ax map-ont -L -t 32) and samtools56 version 1.12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools56</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">fa were counted with samtools idxstats.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR primers for the HBV insertion 3’ junction (Fig. 2b and Supplementary Table 2) were designed with Primer3 using the reference genome and closest match HBV sequence (Genbank accession AB602818) as inputs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer3</div><div>suggested: (Primer3, RRID:SCR_003139)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.31.445667: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 mg of cell lysate was cleared with protein A magnetic beads to remove non-specific interactions (S1425S, NEB) and incubated overnight with anti-ZAP antibody (Proteintech 16820-1-AP) or anti-IgG from rabbit as a control (Cell Signaling, a gift from Dr. Mathias Munschauer, HIRI-HZI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ZAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After transfer using Trans-Blot (Bio-Rad), nitrocellulose membranes were developed using the following primary antibodies: anti-His-tag (ab18184), anti-DDDDK (ab49763), anti-ALFA (FluoTag®-X2 anti-ALFA AlexaFluor 647), anti-ZC3HAV1 (Proteintech 16820-1-AP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ALFA</div><div>suggested: (Antibodies-Online Cat# ABIN125862, RRID:AB_11186338)</div></div><div style="margin-bottom:8px"><div>anti-ZC3HAV1</div><div>suggested: (Proteintech Cat# 16820-1-AP, RRID:AB_2728733)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following secondary antibodies were used: IRDye® 800CW Goat anti-rabbit and IRDye® 680RD Donkey anti-Mouse (both LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-68073, RRID:AB_10954442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nitrocellulose membranes were developed using anti-DDDDK primary (Abcam ab49763) and IRDye® 680RD donkey anti-mouse secondary antibody (LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DDDDK</div><div>suggested: (Abcam Cat# ab49763, RRID:AB_869428)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the experiments, optical tweezers (OT) constructs were mixed with 4 μl of polystyrene beads coated with antibodies against digoxigenin (AD beads, 0.1% v/v suspension, Ø 1.76 μm, Spherotech), 10 μl of assay buffer (20 mM HEPES, pH 7.6, 300 mM KCl, 5 mM MgCl2, 5 mM DTT and 0.05% Tween) and 1 μl of RNase inhibitor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>digoxigenin</div><div>suggested: (Millipore Cat# AQ300D, RRID:AB_11212694)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (ATCC HTB-55) were cultured in MEM (Sigma) supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The supernatant was used to transduce naïve Huh7 cells in the presence of 10 μg/ml polybrene (Merck Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was raised for two passages on Caco-2 cells (HZI Braunschweig).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To study the effect of ZAP-S on SARS-CoV-2 infection, Huh-7 cells were employed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were infected with 200000 pfu/ml, corresponding to an MOI of 0.03 at 24h post-infection, cell culture supernatants were collected and titrated by plaque assay on Vero E6 cells (ATCC CRL-1586).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polysome profiling analysis: A plasmid expressing ZAP-S N-terminally tagged with a His-tag was transfected into HEK293 cells using PEI, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To check endogenous ZAP-S expression, HEK cells were transfected with a plasmid containing the same backbone and His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TFRC (NM_003234.4), ZAP (NM_024625.4) and ZNF346 (NM_012279.4) were placed in frame with the coding sequence for ECFP in pFlp-Bac-to-Mam (gift from Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFlp-Bac-to-Mam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-coding sequences were introduced by Golden Gate Assembly using AarI cut sites 69. pET-SUMO-GFP (gift from Prof. Utz Fischer, Julius-Maximilians-University, Würzburg, Germany) was used as the parental vectors for protein overexpression in E. coli.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-SUMO-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Optical tweezers constructs were based on the wild type SARS-CoV-2 frameshifting site (nucleotides 13475-13541) cloned into the plasmid pMZ_lambda_OT, which encodes for the optical tweezer handle sequences (2Kb each) flanking the RNA structure (130 nt).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMZ_lambda_OT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV-G envelope pseudo-typed lentivirus for the generation of stable cell lines was produced by co-transfection of each transfer plasmid with pCMVdR 8.91 71 and pCMV-VSV-G (gift from Prof. Weinberg, Addgene plasmid # 8454 72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNAs were labeled at the 3’ end using pCp-Cy5 (Cytidine-5’-phosphate-3’-(</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCp-Cy5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed with FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands corresponding to the –1 or 0-frame products, 58 kDa and 33 kDa respectively, on western blots of in vitro translations were quantified densitometrically using ImageJ software 74.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were plotted using GraphPad Prism 8.4.3 software. Microscopy: HEK293 cells were cultured on glass slides and transfected as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were plotted using Prism 8.0.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data are available in the main text, the supplementary materials as well as in Mendeley Data: DOI: 10.17632/c7rbxb86k2.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mendeley</div><div>suggested: (Mendeley Data, RRID:SCR_002750)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT811</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.31.446386: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the transfer, the membrane was blocked in 1% Casein in PBS (Thermo Scientific) and stained using primary antibodies directed against SARS-CoV-2 S (1:1,000, Biozol, 1A9, #GTX632604), ACE2 (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, VSV-M (1:2,000, Absolute Antibody, 23H12, #Ab01404-2.0), V5-tag (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Cell Signaling, #13202), GAPDH (1:1,000, BioLegend, #631401) and Infrared Dye labelled secondary antibodies (1:20,000, LI-CORIRDye).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (BioLegend Cat# 631401, RRID:AB_2247301)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney 293T cells purchased from American type culture collection (ATCC: #CRL3216) were cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM L-glutamine (PANBiotech), 100 μg/ml streptomycin (PANBiotech) and 100 U/ml penicillin (PANBiotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoparticle production: To produce pseudotyped VSVΔG-GFP particles, 6*106 HEK 293 T cells were seeded 18 hours before transfection in 10 cm dishes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stem Cell Culture and Intestinal Differentiation: Human embryonic stem cell line HUES8 (Harvard University, Cambridge, MA) was used with permission from the Robert Koch Institute according to the “79.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUES8</div><div>suggested: RRID:CVCL_B207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">α5β5 integrin blocking: Caco-2 cells were preincubated with the indicated amounts of α5β5 integrin Inhibitor ATN-161 (Sigma) for two hours and infected with 100 μl freshly produced VSVΔG-GFP pseudo particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were preincubated with the indicated amounts of ATN-161 (Sigma) for two hours and infected with SARS-CoV-2 Viral isolate BetaCoV/France/IDF0372/2020 (MOI 0.05, six hours).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression constructs: pCG_SARS-CoV-2-Spike-IRES_eGFP, coding the spike protein of SARS-CoV-2 isolate Wuhan-Hu-1, NCBI reference Sequence YP_009724390.1, was kindly provided by Stefan Pöhlmann (German Primate Center, 473 Göttingen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP and RaTG13-S (synthesized by Baseclear) was PCR amplified and subcloned into a pCG-IRES_eGFP expression construct using the restriction enzymes XbaI and MluI (New England Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicons were assembled with a modified pBeloBAC11 backbone, containing CMV and T7 promotors as well as the HDV ribozyme and bGH polyA signal, using the NEBuilder HiFi DNA Assembly Cloning Kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11</div><div>suggested: RRID:Addgene_60342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assembled DNA was electroporated into E. coli GS1783 strain and resulting clones of pBelo-SARSARS-CoV-2 were confirmed by restriction digestion and next generation sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 ΔS replicon system: HEK293 T cells were seeded in six well format and transfected with 3 μg pBelo-SARSCoV-2-dSpike-GLuc-K2 or pBelo-SARSCoV-2-dSpike-EGFP and 0.25 μg of each expression construct pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro, pCG-ACE2, pCAG-T7-RNA-polymerase and one pCG-vector encoding the spike protein of SARS-CoV-2, RaTG13 or the indicated mutant S respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-GLuc-K2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAG-T7-RNA-polymerase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-vector</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Organoids were imaged using the Cytation 3 cell imaging system and processed with Gen 5 and ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence logos were generated using R packages ggplot2 and ggseqlogo34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.30.446357: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal ethics and animals: Female BALB/c and K18-hACE2 transgenic mice were purchased from the Animal Resources Centre (Perth, Australia) and housed in pathogen-free conditions at the Australian Institute for Bioengineering and Nanotechnology or Griffith University.<br>Euthanasia Agents: Mice received 1 or 2 immunizations, 21 days apart, and were challenged with 1 x 104 PFU of SARS-CoV-2 (VIC01 isolate) 21 days after the final immunization via intranasal inoculation (20 μL total volume) while under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal ethics and animals: Female BALB/c and K18-hACE2 transgenic mice were purchased from the Animal Resources Centre (Perth, Australia) and housed in pathogen-free conditions at the Australian Institute for Bioengineering and Nanotechnology or Griffith University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of BALB/c mice: Naïve 6-8 week old female BALB/c mice were randomly divided into 6 groups of 8 mice and vaccinated either via HD-MAP application or intradermal injection with 2 μg of SARS-CoV-2 S HexaPro, 2 μg of SARS-CoV-2 S HexaPro with the adjuvant QS21 (Desert King), or vehicle only control.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">A lung lobe and brain hemisphere from each animal was fixed in 10% neutral buffered formalin and processed for paraffin embedding and hematoxylin-eosin stained sections were examined by a veterinary pathologist blinded to the treatments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, relevant HRP-conjugated secondary antibodies were added (goat anti-mouse or anti-human, diluted 1:2000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum binding was detected using an HRP-linked goat anti-mouse secondary antibody and TMB substrate as discussed previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 80% acetone 14-16 hours post-infection and allowed to dry prior to plaque visualization with SARS-CoV-2 spike-specific mAbs CR3022 or S309 and IRDye 800CW-conjugated goat anti-human secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>anti-human secondary antibodies .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were purchased from the American Type Culture Collection (ATCC) (catalog: ATCC CRL-1586) and cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplicated with 10% fetal bovine serum (Bovogen, USA), penicillin (100 U/mL) and streptomycin (100 μg/mL) at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal ethics and animals: Female BALB/c and K18-hACE2 transgenic mice were purchased from the Animal Resources Centre (Perth, Australia) and housed in pathogen-free conditions at the Australian Institute for Bioengineering and Nanotechnology or Griffith University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_154754)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism 9 software was used for statistical analysis and generation of graphs and figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.01.446491: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human Subjects: All protocols used for subject recruitment, enrollment, blood collection, sample processing and immunological assays with human samples were approved by the Northwestern University Institutional review board (STU00212583).<br>Consent: All participants voluntarily enrolled in the study by signing an informed consent form after receiving detailed information of the clinical study.<br>IACUC: All mouse experiments with BL2 agents were performed with approval from the Northwestern University Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were purchased from Jackson laboratories (approximately half males and half females) and housed at the Northwestern University Center for Comparative Medicine (CCM) or the University of Illinois at Chicago (UIC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-specific ELISA (SARS-CoV-2 spike, RBD, nucleocapsid; SARS-CoV- 1 spike; OC43 spike): Antigen-specific total antibody titers were measured by ELISA as described previously (Dangi et al., 2020; Palacio et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific total</div><div>suggested: (George Fu Gao; Chinese Academy of Sciences; Beijing; China Cat# Z3L1, RRID:AB_2725798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with wash buffer followed by addition of secondary antibody conjugated to horseradish peroxidase, goat anti-mouse IgG (Southern Biotech) diluted in blocking solution (1:1000) at 100 µl/well were added and incubated for 60 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with fluorescently-labelled antibodies against CD44 (IM7 on Pacific Blue), CD8α (53- 6.7 on PerCP-Cy5.5), IFNγ (XMG1.2 on APC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8α</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescently-labelled antibodies were purchased from BD Pharmingen, except for anti-CD44 (which was from Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD44</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 (MA10) was propagated and tittered on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus propagation: OC43 was propagated in an 80-90% confluent monolayer of HCT-8 cells (ATCC® CCL-244™) in T175 flasks at a multiplicity of infection (MOI) of 0.01 diluted in 5 mL of RPMI supplemented with 2% FBS, 1% penicillin/streptomycin, and 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus neutralization assays: A SARS-CoV-2 pseudovirus was generated by transfection of HEK-293T cells with a pCAGGS vector expressing the SARS-CoV-2 spike glycoprotein (BEI resources, NIAID, NIH: NR-52310).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers were measured by infecting HEK-293T-hACE2 cells and counting GFP foci under a fluorescence microscope after 24 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice, vaccinations, infections and challenges: 6-8-week-old C57BL/6, BALB/c, A/J, Ifnar1-/- mice (on a C57BL/6 background) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A/J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ifnar1-/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vector pCAGGS containing the SARS-related coronavirus 2, Wuhan-Hu-1 spike glycoprotein gene (soluble, stabilized), NR-52394 and receptor binding domain (RBD), NR-52309.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was collected by phlebotomy using BD Vacutainer 10mL tubes containing sodium heparin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Vacutainer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry samples were acquired with a Becton Dickinson Canto II or an LSRII and analyzed using FlowJo (Treestar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TCR analyses were performed using the scRepertoire package30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scRepertoire</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using Prism (Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our study is that we only evaluated heterologous immune protection at an early time post-vaccination or post-infection, and it is possible that cross-protective immunity declines over time. Future studies will determine whether cross-reactive antibodies are produced by plasma cells, or short-lived plasmablasts, which tend to be highly mutated and cross-reactive21, 22. In summary, we show that coronavirus vaccines and coronavirus infections can confer protection against other coronaviruses. These findings provide a framework for the rational design of universal coronavirus vaccines, and present the first definitive demonstration of heterologous immune protection following coronavirus vaccination or infection.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.28.446155: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Donors provided written informed consent (Ethical approval: PV4780).<br>Euthanasia Agents: After 30 min mice were sacrificed by cervical dislocation and tissue samples were collected as described.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse model: C57Bl/6 mice of both sexes were anesthetized by intraperitoneal injection of ketamine (120 μg/g BW) and xylazine (16 μg/g BW in saline, 10 μl/g BW) and 50 μl ChAdOx1 nCov-19 vaccine were intradermally injected into the dorsal region.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse model: C57Bl/6 mice of both sexes were anesthetized by intraperitoneal injection of ketamine (120 μg/g BW) and xylazine (16 μg/g BW in saline, 10 μl/g BW) and 50 μl ChAdOx1 nCov-19 vaccine were intradermally injected into the dorsal region.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Design of primers and probe for digital PCR: PCR primers and probes were designed with Primer Express version 3.0.1 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer Express</div><div>suggested: (Primer Express, RRID:SCR_014326)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.29.443900: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Research protocol was approved and performed in accordance with Scripps Research IACUC Protocol #20-0003.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, yeast cells were stained with FITC-conjugated chicken anti-C-Myc antibody (Immunology Consultants Laboratory, CMYC-45F), AF405-conjugated anti-V5 antibody (made in house), and streptavidin-APC (Invitrogen, SA1005) in 1:100 dilution for 20 min at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-C-Myc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SA1005</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the neutralization assay, antibody samples were serially diluted with complete DMEM medium (Corning, 15-013-CV) containing 10% FBS (Omega Scientific, FB-02), 2 mM L-Glutamine (Corning, 25-005-Cl), and 100 U/mL of Penicillin/Streptomycin (Corning, 30-002-C).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>25-005-Cl</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, alkaline phosphatase-conjugated goat anti-human IgG Fcy secondary antibody (Jackson ImmunoResearch, 109-055-008) was added in 1:1000 dilution and incubated for 1h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal study: Groups of twelve 6-8 week old Syrian hamsters were put into 6 treatment groups who each received an intraperitoneal (i.p.) infusion of either 10 mg, 2 mg, 0.5 mg, or 0.125 mg per animal of the eCR3022.7 monoclonal antibody or 10 mg per animal of the parental CR3022 monoclonal antibody or 10 mg per animal of an anti-dengue isotype matched control antibody (Den3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dengue isotype matched control</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Den3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast cells were firstly spun down and washed with PBS/1% BSA, then incubated with biotinylated SARS-CoV-2 RBD or S or HEK cell membrane protein at several non-depleting concentrations respectively for at least 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the mixture was transferred onto HEK 293T cells (ATCC, CRL-3216) in a 10 cm2 culture dish (Corning, 430293).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After that, 50 μL of Hela-hACE2 cells were added at 10,000 cells/well onto each well of the plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 neutralization assay: Vero E6 cells were seeded in 96-well half-well plates at approximately 8000 cells/well in a total volume of 50 μL complete DMEM medium the day prior to the addition antibody and virus mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEp2 epithelial cell polyreactive assay: Reactivity to human epithelial type 2 (HEp2) cells was determined by indirect immunofluorescence on HEp2 slides (Hemagen, 902360) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEp2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homogenized organs were titrated 1:10 over 6 steps and layered over Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The libraries were displayed on the surface of yeast as molecular Fab using the pYDSI vector, a yeast display vector containing the bidirectional Gal1-10 promoter that was based on the design of a previously described vector (Wang et al., 2018), omitting the leucine-zipper dimerization domains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYDSI</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, 12.5 μg of MLV gag/pol backbone (Addgene, 14887), 10 μg of MLV-CMV-Luciferase plasmid, and 2.5 μg of SARS-CoV-2-d18 spike plasmid were incubated with transfection reagent Lipofectamine 2000 (Thermo Fisher, 11668027) following manufacturer’s instructions for 20 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MLV-CMV-Luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the heavy and light chains were cloned into phCMV3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paired FASTQs were checked for sequence quality using the FastQC package (FastQC v0.11.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Merged reads with full sequence identity were clustered using VSEARCH (v2.15.1) (Rognes et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSEARCH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pacbio sequencing: Long Amp Taq Polymerase (New England Biolabs) was used to PCR amplify Plasmid DNA after sort 4 according to manufacturer’s protocol with the following primers: First round PCR products were purified with SPRI beads (Beckman Coulter) and 10 uL of purified PCR product was used in a second round of index PCR with the following primers: DNA sample was again purified with SPRI beads, then submitted to GeneWiz, where a PacBio SMRTbell amplicon library was prepared per the manufacturer’s protocol and sequenced on the PacBio Sequel platform with v3.0 chemistry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneWiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence data that support the findings in this study are available at the NCBI Sequencing Read Archive (www.ncbi.nlm.nih.gov/sra) under BioProject number PRJNAXXXXXX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequencing Read Archive</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python code will be available on github.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization IC50 values were calculated using “One-Site Fit LogIC50” regression in GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, we plotted a standard curve of serially diluted virus (3000, 1000, 333, 111, 37, 12, 4, 1 PFU) versus RLU using four-parameter logistic regression (GraphPad Prism 8.0) below:

      (y: RLU, x: PFU, a,b,c and x0 are parameters fitted by standard curve) To convert sample RLU into PFU, use the equation below: (if y < a then x = 0)

      Percentage neutralization was calculated by the following equation:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (Emsley et al., 2010) and PHENIX (Adams et al., 2010), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>


      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 26. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.28.446163: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Near infra-red (NIR) secondary antibodies, IRDye® 680RD Goat anti-mouse (abcam; ab216776) and IRDye® 800CW Goat anti-rabbit (abcam; ab216773) were subsequently used to probe membranes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was isolated by inoculating 100 μL of neat swab material onto Vero cells, incubating at 37°C for 1 h before replacing with growth media supplemented with 1x penicillin/streptomycin and 1x amphotericin B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolates were passaged a further two times in Vero E6-ACE2-TMPRSS2 cells (17), the supernatant clarified by centrifugation and concentration for western blot analysis viruses by centrifuging in an Amicon® Ultra-15 Centrifugal Filter Unit followed by an Amicon® Ultra-0.5 Centrifugal Filter Unit with 50 kDa exclusion size.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.28.446200: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse strains: The animal’s experimental procedures were carried out with mixed groups (males and females) of mice aged 6 to 7 weeks and received the approval of the Ethical Committee for Animal Experimentation of the Universidade Federal de Minas Gerais (UFMG) (process No. 190/2020).<br>Euthanasia Agents: MHV-3 infection: Mice were lightly anesthetized with an intraperitoneal injection of ketamine (50 mg/kg): xylazine (5 mg/kg) and received an intranasal inoculation of 30 μl sterile saline solution loaded or not (Mock controls) with MHV-3 at different concentrations (3×101 to 3×104 PFU).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse strains: The animal’s experimental procedures were carried out with mixed groups (males and females) of mice aged 6 to 7 weeks and received the approval of the Ethical Committee for Animal Experimentation of the Universidade Federal de Minas Gerais (UFMG) (process No. 190/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The inflammation-mediated injury in mouse lungs was determined by a pathologist (C.M.Q.J) blinded to the experiment, by employing a scoring system encompassing: (i) airway inflammation (up to 4 points); (ii) vascular inflammation (up to 4 points); (iii) parenchyma inflammation (up to 5 points); and general neutrophil infiltration (up to 5 points) (40).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following permeabilization in PBS / 0,5% Triton X-100, the cryosections were incubated for 1 h in the blocking solution (PBS containing 5% goat serum and 5 μg/mL mouse BD Fc Block™) and then labeled overnight at 4°C with the APC-conjugated rat anti-mouse CD45 antibody (1:100 dilution, BD Pharmingen, cat No. 559864).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1×106 cells were blocked with mouse BD FC block™ (5 μg/mL, BD Pharmingen, Cat No. 553141) and then stained using fluorescent-labeled monoclonal antibodies as follows: Ly6G-BV421 (1:200, BioLegend, Cat No. 127627); CD45-FITC (1:200</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ly6G-BV421</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pre-synaptic and post-synaptic terminals were stained using the monoclonal anti-synaptotagmin antibody (1:250 dilution, Developmental Studies Hybridoma Bank; cat No. 3H2 2D7) and the tetramethylrhodamine-conjugated α-bungarotoxin (1:1000 dilution; Invitrogen, cat No. T1175), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-synaptotagmin</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-46358, RRID:AB_1090909)</div></div><div style="margin-bottom:8px"><div>α-bungarotoxin</div><div>suggested: (Thermo Fisher Scientific Cat# B35451, RRID:AB_2617152)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, viruses and plaque assay: Vero E6 (ATCC® CRL-1586), L929 (ATCC® CCL-1), and Calu-3 (ATCC® HTB-55) cells were cultured under a controlled atmosphere (37aC, 5% CO2) in high glucose DMEM (Vero and L929) or MEM (Calu-3) supplemented with 7% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>L929</div><div>suggested: ECACC Cat# 86032004, RRID:CVCL_4238)</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The levels of IL-6 (cat. No. DY206), IL-8 (cat. No. DY208) and TNF-α (cat. No. DY210) were quantified in the supernatants from uninfected and SARS-CoV-2-infected Calu-3 cells by ELISA (R&D Systems), following manufacturer’s instructions, and results are expressed as n-fold relative to uninfected cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type C57BL/6 (Central Animal House of the UFMG) and TNF receptor Knockout mice (TNFRp55-/-, Jackson Laboratories, stock No. 002818) were housed in individually ventilated cages placed in an animal care facility at 24 ± 2 °C on a 12-h light/ 12-h dark cycle, receiving ad libitum access to water and food.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On the fourth-day post infection, mice were euthanized, the dataloggers were collected and the body temperature readings of each animal were downloaded and analyzed (SubCue software, Calgary, AB, Canada).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The acquisition was carried out in a BD FACSCanto II cell analyzer and analyzed using FlowJo software (Tree Star, Ashland, OR)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      As well as other animal models already proposed for COVID-19 study, the MHV-3 model also has its limitations. One of them is the difference in the host cell receptor used for viral entry. MHV-3 uses the CEACAM-1 receptor (32) whereas SARS-CoV-2 uses ACE2 (33), which may preclude studies of viral entry or drugs that act on this stage of the replication cycle. Another important limitation is the strong viral tropism towards liver cells and the impairment of the function of this organ in late time of infection. However, our results demonstrating significant lung damage and impairment of pulmonary functions following the first days after infection make our model quite useful to study coronavirus-associated lung inflammation and injury.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 35 and 37. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

  3. May 2021
    1. Mutant E

      Article Information: PMID: 30023842 InternalPaperNumber: Luc-C5 Protein: FLuc ReviewOrPrimaryArticle: Primary FirstAuthor: Pozzo, Tania CorrespondingAuthor: Yokobayashi Journal: ACS Year: 2018

      MutantName: Mutant E Mutation(s): T214A, A215L, I232A, F295L, and E345K Substrate(s): D-luc FunctionChange(s): Increased thermostability compared to FLuc. BiochemicalHypotheses: UsefulReferences: [Baggett, B.; Roy, R.; Momen, S.; Morgan, S.; Tisi, L.; Morse, D.; Gillies, R. J. Thermostability of firefly luciferases affects efficiency of detection by in vivo bioluminescence. Mol. Imaging 2004, 3, 324– 332, DOI: 10.1162/1535350042973553]: First to construct the mutant and determine the increased thermostability. [ Branchini, B. R.; Ablamsky, D. M.; Murtiashaw, M. H.; Uzasci, L.; Fraga, H.; Southworth, T. L. Thermostable red and green light-producing firefly luciferase mutants for bioluminescent reporter applications. Anal. Biochem. 2007, 361, 253– 262, DOI: 10.1016/j.ab.2006.10.043]: Determined that combining these 5 point mutations with other mutants increased the stability of the enzyme.

    1. SciScore for 10.1101/2021.05.27.445918: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed written consent to participate in the research project, and the study was approved by the Regional Ethical Board in Ospedale L.<br>IRB: All participants provided informed written consent to participate in the research project, and the study was approved by the Regional Ethical Board in Ospedale L.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">43 subjects (24 males and 19 females, dataset) undergoing COVID-19 serological analysis (Centro Polispecialistico Giovanni Paolo I, Viterbo, I) were enrolled in this study from October 2020 to March 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Replicates were exported as.mzXML files and processed through MAVEN.5.2. Multivariate (PLS-DA) and Univariate (Volcano plot) statistical analyses were performed on the entire metabolomics data set using the MetaboAnalyst 5.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaboAnalyst</div><div>suggested: (MetaboAnalyst, RRID:SCR_015539)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.25.21257501: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was granted exemption from Institutional Review Boards (IRB) approval for utilizing discarded pooled RNA samples, anonymized and de-identified, for single-molecule detection of SARS-CoV-2 RNA with a multiplex approach.<br>Consent: All samples were coded and de-identified as specified in the informed consent and the NIH investigator attestation addressing the protection of human subjects and approved by the NIH Office of Human Subjects Research Protections (OHSRP).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Seropositivity of these samples had been confirmed by MDA with a commercial antibody test (Abbot, SARS-CoV-2 IgG, ref. 6R86-22/6R86-32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>6R86-22/6R86-32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary anti-human IgG1 and IgM labeled antibodies (Rabbit monoclonal [H26-10] Anti-Human IgG1 H&L, Alexa Fluor® 647, Abcam, AB-ab200623 and Rabbit Anti-Human IgM mu chain (Alexa Fluor® 488), Abcam, AB-ab150189) were diluted 1:10,000 and added on the surface for 30 minutes incubation..</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: (Abcam Cat# ab28056, RRID:AB_2040942)</div></div><div style="margin-bottom:8px"><div>IgM labeled antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 hours incubation at room temperature, the plate was washed (X3, 5 minutes incubation for each wash) with Tween 0.05% in PBS. 20ul goat anti-human-HRP (Jackson 109-035-088) secondary antibody, diluted 1:2,500 in 2% FCS, was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>X3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For synthetic COVID-19 DNA, cellular RNA extracted from HEK293 cells were added in a final concentration of 0.1ng/ul.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Those parameters were coded to a MATLAB script that scanned the reverse complement sequence of the SARS-CoV-2 genome (NC_045512.2) in sliding windows of 25-40 nt.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The probe pair dataset attributes every probe in the pair with its coordinates, length, Tm, and BLAST hits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genetic test sample preparation: Synthetic COVID-19 DNA in different concentrations or 10ul RNA extracted from swab samples were mixed with 1nM capture probes, 0.5nM detection probes, 0.3ul Rnase inhibitor (SUPERaseIn RNase Inhibitor, AM2694, ThermoFisher), and 2X SSC buffer in a final volume of 14.8ul.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.26.445843: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human peripheral blood mononuclear cells: Leukapheresis blood packs from healthy donors were obtained under an institutional review board-approved protocol at the National Institutes of Health.<br>Consent: All donors provided written informed consent, and anonymized samples were provided to our laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-S1 neutralizing antibody (Catalog# 40591-MM43, lot HB14AP2001) and anti-S1 non-neutralizing antibody (Catalog # 40591-MM42, lot HB14AP0701) were also purchased from Sino Biological (Vendor #2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1 non-neutralizing</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following 3 washes with PBST, 100 μL of HRP-labelled anti-human IgG Fc antibody (Catalog# 31413, Thermo Fisher) was added to each well and incubated for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 31413, RRID:AB_429693)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess the blockade of spike protein binding to ACE2 by soluble ACE2 and anti-S1 neutralizing antibodies, 400 ng/mL of S1-Fc protein was preincubated with 2 μg/mL of ACE2 or 1 μg/mL of anti-S1 antibodies at room temperature for 20 minutes before incubation with plate-bound ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2 by soluble ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1 neutralizing antibodies, 400</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.24.21257705: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Emergence of new mutations in the S glycoprotein, which is involved in the binding of SARS-CoV-2 to the host cell receptor angiotensin-converting enzyme 2 (ACE2) and entry into the host cell, could have influence on virus binding, entry, immune invasion and antibody neutralization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: A phylogenetic dendrogram was constructed based on the whole genome sequences of 111 SARS-CoV-2 strains, including 38 sequences of the new variant and 73 reference sequences of different clades/variants (11 reference sequences of Indian variant B.1.617; 5 reference sequences of each of G clade, GR clade, GV clade, L clade, V clade, GRY clade/UK variant, South African variant, Brazilian variant, California variant, Nigerian variant and Indian variant B.1.618; 4 reference sequences of S clade; 3 reference sequences of GH clade), using Molecular Evolutionary Genetics Analysis (MEGA) version X [18].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.26.445769: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: (NIID) after approval by the Committee on the Ethics of Animal Experiments in NIID (permission number: 520001) under the guidelines for animal experiments in accordance with the Guidelines for Proper Conduct of Animal Experiments established by the Science Council of Japan (http://www.scj.go.jp/ja/info/kohyo/pdf/kohyo-20-k16-2e.pdf).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus inoculation, blood collection, nasopharyngeal and throat swab collection, and anti-CD8 antibody treatment were performed under ketamine anesthesia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three (Group D) of the nine macaques were intravenously administrated with 5 mg/kg body weight of anti-CD8α antibody clone MT807 (NIH Nonhuman Primate Reagent Resource) on days 5 and 7 post-infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD8α</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-CD8 PerCP (SK1; BD), and anti-CD20 PE (2H7; BD) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20 PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, whole blood samples from anti-CD8 antibody-treated animals were stained with anti-CD3 APC-Cy7, anti-CD4 PerCP (L200; BD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus recovery from swabs: Vero E6/TMPRSS2 cells in 96-well plates were added with 10-fold serially diluted swab solutions and cultured for 4 days without medium change.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation for 45 min at room temperature, 20 μl of the mixture was added to each of four wells (1 x 104 Vero cells/well) in a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using Prism software (GraphPad Software, Inc.) with significance set at p values of < 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their comments, criticisms and suggestions that will help to improve the quality of our manusrcipt.

      Please find enclosed in this initial response our answer to each point raised by the reviewers.

      Please note that for several answers normally come along with an additional figure that could be added in the full revised version of the manuscript. However, these additional figures could not be added in the way we have to submit our answers but we are ready to send a pdf file including our answers with the additional figures upon request.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The paper by Genest et al. describes the effect of flotillins and sphingosine kinase 2 to stabilize AXL as a mechanism to promote epithelial-mesenchymal transition in breast (cancer) cells. The potential role of vesicles trafficking EMT-promoting proteins is of high interest in the field, also for exploring new opportunities of pharmacological targeting. However, the paper fails to convincingly demonstrate that the proposed mechanism is of real importance to support or promote EMT for the following main reasons:

      1-a) The role of flotillins is studied only by overexpression and in the context of non-cancerous MCF10A cells, while breast cancer cells of epithelial-like origin are not analyzed.

      Regarding the first part of the point raised here, we are not sure to understand correctly the sentence “[…] while breast cancer cells of epithelial-like origin are not analyzed”. Indeed, we used the breast cancer cell line MDA-MB-231 and a derived cell line that we generated by knocking down flotillin expression (MDA-MB-231shFlot2) in the second part of this study (Figure 6C, F and H and S7A, E and F). This previously characterized cell line allowed us to demonstrate that abolishing flotillin overexpression was sufficient to significantly inhibit the invasive properties of MDA-MB-231 cells (Planchon et al, J Cell Science 2018, https://doi.org/10.1242/jcs.218925

      Although flotillin upregulation induces some major mechanisms of the EMT process in MCF10A cells, flotillin downregulation was not sufficient to reverse the EMT phenotype in MDA-MB-231 cells. This could be explained by the fact that EMT is a multifactorial process and that MDA-MB-231 cells went through too many irreversible changes leading to this process. By contrast, when we analyzed EMT markers after SphK2 inhibition or knock down in MCF10AF1F2 and in MDA-MB-231 cells (Figure 6A-C), we could observe a significant decrease in ZEB1 expression.

      1-b) This is contrast with the purpose of the paper (see abstract, introduction, patients' data) which is to study tumors and EMT. Effect of shRNAs is also not reported, making it difficult to estimate the importance on the EMT phenotype.

      As we mentioned in our manuscript, previous studies by other groups who downregulated flotillin expression in different cancer cell lines using siRNA approaches or re-expression of miRNAs that inhibit flotillin expression, already showed flotillin participation in EMT (for review please see, Gauthier-Rouvière et al, Cancer Metastasis Review, 2020, **doi: 10.1007/s10555-020-09873-y).

      In this context, the novelty and the first goal of our study was to investigate how strong is the contribution of flotillin upregulation to EMT induction. To achieve this goal, we chose on purpose to use non-tumoral epithelial cells that do not harbor the anomalies already favoring EMT, unlike the cancer cell lines used in previous studies. In these non-tumoral models (the human MCF10A and mouse NMuMG mammary epithelial cell lines), we ectopically overexpressed flotillins (MCF10AF1F2 and NMuMGF1F2) to levels similar to what observed in invasive breast cancer cells. Using this approach, we found that flotillin overexpression is enough to induce EMT.

      1-c) Then, alteration of EMT should be concluded also from other non-genetic functional parameters, not just by markers. For instance: was morphology of the cells changed? Was cell migration affected with F1F2?

      Our conclusion that flotillin upregulation is sufficient to induce EMT in MCF10AF1F2 and NMuMGF1F2 cells is not based only on genetic functional parameters or markers. For instance, Figure S1 (panels H and I) shows a strong modification of the cell morphology and of the actin cytoskeleton organization in NMuMG cells upon flotillin upregulation. NMuMGF1F2 cells became flat and lost their apical F-actin belt and exhibited an increase in stress fibers.

      As shown below (Additional Figure 1), similar modifications of the cell morphology and of the F-actin cytoskeleton organization occur also when flotillins are upregulated in MCF10A cells (see below the comparison of MCF10A and MCF10AF1F2 cells) (these data could be added in the manuscript).

      ADDITIONAL FIGURE 1 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST

      Additional figure 1: Upregulation of flotillins in MCF10A cells leads to changes in the cell morphology and in F-actin cytoskeleton organization. Comparison of the morphology and of the actin cytoskeleton organization in MCF10AmCh and MCF10AF1F2 cells. Confluent cells were fixed and stained for F-actin (green) using Alexa488-conjugated-Phalloidin and for nuclei (blue) using Hoechst (in panel A flotillin2-mCherry signal is shown). (A) Upper panels show the maximum intensity projection images (MIP) of MCF10AmCh (control) and MCF10AF1F2 (flotillin overexpression) cells obtained from a stack of images acquired by confocal microscopy. Lower panels show magnified images from the boxed areas, including one single plane and the x-z and y-z projections along the indicated axes. (B) 3D reconstruction images obtained from the region in the boxed area from the MIP-images shown in A.

      These data show that in MCF10AF1F2 cells the apical actin belt is lost and the height of the cellular monolayer is lower compared with control MCF10AmCh cells.

      We also analyzed the migration capacity of these cells (shown in Figure 3G of the submitted manuscript). Briefly, using a Boyden chamber assay, we showed that flotillin upregulation significantly increased migration of MCF10A cells (Figure 3G). We previously demonstrated that flotillin upregulation also promotes cell invasion in 3D using a spheroid assay (Planchon et al, J Cell Science, 2018, https://doi.org/10.1242/jcs.218925**). As shown below (Additional Figure 2), using a wound healing assay, we also observed that cell velocity is higher in flotillin-overexpressing NMuMGF1F2 cells than in control NMuMG cells (this could be added to the manuscript).

      ADDITIONAL FIGURE 2 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST

      Additional figure 2: Upregulation of flotillins in NMuMG cells increases cell velocity in a 2D migration assay. (A) Representative images of NMuMGmCh (control) and NMuMGF1F2 cells during wound healing. The yellow dashed line indicates the leading edge of the migrating monolayer at the indicated times. The trajectory of 60 individual cells was tracked and the cell velocity and persistence of migration were extracted. The histogram shows the velocity quantification (mean ± SEM of 4 independent experiments). (B) Representative trajectories of individual cells.

      2) AXL up-regulation is not very strong (2-fold). What is unclear is if the minimal AXL increase due to F1F2 really provides a significant contribution to the EMT phenotype (as the authors conclude). The siRNA experiment knocks down all AXL, not just the F1F2-induced levels, making it difficult to estimate the real effect of the mechanism proposed.

      As shown in figure 3A and D, in MCF10AF1F2 cells compared with MCF10AmCh cells, we measured a significant 2.5 ± 0.7-fold increase in the AXL protein level. We do not think that this can be considered as a minimal increase.

      Considering that flotillin upregulation may affect simultaneously different receptors (Figure S2I, Figure S6A-F), we did not expect that downregulating a single receptor would have a major impact on the level of EMT markers and on cell migration. Yet, after knocking down AXL in MCF10AF1F2 cells, we observed a decrease in ZEB1 and N-cadherin expression and the re-expression of E-cadherin (Figure 3D-F) and the inhibition of cell migration (Figure 3G). The fact that we observed such an effect by downregulating AXL, which according to Reviewer #1 is minimally increased, might be explained by its well-known ability to act not alone but through cross-talk with other signaling receptors (Graham et al, Nature Reviews Cancer 2014; Halmos and Haura, Science Signaling 2016; Colavito et al, Journal of Oncology 2020).

      As suggested by Reviewer #1, ideally, it would be interesting to bring back AXL to its level in MCF10AmCh cells to better evaluate only the contribution of its increase. However, adjusting so precisely the efficacy of AXL downregulation by siRNA seems quite difficult to achieve.

      3) Why didn’t the author focus on EphA4 (or to a lesser extent ALK), which showed better regulation ?

      As we mentioned (page 18) “the available tools allowed us to validate this result only for AXL, but not for EphA4 and ALK”**.

      Nevertheless, for EphA4, we showed in Figure S6 that it is located in flotillin-positive late endosomes (Figure S6 A and C, for MCF10AF1F2 and NMuMGF1F2 cells, respectively) in a phosphorylated form (using an antibody against P-Y588/Y596-EphA4 that works in NMuMG cells, Figure S6D). However, the signals obtained by western blotting using the same antibody were too low to validate any significant variation of EphA4 Y-phosphorylation status, as suggested by the results from the phospho-RTK array.

      Regarding ALK, the increase in its phosphorylation, suggested by the phospho-RTK array, remains puzzling to us. By western blotting of cell lysates and in the presence of positive controls, we did not detect any positive signal for phosphorylated ALK and even for total ALK in MCF10A and MCF10AF1F2 cells. In addition, to our knowledge, ALK expression in MCF10A cells has never been reported in the literature. These observations did not encourage us to pursue our investigations on ALK.

      Moreover, several points led us to focus on AXL. Indeed, AXL expression is associated with the acquisition of a mesenchymal cell phenotype, invasive properties, and resistance to treatments and AXL is an attractive therapeutic target against which several inhibitors are in preclinical and clinical development (Shen Y et al. Life Sciences 2018). Moreover, AXL expression in tumors is attributed to post-transcriptional regulation, but the mechanisms are totally unknown. Understanding how its stabilization and signaling can be triggered by flotillin-mediated endocytic pathways is new and of high significance for the cancer field and the trafficking community.

      3) The conclusions of the manuscript are contradicted by the reported clinical data. In Figure S4 the authors clearly observe co-expression of Flotillin 1 and AXL prevalently in luminal breast cancers, which is the subtype known to not be driven by EMT. This evidence already indicates that this (otherwise interesting) mechanism is not relevant to EMT in breast cancer. So, the conclusions are not supported by the data, and the experimental setup and model chosen are not appropriate to generalize the findings to cancer.

      We acknowledge that flotillin 1/AXL co-expression is highest in the luminal subtype. If this co-expression was observed only in this particular subtype, we would have agreed that it excluded that flotillins and AXL co-overexpression may participate in EMT in tumor cells. However, our results show that flotillin 1 and AXL are co-expressed also in other subtypes that have undergone EMT. Considering this observation and the influence of flotillin upregulation on AXL overexpression we reported here, we believe that the point raised by the Reviewer is not sufficient to exclude that the co-upregulation of flotillins and AXL can participate in EMT induction in breast cancer cells.

      **Minor (here the most important):**

      4) The point of the Figure 2 is not clear. Why this part should have such a central role in the story? The entire data presented are not followed up in the rest of the paper. Moreover, in some cases upregulations also questionably significant (like RAS and STAT3 are not even 2 fold).

      Moreover, the error bars are so small that it seems unrealistic that the plots indicate three independent experiments.

      Because the activation of oncogenic signaling pathways is crucial to promote EMT, we think that analyzing these pathways in the context of flotillin upregulation is coherent with the message of the paper.

      To our knowledge, the amplitude of up- or down-regulation has nothing to do with its significance. The amplitude also depends strongly on the context (stimulation with an agonist, overexpression of GEF, etc). For instance, increases lower than 2-fold are frequently reported (Bodin and Welch, Mol Biol Cell, 2005; Miura SI et al, Arteriosclerosis, Thromb and Vasc Biology, 2003; Matsunaga-Udagawa R et al, J Bio Chem 2010)** when assessing the activity of Ras or small GTPases, but they represent real upregulations. Furthermore, Ras activation is supported by the downstream 4-fold activation of ERK that we measured (Figure 2C).

      In Figure 2, panels B, C, E, F and J, considering the amplitude of the mean increases shown, the error bars corresponding to SEM do not seem disproportionately small.

      As the Reviewer seems to insinuate that we have not performed independent experiments, we are presenting in the table below the detailed results all obtained from independent experiments.

      Panel

      Parameter measured

      Number of independent experiments

      Fold of increase value in MCF10AF1F2 cells compared with MCF10AmCh cells in each experiment

      Mean

      SEM

      p-value

      B

      Ras-GTP

      5

      1.95 ; 1.96 ; 1.18 ; 1.67 ; 1.86

      1.72

      0.14

      0.001

      C

      Phospho- ERK

      5

      1.24 ; 5.43 ; 3.22 ; 6.11 ; 3.52

      3.71

      0.73

      0.0042

      E

      Phospho-AKT

      4

      2.29 ; 6.54 ; 3.76 ; 2.6

      3.8

      0.97

      0.0276

      F

      Phospho-STAT3

      4

      1.63 ; 1.63 ; 2.42 ; 1.60

      1.82

      0.20

      0.0066

      J

      Phospho-SMAD3

      8

      4.1 ; 5.12 ; 6.29 ; 1.82 ; 2.58 ; 6.66 ; 2.82 ; 5.40

      4.35

      0.64

      0.0001

      In the legend to figure 2 panels C, E, F, J, “The histograms show […] with control MCF10AmCh **cells calculated from 4 independent experiments” was corrected by “The histograms show […] with control MCF10AmCh cells calculated from at least 4 independent experiments” as data shown in panel J were actually calculated from 8 independent experiments.

      5) More robust statistical analysis should be provided in the Figure 1 to support that EMT is suppressed with F1F2 overexpression. For instance a more standard GSEA on hallmark signatures.

      To avoid confusion, we understand that Reviewer #1 meant “… that EMT is induced with F1F2 overexpression” and not “… suppressed …”.

      As recommended by Reviewer #1, we performed a GSEA on the hallmark signature and the results are already included in the current revised version of our manuscript (figure 1C).

      6) In Figure 3 E-Cadherin is rescued with siAXL in the IF but not in the western blot.

      Using siRNA transfection, we can have a mosaic effect due to the fact that not all the cells of the sample are transfected and thus efficiently knocked down. This mosaicism was clear when we analyzed E-cadherin by immunocytochemistry. Indeed, in some cells, probably the ones that have been more efficiently transfected with the AXL siRNA, E-cadherin expression is clearly seen. By western blotting, which provides a global analysis in which transfected and non-transfected cells are mixed, this was not significantly higher than in MCF10AF1F2 cells transfected with a control siRNA, although there was a trend towards increased E-cadherin expression in MCF10AF1F2 transfected with the AXL siRNA.

      For the revised version of our manuscript we will try to improve the efficacy of the AXL siRNA and test whether we can fully rescue E-cadherin expression. The corresponding panel could be modified according to the data we will obtain.

      7) Some sentences require clarifications. The authors should be more clear on why ZEB2 antibody was not available or what they mean with "Unfortunately the available tools..".

      Page 7: we wrote «no anti-Zeb2 antibody is available». We should have said: «none of the anti-Zeb2 antibodies tested worked in MCF10A cells». We decided to remove “no anti-Zeb2 antibody is available” from the sentence to avoid confusion in the revised version of our manuscript.

      Page 19: we wrote «unfortunately the available tools» to refer **the available tools against EphA4 and ALK that did not allow us to validate the data obtained using the phospho-RTK array showing that the Y-phosphorylation of these two RTK is increased in cells with upregulated flotillins. (see also our answer to major point 2).

      8) Western blot from the CHX experiment should be shown, at least in the supplements. Again, the standard deviation in this experiment is minimal, was this really an average of three independent experiments (and not three western on the same lysates)?

      As asked, a representative western blot is now shown in Figure 3C in the current revised version of the manuscript.

      As indicated in the legend to the figure already in the initial version of our manuscript: “**The results are the mean ± SEM of 6 to 8 independent experiments depending on the time point, and are expressed as the percentage of AXL level at T0”. We wish to reassure Reviewer#1 that the results are really based on western blots performed on different lysates obtained in independent experiments. We can show the Reviewer these data obtained from independent experiments if necessary.

      9) All conclusions are derived from one single cells MCF10a. NMuMG cells are shown at the beginning but not used for the rest of the paper. Anyway, if this wants to be a cancer research paper, then cancer cells needs to be used.

      It is true that we did not use a cancer cell line at the beginning of the paper because, as expected, flotillin knock-down did not allow to revert the mesenchymal phenotype of MDA-MB-231 cells toward an epithelial one. If this had been obtained, we would have used these cells from the beginning of the paper. The lack of reversion of the mesenchymal phenotype after flotillin knock-down was expected. Indeed, the EMT process is multifactorial and the decrease of flotillins alone is obviously not sufficient to reverse it in a tumor cell line bearing multiple oncogenic mutations. Moreover, because we wanted to assess whether flotillin upregulation is sufficient in normal cells to acquire the properties of tumor cells and particularly to induce EMT, we used human MCF10A and murine NMuMG cells, two non-tumoral epithelial cell lines. Until now, the studies carried out on the effects of flotillin overexpression have used tumor cells that already harbor pro-oncogenic perturbations, preventing to show that flotillin overexpression alone activates oncogenic processes leading to EMT, and to identify the downstream mechanisms.

      Nevertheless, we have used the MDA-MB-231 cell line in several experiments to analyze: i) AXL distribution and internalization following the knock-down of flotillins (Figures 4 and S5), ii) SphK2 and flotillin 2 co-localization and co-endocytosis (Figures 5A and D and S7A), iii) the impact of SphK2 inhibition on AXL expression level distribution and endocytosis (Figure 6), iv) SphK2 expression level upon flotillin knock-down (Figure S7E) and AXL expression level upon SphK1 inhibition (Figure S7F). With these experiments performed in MDA-MB-231 cells, we showed that AXL and SphK2 colocalize in flotillin-positive late endosomes and are co-endocytosed from the plasma membrane containing flotillin-rich domains to flotillin-positive vesicles. We also demonstrated that flotillins and SphK2 control the rate of AXL endocytosis and its stabilization.

      We recently obtained additional data with HS578T cells, another triple negative breast cancer cell line, on the co-trafficking of AXL and flotillins as well as the co-trafficking of SphK2 and flotillins (Additional Figure 3, this data could be added in the fully revised version of our manuscript).

      In addition, we observed that inhibiting SphK2 also decreased the level of AXL in HS578T cells. This data could be added in the revised version of the manuscript (see data in our answer to Point #1 from Reviewer #3).

      • ADDITIONAL FIGURE 3 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST*

      Additional figure 3: Co-trafficking of SphK2 and AXL with flotillin 1 in intracellular vesicles in HS578T cells. HS578T cells co-expressing Flot1-mCherry with SphK2-GFP (A) or AXL-GFP (B) were monitored by time lapse spinning disk confocal video-microscopy. On the right of each panel are shown still images at different time points (min) of the boxed area. The colored arrows allow following three distinct vesicles that are positive for Flot1-mCherry and Sphk2-GFP, or AXL-GFP.

      10) The methods section contains inconsistent data about patients' samples (9 are indicated, but the Figure S4 features 37). Then, where those other 527 come from?

      We corrected the manuscript and added all characteristics regarding the 37 patients in the “Supplementary information” section.

      The 527 patients are from another cohort and were used for the analysis of the correlation between the mRNA levels of FLOT1 and p63 in breast cancer biopsies from 527 patients (Figure 2I). This cohort was described in our previous study (Planchon et al. J Cell Science 2018, https://doi.org/10.1242/jcs.218925). In the revised version of our manuscript, we now refer to this previous article in the “Result” section and in the legend to figure 2I to explain the origin and characteristics of this cohort.

      11) Some figures do not match with the legends or with the description in the text. It has not been easy to review this paper.

      We apologize as we indeed made one mistake in figure 2 that was inserted into the manuscript and that was actually figure S2 (that appeared twice). However, the correct figure 2 was uploaded on the website of Review Commons and BioRxiv. Regarding the comments made in point 4, it seems that Reviewer #1 examined the correct figure 2 that was uploaded and that matches the legend indicated in the manuscript.

      Besides this mistake, we do not see any other mismatch between figures and legends.

      Reviewer #1 (Significance (Required)):

      I am a cancer biologist working on EMT.

      **Referee Cross-commenting** I have nothing to comment on other's reviews.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)): Genest and co-authors present in this paper new fascinating evidence on how intracellular trafficking can modulate oncogenic signalling.

      First of all, they show how overexpression of Flotillin1 and 2 in non-cancerous breast lines can induce a strong reprogramming towards an EMT phenotype. They analyse mRNA and protein expression, intracellular distribution of activated proteins, cell phenotypes to demonstrate a strong activation of oncogenic signalling pathways. They then identify AXL as a key player in this process and show how this protein is stabilised upon Flotillin expression. The authors use an amazing variety of approaches to study the endocytosis and the trafficking of endogenous, GFP-tagged, Halo-tagged and Myc-tagged AXL in different cell lines and their data are strong and very convincing, the images are of very high quality and the analysis rigorous. Their data strongly support the hypothesis that high Flotillin levels triggers AXL endocytosis and accumulation in non-degradative late endosomes where signalling remains active. The authors then show how SphK2 has a key role in AXL stabilisation, it colocalises with Flotillin, AXL and CD63 and its activity (which they block by using inhibitors or siRNA) is necessary for flotillin-induced AXL stabilisation and EMT induction. The paper is extremely well written, the data flow logically and they are appropriately presented and analysed. I don't have any major comment and I believe the paper is suitable for publication.

      We thank the Reviewer for the positive appreciation on our manuscript.

      I have only some minor comments/questions: 1) did the authors try to colocalise AXL with endogenous Flotillin in MDA-MB-231 cells? They could use the antibodies used in Fig S1B. Of note, the authors have shown it in luminal tumours in Fig S4C.

      We performed co-immunofuorescence experiments to detect endogenous AXL with endogenous Flotillin in MDA-MB-231 cells. As shown below (Additional Figure 4), we could find AXL and Flotillin being present in the same intracellular endosomes. Images could be added in the revised version of the manuscript.

      ADDITIONAL FIGURE 4 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST

      Additional figure 4: Endogenous AXL and flotillin 1 are found in the same in intracellular vesicles in MDA-MB-231 cells. MDA-MB-231 cells were fixed and labelled with relevant antibodies directed against Flotillin1 and AXL. Scale bar in the main image : 10 µm. Scale bars in the magnified images from the boxed area : 1 µm. Arrows indicate flotillin and AXL positives vesicles

      2) In Fig6G, it appears that AXL-Flotillin colocalization is lost upon SphK2 inhibition. Is this the case? It could be that the correct lipids are necessary for the formation of Flotillin-positive internalisation domains and this could be very interesting and reinforce the model proposed in the paper.

      In figure 6G, cells were not permeabilized. Thus, only AXL at the cell surface was labelled using an antibody against the extracellular domain of AXL. Because flotillin 2 is tagged with mCherry, this allowed its visualization revealing its localization both at the cell surface and intracellularly in the inset of the lower pane l of figure 6G.

      After 6 hours of treatment using the opaganib inhibitor, we did not notice any major change in AXL-flotillin colocalization at the cell surface. Somehow, this is expected because blocking the generation of S1P is more likely to inhibit the invagination of flotillin-rich membrane microdomains rather than their formation.

      3) I would remove the sentence on line 995-997 "to our knowledge this is the first report to describe ligand-independent AXL stabilization..." as the cells are not serum starved in all experiments and animal serum can contain variable amounts of the ligand GAS6.

      We understand and agree with Reviewer #2, this sentence has been modified by “**To our knowledge this is the first report to describe AXL stabilization following its endocytosis”

      Please note that the authors don't have to necessarily address comments 1-2, their paper is already very rich in convincing data.

      Reviewer #2 (Significance (Required)):

      AXL is a major oncogene that promotes EMT in a variety of tumour types. Understanding how its signalling can be triggered by endocytic pathways even in cells that are non-cancerous is very important and of high significance for the cancer field and the trafficking community.


      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      This is an interesting and well written paper describing that upregulated flotillin promotes an endocytic pathway called upregulated flotillins-induced trafficking (UFIT) that mediates AXL endocytosis and allows its stabilization. Consequently, stabilized AXL in these flotillin-positive late endosomes enhances activation of oncogenic signaling pathways that promotes EMT. The authors suggest that Flotillin upregulation-induced AXL stabilization requires the activity of SphK2. However, this latter point is not supported by the data and further studies are needed to support this important conclusion.

      **Major concerns:**

      1. Most of the conclusions are based on effects of high concentrations (50 uM) of an ill-defined SphK2 inhibitor. The experiment described in Figure 6C-H need to be confirmed by downregulation of SphK2.

      We understand that Reviewer #3 is concerned that in our experimental conditions, the effects we observed could be really explained by a specific inhibition of SphK2.

      From the literature, among all the inhibitors described for SphK2, opaganib (ABC294640) is the most specific inhibitor available. It was shown to have no inhibitory effect on SphK1 up to 100 µM (French et al, J Pharmacol Experimental Exp Ther 2010; Neubauer HA and Pitson SM, The FEBS Journal 2013). In agreement, we found that PF543, the most specific SphK1 inhibitor, had no effect on AXL level (Figure S7F), unlike incubation with opaganib (Figure 6A and C), and that was confirmed in MCF10AF1F2 cells by the knock down of SphK2 with a specific siRNA (Figure 6B).

      In the literature, depending on the cell lines, opaganib is used in vitro in the 10 to 60 µM range. Opaganib IC50 on recombinant SphK2 was established at 60 µM (French et al, J Pharmacol Experimental Exp Ther 2010). In our experiments, opaganib was used at a concentration of 50 µM, below the IC50 value, as previously done by Nichols’ group (Riento and al, PloS ONE, 2018). In most of our experiments (Figure 6, A, D, E-I, Figure S7D), opaganib was added for a maximum of 10 hours, which is shorter compared to what done in other studies (24-48 hours). Furthermore, it was shown that an opaganib concentration of 50 µM does not have any inhibitory effect in vitro on 20 protein kinases tested, including PKA, PKB, PKC, CDK, MAP-K, PDK1 and Src (French et al, J Pharmacol Experimental Exp Ther 2010).

      In addition to inhibit SphK2, acting in a sphingosine-competitive manner, opaganib also was shown to act as an antagonist of estrogen receptor (ER), and inhibits ER-positive breast cancer tumor formation in vivo (Antoon JW et al, Endocrinology 2010). If Reviewer #3 is concerned about the possibility that the opaganib downstream effects we observed in our study might be explained by ER inhibition, we remind that we used cellular models that do not express ER. Indeed, the MDA-MB-231 cell line is a triple negative breast cancer cell line. MCF10A cells also do not express ER (Lane MA et al, Oncolgy Report, 1999,)** and our transcriptomic analysis (Table S1) did not reveal any increase in the expression of ER genes in MCF10AF1F2 cells in which flotillins are upregulated, thus eliminating a possible non-specific effect of opaganib in these cells.

      In conclusion, we hope that these arguments help to convince Reviewer #3 that our experiments were performed in conditions where we carefully limited the possibility of opaganib off-target effects, on the basis of the currently available opaganib-related data from the literature.

      We totally agree with Reviewer #3 that complementary experiments by downregulating SphK2 must be used. In agreement, we already downregulated SphK2 by siRNA in MCF10AF1F2 cells. This led to a significant decrease in AXL and ZEB1 expression. In the current revised version of the manuscript we have added data obtained with similar siRNA experiments performed in MDA-MB-231 cells (now Figure 6C). In agreement, we observed AXL and ZEB1 downregulation.

      As shown below (Additional Figure 5) we recently obtained similar data in HS578T cells, showing that inhibiting SphK2 also affects AXL protein level in this triple negative breast cancer cell line (these data could be added in the manuscript).

      ADDITIONAL FIGURE 5 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST

      Additional figure 5: SphK2 inhibition decreases AXL level in HS578T cells. HS578T cells were incubated with opaganib (50µM, 10 hours) (A) or with siRNA Ctrl or siRNA SphK2 for 72 hours (B). Cell lysates were blotted with relevant antibodies against AXL, SphK2 and actin. The histograms show AXL level (normalized to actin) expressed as fold-increase compared with the control condition, and data are the mean ± SEM of 3 (A) and 4 (B) independent experiments.

      Reviewer #3 also asks to use the siRNA approach on experiments shown in previous panels D-H (now panels E-I) of figure 6.

      In complement to Figure 6D (now Figure 6E), experiments using a siRNA against SphK2 to show that “**AXL decrease upon SphK2 inhibition is not due to protein synthesis inhibition” are on-going and the obtained data could be added in the full revised version of our manuscript.

      However, we are unfavorable to use a siRNA against SphK2, in addition to opaganib, in the experiments done to measure the effect of SphK2 inhibition on the rate of AXL internalization (previously in Figure 6E and F, now Figure 6F and G) and the level of AXL at the cell surface (previously in Figure 6G and H, now Figure 6H and I). Indeed, we carefully chose a short (4 hours) incubation with opaganib at the end of which the total cellular level of AXL was not yet decreased, allowing to measure unambiguously a defect in AXL endocytosis or a change in the level of AXL at the cell surface. We believe that it would be very difficult to achieve similar experiments using a siRNA against SphK2. It would require to determine the exact time after siRNA transfection leading to a sufficient SphK2 level reduction but in conditions where AXL level is still maintained. We think that due to the mosaic transfection efficiency, being able to precisely synchronize the effect of a siRNA at its beginning is impossible.

      1. Does overexpression of SphK2 reverse the effects of the SphK2 inhibitor? In a similar manner, does overexpression of SphK2 enhance stabilization of AXL?

      To answer the first question, it is not clear for us how to test whether SphK2 overexpression can reverse the effects of the SphK2 inhibitor because the ectopically expressed SphK2 would also be sensitive to the inhibitor. This would require to overexpress a SphK2 mutant that is catalytically active but insensitive to the inhibitor, and to our knowledge, such a mutant does not exist.

      Regarding the second question, we are currently generating a retroviral DNA construct allowing to overexpress SphK2 homogeneously in the cell population. Then we will test whether it further increases AXL level through its stabilization. This will be tested in cells upregulated for flotillin. As we showed in Figure 6 A and D (previously Figure 6 A and C) that AXL level depends on SphK2 activity only in cells that overexpress flotillins, we anticipate that there will be no impact in a cell line with a moderate level of flotillin. Results could be added in the fully revised manuscript.

      1. Although the authors suggest recruitment of SphK2 and formation of S1P in UFIT, there are no measurements of S1P. Also, there is no indication that SphK2 is activated despite the fact that ERK and AKT are activated in UFIT and are known to phosphorylate and activate SphK2. Is SphK2 that is recruited to flotillin phosphorylated?

      To answer the first point raised by Reviewer#3, we recently performed, in collaboration with a lipidomic platform, a comparative analysis by quantitative mass-spectrometry of S1P levels between MCF10AmCh and MCF10AF1F2 cells. As we anticipated, the results show a 3,5-fold increase in S1P in MCF10AF1F2 cells compared with MCF10AmCh (Additional Figure 6). This data agrees with the fact that we found that the SphK2 catalytic activity is required for the UFIT pathway mediated AXL stabilization. This result is also in agreement with the study from the Nichols’ group which detect a decrease in S1P in cells in which flotillins were knocked out (Riento et al, PloS ONE, 2018). The results regarding the analysis of S1P level along with the complete methodology used will be added in the fully revised version of our manuscript.

      ADDITIONAL FIGURE 6 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST

      Additional figure 6: Upregulation of flotillins in MCF10A cells promotes an increase in the level of Sphingosine-1-phosphate. The level of sphingosine-1-phosphate was compared by quantitative mass-spectrometry analysis from three independent samples of MCF10AmCh and MCF10AF1F2 cells. The results are expressed in pmol equiv / 1 . 106 cells. The graph shows the value for each sample and the bar horizontal bars indicate the mean value for each condition.

      Regarding the second point, we would like to clarify that we do not think that SphK2 interacts directly or indirectly with flotillins because SphK2 did not co-immunoprecipitate with flotillins (not shown). Thus, investigating by western blotting SphK2 phosphorylation status in flotillin immunoprecipitates is pointless. In theory, we could investigate the activity-related phosphorylation status of SphK2 associated with flotillin rich-membranes and endosomes. But this seems difficult to achieve because unfortunately, the only two commercially available antibodies against phosphorylated SphK2 are not described to work for immunofluorescence staining. One is against the Thr578 residue (https://www.abcam.com/sphk2-phospho-t578-antibody-ab215750.html), identified as phosphorylated downstream of ERK by Sarah Spiegel’s group (Hait et al, J Biol Chem, 2007). The second is designed to recognize specifically the phospho-Thr614 residue (https://www.abcam.com/sphk2-phospho-t614-antibody-ab111948.html), but this site has not been rigorously demonstrated to be phosphorylated downstream of AKT or ERK or to stimulate SphK2 activity. Thus, considering the lack of appropriate tools and considering that we already showed, using opaganib, that the catalytic activity of SphK2 is required for the UFIT pathway, we believe that investigating the phosphorylation status of SphK2 reflecting its activity in flotillin-positive vesicles will be complicated to achieve in a reasonable amount of time and we think that it will not bring a higher value to our present study.

      To answer more broadly to the question “Is SphK2 recruited to flotillin phosphorylated?”, we anticipate that it could be the case at least on the Ser419 and Ser420 residues because Nakamura’s group demonstrated that the phosphorylation of these sites favors the nuclear export of SphK2 (Ding G et al, J Biol Chem, 2007). This group developed an antibody against these phospho-sites, potentially working by immunofluorescence. However, as it is unknown whether phosphorylation of these residues influences SphK2 activation status, we do not plan to perform immunofluorescence experiments with this tool (not available commercially) because the results would not address the Reviewer’s question.

      1. It should be determined whether the optogenetic system used to induce flotillin oligomerization also induces recruitment and activation of SphK2.

      As we already have all the available tools, optogenetic experiments will be performed to answer this point and the results could be added to the fully revised version of our manuscript.

      As suggested, we plan to perform experiments in which exogenous S1P will be added to cells with a moderate flotillin expression level to check whether it could recapitulate the effect of flotillin upregulation on AXL expression. Results could be added to the fully revised version of the manuscript.

      However, our current results on the localization and the involvement of SphK2 suggest that the generation of S1P involved in the UFIT pathway occurs at the plasma membrane and in late endosomes. Because the exogenous S1P that will be added in the culture medium will not go through the plasma membrane, we anticipate that it could be insufficient to mimic all the mechanisms of the UFIT pathway. Its effect will be limited to the plasma membrane. In addition, these mechanisms are very likely based on a local concentration of S1P in some microdomains (at the plasma membrane and in intracellular membranes) scaffolded by flotillins. It will be very difficult to mimic such local concentration of S1P just by adding S1P to the cells.

      We agree that identifying the S1P receptors involved would be of valuable interest for a better characterization of the UFIT pathway. However, we think that this is beyond the scope of our present study. Among the five known S1P receptors, we do not know if any could be involved in membrane remodeling at the plasma membrane to promote endocytosis. To our knowledge, involvement of S1P receptors in endocytosis has never been reported. However, based on the work by Nakamura’s group (Kajimoto et al, Nat Comm, 2013 and Kajimoto et al, J Biol Chem, 2018), the S1P1 and S1P3 receptors are involved in membrane remodeling and cargo sorting from the outer membrane of late endosomes (where flotillins accumulate in our cell models). We could hypothesize that these receptors are influenced by flotillins and are involved in the UFIT pathway. But we think that testing this hypothesis would be the subject of a distinct study.

      At the plasma membrane, we totally agree that the effect of S1P could be mediated, as suggested by De Camilli’s group (Shen et al, Nat Cell Biol 2014), by the formation of tubular endocytic structure rich in sphingosine after acute cholesterol extraction. Reciprocally, in our cell models, upregulated flotillins, thanks to their ability to bind to sphingosine (demonstrated by Nichols’ group (Riento et al, PloS ONE, 2018)) and to oligomerize, could create sphingosine-rich membrane regions.

      1. There is a commercial antibody for endogenous SphK2 that can be used to validate and substantiate the data with GFP-SphK2. (F1000Res . 2016 Dec 6;5:2825. doi: 10.12688/f1000research.10336.2. eCollection 2016. Validation of commercially available sphingosine kinase 2 antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence)

      We thank Reviewer #3 for this suggestion and advice. Being able to detect the localization of endogenous SphK2 in late endosome would be valuable for our study. We already tried with no success with antibodies from Sigma and Cell Signaling Technology (not described to work in immunofluorescence experiments).

      We will follow the advice from Reviewer #3 and test the anti-SphK2 antibody from ECM-Biosciences mentioned in the article by Neubauer and Pitson F1000 research, 2016. If we obtain interesting results, they will be included in the revised version of our manuscript.

      However, in experiments using SphK2-GFP, we noticed that in live cells, the signal in late endosomes was completely lost after fixation using paraformaldehyde. Similarly, we also observed in live cells that NBD-Sphingosine, added in the culture medium, quickly accumulated in flotillin-positive late endosomes (Additional Figure 7, this data could be added in the fully revised version of the manuscript), but this accumulation was no longer detectable after fixation. Based on these observations, we believe that SphK2 recruitment to flotillin-positive late endosomes is highly labile probably because it mainly involves its interaction with sphingosine molecules that are enriched in these intracellular compartments. This is supported by our observation that addition of opaganib, characterized as a sphingosine competitive inhibitor, displaces SphK2-GFP from flotillin-positive late endosomes in live cells (Figure S7D). In addition, we showed that SphK2-Halo is more recruited in CD63-positive late endosomes in cells overexpressing flotillins (Figure 5E). This could be due to a higher concentration of sphingosine promoted by flotillins (that bind to sphingosine) accumulating in these compartments.

      Thus, we will try the immunofluorescence staining of endogenous SphK2 using the recommended antibody, but it might be difficult to detect its presence in flotillin-rich late endosomes in fixed cells. The data could be added in the fully revised version of the manuscript.

      ADDITIONAL FIGURE 7 CAN NOT BE ADDED BUT IS AVAILABLE UPON REQUEST

      Additional figure 7: Visualization of NBD-sphingosine in flotillin-positive late endosomes. Live HS578T, MDA-MB-231 and MCF10AF1F2 cells expressing Flot1-mCherry were monitored by time lapse spinning disk confocal video-microscopy, 5 min after addition of fluorescent NBD-Sphingosine in the culture medium. On the right are shown still images corresponding to the boxed areas to illustrate the accumulation of NBD-sphingosine in virtually all flotillin-positive endosomes.

      Reviewer #3 (Significance (Required)): This is an interesting paper. If the authors confirm the involvement of Sphk2 and mechanism of action of S1P, this would be an important contribution to the field.

      Modifications done in the initial revised-version of our manuscript (at the time of the initial response). A full revised version will be provided after all the additional experiments asked by all the Reviewers will be achieved.

      Revisions are highlighted in grey in the initial revised-version of the manuscript

      1) Figure 1 has been modified and now includes results from a GSEA analysis as recommended by Reviewer #1. The texts of the corresponding legend and of the “Results” and “Methods” sections have been modified accordingly.

      1) The Figure 2 version that was inserted in the manuscript was wrong because it was a copy of Figure S2. However, the correct Figure 2 was uploaded to the Review Commons website and accessible for the Reviewers. The correct Figure 2 is now inserted in the manuscript.

      2) In the legend to panels C, E, F, J of Figure 2, the sentence: “The histograms show […] with control MCF10AmCh cells calculated from 4 independent experiments” was corrected to “The histograms show […] with control MCF10AmCh cells calculated from at least 4 independent experiments” because data shown in panel J are actually calculated from 8 independent experiments.

      3) Figure 6 has been modified with the addition of panel C showing the effect of SphK2 downregulation by siRNA on AXL and ZEB1 level in MDA-MB-231 cells. The text has been modified accordingly.

      4) In Figure 3 C, representative western blots have been added as asked by Reviewer #1.

      5) In the Supplementary information section, the full clinicopathological characteristics of only 9 patients were indicated, whereas Figure S4 mentioned 37 patients. We corrected this mistake and now provide the characteristics of all patients.

      6) In the sentence “Conversely, it induced ZEB 1 and 2 mRNA expression (Figures 1H and S1K) and ZEB1 protein expression (Figures 1I and S1L) (no anti-ZEB2 antibody is available)”, we removed “no anti-ZEB2 antibody is available”.

      7) The sentence previously on line 995-997 "to our knowledge this is the first report to describe ligand-independent AXL stabilization..." has been modified to “**To our knowledge this is the first report to describe AXL stabilization following its endocytosis”

      8) We are now referring to reference 18 (Planchon et al. J Cell Science, 2018) for the description of the cohort of 527 patients with breast cancer because this was missing.

    1. SciScore for 10.1101/2021.05.25.445649: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: In vivo lung inflammation: All in vivo experiments were performed in compliance with federal laws and institutional guidelines and have been approved by the Stanford University Institutional Animal Care and Use Committee.<br>IRB: Clinical cohorts and samples: Characterization of these samples was performed under a protocol approved by the Institutional Review Board of Stanford University (protocol #55718)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following primary incubation with the sera, 25 μl of 1:5000 diluted horse radish peroxidase (HRP) conjugated anti-Human IgG and IgA secondary antibodies (Southern Biotech) were added and incubated for 1h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained for viability with Live/Dead Fixable Staining Kit (ThermoFisher) as well as the following antibody cocktail: anti-CD3 (BioLegend; clone OKT3), anti-CD11c (BioLegend; clone S-HCL-3), anti-CD14 (BioLegend; clone M5E2), anti-CD16 (BioLegend; clone 3G8), anti-CD19 (BioLegend; clone SJ25C1), anti-CD32 (STEMCELL; clone IV.3), anti-CD32B/C (BioLegend; clone S18005H), anti-CD56 (BioLegend; 5.1H11), and anti-HLA-DR (BioLegend; clone L243).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>anti-CD11c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD14</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD16</div><div>suggested: (BioLegend Cat# 158402, RRID:AB_2876547)</div></div><div style="margin-bottom:8px"><div>anti-CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD32</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>STEMCELL</div><div>suggested: (STEMCELL Technologies Cat# 60021, RRID:AB_2891082)</div></div><div style="margin-bottom:8px"><div>anti-CD32B/C</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD56</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HLA-DR</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Human embryonic kidney (HEK) 293T (American Type Culture Collection, ATCC; CRL-3216) and Vero (ATCC; CCL-81) cells were grown and maintained in 1X Dulbecco’s Modified Eagle Medium (DMEM; ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After poly-D-lysine treatment, plates were washed three times with sterile water and then seeded with 1.5e6 cells of HEK 293T per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We did this by modifying a pCAGGS mammalian expression vector encoding the full-length Wuhan S and deleting its last 18 amino acids of the cytoplasmic domain, which we call pCAGGS-SΔ18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div><div style="margin-bottom:8px"><div>pCAGGS-SΔ18</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and Statistical analysis: The log10 transformed half-maximal serum neutralization titers (pNT50) were used to generate the heatmap to show the evolution of antibody responses in longitudinal samples collected at different time-points after COVID-19 disease symptom onset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNT50</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A non-linear curve and the half-maximal neutralization titer (NT50) were generated using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-human CD64 (BioLegend; clone 10.1), anti-B220 (BioLegend), anti-anti-Ly6G (BioLegend; clone 1A8), anti-MERTK (BioLegend; clone 2B10C42)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python version 3.8.5 was used for machine learning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.25.21257427: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The investigation was approved by the Yale University Institutional Review Board (IRB) and all study subjects provided written informed consent before participating in the study.<br>Consent: The investigation was approved by the Yale University Institutional Review Board (IRB) and all study subjects provided written informed consent before participating in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, serum was incubated with a fully random 12-mer bacterial display peptide library (1×1010 diversity, 10-fold oversampled) at a 1:25 dilution in a 96-well, deep well plate format.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and incubated with 50 μL of HRP anti-Human IgG Antibody (Pharmingen, 1:2,000) for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was obtained by venipuncture in a serum separator tube (BD Vacutainer®, Franklin Lakes, NJ) and the serum fraction was separated following centrifugation and stored at -80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Vacutainer®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism (v8) and Microsoft Excel for Windows 10 (v16.0.13001.20254) were used for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The findings are consistent with prior reports that did not detect spike RBD linear epitopes and may be due to multiple reasons including limitations in sensitivity and frequency/sample size, as well as the RBD’s complex secondary structure, which is thought to form immunogenic 3-D conformations, or non-continuous epitopes (11, 13, 17, 26). RBD specific antibodies are a minor proportion of total anti-spike IgG and linear RBD epitopes are not prominent IgG epitopes in natural SARS-CoV-2 infection (12, 13, 27). Nonetheless, the RBD is an important target of neutralizing antibodies that develop in vivo during natural infection (28), and possibly a driver for the evolution of mutations given its critical role in the virus life cycle (29, 30). Many of the SARS-CoV-2 variants that have evolved to date contain mutations that affect the RBD and result in decreased neutralization by RBD-specific antibodies (31), but not mAbs that bind outside the receptor-binding motif (32, 33). In this context dominant linear neutralizing epitopes may provide an increased role in immunity and compensate for loss of neutralization activity due to decreased IgG recognition of variant RBDs, and perhaps contribute to current mRNA vaccine efficacy in populations with high prevalence of B.1.1.7 and B.1.351 variants (34). Mutations that result in escape from dominant linear epitopes outside the RBD might also adversely affect host immunity and vaccine efficacy, particularly if compounded by RBD escape varia...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.23.445305: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed thrice with 1X-TBST and incubated with anti-SARS-CoV-2 N protein antibodies (catalogue No. ab272852, Abcam, 1:1000) in TBST with BSA (2%, w/v).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoblot was then incubated with HRP conjugated-goat anti-human IgG secondary antibodies (Millipore, AP309P) in a dilution of 1:10,000 for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Millipore Cat# AP309P, RRID:AB_11212373)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-SARS-CoV-2 N protein antibodies (Abcam) were diluted in 1X TBST and 100 μL of the diluted antibodies were allowed to interact with the coated N protein in the ELISA wells at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>The anti-SARS-CoV-2 N protein antibodies ( Abcam )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N protein antibodies ( Abcam )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were then washed with 200 μL of 1X TBST buffer three times followed by incubation with 100 μL of goat IgG-HRP antibody (Thermo Fisher Scientific) prepared in 1X TBST buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression construct of SARS-CoV-2 N protein was commercially procured through Addgene in a pGBW-m4046785 vector with N protein gene insert of 1253 bp under the control of T7 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGBW-m4046785</div><div>suggested: RRID:Addgene_145684)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MS spectrum was analysed with Agilent MassHunter Qualitative analysis software (B.07.00).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent MassHunter</div><div>suggested: (Agilent MassHunter Qualitative Analysis, RRID:SCR_019081)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pymol tool was used to superimpose the structure of 6WZO and modelled monomeric structure to build its dimeric form.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Later, a similar analysis was performed with the DiscoTope server.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DiscoTope</div><div>suggested: (DiscoTope, RRID:SCR_018530)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.20.21256954: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial complied with the Declaration of Helsinki and applicable local regulations and was approved by the Research Ethics Committee of Hospital General Dr. Manuel Gea Conzalez of Mexico City (approval number 12-120-2020, ClinicalTrials.gov identifier: NCT04517422).<br>Consent: All participants provided written informed consent before entering the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Finally, exploratory, non-prespecified (post-hoc) endpoints included: i) significance of the primary endpoint when splitting the population according to age (less than 50 years old vs 50 years and older), sex (male vs female), metabolic comorbidity (diabetes, hypertension or obesity vs none), viral load at baseline (below vs above median value at baseline) and time from symptom onset (one to four days vs five or more days); ii) time to symptomatic resolution, defined as the disappearance of all five core Covid19 symptoms according to patient diaries (fever, headache, cough, body aches and shortness of breath); and iii) number of days of use of acetaminophen, of loss of taste (ageusia) and of loss of smell (anosmia).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design: Randomized, quadruple-blinded (patient, caregiver, investigator and outcomes assessors), randomized, placebo-controlled, parallel-arms clinical trial, in outpatient subjects with recently diagnosed Covid19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study products (active or placebo) were given in coded, anonymous boxes, and subjects, caregivers, investigators and outcome assessors were unaware of the treatment allocation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Taking the average value (47%) and aiming at detecting a relative reduction of at least 35% with a two-sided alpha = 5% and power = 80% resulted in 150 subjects per study arm after rounding up.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed with the SPSS program v.24 (IBS Corp., Armonk, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations worth mentioning. First, no patients older than 60 years old were included in the study. However, the consistency of the effect across age subpopulations when splitting the study sample at the 50 years-old cutoff suggests the effects of this probiotic are not limited to young adults, but additional studies in older populations are warranted. Second, all subjects in the study were of Hispanic ethnicity, which has been associated to higher mortality in Covid19. 32 In our study, reduction of viral load in placebo group was slower than reported in similar studies where Hispanic subjects accounted for 50% or less of the study population. 18,19 Accordingly, our study population could be regarded as more challenging, but replication studies should be performed in more diverse populations. Third, the 16S stool microbiome analysis is still ongoing at the time of writing. Microbiome analysis could provide clues about the mechanism of action of the probiotic formula used in this trial and/or reveal if baseline enterotype influences the effectiveness of the probiotic. However, microbiome changes are not required for a probiotic to be effective since activity could be due to crosstalk between the probiotic strains per se and the host’s immune system. Results of microbiome analysis and digestive symptoms will be jointly reported in future publications. Fourth, the SARS-CoV2 strains affecting patients in this study were not determined. In our view, this st...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04517422</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Efficacy of L. Plantarum and P. Acidilactici in Adults With …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.20.445077: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (ATCC HTB-55) were cultured in EMEM medium complemented with 10% FCS, penicillin/streptomycin, 2 mM L-glutamine, non-essential amino acids and sodium pyruvate (Life technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effect (CPE) reduction assay: Cells were seeded in 96-well flat bottom plates in 100 μl at a density of 10000 cells/well of Huh7, 15000 cells/well of MRC-5 or 20000 cells/well of Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dose response assay: To evaluate the effect of compound treatment on viral progeny titers, confluent monolayers of Vero, Huh7 or MRC-5 were seeded in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MERS-CoV (strain EMC/2012; (3, 4)), SARS-CoV (Frankfurt-1 strain,(88)), SARS-CoV-2/Leiden-0002 (GenBank accession nr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MERS-CoV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(DFA) and its adenine phosphoramidate pro-drug (pDFA) were designed and synthesized, designated as 2c and 3a, respectively, as described in a previous report (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDFA</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.19.21257470: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The study was approved by the Ethics Committees from Hospital de Clínicas de Porto Alegre (CAAE: 30767420.2.0000.5327).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleic acid extraction: RNA was extracted from 600 μL of respiratory specimens using the Abbott mSample Preparation System (Promega, Madison, WI, USA) with an Abbott M2000 instrument (Abbott, Chicago, EUA), following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.19.21257237: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participant involvement and sample processing: Individuals deemed PCR-positive for SARS-CoV-2 by a clinician affiliated with the University of Florida in Alachua County were eligible for molecular epidemiology investigation as part of the statewide Screen, Test, and Protect (STP) program if they met the following criteria: If both criteria were met and informed consent for the use of the sample for the purpose of public health molecular surveillance was given, individuals were encouraged to arrive on site for sample collection as soon as possible to increase the probability of detectable virus for collection.<br>IRB: Patient samples were de-identified following Institutional Review Board approval prior to viral processing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The cells were observed daily for one month before being judged negative for virus isolation, with a blind passage performed 15 days post-inoculation of the cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were propagated in cell culture medium comprised of aDMEM (advanced Dulbecco’s modified essential medium, Invitrogen, Carlsbad, CA) supplemented with 10% low antibody, heat-inactivated, gamma-irradiated fetal bovine serum (FBS, Hyclone, GE Healthcare Life Sciences, Pittsburgh, PA), L-alanine, L-glutamine dipeptide supplement (GlutaMAX,), and 50 μg/mL penicillin, 50 μg/mL streptomycin, 100 μg/mL neomycin (PSN antibiotics, Invitrogen) with incubation at 37°C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L-alanine, L-glutamine dipeptide supplement (GlutaMAX,),</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>neomycin (PSN antibiotics,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture for viral infectivity: Vero E6 cells were used for SARS-CoV-2 isolation attempts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participant involvement and sample processing: Individuals deemed PCR-positive for SARS-CoV-2 by a clinician affiliated with the University of Florida in Alachua County were eligible for molecular epidemiology investigation as part of the statewide Screen, Test, and Protect (STP) program if they met the following criteria: If both criteria were met and informed consent for the use of the sample for the purpose of public health molecular surveillance was given, individuals were encouraged to arrive on site for sample collection as soon as possible to increase the probability of detectable virus for collection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Protect</div><div>suggested: (ProTECT, RRID:SCR_004531)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Illumina’s DRAGEN pipeline was used to derive sample consensus sequences, which were filtered based on a minimum of 70% coverage of the genome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DRAGEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Database sequence retrieval: Each Floridian sequence was used in a local alignment (BLAST) (28) search for the most (genetically) similar non-Floridian sequence in the GISAID database as of March 23, 2021, and linked to two reference sequences including the best match (highest E-value) with a date occurring within one month following, as well as one month prior to the sampling date of the Floridian sequence (15).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Of course, Google Search is an advertising company, not a reliable information company. At the very least, we must ask when we find these kinds of results, Is this the best information? For whom? We must ask ourselves who the intended audience is for a variety of things we find, and question the legitimacy of being in a “filter b u b b l e ,”3 when we do not want racism and sexism, yet they still find their way to us.

      I definitely think that search engines like Google are viewed as a neutral and trustworthy resource for information. But since Google's framework is indeed an advertising and corporate model this concept of "neutrality" is in fact illusionary, and racism and sexism creep in through the algorithms. I definitely think Google user's blind belief of receiving "neutral" and "reliable" free from prejudice, means that the harmful affects of Google's often go unnoticed and are subconsciously absorbed into the user's psyche. How can we be more cautious and shed light on biased information sources that from the outside seem harmless or trustworthy?

    1. SciScore for 10.1101/2021.05.20.444757: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the blocking buffer was aspirated and 50 μl of primary antibody solution (anti-SARS-CoV-2-NP (RRID: AB_2890255) 1:5000 diluted in PBS + 1% FBS) was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-NP</div><div>detected: (Antibodies-Online Cat# ABIN6952435, RRID:AB_2890255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, 50 μl of the secondary antibody solution (Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L) (RRID: AB_10015289) 1:2000 in PBS, 1% FBS) was added to the wells and the plate was incubated for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse IgG</div><div>detected: (Jackson ImmunoResearch Labs Cat# 115-035-003, RRID:AB_10015289)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with the primary antibody solution, 50 μl secondary antibody solution (Goat IgG anti-Mouse IgG (H+L)-Alexa Fluor 488, MinX none 1:2000 (RRID: AB_2338840), Phalloidin CF647 1:100 (Biotium) in PBS + 1% FBS) were added to each well and the plate was incubated for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>detected: (Jackson ImmunoResearch Labs Cat# 115-545-003, RRID:AB_2338840)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">End-point dilution assay: VeroE6 cells were seeded at a density of 10,000 cells per well in a 96-well plate and maintained in 200 μl DMEM (Gibco) supplemented with 10% fetal bovine serum (Sigma-Aldrich), L-glutamine (Gibco), penicillin and streptomycin (Gibco) overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IAV plaque assay: MDCK-II cells were seeded in 6 well plates, and cultured in DMEM supplemented with 5% FBS and 1% Penicillin-Streptomycin until 100% confluent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-II</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess M- and N-gene copy numbers, the M- and N-gene were partially cloned into pCR™2.1 (ThermoFisher Scientific) or pMiniT 2.0 (NEB), respectively, and a 1:10 plasmid dilution series was used as a reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR™2.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inhibitory concentration 50 (IC50) was calculated using GraphPad Prism 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 10 highest abundant peptide ions were fragmented by HCD (NCE [normalized collision energy] = 27) and MS/MS spectra were acquired at a resolution of 35,000. Proteomics Data Analysis: Peptide identification and quantification were performed using MaxQuant (v.1.6.17) searching UniProtKB/SwissProt (2020_05, 563,552 entries) restricted to either Homo sapiens or Homo sapiens and SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO annotation and enrichment analyses were performed using STRING (v.11).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization was done using R and Cytoscape (v.3.8.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited at the ProteomeXchange consortium via the PRIDE partner repository with the dataset identifier PXD000XXX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteomeXchange</div><div>suggested: (ProteomeXchange, RRID:SCR_004055)</div></div><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptomics: Quality and integrity of total RNA was controlled on 5200 Fragment Analyzer System (Agilent Technologies)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Technologies</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All FASTQ files were aligned to the gene model Ensembl v96 and to the reference library Human B38 using the proprietary OmicSoft Aligner OSA62.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed genes were sent to Ingenuity Pathway Analysis (IPA) (https://digitalinsights.qiagen.com/products-overview/discovery-insights-portfolio/analysis-and-visualization/qiagen-ipa/) for biological analysis using the cutoffs: p-value <0.05, fold change (fc) >|1.5| and mean counts min>5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Differences in transformed data were tested for significance using GraphPad Prism v8.4.2 for Windows (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.20.444952: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Cell culture of human intestinal organoids and human airway: Human small intestinal tissue was obtained from the UMC Utrecht with informed consent of the patient.<br>IACUC: The study was approved by the UMC Utrecht (Utrecht, The Netherlands) ethical committee and was in accordance with the Declaration of Helsinki and according to Dutch law.<br>IRB: The Medical Ethical Committee of the Erasmus MC Rotterdam granted permission for this study (METC 2012-512).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experiments were not randomized and the investigators were not blinded to the sample allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experiments were not randomized and the investigators were not blinded to the sample allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Quantification and statistics: No statistical methods were used to predetermine sample size.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 8 hours incubation, cells were fixed with formalin, permeabilized with 70% ethanol and stained with polyclonal rabbit anti-SARS-CoV nucleoprotein antibody (1:1000; 40588-T62, Sino Biological) followed by secondary Alexa488 conjugated goat-anti-rabbit antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>polyclonal rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody ( Invitrogen) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunofluorescence, primary antibodies used were mouse anti-nucleoprotein (1:200; 40143-MM05, Sino Biological),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleoprotein</div><div>suggested: (Sino Biological Cat# 40143-MM05, RRID:AB_2827977)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mouse anti-dsRNA (1:200; Scicons), goat anti-ACE (1:100; R&D Systems, AF933), goat anti-DPP-4 (1:200; R&D systems, AF1180) and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE</div><div>suggested: (LSBio (LifeSpan Cat# LS-C96272-200, RRID:AB_2032850)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunofluorescence, organoids were incubated with the corresponding secondary antibodies Alexa488-, 568- and 647-conjugated anti-rabbit and anti-goat (1:1,000; Molecular Probes) or Phalloidin-Alexa488 (Thermofisher Scientific) in blocking buffer containing 4ʹ,6-diamidino-2-phenylindole (DAPI; 1;1,000, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody used was rabbit anti-TMPRSS2 (1:100; Abcam, ab109131) followed by anti-rabbit conjugated to horseradish peroxidase (Powervision, Leica) For Western blot of CTSL, organoid proteins were solubilized using a standard RIPA buffer for 30 min on ice in the presence of protease inhibitors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Abcam Cat# ab109131, RRID:AB_10863728)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both primary antibodies, mouse anti-CTSL (± 25 kDa) and mouse anti-ITGB4 (± 200 kDa), were incubated O/N at 4C in PBS/10% milk protein/0.1% Tween20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CTSL</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ITGB4</div><div>suggested: (LSBio (LifeSpan Cat# LS-C43630-200, RRID:AB_1055018)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mouse IgG2a antibody against ITGB4, 58XB4, was a gift from A. Sonnenberg (NKI, Amsterdam, The Netherlands).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse IgG2a</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cell lines: Vero and VeroE6 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal calf serum (FCS), HEPES, sodium bicabonate, penicillin (100 IU/mL) and streptomycin (100 IU/mL) at 37°C in a humidified CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in Opti-MEM I (1X) + GlutaMAX (Gibco)(Gibco) supplemented with 10% FCS, penicillin (100 IU/mL) and streptomycin (100 IU/mL) at 37°C in a humidified CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV (isolate HKU 39849, genbank accession no. AY278491), SARS-CoV-2 (isolate Bavpat-1; European Virus Archive Global #026V-03883; kindly provided by Dr. C. Drosten) were propagated on VeroE6 cells in Opti-MEM I (1X) + GlutaMAX (Gibco), supplemented with penicillin (100 IU/mL) and streptomycin (100 IU/mL) at 37°C in a humidified CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection of organoids for CRISPR-Cas9 experiments: sgRNAs targeting loci of interest were cloned into a SpCas9-EGFP vector (addgene plasmid #48138) using a protocol described before58. sgRNAs were designed using WTSI website (https://www.sanger.ac.uk/htgt/wge/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SpCas9-EGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To obtain differentiated organoid-derived cultures, organoids were dissociated into single cells using TrypLE express (Gibco; #12604013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPR/Cas9-mediated indel formation was confirmed by sanger sequencing of these amplicons (Macrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Macrogen</div><div>suggested: (Macrogen, RRID:SCR_014454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using ImageQuant TL 8.2 image analysis software (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stained organoids were imaged using a SP8 confocal microscope (Leica) or a Zeiss LSM700, and image analysis and presentation was performed using ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read 2 was aligned to the CRCh38 human RefSeq transcriptome, with the addition SARS-CoV-2 (Ref-SKU: 026V-03883) or MERS (NC_038294.1) genomes, using BWA using standard settings64.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalization using the median of ratios method and differential gene expression analysis was performed using the DESeq2 package64.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed with the GraphPad Prism 9 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The current COVID-19 pandemic has exposed weaknesses in our preparedness for coronavirus pandemics. No effective coronavirus antivirals are approved for use in humans and all completed large-scale COVID-19 drug trials have failed to show efficacy to this date, including (hydroxy)chloroquine and remdesivir8,47. The disappointing clinical effects of (hydroxy)chloroquine in humans in particular highlights gaps in the understanding of fundamental coronavirus biology. (Hydroxy)chloroquine, an inhibitor of the endosomal acidification was identified as a potent inhibitor of SARS-CoV48 and SARS-CoV-27 viral entry in cell line-based assay, confirmed here. In agreement with this, recent whole genome CRISPR/Cas9 genetic screens in transformed cell lines again suggested that endosomal entry factors, such as cathepsin L, are crucial for SARS-CoV-2 entry9,49,50. Here, we use human intestinal organoids as a non-transformed model to study genes implicated in coronavirus biology. We have chosen to use only IOs since it is currently not possible to efficiently genetically engineer airway organoids due to limited clonal outgrowth of these cells. Nevertheless, IOs express the majority of host factors assessed, including proteases, to a similar level as the airways (Fig. 1). We confirmed that in this model ACE2 is the obligate entry receptor for SARS-CoV-2 and SARS-CoV, while DPP4 is the entry receptor for MERS-CoV, indicating that accessory receptors may not play crucial roles for these viruses....

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 32. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.15.21257254: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Our research was approved by the Ethics Committee of Beijing Ditan Hospital (No. 2021-010-01), and exemption of informed consent was obtained prior to sera collection.<br>Consent: Our research was approved by the Ethics Committee of Beijing Ditan Hospital (No. 2021-010-01), and exemption of informed consent was obtained prior to sera collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The highest dilution of serum that showed complete inhibition activity of SARS-CoV-2 was recorded as the neutralizing antibody titer (ID50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ID50</div><div>suggested: (bNAber Cat# bNAberID_50, RRID:AB_2491067)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with PBST, the array was then incubated for 20 min with a Cy3 labelled donkey anti-human IgG(H+L) antibody (Jackson ImmunoResearch, USA) (2 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG(H+L</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were expressed in HEK293 cells, followed by further purification on a Ni-NTA spin column (Thermo Fisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was placed into a 96-well plate and incubated at 37°C for 2 h in CO2 5%, and then 2□×□104 Vero cells were added and incubated again at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using the GraphPad Prism software 8.3 and Microsoft Excel with the unpaired t test and Mann-Whitney test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There were several limitations in this study. First, the mSAIS assay is in vitro, which might not accurately reflect results in vivo. Second, some conformational and glycosylation epitopes might not be detected using the peptide microarray that employed chemically-synthesized peptides (Wang et al., 2020). Finally, the number of serum samples from convalescent COVID-19 patients and vaccinees were limited. The results obtained in this study should be validated in a large different cohort in the future.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.15.444222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal procedures were performed under the approvals of the Institutional Animal Care and Use Committee of University of Washington, Seattle, WA.<br>Euthanasia Agents: Mice were injected intramuscularly into the gastrocnemius muscle of each hind leg using a 27-gauge needle (BD, San Diego, CA) with 50 μL per injection site (100 μL total) of immunogen under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line, a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.<br>Authentication: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of sera were added to the plates and, after washing, antibody binding was revealed using a hydrogen peroxidase coupled horse anti-mouse IgG antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line, a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK-ACE2 adherent cell line was obtained through BEI Resources, NIAID, NIH: Human Embryonic Kidney Cells (HEK293T) Expressing Human Angiotensin-Converting Enzyme 2, HEK293T-hACE2 Cell Line, NR-52511.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T-ACE2 cells (BEI NR-52511) were seeded at 1.25×104 cells per well in 50 uL D10 growth media (DMEM with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin) in poly-L-lysine coated black-walled clear-bottom 96-well plates (Greiner 655930).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Poly-lysine was removed, plates were dried for 5 min then washed 1× with water prior to plating cells HEK-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female BALB/c mice four weeks old were obtained from Jackson Laboratory, Bar Harbor, Maine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HexaPro-foldon construct used for immunization studies was produced as previously described (24) and placed into pCMV/R with an octa-histidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV/R</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Melting temperatures were defined as the maximum point of the first derivative of the melting curve, with first derivatives calculated using GraphPad Prism software after smoothing with four neighboring points using 2nd order polynomial settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Midpoint titers calculations (EC50) were generated based on fitted four point logistic equations using the SciPy library in Python, in which the EC50 was the serum dilution at which the curve reached 50% of its maximum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.12.21257125: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: COVID-19 Serum Samples: Studies were performed on sera from deidentified specimens submitted to the New York State Department of Health in response to a broad request for assay development and validations.<br>IRB: All testing and archiving of human specimens were done under a declared New York State Public Health Emergency and also approved by NYSDOH Institutional Review Board (IRB 20-021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples (25 μL at 1:100 dilution) and antigen-conjugated microspheres (25 μL at 5×104 microspheres/mL) were mixed and incubated 30 minutes at 37°C before washing and further incubation with phycoerythrin (PE)-conjugated secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-conjugated microspheres ( 25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PE-conjugated antibodies were chosen to specifically recognize, as indicated, total antibodies (pan-Ig), or, individually IgM, IgA, IgG, IgG1, IgG2, IgG3, IgG4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The target antigen is the SARS-CoV-2 N protein and only IgG antibodies were measured.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>only IgG antibodies</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For production of the recombinant SARS-CoV-1 Nucleocapsid protein, a cDNA copy of the N gene of SARS-CoV was produced by reverse transcription-PCR of RNA purified from Vero E6 cells that had been infected with SARS-CoV (strain Urbani; GenBank accession number AY278741).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthetic gene encoding the Receptor Binding Domain (RBD) a.a. 319-541 and S1 subunit a.a. 1-604 of the S glycoproteins were cloned into pcDNA 3.1 Myc/His in-frame with c-Myc and 6-histidine epitope tags that enabled detection and purification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA 3.1</div><div>suggested: RRID:Addgene_20407)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The N gene cDNA was ligated into the bacterial expression vector pET-28a(+) (Novagen (Merck-Millipore) Burlington,MA) for expression of carboxy-terminal His6-tagged full-length N protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a(+</div><div>suggested: RRID:Addgene_108949)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.3 Reagents: For MIAs, wash buffer and phosphate buffered saline pH 7.4, 0.05% sodium azide (PBS-TN) were purchased from Sigma (Sigma Aldrich, St. Louis, MO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigma ( Sigma Aldrich</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Vitros anti-SARS-CoV-2 IgG chemiluminescent immunoassay; 2) the Abbott Laboratories (Abbott Park, IL)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Abbott Laboratories SARS-CoV-2 IgG assay is a qualitative chemiluminescence test that we performed on the Abbott Architect i1000SR automated immunoassay analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0%); Specificity, 99.9% (99.4% - 100%). 4.7 Reporting of Statistical Methods: All graphs and statistical analyses to determine Spearman’s rank correlation coefficients were done using Prism 9.0 (Graphpad, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.16.444004: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were reviewed and approved by the Institutional Review Board of Vanderbilt University Medical Center.<br>Consent: The sample was obtained after written informed consent was obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, synthesized antibody-encoding DNA (∼2 μg per transfection) was added to OptiPro serum free medium (OptiPro SFM), incubated with ExpiFectamine CHO Reagent and added to 800 µl of ExpiCHO cell cultures into 96-deep-well blocks using a ViaFlo 384 liquid handler (Integra Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-encoding DNA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody, goat anti-human IgG conjugated to peroxidase, was added at 1:10,000 dilution in 1% milk in PBS-T to the plates, which were incubated for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, antibodies were biotinylated using NHS-PEG4-biotin (Thermo Fisher Scientific, cat# A39259) according to manufacturer protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NHS-PEG4-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After subtracting the background signal, the signal obtained for binding of the biotin-labeled reference antibody in the presence of the unlabeled tested antibody was expressed as a percentage of the binding of the reference antibody in the presence of 10 µg/mL of the anti-dengue antibody DENV 2D22, which served as a no-competition control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dengue</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real-time Cell Analysis (RTCA) Neutralization Assay Screen: To screen for neutralizing activity in the panel of recombinantly expressed antibodies, we used a high-throughput and quantitative RTCA assay and xCelligence RTCA HT Analyzer (ACEA Biosciences) that assesses kinetic changes in cell physiology, including virus-induced cytopathic effect (CPE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CPE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T, and bound ACE2 was detected using HRP-conjugated anti-mouse Fc antibody and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-NL63 and HCoV-229E alpha coronavirus spike proteins were purchased from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody expression, microscale transfection were performed (∼1 ml per antibody) of CHO cell cultures using the Gibco ExpiCHO Expression System and a protocol for deep 96-well blocks (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of antibody) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each spike protein mutant was transfected into HEK-293T cells and allowed to express for 22 hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque reduction neutralization test (PRNT): The virus neutralization with live authentic SARS-CoV-2 virus (USA-WA1) was performed in the BSL-3 facility of the Galveston National Laboratory using Vero E6 cells (ATCC CRL-1586) following the standard procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) sequencing core at an appropriate target concentration for 10X Genomics library preparation and subsequent sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genomics</div><div>suggested: (UTHSCSA Genomics Core, RRID:SCR_012239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FACS data were analyzed using FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, synthesized antibody-encoding DNA (∼2 μg per transfection) was added to OptiPro serum free medium (OptiPro SFM), incubated with ExpiFectamine CHO Reagent and added to 800 µl of ExpiCHO cell cultures into 96-deep-well blocks using a ViaFlo 384 liquid handler (Integra Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RTCA IC50 values were determined by nonlinear regression analysis using Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibodies, the inhibitory concentration at 50% (IC50) values were calculated in GraphPad Prism software by plotting the midway point between the upper and lower plateaus of the neutralization curve among dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SerialEM was used to collect movies at 29,000X nominal magnification with a calibrated pixel size of 0.81 Å/pixel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryogenic electron microscopy (Cryo-EM): Motion correction, CTF estimation, particle picking, and preliminary 2D classification were performed using cryoSPARC v3.2.0 live processing (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was iteratively refined and completed using a combination of Phenix, Coot, and ISOLDE (Adams et al., 2002; Croll, 2018; Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RMSD calculation for the differences in angle of antigen approach for different antibodies: The SARS-CoV-2 spike receptor binding domain coordinates present in each antibody-antigen complex were aligned in PyMOL (The PyMOL Molecular Graphics System, Version 1.2r3pre, Schrödinger, LLC.) using an all-atom alignment with 5 cycles of outlier rejection of atom pairs having an RMSD greater than 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04625725</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase III Double-blind, Placebo-controlled Study of AZD7442 …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04723394</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase III Study of AZD7442 for Treatment of COVID-19 in Outp…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04518410</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ACTIV-2: A Study for Outpatients With COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04501978</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ACTIV-3: Therapeutics for Inpatients With COVID-19</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 58 and 53. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.15.444128: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: EBOV and MARV work was conducted at the high-containment BSL4 facilities at the United States Army Medical Research Institute of Infectious Diseases.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells were tested negative for mycoplasma by the MycoAlert mycoplasma detection kit (Lonza, Morristown, NJ)</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were blocked with 5% BSA/TBST and blotted with anti-ErbB4 (Santa Cruz), ErbB2 (Cell Signaling), ErbB1, AKT, ERK, p38 (Cell Signaling), P-ErbB4 (Tyr1284), P-ErbB2(Tyr1248), P-AKT(Ser473), P-ERK(Thr202/Tyr204), P-p38 (Thr180/Tyr182) (Cell Signaling), and β-actin (Sigma-Aldrich, catalog A3854) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ErbB4</div><div>suggested: (Cell Signaling Technology Cat# 4757, RRID:AB_2099987)</div></div><div style="margin-bottom:8px"><div>ErbB2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ERK</div><div>suggested: (Thermo Fisher Scientific Cat# 85-86195-11, RRID:AB_2574775)</div></div><div style="margin-bottom:8px"><div>p38</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Tyr1284</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Tyr1248</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P-ERK(Thr202/Tyr204</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>β-actin ( Sigma-Aldrich , catalog A3854 ) antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lysates were obtained at 1.5 and/or 24 hours post-infection followed by Western blot analysis with antibodies targeting the phosphorylated and total forms of ErbB1, 2 and 4, p38/MAPK, ERK, and AKT, as described(Zona et al., 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AKT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with mouse mAb SARS-CoV-2 nucleocapsid antibody (SinoBiological, 1:100) and rabbit Claudin 7 polyclonal antibody (ThermoFisher, 1:200) overnight at 4°C, followed by 1 hour incubation at room temperature with goat anti-mouse AF488 (ThermoFisher, 1:400)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 30 µL Vero-E6-eGFP cells were added at 8000 cells/well to columns 1-24 24 hours before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks preparation and/or passaging: Belgium-GHB-03021 SARS-CoV-2 strain was recovered from a nasopharyngeal swab taken from an asymptomatic patient returning from Wuhan, China early February 2020 (Spiteri et al., 2020) and passaged 6 times on Huh7 and Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VEEV-TC-83-nLuc RNA was transcribed in vitro from cDNA plasmid templates linearized with MluI via MEGAscript SP6 kit (Invitrogen #AM1330) and electroporated into BHK-21 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dose response curves with lapatinib in Vero and Calu-3 cells (Figures 1E and 2B, respectively) were performed with a P3 USA-WA1/2020 SARS-CoV-2 virus harboring no deletion or point mutations in the MBC domain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero (ATCC), HEK-293T (ATCC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells (Apath LLC) and Calu-3 cells (ATCC) were grown in DMEM (10-013-CV, Corning) supplemented with 10% FBS (Omega Scinetific, Inc), 1% l-glutamine, 1% nonessential amino acids (Corning) and 1% penicillin-streptomycin (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Resistance studies: VEEV (TC-83) was used to inoculate U-87 MG cells at MOI of 0.1 and passaged every 24 hours by transferring an equal volume of viral supernatant to naive cells under increasing drug selection (2.5-5 μM, passages 1–3; 5-10 μM, passages 4-7; 10-15 μM, passages 8-10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U-87 MG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DENV2 (New Guinea C strain) TSV01 Renilla reporter plasmid (pACYC NGC FL) was a gift from Pei-Yong Shi (University of Texas Medical Branch, Galveston, Texas, USA) (Zou et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACYC</div><div>suggested: RRID:Addgene_102793)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pDONR223-ErbB4 was a gift from William Hahn & David Root (Addgene plasmid # 23875; http://n2t.net/addgene:23875; RRID:Addgene_23875) (Johannessen et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_23875)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ORF was recombined into a gateway compatible pGluc destination vector using Gateway technology (Invitrogen) and the construct was verified using Sanger sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGluc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, DENV RNA was transcribed in vitro from pACYC-DENV2-NGC plasmid by mMessage/mMachine (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACYC-DENV2-NGC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band intensity was quantified with ImageJ software (NIH)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adjustment for brightness, contrast and color balance were done using Fiji software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and Statistical Analysis: All data were analyzed with GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.13.444010: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Enrolled adults were healthy and provided informed consent prior to any study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">8 subjects each were randomly chosen from participants from age cohorts 18-55, 56-70, and 71+ years of age who received two doses of 100 mcg mRNA-1273.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with an anti-SARS-CoV spike primary antibody directly conjugated to biotin (CR3022-biotin) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates are washed and Sulfo-tag labeled anti IgG antibody is applied to the wells and allowed to associate with complexed coated antigen – sample antibody within the assay wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Viruses: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells were kindly provided by Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were propagated in Vero-TMPRSS2 cells to generate viral stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses were mixed with serial dilutions of sera or antibodies and then added to monolayers of ACE2-overexpressing 293T cells (gift of Michael Farzan and Huihui Mu), in triplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Saponin [Sigma, 47036-250G-F] in PBS), was added to the fixed Vero cells for 20 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface spike binding: HEK293T cells were transiently transfected with plasmids encoding full length SARS-CoV-2 spike variants using lipofectamine 3000 (L3000-001, ThermoFisher) following manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce SARS-CoV-2 pseudoviruses, an expression plasmid bearing codon-optimized SARS-CoV-2 full-length S plasmid was co-transfected into HEK293T/17 cells (ATCC#CRL-11268) cells with packaging plasmid pCMVDR8.2, luciferase reporter plasmid pHR′CMV-Luc (40) and a TMPRSS2 plasmid (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVDR8.2 , luciferase reporter</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHR′CMV-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: RRID:Addgene_53887)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All calculations are performed within Excel and the GraphPad Prism software, version 7.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then acquired on a BD LSR Fortessa X-50 flow cytometer (BD biosciences) and analyzed using Flowjo (BD biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.15.443978: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal experiments: Treatment of animals was in accordance with regulations outlined in the U.S. Department of Agriculture (USDA) Animal Welfare Act and the conditions specified in the Guide for Care and Use of Laboratory Animals (National Institute of Health, 2011).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female K18-hACE2 transgenic (B6.Cg-Tg(K18-ACE2)2Prlmn/J HEMI) were maintained at 20-22 °C and a relative humidity of 50±10% on a 12 hours light/dark cycle, fed with commercial rodent chow (Koffolk Inc.) and provided with tap water ad libitum.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies: AP-conjugated Donkey anti-human IgG (Jackson ImmunoResearch, USA, Cat# 709-055-149, lot 130049) or AP-conjugated Donkey anti-mouse IgG (H+L) minimal cross (Jackson ImmunoResearch, USA, Cat# 715-055-150, lot 142717) were applied, followed by the addition of PNPP substrate (Sigma, Israel, Cat# N1891).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 709-055-149, RRID:AB_2340501)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 715-055-150, RRID:AB_2340777)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CD16, plate was incubated with antibodies MD65-YTE and MD65-AG-YTE starting at 100 µg/ml with 2-fold serial dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CD64, antibodies were used starting at 10 µg/ml with serial dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD64</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sensors were loaded with CD32 (10 µg/ml), followed by a wash, and then incubated with antibodies MD65-YTE or MD65-AG-YTE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD32</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The original viral isolate was amplified by 5 passages and quantified by plaque titration assay in Vero E6 cells, and stored at -80°C until use.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female K18-hACE2 transgenic (B6.Cg-Tg(K18-ACE2)2Prlmn/J HEMI) were maintained at 20-22 °C and a relative humidity of 50±10% on a 12 hours light/dark cycle, fed with commercial rodent chow (Koffolk Inc.) and provided with tap water ad libitum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J HEMI</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sensors were then incubated with C1q native protein (250 nM; US Biologicals, USA, Cat# C0010-10D) for 180 s and then transferred to buffer-containing wells for another 180 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>US Biologicals</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then incubated with blocking solution containing 10% FBS in PBST (0.05% Tween-20), washed and incubated with the collected supernatant for 2 hours, followed by addition of relevant detection mAbs: biotin anti-human IFN-γ (Clone: 4S.B3, BioLegend); biotin anti-human TNF-α (Clone: MP6-XT22, BioLegend); or biotin anti-mouse IL-2 (Clone: JES6-5H4, BioLegend) SA-HRP (Jackson immunoresearch, PA USA) and TMB (Dako, Denmark) used for detection of mIL-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLegend)</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.14.444111: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Multiplex immunofluorescence staining: Multiplex immunofluorescence analyses were performed using 3-μm-thick sections of formalin-fixed and paraffin-embedded tissues.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CD147 antibody treatment, 3 mg/kg CD147 antibody (Meplazumab) was administered via the tail vein at 1 d.p.i.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD147</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mouse anti-human CyPA antibody (50 μg) and mouse anti-human CD147 antibody (Jiangsu Pacific Meinuoke Biopharmaceutical Co. Ltd, China, 50 μg) were used for antibody immobilization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CyPA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD147</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were developed following incubation with the secondary antibody (goat anti-mouse IgG (H+L), 31430, Thermo Fisher Scientific, 1:5000 dilution) at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 31430, RRID:AB_228307)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of stable knockdown and knockout cell lines: VeroE6 cells were transfected with supernatants containing lentiviruses encoding the shCD147 and shACE2 constructs (GeneChem Co. Ltd.) using Lipofectamine 2000 reagent (Invitrogen) to generate the CD147 and ACE2 knockdown cell lines, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GenePix, ScanArray Express, ArrayVision and MicroVigene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MicroVigene</div><div>suggested: (MicroVigene, RRID:SCR_002820)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism, version 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.13.21257129: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participant Selection: This protocol was approved by the University of Arizona Institutional Review Board and activated in January 2021.<br>Consent: Participants scheduled for vaccine appointments at Banner University Medical Center North site were approached with the IRB approved consent and sequentially enrolled.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell pellets were resuspended in 1 mL of X-VIVO 15 media with Gentamicin and Phenol Red (VWR #12001-988) containing 5% male human AB serum (Sigma #H4522-100ML), and incubated in 24-well plates overnight at 37°C with 5% CO2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed and incubated for 1hr in 1% PBS and milk containing anti-human Pan-Ig HRP conjugated antibody (Jackson ImmunoResearch catalog 109-035-064) at a concentration of 1:2000 for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Pan-Ig HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were emptied, washed 5 times with 200 μl/well of PBS (Fisher Scientific Hyclone PBS #SH2035), and incubated for 2 hours at room temperature with 100 μl/well PBS containing 0.5% fetal calf serum and 1 μg/ml detection antibody (7-B6-1-biotin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>7-B6-1-biotin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus neutralization assays: SARS Coronavirus 2, Isolate USA-WA1/2020 (BEI NR-52281) was passaged once on Vero (ATCC #CCL-81) cells at a multiplicity of infection of 0.01 for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CCL-81, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1 and RBD tetramers were validated by staining 293T cells as a negative control or 293T-hACE2-expressing cells72 (BEI Resources NR-52511) as a positive control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tetramer reagents were assembled by mixing 100μg/ml C-terminal Avitagged RBD or S1 (AcroBiosystems) with 100μg/ml streptavidin-PE (eBiosciences) or streptavidin-BV421 (Biolegend), respectively, at a 5:1 molar ratio in which 1/10 the final volume of streptavidin was added every 5 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in GraphPad Prism 9 and the R programming language version 4.0.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.14.444205: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse studies and in vivo infections: All mouse studies were performed at the University of North Carolina (Animal Welfare Assurance #A3410-01) using protocols approved by the UNC Institutional Animal Care and Use Committee (IACUC).<br>Euthanasia Agents: Flow cytometry analysis of immune cell infiltrates: For analysis of BAL fluid, mice were sacrificed by ketamine overdose, followed by cannulation of the trachea with a 19-G canula.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">F2 mice (226 males, 177 females) were weaned such that littermates were randomized to different experimental cages to further reduce litter- or batch-effects on the study, and mice were transferred at 5-6 weeks of age to the RSB laboratory for infection between 9-12 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">F2 mice (226 males, 177 females) were weaned such that littermates were randomized to different experimental cages to further reduce litter- or batch-effects on the study, and mice were transferred at 5-6 weeks of age to the RSB laboratory for infection between 9-12 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For Matute-Bello scoring samples were blinded and three random fields of lung tissue were chosen and scored for the following: (A) neutrophils in alveolar space (none = 0, 1–5 cells = 1, > 5 cells = 2), (B) neutrophils in interstitial space (none = 0, 1–5 cells = 1, > 5 cells = 2), (C) hyaline membranes (none = 0, one membrane = 1, > 1 membrane = 2), (D) Proteinaceous debris in air spaces (none = 0, one instance = 1, > 1 instance = 2), (E) alveolar septal thickening (< 2Å~ mock thickness = 0, 2–4Å~ mock thickness = 1, > 4Å~ mock thickness = 2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with antibodies against the following markers: efluor506 Viability Dye (Thermo Fisher, 65-0866-14), BUV395 anti-CD45 (Clone 30-F11, BD Biosciences), BV711 anti-CD11b</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD45</div><div>suggested: (BD Biosciences Cat# 740809, RRID:AB_2740472)</div></div><div style="margin-bottom:8px"><div>BV711</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For virus titration, the caudal lobe of the right lung was homogenized in PBS, resulting homogenate was serial-diluted and inoculated onto confluent monolayers of Vero E6 cells (ATCC XXX), followed by agarose overlay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15- week old CCR9-/- mice (strain 027041) and 15-week old female C57BL/6NJ mice (strain 005304) were purchased from Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCR9-/-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, CC-F2 mice, Trim14-deficient, and CCR9-/- mice were infected with 5×103 (CC-RIX with SARS-MA), 1×104 (CC-F2 with SARS-MA and SARS-CoV-2 MA10), and 1×105 (CC-RIX with HKU3-MA, Trim14Δ47/Δ47 and CCR9-/- mice with SARS-MA and SARS-CoV-2 MA10) plaque forming units (PFU) in 50 μl PBS intranasally at 9-12 (CC-RIX and CC-F2 mice) or 15 (CCR9-/- and C57BL/6NJ) weeks of age, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6NJ</div><div>suggested: RRID:IMSR_JAX:005304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sgRNA was mixed and co-injected with Cas9 RNA at 5ng/μl and 10ng/μl final concentrations into half-day-old C57BL/6J embryos (E0.5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trim14Δ47/Δ47 mice were born in normal Mendelian frequencies and showed no apparent defects in development, growth, or fecundity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trim14Δ47/Δ47</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric data were acquired on a cytometer (BD-X20; BD Biosciences) and analyzed using FlowJo software (Tree Star) (Figure S7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the F2 crosses, instead of a regression on haplotype probabilities, the R/QTL package conducts a regression of the trait of interest on the exact genotypes at each locus54.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R/QTL</div><div>suggested: (R/QTL, RRID:SCR_009085)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.12.443948: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Plasmacytoid dendritic cell isolation: Deidentified human blood from healthy individuals was collected with the approval of the Internal Review Board (IRB) of Emory University number IRB00045821.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Permeabilized cell monolayers were incubated with an anti-SARS-CoV-2 spike protein primary antibody (provided by Jens Wrammert, Emory University) conjugated to biotin for 2 hours at room temperature (RT), then washed 3 times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were cultured in complete DMEM medium consisting of 1x DMEM (Corning Cellgro), 10% FBS, 25 mM HEPES Buffer (Corning Cellgro), 2 mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were normalized and differentially expressed genes were analyzed using DESeq2 (Bioconductor)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data of all RNA sequencing will be deposited into the Gene Expression Omnibus (GEO) repository and the accession number will be available following acceptance of this manuscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism 8</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">8, ggplot2 R package, and GSEA software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.13.443734: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Female and male rats (Wistar, 7-8 weeks of age) were provided and handled by Preclinics Gesellschaft für präklinische Forschung mbH, (Potsdam, Germany).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific S protein expression was assessed via staining with Human anti SARS CoV S antibody (CR3022) (Creative Biolabs, Cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti SARS CoV S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRO-1214LC) followed by goat anti-human IgG F(ab’)2 fragment PE antibody (Immuno Research, Cat. 109-116-097) in a BD FACS Canto II cell analyzer and the FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-116-097, RRID:AB_2337677)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody analysis: SARS-CoV-2 Spike RBD protein specific IgG1 and IgG2a binding antibodies were detected via ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 Spike RBD protein specific IgG1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro protein expression: For detection of mRNA expression in cell culture, HeLa cells were seeded in 6-well plates at a density of 400.000 cells/well. 24h later, cells were transfected with 2μg of mRNA per well via Lipofection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, 100 μl of trypsinated VeroE6 cells (cells of one confluent TC175 flask per 100 ml) in DMEM with 2 % penicillin/streptomycin supplementation was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female and male rats (Wistar, 7-8 weeks of age) were provided and handled by Preclinics Gesellschaft für präklinische Forschung mbH, (Potsdam, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRO-1214LC) followed by goat anti-human IgG F(ab’)2 fragment PE antibody (Immuno Research, Cat. 109-116-097) in a BD FACS Canto II cell analyzer and the FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.02.09.21250610: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The primary studies under which the samples were collected received ethical clearance from PATH Institutional Review Board (IRB) (approval number 00004244).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image Analysis: Rapid antigen test result images were captured via the iPhone E25Bio Passport application (currently only available via TestFlight) and analyzed using image processing software, Image J (NIH), to machine-read and quantify test results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, performing individual antigen testing on a single nasal swab specimen can present further cost and logistical limitations when the frequency of antigen testing is increased, especially for wide-scale surveillance. For pooled sample testing, nasal swabs are collected from up to 20 individuals, each of the nasal swabs are then resuspended into 0.3-0.5 ml solution, and 50 μl from each nasal swab specimen is pooled into a mixture before applying 100 μl to a rapid antigen test (Fig. 2). If a pool tests negative by an antigen test, then all of the constituent nasal swab specimens are assumed negative. If a pool tests positive by the antigen test, then the constituent nasal swab specimens are putatively positive and should be re-tested in mini pools. If a mini pool remains positive, then antigen testing on individual nasal swab specimens can be performed. Pooled testing using rapid antigen tests is a cost-effective and public health conscious approach to expanding SARS-CoV-2 surveillance, thus further enabling societal reopening, especially in instances where capacity and resources are constrained. Our results show that the rapid antigen test can detect SARS-CoV-2 positive nasal swab specimens up to Ct value 30.1, even when the positive specimen is combined with 19 negative nasal swab specimens. While our experiments suggest that a pooling strategy for antigen testing may be beneficial for SARS-CoV-2 surveillance and identification of individuals during the infectious phase...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.12.443228: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: All mice involved in the experiments were approved by the Biomedical Research Ethics Committee of the Institute of Biophysics of the Chinese Academy of Sciences and were performed in compliance with the Guidelines for the Care and Use of Laboratory Animals of the Institute of Biophysics.<br>IACUC: Non-human primates, Rhesus macaques immunogenicity studies were performed in the animal facility of Guangxi Fangchenggang Biotechnology Development Co., Ltd. (GFBDCL), according to the guidelines of the Committee on Animals of GFBDCL (approval No.: SYXK2018-0004/200005).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunogenicity of I-P-R-F in rhesus macaques: To evaluate the immunogenicity of I-P-R-F in non-human primates, a total of 10 rhesus macaques (5 male and 5 female, weighing 3∼5 kg) purchased from Guangxi Fangchenggang Biotechnology Development Co., Ltd. were randomly assigned into four groups with one male and one female in each group and intramuscularly immunized with high does(50 μg) or low dose(10 μg) of I-P-R-F with or without alum as adjuvant two times at a 14-day interval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ploy-histidine tagged hACE2, rabbit anti-SARS-CoV-2 nucleocapsid, and HRP-conjugated goat anti-rabbit IgG (H+L) antibody antibodies were purchased from Sino Biological lnc. (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed with PBST (PBS containing 0.05% Tween 20) and incubated with goat anti-mouse IgG-HRP (1:5000, Cwbiotech) or goat anti-monkey IgG-HRP (1:10000, Invitrogen) at 37°C for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2×106 cells were blocked with anti-CD16/32 (anti-FcγIII/II receptor, clone 2.4G2) and stained with specific fluorescence-labeled antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD16/32 (anti-FcγIII/II receptor,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was collected at indicated time points, and the SARS-CoV-2 specific IgG and neutralization antibody titers in serum were determined.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was stock and amplified in Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD protein (rRBD) was also expressed in 293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-viral activity of IFNα: The IFNα bioactivity was determined by the anti-viral infection assay using the L929 fibroblast cell line sensitive to VSV infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L929</div><div>suggested: ECACC Cat# 86032004, RRID:CVCL_4238)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the neutralization of vaccinated mice serum, 293-hACE2 cells were seeded into 96-well plates (2×104 per well) and 3-fold serially diluted heat-inactivated serum samples were incubated with 100 TCID50 of pseudovirus for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated for 1 hour at 37°C and then transferred to the 96-well plates seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female (6-8-week-old) BALB/c or C57BL/6 mice were immunized intramuscularly or subcutaneously with different immunogens in 100μL using insulin syringes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL43R-E-luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the coding sequence for RBD with a 6 x his tag on C terminus was cloned into the pEE12.4 vector without a human IgG1 Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEE12.4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the pseudovirus was produced by co-transfection of the plasmid expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 expressing the SARS-CoV-2 spike protein into 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequence for SARS-CoV-2 RBD spanning S protein 319-541 (GenBank: YP_009724390) was codon-optimized for mammalian cells and synthesized by GENEWIZ, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence imaging data were analyzed by Living Image software (PerkinElmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Living Image</div><div>suggested: (Living Image software, RRID:SCR_014247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the samples were acquired by BD LSRFortessa flow cytometer (BD Bioscience), and the data were analyzed with Flowjo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Bioscience</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and statistical analysis: All statistical analyses were performed using Graphpad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33, 37 and 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.10.443532: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After 24 h incubation, five fields were randomly selected in each well to count the number of nuclei in fused and unfused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, antibodies and reagents: HEK 293T cells (ATCC CRL-3216 from American Type Culture Collection, Rockville, MD) and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Life Technologies), and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibiotics</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike protein S2 monoclonal antibody (1A9), PDI mouse antibody (Clone: RL90), Alexa 594- and Alexa 488-conjugated antibodies against mouse and rabbit IgG, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PDI</div><div>suggested: (Thermo Fisher Scientific Cat# MA3019A488, RRID:AB_2633336)</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">rabbit monoclonal antibody, the Calnexin (C5C9) rabbit monoclonal antibody and the FLAG-tag (D6W5B)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The eluted samples were separated by SDS-PAGE and analyzed by Western blotting using anti-FLAG M2 monoclonal antibody or SARS-CoV/SARS-CoV-2 Spike protein S2 monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV/SARS-CoV-2 Spike protein S2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35946, RRID:AB_2866558)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Input lysates and pulldown proteins were analyzed by western blotting with the anti-FLAG M2 monoclonal antibody (Sigma) and anti-GAPDH monoclonal antibody (Cell Signaling) as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Digested proteins were analyzed by Western blotting with anti-M2 FLAG monoclonal antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M2 FLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, antibodies and reagents: HEK 293T cells (ATCC CRL-3216 from American Type Culture Collection, Rockville, MD) and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Life Technologies), and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to transduce cells with pseudovirions, virus was added either to mock transfected 293T or ACE2-transfected 293T cell lines at 24 hr post-transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Treatment with N-glycosylation processing inhibitors and glycosidases: Tunicamycin (TM) and Kifunensine (KIF) at a concentration of 1 μg/ml and 5 μg/ml, respectively, were used to inhibit N-glycosylation in transfected HEK-293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The plasmids, pCDNA3.1-hACE2-FLAG and pCDNA3.1-pACE2-FLAG, which express human ACE2 (GenBank accession number NM_021804.3) and pig ACE2 (GenBank accession number NM_001123070.1) fused to a FLAG epitope, respectively, were purchased from GenScript, as well as the pCDNA3.1-TMPRSS2-FLAG expressing TMPRSS2 ( GenBank accession number NM_005656.4) fused to a FLAG epitope.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-hACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-pACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-TMPRSS2-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-SARS2-Spike</div><div>suggested: RRID:Addgene_145032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface biotinylation assay: Human 293T cells were transiently transfected with plasmids encoding FLAG-tagged hACE2 variants or FLAG-tagged pACE2 protein for 24h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate these viruses, Lenti-X 293 T cells (Takara Bio) grown in 10 cm dish were transiently transfected with the following plasmids: 5 µg of pLenti-GFP (Cell Biolabs), 6 µg of psPAX2 and 0.9 µg of pCMV-VSVG (Cell Biolabs), or 0.9 µg of pCDNA3.1-SARS2-SpikeΔ19, or 0.9 µg of pCDNA3.1-SARS-Spike using the TransIT®-LT1 Transfection Reagent (Mirus) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCMV-VSVG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-SARS2-SpikeΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-SARS-Spike</div><div>suggested: RRID:Addgene_145031)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were purchased from Thermo Fischer: SARS-CoV/SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fischer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed with NIS-elements software (Nikon).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIS-elements</div><div>suggested: (NIS-Elements, RRID:SCR_014329)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56 and 54. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.11.443693: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All work with infectious SARS-CoV-2 was carried out in a biosafety level 3 (BSL3) facility following approved protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral Propagation: Vero E6 cells were obtained from the American Type Culture Collection (ATCC CRL-1586) and cultured at 37°C, 5% CO2 in DMEM with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, and 1% L-Glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with the primary MAb, cells were washed three times with PBS, and developed with the Vectastain ABC kit and DAB Peroxidase Substrate kit (Vector Laboratory, Inc., CA, USA) according to the manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vector Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All plates were imaged on the InCell2200 and FFU quantified using Columbus Analysis software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Columbus Analysis</div><div>suggested: (CalR, RRID:SCR_015849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquired data were analyzed using Millipore Sigma Belysa™ v1.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Millipore Sigma Belysa™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical significance was determined using Prism v9.0.1 software (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A major limitation of these models is that we were only able to study the local epithelial-driven response by itself, without the contribution of myeloid cells or lymphocytes, which are important in mounting an appropriate innate immune response against viral infections. In general, we observed that both tracheobronchial and alveolar ALI tissues are capable of mounting a local epithelial-driven response to IAV and SARS-CoV-2 virus infection. Overall, IAV infected tissues had a stronger and earlier inflammatory response than SARS-CoV-2 infected ALI tissues, including inflammatory as well as anti-inflammatory immune modulators. And although myeloid cells were not included in this model, we hypothesize that the addition of the myeloid compartment in both tissues will show a more pronounced immune response that may reflect more accurately the different stages of human COVID-19 and severe influenza disease progression. Future studies will address the contribution of the lung epithelium and its role in recruiting additional inflammatory immune cells. While there has been intense high-throughput screening efforts to discover potential antivirals for SARS-CoV-2, relatively few compounds have proven to be effective in clinical settings. Most of the studies published have relied on traditional mono-cellular tissue culture models, which do not allow crosstalk among different cell populations. In some cases, relying on in vitro activity profiles may prove detrimental. This is the case fo...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.07.21256860: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Similar cases can be found in the literature, and therefore, it is important to consider that the compartmental model usually presents limitations for long-term prediction (even more than two months). Despite it, parameter estimation with the data is needed to validate this model, even when further considerations will be added to improve the quality of the fittings. COVID-19 motivates the generalization of the VSIR model with multiple vaccines, but instead of only focusing on this disease, we provided a more general preliminary model, but excluding the compartments of the extended models such as SEIR and SIRD. In this manner, our model attempts to use only the necessary compartments to extend the SIR model with multiple types of vaccines. However, the addition of E, D and other compartments, time-dependent parameters, and specific compartments for one and two doses would improve the model for the sole study of the COVID-19 pandemic. Theoretical analysis showed two important results. Could the vaccination itself manage to eliminate the outbreak? Proposition 4 and its general version 5 provide a negative answer for this question: if the reproduction number and the leakiness of the vaccine are high enough it is impossible to reach ℛc < 1, even with a very high vaccination rate. At the beginning of the pandemic, Billah, Mamun Mian, and Nuruzzaman Khan [5] estimated a summary for the reproductive number, which was 2.87. In this manner, vaccines with εL higher than 0.34843 might re...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.09.442808: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AMBRA (antigen-specific memory B cell repertoire analysis) of IgG antibodies: Replicate cultures of total unfractionated PBMC from SARS-CoV-2 infected or vaccinated individuals were seeded in 96 U-bottom plates (Corning) in RPMI1640 supplemented with 10% Hyclone, sodium pyruvate, MEM non-essential amino acid, stable glutamine and PenicillinStreptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific memory B cell repertoire analysis) of IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody discovery and expression: Antigen specific IgG+ memory B cells were isolated and cloned from total PBMCs of convalescent individuals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen specific IgG+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry of antibody on S Protein expressing ExpiCHO-S cells: For Expi-CHO cell transient transfection, S plasmids (21, 58) were diluted in cold OptiPRO SFM, mixed with ExpiFectamine CHO Reagent (Life Technologies, A29130) and added to the cells seeded at 6×106 cells/ml in a volume of 5 ml in a 50 ml bioreactor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A29130</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twelve-point 3-fold serial dilutions of S2P6 were prepared in DMEM and OC43 S VSV pseudoviruses were added 1:1 (v/v) to each dilution in the presence of anti-VSV-G antibody from I1-mouse hybridoma supernatant diluted 50 times (final volume: 50 μl).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ATCC (HEK293T and Vero-E6) or ThermoFisher Scientific (ExpiCHO cells, FreeStyle™ 293-F cells and Expi293F™ cells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a BSL3 facility, serial dilutions of mAbs (1:4) were incubated with 200 PFU (plaque forming units, corresponding to a multiplicity of infection of 0.01) of authentic SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero-E6 cells) for 30 minutes at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform pseudotype neutralization assays, VeroE6-TMPRSS2 cells were used for VSV-SARS-CoV-2, VSV-SARS-CoV-1, and VSV-GD19 and Huh7 cells were used for VSV-MERS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S D614G, used for production of SARS-CoV-2 postfusion, contains a mu-phosphatase signal peptide beginning at 14Q, a mutated S1/S2 cleavage site (SGAR), and ends at residue K1211 followed by a TEV cleavage, foldon trimerization motif, and an 8X his tag in a pCMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV pseudotype virus production and neutralization: Sarbecovirus spike cassettes with a C-terminal deletion of 19 amino acids (D19) were synthesized and cloned into mammalian expression constructs (pcDNA3.1(+) or pTwist-CMV) for the following Sarbecoviruses: SARS-CoV-2 (Accession QOU99296.1), SARS-CoV-1 (Accession AAP13441.1), hCoV-19/pangolin/Guangdong/1/2019 (GD19, Accession QLR06867.1), and Middle East respiratory syndrome-related coronavirus (MERS, Accession YP_009047204).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTwist-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UCA sequences of the VH and VL were constructed using IMGT/V-QUEST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation analysis: Conservation analysis was performed as described previously (Pinto et al 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiple sequences alignment was performed using MAFFT (https://mafft.cbrc.jp/alignment/software/) with the spike amino acid sequences as input.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were imaged with an automated microscope (Cytation5, Biotek), and nuclei and cells positive for the SARS-CoV-2 Nucleoprotein were quantified using the supplied Gen5 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization data were analyzed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several subsequent rounds of model building and refinement were performed using Coot (71), ISOLDE (72), Refmac5 (73), and MOE, to arrive at a final model for the complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two rounds of reference-free 2D classification were performed using cryoSPARC (76) to select well-defined particle images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.09.443238: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse immunizations: Mouse immunogenicity studies were performed under the guidelines and approval of the Institutional Animal Care and Use Committee (IACUC) at the National Institutes of Health.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing epitopes were probed using an Ace2-Fc(IgG1) fusion (0.2 ug/well) or a human IgG1 antibody containing the CR3022 variable domain (0.05 ug/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μl primary antibody was added to each well at the indicated concentration: Ace2 – 3.1 ng/mL, REGN10933, CR3022, and S309 – 1.5 ng/mL, and P2B-2F6 – 7.5 ng/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ace2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2B-2F6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody was incubated 1 hour at room temperature then plates were washed three times with PBST and 200 μl 1:5000 peroxidase-conjugated anti-human IgG was added (Jackson ImmunoResearch Laboratories, Inc. Cat.# 109-035-098).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μl primary antibody was added to each well at the indicated concentration: Ace2 – 3.1 ng/mL, REGN10933, CR3022, and S309 – 1.5 ng/mL, and P2B-2F6 – 7.5 ng/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ace2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2B-2F6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour incubation at room temperature, 20,000 HEK293 cells overexpressing Ace2 were added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Five 5-6 week old female CD-1 mice (Charles River Laboratories) per group were immunized with 10 μg antigen each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RRID:Addgene_99845)45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_99845)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Ace2-Fc fusion was expressed from pcDNA3: pcDNA3-sACE2(WT)-Fc(IgG1) was a gift from Erik Procko (Addgene plasmid # 145163; http://n2t.net/addgene:145163; RRID:Addgene_145163)47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_145163)</div></div><div style="margin-bottom:8px"><div>pcDNA3-sACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Ace2-Fc fusion was expressed from pcDNA3: pcDNA3-sACE2(WT)-Fc(IgG1) was a gift from Erik Procko (Addgene plasmid # 145163; http://n2t.net/addgene:145163; RRID:Addgene_145163)47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_145163)</div></div><div style="margin-bottom:8px"><div>pcDNA3-sACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extinction coefficients were calculated using the ExPASy ProtParam tool46.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExPASy ProtParam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This model was then edited in COOT to incorporate the amino acid changes present in immunogen 3 and subsequent rounds of refinement and model building were performed with COOT and PHENIX Refine53.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final model was evaluated with MolProbity, which showed good geometry, with 96.0% of the residues as Ramachandran favored and 0% outlier residues (Extended Data Table 2)54.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">% inhibition values were measured for each serum dilution in triplicate and average values were plotted in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.06.442916: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: For Western Blot, we used mouse anti-DAXX (diluted 1:1000, Abnova #7A11),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DAXX</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were goat anti-mouse and anti-rabbit HRP-conjugates (diluted 1:5000, GE Healthcare #NA931V and #NA934V).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (GE Healthcare Cat# NA931, RRID:AB_772210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were goat anti-rabbit AF555 and anti-mouse AF488 (diluted 1:1000, ThermoFisher #A-21428 and #A-28175).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# A-21428, RRID:AB_141784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For flow sorting of infected cells, we used the anti-S2 H2 162 antibody (diluted 1:150), a kind gift from Dr. Hugo Mouquet, (Institut Pasteur, Paris, France).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S2 H2 162</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody was donkey anti-mouse AF647 (diluted 1:1000, Invitrogen #A31571).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were goat anti-rat AF647 and anti-mouse AF488 (diluted 1:1000, ThermoFisher #A-21247 #A-28175).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat AF647</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, viruses & plasmids: HEK 293T (ATCC #CRL-11268) were cultured in MEM (Gibco #11095080) complemented with 10% FBS (Gibco #A3160801) and 2 mM L-Glutamine (Gibco # 25030081).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-11268G-1, RRID:CVCL_UE07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 (ATCC #CRL-1586), A549 (ATCC #CCL-185) and HEK 293T, both overexpressing the ACE2 receptor (A549-ACE2 and HEK 293T-ACE2, respectively), were grown in DMEM (Gibco #31966021) supplemented with 10% FBS (Gibco #A3160801), and penicillin/streptomycin (100 U/mL and 100 µg/mL, Gibco # 15140122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK 293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks were generated by infecting VeroE6 cells (MOI 0.01, harvesting at 3 dpi) using DMEM supplemented with 2% FBS and 1 μg/mL TPCK-trypsin (Sigma-Aldrich #1426-100MG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPR/Cas9 screen: 4×107 A549-ACE2 cells were treated with IFNα (200U/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Overexpression assay: 2×105 293T-ACE2 cells were seeded in a 24-well plate 18h before experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plentiCRISPRv.2 backbone was ordered through Addgene (Plasmid #52961). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259; #12260).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>plentiCRISPRv.2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMD2 . G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected with 500 ng of plasmids expressing HA-DAXX WT, HA-DAXX 15KR and HA-DAXXΔSIM plasmids, using Fugene 6 (Promega # E2691), following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-DAXXΔSIM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reference library was built using bowtie2 v2.2.9 (59).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read mapping was performed with bowtie2 allowing 1 seed mismatch in --local mode and samtools v1.9 (60)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mapping analysis and gene selection were performed using MAGeCK v0.5.6, normalizing the data with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAGeCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10 pmol of NLS-Sp.Cas9-NLS (SpCas9) nuclease (Aldevron #9212) was combined with 30 pmol total synthetic sgRNA (10 pmol for each sgRNA) (Synthego) to form RNPs in 20 µL total volume with SE Buffer (Lonza #V5SC-1002).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Aldevron</div><div>suggested: (Aldevron, RRID:SCR_011017)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR Fortessa and analyzed using FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis was performed using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism was used for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Linear models were computed using Rstudio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 13. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.05.442875: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures were approved by the Institutional Animal Care and Use Committee (protocol number 20-005) of Northern Arizona University. 4.2 Virus and Media: This study used coronavirus SARS-CoV-2 isolate USA-WA1/2020 (NR-52281; BEI Resources, Manassas, VA, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">hACE2 male and female mice (6-8 weeks) were used for these studies according to NIH guidelines for housing and care in a biosafety level 3 animal laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a t175 flask that was ~50% confluent was infected with SARS-CoV-2 virus, whereby 10 mL of fresh 2% FBS growth media containing 100μL of the BEI viral stock was added to VeroE6 cells and gentle rocked on a rocking platform for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.1 Mice: The K18-hACE2 COVID-19 transgenic mouse model (B6.Cg-Tg (K18-ACE2)2Primm/J, Stock No. 034860, Jackson Laboratory, Bar Harbor, ME, USA) was used in the current study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg (K18-ACE2)2Primm/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then processed for H&E staining and submitted to pathologist for analysis. 4.7 Statistical Analysis: Differences in data were tested for significance using either GraphPad Prism for Windows (GraphPad, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.05.442780: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Approval of animal experiments was obtained from the Institutional Animal Care and Use Committee of the Rocky Mountain Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal exposure and inoculation: Four to six-week-old female Syrian hamsters (ENVIGO) were exposed either via the intranasal, aerosol or fomite route as previously described by Port et al. 2020 [2].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: No mycoplasma was detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using GenScript U864YFA140-4/CB2093 NP-1 (1:1000) specific anti-CoV immunoreactivity was detected using the Vector Laboratories ImPress VR anti-rabbit IgG polymer (# MP-6401) as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NP-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Biorbyt Cat# orb14385, RRID:AB_10735740)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-specific antibodies were detected with goat anti-hamster IgG Fc (horseradish peroxidase (HRP)-conjugated, Abcam) for 1 h at RT and visualized with KPL TMB 2-component peroxidase substrate kit (SeraCare, 5120-0047).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hamster IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both variants were propagated in VeroE6 cells in DMEM supplemented with 2% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (DMEM2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.04.441029: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee (IACUC Protocol No. 12-08-391) and in strict accordance with its guidelines and those of the Council of Agriculture Guidebook for the Care and Use of Laboratory Animals.<br>Euthanasia Agents: Surviving mice after viral challenge were euthanized using carbon dioxide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All recordings and analyses were conducted blind to the experiential conditions (i.e., HA tag or Spike protein expression).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and respective dilutions are as follows: hACE2 (Abcam ab108209, 1:2500); HA (Cell Signaling #3725, 1:1000); and HSP90 (provided by Dr. Chung Wang, 1:5000) [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following commercial antibodies were used as primary antibodies for immunostaining: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); and rabbit anti-HA (Cell Signaling, 3742).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neuronal cultures were then fixed for immunofluorescence staining as described previously [18, 19] using the following primary antibodies: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); rabbit anti-HA (Cell Signaling, 3742); mouse anti-MAP2 (Sigma,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAP2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">M4403); mouse anti-GFAP (Millipore, MAB3402); and rabbit anti-GFP (Invitrogen, A6455).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Molecular Probes Cat# A-6455, RRID:AB_221570)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: CAG-hACE2 transgenic or wild-type (WT) mice were anesthetized and intranasally challenged with SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020 obtained from Taiwan Centers of Disease Control; lot: IBMS20200819) in a volume of 100 μL of sterile PBS at the indicated plaque-forming units (PFU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 infection: CAG-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-ΔR8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLAS2w.EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Puro and pcDNA3.1-nCoV-SΔ18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-nCoV-SΔ18</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting products were scanned on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data was analyzed using QuantaSoft™ software (Bio-Rad Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div><div style="margin-bottom:8px"><div>QuantaSoft™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Photoshop (Adobe) with minimal adjustment of brightness or contrast applied to the entire images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were carried out in Excel or GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 20, 21 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.03.442538: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments adhered to the guidelines approved by the Emory University Institutional Animal Care and Committee.<br>Euthanasia Agents: Quantification of infectious virus: At the indicated day post infection, mice were euthanized via isoflurane overdose and lung tissue was collected in Omni-Bead ruptor tubes filled with 1% FBS-HBSS.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All mice used in these experiments were females between 8-12 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used in this study: CD45:PE (Biolegend, Clone: 30-F11), CD45.2:BV605 (Biolegend, Clone: 104), CD11b:BUV395 BD Biosciences, 440c), I-A/I-E:AF700 (Biolegend, M5/114.15.2), CD11c:BUV737 (Biolegend, N418), CD26: PE-Cy7 (Biolegend, H194-112), CD172a:BV510 (Biolegend, P84), XCR1:AF647 (Biolegend, Zet), CD64: PerCpCy5.5 (Biolegend, X54-5/7.1), F4/80:FITC (Biolegend, BM8), H2kb:BUV805 (BD Biosciences, AF6-88.5), CD86:PE-Dazzle594 (Biolegend, GL1), Live/Dead Ghost Dye:R780 (Tonbo), CD3:APC-Cy7 (Biolegend, 145-2C11), CD19:APC-Cy7 (BD Biosciences, 1D3), NK1.1 (Biolegend, PK136), Ly6C:BV785 (Biolegend, Hk1.4), Ly6G:BV650 (Biolegend, 1A8), SiglecF:BV421 (BD Biosciences, E50-2440).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45.2:BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I-A/I-E:AF700</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD26</div><div>suggested: (BD Biosciences Cat# 749316, RRID:AB_2873690)</div></div><div style="margin-bottom:8px"><div>PE-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD172a:BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: (BD Biosciences Cat# 742023, RRID:AB_2871319)</div></div><div style="margin-bottom:8px"><div>PerCpCy5.5</div><div>suggested: (BD Biosciences Cat# 565364, RRID:AB_2869666)</div></div><div style="margin-bottom:8px"><div>F4/80:FITC</div><div>suggested: (Bio-Rad Cat# MCA497FA, RRID:AB_567113)</div></div><div style="margin-bottom:8px"><div>CD86:PE-Dazzle594</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3:APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19:APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NK1.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells and VeroE6-TMPRSS2-hACE2 cells were cultured in complete DMEM in the presence of Gibco Puromycin 10mg/mL (#A11138-03).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform plaque assays, 10-fold dilutions of viral supernatant in serum free DMEM (VWR, #45000-304) were overlaid on VeroE6-TMPRSS2-hACE2 cells monolayers and adsorbed for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This virus was then passaged 20 times in Balb/c mice followed by deep sequencing which identified 3 additional acquired mutations (S T417N, S H655Y, and E E8V).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of mice with MA-SARS-CoV-2: C57BL/6J and Ccr2-/- mice were purchased from Jackson Laboratories or bred in-house at the Yerkes National Primate Research Center rodent facility at Emory University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ccr2-/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VERO E6 cells (ATCC CRL-1586) were transfected with pCAGGS plasmid in which chicken actin gene promoter drives the expression of an open reading frame comprising Puromycin N-acetyl transferase, GSG linker, 2A self-cleaving peptide of thosea asigna virus (T2A), human transmembrane serine protease 2 (TMPRSS2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of mice with MA-SARS-CoV-2: C57BL/6J and Ccr2-/- mice were purchased from Jackson Laboratories or bred in-house at the Yerkes National Primate Research Center rodent facility at Emory University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jackson Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) was conducted using ranked gene list produced with Seurat FindMarkers function (comparing CoV2 samples with mock samples) and Genelist were obtained from: MsigDB (hallmarks) and https://www.nature.com/articles/s41422-020-00455-9#MOESM1 (macrophage suppressive and hyperinflammatory).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.03.442357: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Synthetic construction of SARS-CoV-2 mouse adapted strains were approved by the University of Texas Medical Branch Institutional Biosafety Committee.<br>IRB: For samples Emory University, collection and processing were performed under approval from the University Institutional Review Board (IRB #00001080 and #00022371).<br>Consent: Adults ≥18 years were enrolled who met eligibility criteria for SARS-CoV-2 infection (PCR or rapid antigen test confirmed by a commercially available assay) and provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All patients enrolled in July 2020 and had a mean age of 57 (range: 26-85; 50% male).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">No blinding was used in any sample collections, nor were samples randomized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">No blinding was used in any sample collections, nor were samples randomized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Viral mutants were confirmed by sequence analysis prior to use.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC was conducted using rabbit polyclonal antibodies raised against the SARS-CoV nucleocapsid protein (clone NB100-56576 [1:100], Novus Biologicals, Littleton, CO) and biotinylated anti-rabbit IgG, streptavidin AP (Vector Labs, Burlingame, CA) with Permanent Red chromogen (Dako/Agilent, Santa Clara CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV nucleocapsid protein</div><div>suggested: (Creative Diagnostics Cat# DMAB8869, RRID:AB_2392503)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slides were incubated with anti-SARS-CoV antibody for one hour at room temperature, washed in 1X Tris-buffered saline (TBS), 0.05% Tween 20 (wash buffer), and incubated with goat biotinylated anti-rabbit IgG (H + L) antibody for 30 min at room temperature followed by rinse in wash buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The medium from electroporated cells as harvested at 40 hours post transfection and served as seed stocks for amplifying one passage on Vero E6 cells (P1 stock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice and in vivo infection: Ten-week-old BALB/C mice were purchased from Charles River Laboratories and were maintained in Sealsafe™ HEPA-filtered air in/out units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/C</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">modeling: Spike receptor binding tables were constructed from a set of representative group 2B coronaviruses by using alignment data paired with neighbor-joining phylogenetic trees built in Geneious (v.9.1.5) using the spike amino acid sequences derived the following accession numbers: QHU79204 (SARS-CoV-2 WA1), AGZ48806 (RsSHC014), ALK02457 (WIV16), and AYV99817.1(SARS-CoV Urbani).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homology models were visualized and manipulated in PyMOL (version 2.4.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel for Mac 2011 was used to analyze data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pileup files were generated using Samtools v1.9 43 and minority variants were extracted by nucleotide voting (PHRED>=30) using a custom python3 script previously described 39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.09.443331: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The research protocol was approved by the Institutional Animal Care and Use Committee of WRAIR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each study group was composed of 10 hACE2 K18 Tg mice (5 males and 5 females).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly assigned to experimental groups and were not pre-screened or selected based on size or other gross physical characteristics.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the antibodies, plasmids encoding heavy and light chains of antibodies (CR3022, and SR1-SR5) were co-transfected into Expi293F cells (ThermoFisher) according to the manufacturer’s instructions for expression of antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-COV-2 antibodies were immobilized onto AHC biosensors (FortéBio) for 100 seconds, followed by a brief baseline in assay buffer for 15 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody positive (anti-RBD mouse mAb; BEI resources) and negative controls were included on each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies were HRP-conjugated AffiniPure Goat Anti-Mouse antibodies from Jackson ImmunoResearch specific for either Fcγ subclass 1, Fcγ subclass 2a, or Fcγ subclass 2c.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Fcγ subclass 1 , Fcγ subclass 2a , or Fcγ subclass 2c .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectivity and neutralization titers were determined using ACE2-expressing HEK293 target cells (Integral Molecular) in a semi-automated assay format using robotic liquid handling (Biomek NXp Beckman Coulter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was passaged once in Vero CCL81 cells (ATCC) and titrated by focus-forming assay on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum-virus mixtures were then added to Vero E6 cells in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c and C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the passive immunization study, on day −1, K18-hACE2 mice were injected intravenously with purified IgG from C57BL/6 vaccinated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The His-tagged SARS-CoV-2 RBD molecule was generated by amplifying the RBD domain from the RBD-Ferritin plasmid while encoding the 3’ purification tag and subcloned into the CMVR vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-Ferritin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human Immunodeficiency Virus 1 (HIV-1) NL4-3 ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-), ARP-3418, contributed by Dr. Nathaniel Landau and Aaron Diamond).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-domain ferritin nanoparticle fusions were modelled using Pymol and Coot (Emsley et al., 2010) and expanded using “phenix.apply_ncs” (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visual analysis and figure generation was conducted using ChimeraX and PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were imaged using a FEI T20 operating at 200 kV with an Eagle 4K CCD using SerialEM or using a Thermo Scientific Talos L120C operating at 120 kV with Thermo Scientific Ceta using EPU.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.1.1, and/or cisTEM-1.0.0-beta.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CTF estimation was done with CTFFIND 4.1.13 and used for 2D classification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CTFFIND</div><div>suggested: (CTFFIND, RRID:SCR_016732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified research grade nanoparticle immunogens were formulated in PBS with 5% glycerol at 1 mg/ml and subsequently diluted with dPBS (Quality Biological) to provide 10 μg or lower amount per 50 μl dose upon mixing with adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-Ferritin nanoparticle immunogens were formulated with ALFQ to contain 20 μg 3D-PHAD and 10 μg QS21 per 50 μl dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALFQ</div><div>suggested: (aLFQ, RRID:SCR_005925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay equivalency for SARS-CoV-2 was established by participation in the SARS-CoV-2 Neutralizing Assay Concordance Survey (SNACS) run by the Virology Quality Assurance Program and External Quality Assurance Program Oversite Laboratory (EQAPOL) at the Duke Human Vaccine Institute, sponsored through programs supported by the National Institute of Allergy and Infectious Diseases, Division of AIDS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Assurance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Quality Assurance Program Oversite Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves were generated using Prism software (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03186781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza HA Ferritin Vaccine, Alone or in Prime-Boost Regim…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03814720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579250</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04645147</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Epstein-Barr Virus (EBV) gp3…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04296279</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial For The Study of Falciparum Malaria Protein 014 Admi…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04784767</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SARS-COV-2-Spike-Ferritin-Nanoparticle (SpFN) Vaccine With A…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.07.443175: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants at Rockefeller University provided written informed consent before participation in the study and the study was conducted in accordance with Good Clinical Practice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 6 times with washing buffer and then incubated with anti-human IgG, IgM or IgA secondary antibody conjugated to horseradish peroxidase (HRP) (Jackson Immuno Research</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IC90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The enriched B cells were incubated in FACS buffer (1× PBS, 2% FCS, 1 mM EDTA) with the following anti-human antibodies (all at 1:200 dilution): anti-CD20-PECy7 (BD Biosciences, 335793), anti-CD3-APC-eFluro 780 (Invitrogen, 47-0037-41)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (GenWay Biotech Inc. Cat# 18-202-335793-0.1 mg, RRID:AB_1981874)</div></div><div style="margin-bottom:8px"><div>anti-CD20-PECy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3-APC-eFluro 780</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies: anti-IgD-BV421 (Biolegend, 348226), anti-CD27-FITC (BD biosciences, 555440), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD biosciences, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies: anti-IgD-BV421 ( Biolegend , 348226</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27-FITC</div><div>suggested: (Millipore Cat# FCMAB191F, RRID:AB_10807274)</div></div><div style="margin-bottom:8px"><div>anti-CD19-BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD71-PerCP-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG-PECF594</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM-AF700 ( Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec , 130-113-481)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The frequency distributions of human V genes in anti-SARS-CoV-2 antibodies from this study was compared to 131,284,220 IgH and IgL sequences generated by 45 and downloaded from cAb-Rep46, a database of human shared BCR clonotypes available at https://cab-rep.c2b2.columbia.edu/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hpt, filtered and stored at -80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_H376)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hpt, filtered and stored at -80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3ΔEnv-nanoluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2-SΔ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average of its signal was used for normalization of all of the other values on the same plate with Excel software before calculating the area under the curve using Prism V9.1(GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For monoclonal antibodies, the EC50 was determined using four-parameter nonlinear regression (GraphPad Prism V9.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins: Mammalian expression vectors encoding the RBDs of SARS-CoV-2 (GenBank MN985325.1; S protein residues 319-539) or K417N, E484K, N501Y RBD mutants with an N-terminal human IL-2 or Mu phosphatase signal peptide were previously described 43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteins</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single CD3-CD8-CD14-CD16-CD20+Ova-RBD-PE+RBD-AF647+ B cells were sorted into individual wells of 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III and FACSDiva software (Becton Dickinson) for acquisition and FlowJo for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies: anti-IgD-BV421 (Biolegend, 348226), anti-CD27-FITC (BD biosciences, 555440), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD biosciences, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Miltenyi</div><div>suggested: (Miltenyi Biotec, RRID:SCR_008984)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis was performed using MacVector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MacVector</div><div>suggested: (MacVector, RRID:SCR_015700)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.06.442911: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: (24) Animal Studies: All animal work was performed in accordance with protocols approved by the Lawrence Livermore National Laboratory Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-huFc, ACE2-rbFc, and VHH-huFc antibodies were produced by transient expression in CHO-S cells using the ExpiCHO expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VHH-huFc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A high diversity library was designed by incorporating the natural prevalence of amino acids at positions in CDR1 and CDR2 based off 670 functional VHH antibodies deposited on sdAb-DB (www.sdab-db.ca).(15) Amino acids cysteine and methionine were omitted from all CDR loops and full diversity was used for CDR3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CDR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody, goat anti-human H+L IgG HRP (Thermo) was added for an additional hour before washing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human H+L IgG HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-2-NG, VSV-SARS-2-GFP, or VSV-SARS-1-GFP was added to the serially diluted VHH-huFc antibodies for a final multiplicity of infection (MOI) of 0.2 (RG 2) or 0.1 (RG 3) and allowed to incubate at 37°C for 30 minutes to 1 hour with shaking prior to transfer of virus-VHH-huFc mixture to cells seeded in 96 (RG 3) or 384 well plates (RG 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-SARS-2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Expi293 cells were subsequently infected with VSV-DG-GFP, itself pseudotyped with VSV-G, at 72 h post-transfection using a multiplicity of infection (MOI) of 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH-huFc-virus complexes were incubated with Vero cells at 37°C with 5% CO2 for 12-16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 30-minute incubation of VHH-huFc-virus complexes with Vero E6 cells at 37°C with 5% CO2, overlays of 2 mL per well of 0.6% microcrystalline cellulose (MCC, Sigma 435244), in 8% FBS, 1% P/S complemented 2X MEM were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA Manipulation and Production of Proteins: pSF-CMV-SARS-2-S was constructed as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pSF-SARS-2-RBD was produced by commercial production of double stranded DNA encoding a N-terminal Kozak, a signal peptide (MDWTWRFLFVVAAATGVQS), 319-577 of the SARS-2 S gene (GenBank:MN908947.3), a TEV site, and a C-terminal, decahistadine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-SARS-2-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All DNA fragments and pSF-CMV vector restriction digested with EcoRI and BamHI were assembled using NEBuilder HiFi DNA master.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pAce2-huFc was produced by subcloning the ectodomain on human ACE2 (Sino Biological) into pCR-Fc using the NotI and BamHI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce Ace2-rbFc (rabbit Fc domain), a gBlock (IDT) of this same region of Ace2 was subcloned into pFUSE rIgG-Fc2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The minimum region containing all 3 CDR domains, approximately 300 bps, was excised from the pADL20c backbone by two-step restriction digests, BglI followed by DdeI/BstEII double digests on the gel-purified small fragment from the BglI restriction reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pADL20c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diversity of the nanobody library was determined by both NGS and colony PCR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCL files were converted to FASTQ and demutiplexed using the bcl2fastq script from MyIllumina (https://my.illumina.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality filtering and adaptor trimming were performed using fastp (https://github.com/OpenGene/fastp) with following parameters, -q 30 -l 100 -x 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://github.com/OpenGene/fastp</div><div>suggested: (fastp, RRID:SCR_016962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R2read was reformatted to be reverse complemented and merged with R1 read using BBTools (BBMap, https://sourceforge.net/projects/bbmap/).(17) Three CDR domains with correct sequence lengths were extracted, concatenated and translated and counted unique amino acid sequences using a custom python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dose response curves and 50% effective inhibitory concentrations (EC50) were generated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to Spike protein coding region of the SARS-2 Wuhan Hu-1 isolate (GenBank:MN908947.3) using Bowtie 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival curves were generated based on two independent experiments and log rank tests were performed with Bonferroni multiple comparison correction applied (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While vaccines have been great successes, therapeutic biologics are emerging as a critical tool in preventing progression to severe disease in those who do become infected.(31) Several therapeutic antibody candidates with efficacy against SARS-2 have been recently identified, including three with emergency use authorization, but there are a number of caveats associated with conventional antibodies as therapeutics such as time-consuming discovery, relying on immunized or patient sera, expensive and labor-intensive production, and the large doses required to achieve clinical efficacy. (9, 22, 32-34) High stability, solubility, and the ability to be multimerized, are just some of the many reasons why single-domain heavy chain-based antibody therapeutics (VHH-Fc) represent a highly promising method for treatment.(12) One VHH-based therapeutic is already approved by the FDA for treatment of a rare blood clotting disorder and many more are in late stage clinical trials.(12, 35) The small size of VHH antibodies and the wider distribution of CDR3 loop lengths compared to human IgGs expands the type of epitope which can be effectively targeted.(12) Finally, preliminary evidence suggests that VHH-Fc antibodies are transported more efficiently into the blood and lung parenchyma following intraperitoneal administration compared to conventional IgG1 antibodies.(36, 37) Several groups have recently used in vitro screening techniques to identify VHH domains with high affinity for the SARS-2...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Author Response:

      Reviewer #1:

      Summary and Strength:

      Single-cell RNA sequencing is the most appropriate technique to profile unknown cell types and Koiwai et al. made good use of the suitable tool to understand the heterogeneity of shrimp hemocyte populations. The authors profiled single-cell transcriptomes of shrimp hemocytes and revealed nine subtypes of hemocytes. Each cluster recognizes several markers, and the authors found that Hem1 and Hem2 are likely immature hemocytes while Hem5 to Hem9 would play a role in immune responses. Moreover, pseudotime trajectory analysis discovered that hemocytes differentiate from a single subpopulation to four hemocyte populations, indicating active hematopoiesis in the crustacean. The authors explored cell growth- and immune-related genes in each cluster and suggested putative functions of each hemocyte subtype. Lastly, scRNA-seq results were further validated by in vivo analysis and identified biological differences between agranulocytes and granulocytes. Overall, conclusions are well-supported by data and hemocyte classifications were carefully performed. Given the importance of aquaculture in both biology and industry, this study will be an extremely useful reference for crustacean hematopoiesis and immunity. Moreover, it will be a good example and prototype for cell-type analysis in non-model organisms.

      Thank you very much for your kind review. We hope that this paper will lead to a better understanding of the immune system of shrimp and further development of aquaculture.

      Weaknesses:

      The conclusions of this paper are mostly well supported by data, but some aspects of data analysis QC and in vivo lineage validation need to be clarified.

      1) It is not a trivial task to perform genome-wide analyses of gene expression on species without sufficient reference genome/transcriptome maps. With this respect, the authors should have de novo assembled a transcriptome map with a careful curation of the resulting transfrags. One of the weaknesses of this study is the lack of proper evaluation for the assembly results. To reassure the results, the authors would need to first assess their de novo transcripts in detail and additional data QC analysis would help substantiate the validity.

      The genome sequence of the kuruma shrimp M. japonicus has only been registered, and the high-quality data has not been published yet. Therefore, we could not perform validation using the genome sequence. However, by applying the BUSCO tool to the assembled sequences, we verified the quality of the assembly genes. Line 80-82 and 634-636.

      2) The authors applied SCTransform to adjust batch effects and to integrate independent sequencing libraries. SCTransform performs well in general; however, the authors would need to present results on how batch effects were corrected along with before and after analysis. In addition, the authors would need to check if any cluster was primarily originated from a single library, which could be indicative of library-specific bias (or batch effects).

      Thank you for your suggestion. The triplicate distribution after batch correction is shown in the Figure 2-figure supplement 1 and Figure 5-figure supplement 1. Line 123 (Figure 2-figure supplement 1), 244 ( Figure 5-figure supplement 1) and 686-689.

      3) Hem6 cells lack specific markers and some cells in this cluster are scattered throughout the other clusters (Fig. 1 & 2). Based on the pattern, it is possible that these cells are continuous subsets of other clusters. It would be good if the authors could group these cells with Hem7 or other clusters based on transcriptomic similarities or by changing clustering resolution. Additionally, they may also be a result of doublets, and it is unclear whether doublets were removed. Hem6 cells require additional measures to fully categorize as a unique subset.

      Based on the new UMI counts, we re-did in silico clustering and pseudotime analysis with new parameters. For Doublets, we assumed UMI less than 4000 this time because none of them had prominent UMI. Line 118 (Figure 2), 237 (Figure 5), 686-689 and 710-712.

      4) The authors took advantage of FACS sorting, qRT-PCR, and microscopic observation to verify in silico analyses and defined R1 and R2 populations. While the experiments are appropriate to delineate differences between the two populations, it is not sufficient to determine agranulocytes as a premature population (Hem1-4) and granulocytes as differentiated subsets (Hem5-9). To better understand the two groups (ideally nine subtypes), additional in vivo experiments would be essential. For example, proliferation markers (BrdU or EdU) could be examined after FACS sorting R1 and R2 cells to show R1 cells (immature hemocytes) are indeed proliferating as indicated in the analyses.

      Since stable culture of shrimp hemocytes is still difficult, it is difficult to implement BrdU assay now. We believe the advantages of our study are that single-cell analysis can be used in shrimp, that we explored marker candidates, and that we were able to provide guidelines for cell classification in the future. Of course, we are going to adapt BrdU or EdU assay on hemocytes in the feature.

      5) FACS-sorted R1 or R2 population does not look homogeneous based on the morphology and having two subgroups under nine hemocyte subtypes may not be the most appropriate way to validate the data. The better way to prove each subtype is to use in situ hybridization to validate marker gene expressions and match with morphology.

      What we want to show here is that it is very difficult to classify hemocytes by morphologically, and even if we could, it is likely to be divided into two rough groups (FACS result). As in the answer to the question above, we believe the advantage of this project is that we were able to search for marker candidates and provide guidelines for cell classification in the future. Of course, in the future, we hope to look at the function and expression of each gene. Since it is difficult to perform the in-situ assay or BrdU assay in shrimp hemocytes immediately, we have removed the Figure 7.

      Reviewer #2:

      In this manuscript Koiwai et al. used single cell RNA sequencing of hemocytes from the shrimp Marsupenaeus japonicus. Due to lack of complete genome information for this species, they first did a de novo assembly of transcript data from shrimp hemocytes, and then used this as reference to map the scRNA results. Based on expression of the 3000 most variable genes, and a subsequent cluster analysis, nine different subpopulations of hemocytes were identified, named as Hem1-Hem9. They used the Seurat marker tool to find in total 40 cluster specific marker transcripts for all cluster except for Hem6. Based upon the predicted markers the authors suggested Hem1 and Hem2 to be immature hemocytes. In order to determine differentiation lineages they then used known cell-cycle markers from Drosophila melanogaster and could confirm Hem1 as hemocyte precursors. While genes involved in the cell cycle could be used to identify hemocyte precursors, the authors concluded that immune related genes from the fly was not possible to use to determine functions or different lineages of hemocytes in the shrimp. This is an important (and known) fact, since it is often taught that the fruit fly can be used as a general model organism for invertebrate immunologists which obviously is not the case. Even among arthropods, animals are different. The authors suggest four lineages based upon a pseudo temporal analysis using the Drosophila cell-cycle genes and other proliferation-related genes. Further, they used growth factor genes and immune related genes and could nicely map these into different clusters and thereby in a way validating the nine subpopulations. This paper will provide a good framework to detect and analyze immune responses in shrimp and other crustaceans in a more detailed way.

      Strengths:

      The determination of nine classes of hemocytes will enable much more detailed studies in the future about immune responses, which so far have been performed using expression analysis in mixed cell populations. This paper will give scientists a tool to understand differential cell response upon an injury or pathogen infection. The subdivision into nine hemocyte populations is carefully done using several sets of markers and the conclusions are on the whole well supported by the data.

      Thank you for taking the time to review our paper. We hope that this paper will serve as a guideline for crustacean hemocyte research.

      Weaknesses:

      One obvious drawback of the paper is first the low number of UMIs. A total number of 2704 cells gave a median UMI as low as 718 which is very low. Especially shrimp no. 2 has an average far below 500 and should perhaps be omitted. Therefore, one question is about cell viability prior to the drop-seq analysis. The fact of this low number of UMIs should be discussed more thoroughly.

      By confirming the mitochondrial-derived sequences, we cleared up the suspicion that large numbers of dead cells were contaminating. We have also succeeded in increasing the number of UMIs by changing mapping software and adjusting the parameters. The value of UMIs is still lower than that of other model organisms, but we think that will improve as the reference genome is published in the future. I have discussed this in the manuscript. Line 87-89, 118 (Figure 2) and 716-717.

      Details about how quality control (QC) was performed would be needed, for example the cutoff values for number of UMI per cell, and also one important information showing the quality is the proportion of mitochondrial genes.

      As we answered in the above section, we checked and figured the results of mitochondrial contents. Since there are no set rules here, we set the parameters for one cell based on the initial distribution diagram. Line 87-89, 118 (Figure 2) and 686-689

      The clustering into nine subpopulations seems solid, however the determination of lineages based upon the pseudo time analysis with cell-cycle related genes is not that strong. The authors identify four lineages, all starting from hem1 via hem2-Hem3- Hem4 and then one to Hem5, another through part of Hem 6 to Hem 7, next through part of Hem 6 to Hem 8 and finally through part of Hem 6 to Hem 9. Referring to Figure 3 - supplement 3, it seems as if Hem6 could be subdivided into two clusters, one visible in B and C, while another part of Hem & is added in D.

      Based on the new UMI counts, we re-did in silico Clustering and pseudotime analysis with new parameters. It made more clear result. Line 118 (Figure 2), 237 (Figure 5), 686-689 and 710-712.

      Also, the data in figure 3 - supplement 1 showing expression of cell cycle markers do not convincingly show the lineages. Cluster Hem 3 and 4 seems to express much fewer and lower amount of these markers compared to cluster Hem6 - Hem9.

      As a result of the new clustering and other analyses, we can now see more clearly how growth-related genes vary along the clusters (Figure 7). Line 366 (Figure 7).

      It is also clear (from figure 5 - supplement 1) that there are more than one TGase gene and the authors would need to discuss that fact related to differentiation.

      Thank you for your suggestion. We discussed about different type of TGase in revised paper. Line 386-399, 457 (Figure 8-figure supplement 2).

      While the part to determine subpopulations is very strong, the part about FACS analysis and qRT-PCR is weaker than the other sections, and doesn't add so much information. Validation of marker genes and the relationship between clusters and morphology shown in figure 6 is not totally convincing. It seems clear that both R1 and R2 contains a mixture of different cell types even if TGase expression is a bit higher in R1. A better way to confirm the results could be to do in situ hybridization (or antibody staining) and show the cell morphology of some selected marker proteins in a mixed hemocyte population. FACS sorting is very crude and does not really separate the shrimp hemocytes in clear groups based on granularity and size. This may be because the size of hemocytes without granules vary a lot. You need cell surface markers to do a good sorting by FACS.

      We agree your comments that in situ hybridization or antibody staining are powerful tools to support our new findings. However, it is difficult to perform in-situ assay or preparation of antibody for shrimp hemocytes immediately. What we want to show here is that it is very difficult to classify hemocytes by morphologically, and even if we could, it is likely to be divided into two rough groups (FACS result). As in the answer to the question above, we believe the advantage of this project is that we were able to search for marker candidates and provide guidelines for cell classification in the future. Of course, in the future, we hope to look at the function and expression of each gene.

      Another minor issue is the discussion about KPI. There are a huge number of Kazal-type proteinase inhibitors in crustaceans and it is not clear from this data if the authors discuss a specific KPI-gene, and there is a mistake in referring to reference 65 which is about a Kunitz-type inhibitor.

      Thank you for your important pointing. In case of kuruma shrimp, de novo assembled genes and blast results showed low (around 60%) identity against L. vannamei’s Kazal-type proteinase inhibitor, not against kuruma shrimp. Therefore, we could not discuss about which type of KPI in this study. We consider it important that further research on KPIs for kuruma shrimp be conducted in the future. Also, as you pointed out, reference 65 was wrong, so we removed it. Line 474 (Figure 8-figure supplement 5).

      In summary, this paper is a very important contribution to crustacean immunology, and although a bit weak in lineage determination it will be of extremely high value.

      Thank you for giving us a good feedback. We understand that the evaluation of the gene as a marker and the expression of the marker gene in each cell is poor in not being able to confirm. However, we believe that our research will hopefully serve as a basis for future research.

      Reviewer #3:

      This manuscript by Koiwai et al. described the single-cell RNA-seq analysis of shrimp hemocytes and was submitted as a Resource Paper in eLife. In this study, they identified 9 cell types in shrimp hemocytes based on their transcriptional profiles and identified markers for each subpopulation. They predicted different immune roles among these subpopulations from differentially expressed immune-related genes. They also identified cell growth factors that might play important roles in hemocyte differentiation. This study helps to understand the immune system of shrimp and maybe useful for improving the control of the pathogen infections. The analysis of the data and interpretation is overall good but there are also some concerns:

      Thank you for your careful peer review. We hope that this paper will be useful to other researchers in the future. We have made a revise based on your comments, please review it again.

      1) The number of UMI and genes detected per cell after mapping to the in-house reference genome does not appear to be presented, and the similarities or differences between the three replicated samples are not discussed, as well as the low number of genes detected per cell (~300 in this study) .

      By confirming the mitochondrial-derived sequences, we cleared up the suspicion that large numbers of dead cells were contaminating. We have also succeeded in increasing the number of UMIs by changing mapping software and adjusting the parameters. The value of UMIs is still lower than that of other model organisms, but we think that will improve as the reference genome is published in the future. I have discussed this in the manuscript. Line 87-89, 118 (Figure 2) and 686-689.

      2) The correlation between the morphology and the expression of marker genes demonstrated in Figure 6 is questionable. Cells of the same size could express totally different genes. On the other hand, cells that are different in size can express nearly identical genes. The evidence presented in this manuscript is not enough to support a correlation between cell size and gene expression. Therefore, the author would either need to provide more evidence to support this correlation, or not make such correlation.

      Yes, we agree your comments. What we want to show here is that it is very difficult to classify hemocytes by morphologically, and even if we could, it is likely to be divided into two rough groups (FACS result). So, it is not surprising that similar cells may or may not express similar genes. However, some of genes can be used as markers for cell (may refer to cell size too), such as TGase or proPO genes.

      3) There are many spindle-shaped cells in Figure 6B, but none of them appeared in Figure 6C and D after sorting, and the reason for this is unclear.

      We don't have any idea why the cells were deformed either, and we think this is exactly why it is so difficult to classify hemocytes by morphologically. This reason is unknown as cell culture is also not currently possible.

      4) The hemocyte differentiation model in Figure 7 is not supported by any experimental data.

      We understood your comment. Since we could not conduct any functional research about marker genes, we have removed figure 7.

    1. SciScore for 10.1101/2021.05.05.21256681: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This work (ethics approval number 32077020.6.0000.0005) was approved on May 2020 by the National Committee in Ethics and Research, Brazil. in COMISSÃO NACIONAL DE ÉTICA EM PESQUISA.<br>IRB: This work (ethics approval number 32077020.6.0000.0005) was approved on May 2020 by the National Committee in Ethics and Research, Brazil. in COMISSÃO NACIONAL DE ÉTICA EM PESQUISA.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">As control tissue, FFPE lung of a healthy, 62-years old, male donor was used (NBP2-30182, Novusbio, cat. No 0028000B).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IAV foci immunostaining was achieved using mouse the anti-influenza A virus nucleoprotein monoclonal antibody clone AA5H (BioRad, MCA400) and visualised with goat anti-mouse IgG (H+L)-HRP conjugate (BioRad, 1721011) and TrueBlue Peroxidase Substrate (KPL, 5510-0030) following standard plaque assay protocols as described previously (Turnbull et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA400</div><div>suggested: (Bio-Rad Cat# MCA400, RRID:AB_2151884)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Bio-Rad Cat# 172-1011, RRID:AB_11125936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were probed with either antibodies raised against actin (mouse JLA20 hybridoma; courtesy of the Developmental Studies Hybridoma Bank, University of Iowa), OAS1 (rabbit polyclonal 14955-1-AP, Proteintech), OAS3 (rabbit polyclonal 21915-1-AP, Proteintech), or the rabbit anti-RNase L monoclonal antibody (Cell Signalling Technology, 27281).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies raised against actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OAS1</div><div>suggested: (Proteintech Cat# 14955-1-AP, RRID:AB_2158292)</div></div><div style="margin-bottom:8px"><div>OAS3</div><div>suggested: (Proteintech Cat# 21915-1-AP, RRID:AB_2876880)</div></div><div style="margin-bottom:8px"><div>anti-RNase L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, membranes were probed with species IgG-specific fluorescently labelled secondary antibodies goat anti-rabbit IgG or goat anti-mouse IgG (Thermo Scientific) and scanned using a LiCor Odyssey scanner.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining was performed using a rabbit anti-OAS1 monoclonal antibody [clone D1W3A] (Cell Signaling Technology, 14498) and sheep anti-SARS-CoV-2-nsp5 antiserum, (https://mrcppu-covid.bio described in (Rihn et al., 2021)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-nsp5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody staining was performed with Alexa Fluor™ 488 Goat anti-Rabbit IgG and Alexa Fluor™ 594 Donkey anti Sheep IgG both at 1:1000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti Sheep IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells were propagated from lab stocks and A549-NPro cells were a kind gift of Prof. Richard E. Randall.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-NPro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in MEM supplemented with 10% FCS, 2 mM glutamine, 2 mM sodium pyruvate and 100 μM non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Indiana vesiculovirus (VSV) was a kind gift of Dr. Megan Stanifer and was propagated on BHK cells at low MOI as described previously (Rihn et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral vectors were produced by transfecting 293T cells as described previously (Rihn et al., 2019) and 0.45 μm-pore-size-filtered supernatant was used to transduce AAT cells and were selected using 2 μg/ml puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ISRE::GFP cells (gift from Prof. Richard E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ISRE::GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus inputs were normalized using plaque assays on VeroE6 cells to 500 PFU per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Retroviral vectors and cell modification: The lentiviral vector pSCRPSY (KT368137.1) has been previously described (Kane et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSCRPSY</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLV-EF1a-IRES-Puro (Addgene plasmid # 85132) was modified by PCR amplifying the tagRFP ORF (using pSCRPSY as template) flanked by directional SfiI sites which were further flanked by BamHI and EcoRI restriction sites (forward oligo: 5’-CTC TCG GAT CCG GCC GAG AGG GCC ATG AGC GAG CTG ATT AAG-3’ and reverse oligo: 5’-CTC TCG AAT TCG GCC AGA GAG GCC TCA CTT GTG CCC CAG-3’) and the BamHI-EcoRI fragment was subcloned into the vector to create the modified pLV-EF1a-IRES-Puro-SfiI-tagRFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-EF1a-IRES-Puro</div><div>suggested: RRID:Addgene_85132)</div></div><div style="margin-bottom:8px"><div>pLV-EF1a-IRES-Puro-SfiI-tagRFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA corresponding to the ORFs of the following OAS genes (GenBank accession number): OAS1p46 (NM_016816), human OAS3 (NM_006187), macaque OAS1 (EF467665), bovine OAS1X (NM_178108), bovine OAS1Y (NM_001040606), bovine OAS1Z (AY650038), and Rhinolophus ferrumequinum OAS1 (XM_033097132 / Ensembl: ENSRFET00010016745) were chemically synthesised as gene-blocks with flanking SfiI sites (IDT DNA) and the SfiI fragment was subcloned into the modified pLV-EF1a-IRES-Puro-SfiI plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-EF1a-IRES-Puro-SfiI</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the human OAS1p42 sequence (in accordance with GenBank accession NM_002534), OAS1p46-c397a, and OAS1p42-CTIL sequences, the pLV-SfiI-OAS1p46 lentiviral vector plasmid was modified by overlap extension PCR (using primer pair 5’-CTC TCT GGC CGA GAG GGC CAT GAT GGA TCT CAG AAA TAC CCC AG-3’ and 5’-TCT CTC GGC CAG AGA GGC CTC AAG CTT CAT GGA GAG GGG CAG GGA TGA ATG GCA GGG AGG AAG CAG GAG GTC TCA CCA GCA GAA TCC AGG AGC TCA CTG GG-3’ for OAS1p42, primer pair 5’-CTC TCT GGC CGA GAG GGC CAT GAT GGA TCT CAG AAA TAC CCC AG-3’ and 5’-TCT CTC GGC CAG AGA GGC CTC AGA GGA TGG TGG CGG TCC AGT CCT CTT CTG CCT GTG GG-3’ for p46-c395a, and primer pair 5’-CTC TCT GGC CGA GAG GGC CAT GAT GGA TCT CAG AAA TAC CCC AG -3’ and 5’-TCT CTC GGC CAG AGA GGC CTC AGA GGA TGG TGC AAG CTT CAT GGA GAG GGG CAG GGA TGA ATG GCA GGG AGG AAG CAG GAG GTC TCA CCA GCA GAA TCC AGG AGC TC ACT GGG -3’ for p42-CTIL) and the SfiI-fragment was subcloned in place of OAS1p46 in the pLV lentiviral vector plasmid described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-SfiI-OAS1p46</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV lentiviral</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPR guides were designed using the CHOPCHOP online tool (https://chopchop.cbu.uib.no).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://chopchop.cbu.uib.no</div><div>suggested: (CHOPCHOP, RRID:SCR_015723)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post-acquisition, the contrast of images within each set were optimised using Zen software (Carl Zeiss) to equal degrees for the vector, p42, p42-CTIL and p46 C397A samples, whereas the histogram maximum was increased independently in the p46 sample shown in (Figure 4) to prevent oversaturation in the green channel due to strong perinuclear concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DIGS uses a nucleotide or amino acid sequence probe to perform a BLAST similarity search through genome assemblies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DIGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We first used the nucleotide sequence of the syntenic region of R. ferrumequinum to human exon 7 (Ensembl) and the adjacent 580bp region with the detected LTR insertion until homology resumes to the human genome as a probe (Supplementary digs_probes.fas).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matches were aligned using MAFFT v7.453 (Katoh and Standley, 2013) and inspected for covering all regions of the probe (Supplementary Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PDE analysis: To examine the diversity of PDE proteins encoded by coronaviruses we first constructed an HMMER protein profile.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HMMER</div><div>suggested: (Hmmer, RRID:SCR_005305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment was then manually curated using Bioedit based on the homology described in the literature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioedit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EMBOSS getorf program (Rice et al., 2000) was used to extract the translated sequences of all methionine starting open reading frames (ORFs) with length above 100 nucleotides from the filtered virus genome dataset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBOSS</div><div>suggested: (EMBOSS, RRID:SCR_008493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study was registered at https://www.isrctn.com/ISRCTN66726260. Pre-processed and STAR (Dobin et al., 2013) mapped paired-end reads of 499 whole-blood patient transcriptomes with known disease outcomes from the ISARIC4C study were analysed to stratify mild (hospitalised but not ICU-admitted patients) and severe (ICU admitted and/or deceased) patients further into p46 +ve and p46 -ve groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were implemented using IBM SPSS Statistics version 25 (IBM Corp. Armonk, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN66726260</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.02.442326: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were approved by the Institutional Review Board of Vanderbilt University Medical Center.<br>IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We studied one patient (a 59-year-old male) who received Pfizer-BioNTech vaccine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Mycoplasma testing of cell lines was performed on monthly basis using a PCR-based mycoplasma detection kit (ATCC, 30-1012K), with negative results at each testing.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with anti-IgG Alexa-Fluor-647-labelled secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG Alexa-Fluor-647-labelled secondary antibodies.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 binding was detected using HRP-conjugated anti-FLAG antibodies and developed with TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary J2 anti-dsRNA (Scicons #10010500) antibody solution at a 1:1,000 dilution was placed on the cells overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed with 0.1% Tween-20/PBS (PBST) three times and plates were incubated with secondary goat anti-mouse Alexa-Fluor-546-labeled antibody at 1:1,000 dilution (Thermo Fisher Scientific) for 2 h at room temperature in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: (Millipore Cat# FCMAB218F, RRID:AB_10919255)</div></div><div style="margin-bottom:8px"><div>anti-CD27-APC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700132, RRID:AB_10896618)</div></div><div style="margin-bottom:8px"><div>anti-CD38-PE</div><div>suggested: (Sigma-Aldrich Cat# P6722, RRID:AB_261136)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot assay: Direct enzyme-linked immunosorbent spot (ELISpot) assay was performed to enumerate plasmablasts present in the PBMC samples secreting IgG, IgM, or IgA antibodies reacting with either SARS-CoV-2-S6Pecto protein or influenza A/Darwin/42/2020 H1N1 hemagglutinin protein (as a negative control).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H1N1 hemagglutinin protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div><div style="margin-bottom:8px"><div>anti-human IgM-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech, catalog no. 2040-05), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech, catalog no. 2050-05), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech, catalog no. 2020-05) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA-HRP</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 (ATCC, CRL-1586) cells were maintained at 37°C in 5% CO2 in Dulbecco’s minimal essential medium (DMEM) containing 10% heat inactivated fetal bovine serum (FBS), 10 mM HEPES pH 73, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U/mL of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (ATCC, HTB-55) cells were maintained at 37°C in 5% CO2 in DMEM with high glucose and L-glutamine (Gibco 11965092), containing 10% heat inactivated fetal bovine serum (FBS), and 100 U/mL of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious stocks were propagated by inoculating Vero CCL81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface antigen-display assay: Vero cell monolayers were monitored until 80% confluent and then inoculated with VSV-SARS-CoV-2 V (WA1/2020 strain) at an MOI of 0.5 in culture medium (DMEM with 2% FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding cDNA for each S protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE c57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat map generation: All sequences that were identified to be public clonotypes were analyzed with PyIR66 to identify the V and J genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyIR66</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These frequency counts then were plotted onto the heatmap using Python Seaborn Library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expressed protein was incubated with BioLock (IBA Lifesciences) and then isolated by Strep-tag affinity chromatography on StrepTrap HP columns (GE Healthcare), followed by size-exclusion chromatography on TSKgel G4000SWXL (TOSOH) if needed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLock</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer:m GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons were sequenced on an Illumina Novaseq 6000, and data were processed using the CellRanger software v3.1.0 (10X Genomics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: (SCIGA, RRID:SCR_021002)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Prism v8.4.3 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.02.441948: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Blood donors provided written informed consent for the collection of samples and subsequent analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">BMDM were obtained from bone marrow of 6-10 week old female C57Bl6 mice (Charles River).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: To assure mycoplasma-free conditions, all cells were routinely tested.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CD14 cells were purified by anti-CD14 monoclonal antibody (mAb)-conjugated magnetic microbeads (Miltenyi Biotec) and then cultured for 6 days in RPMI 1640 medium (Life Technologies Invitrogen), supplemented with heat-inactivated 10% lipopolysaccharide-free FBS, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 2 mM L-glutamine, 25 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin (all from EuroClone) in the presence of human recombinant M-CSF (100 ng/µL; Peprotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD14</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slides were stained with primary antibodies diluted in 1% BSA in PBS (NF-kB and IRF1 1:400, NSP9 1:1000) for 90 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IRF1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NSP9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells labelled with DAPI and anti-NF-kB/NSP9 or anti-IRF1/NSP9 antibodies were imaged with a 60x 1.4 NA oil immersion objective lens on a CSU-W1 Yokogawa Spinning Disk confocal system with a 50 μm pinhole disk mounted on an Eclipse Ti2 stative and equipped with a motorized xyz stage, 6 solid state lasers, a multi-dichroic mirror, single emission filters and a Prime BSI sCMOS camera (TELEDYNE PHOTOMETRICS, Tucson, AZ 85706, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NF-kB/NSP9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IRF1/NSP9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The immunoprecipitation was performed using magnetic Dynabeads Protein G. Beads were blocked with 0,5% BSA in PBS and then mixed with the different antibodies (15 µg antibody:100 µl beads ratio) and incubated overnight on a rotating platform at 4°C. 1% of Triton X-100 was added to the sonicated lysates and lysates were centrifuged in microfuge (8000g, 10 min. at 4C) to pellet debris.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody:100</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, supernatants from infected cells were 10-fold serially diluted and titrated on target cells plated at 80-90% confluence (for MHV, L929 cells; for SARS-CoV2, VeroE6 cells) in 96 wells in a total volume of 100 µl, (8 replicate wells for MHV, 10 replicate wells for SARS-CoV2) and incubated at 37 °C under 5% carbon dioxide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid was used to produce lentiviral particles in 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bone marrow derived macrophages or L929 cells were seeded on a 12 glass-bottom wells (MatTek Corporation, Ashland, MA 01721, USA), coated with poly-D-Lysine 0.1% (w/v) in water (3×105 cells/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L929</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Raw264.7, L929, LA4, Calu3 and VeroE6 cell lines were purchased by American Type Culture Collection and grown according to ATCC recommendations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Raw264.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BMDM were obtained from bone marrow of 6-10 week old female C57Bl6 mice (Charles River).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of LSD1 KO cells by CRISPR/Cas9: The sgRNA oligo (see Reagents table) 10, targeting exon 3 of Lsd1, was cloned into pSpCas9(BB)-2A-GFP, a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138) 52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSpCas9</div><div>suggested: RRID:Addgene_48137)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_48138)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Forty-eight hours later, GFP-positive cells were single-cell sorted in 96-well plates and after clonal expansion, sublines were screened by Western blot against LSD1. RNAi Knockdown: To knock down LSD1, one short hairpin RNA (shRNA) sequences was tested. shLSD1#1 (see reagents table for sequence) was cloned into the pLKO vector by AgeI–Eco RI double digestion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLKO</div><div>suggested: RRID:Addgene_52920)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PolyIC was purchased from Cytiva and dissolved in PBS to a concentration of 1mg/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PolyIC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UV inactivation was performed on ice, using Agilent Genomics/Stratagene Stratalinker 2400 UV Crosslinker, by delivering an energy dose equivalent to 0,3 Joules.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Genomics/Stratagene</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Widefield images of the DAPI and Lysosensor were quantified using a custom-made ImageJ macro.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-seq data were mapped using STAR aligner 54 against the mouse genome (mm10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Counts were obtained by htseq-counts 55 and differential expression analysis was performed with DESeq2 package hosted in Galaxy online platform 56 using a false discovery rate (FDR) cut-off of 1 x 10-4 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Galaxy</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, BAM files for all samples were pooled and the coordinates of mapped reads were intersected (bedtools intersect 57) with those of TEs annotated in RepeatMasker (v405).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bedtools</div><div>suggested: (BEDTools, RRID:SCR_006646)</div></div><div style="margin-bottom:8px"><div>RepeatMasker</div><div>suggested: (RepeatMasker, RRID:SCR_012954)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cluster counts for each sample were first normalised using size factors estimated from the number of reads uniquely mapping to Ensembl genes, then differential expression analysis was performed using the Wald Test and a design formula capturing the interaction between DDP treatment and MHV infection status (∼Infection*Treatment).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cluster</div><div>suggested: (Cluster, RRID:SCR_013505)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the remaining TE clusters, we then plotted the log2 fold changes estimated by DESeq2 as boxplots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral genome analysis and assembly: To identify the MHV viral strain we used by the SPADES software 60.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPADES</div><div>suggested: (SPAdes, RRID:SCR_000131)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.30.442194: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Induction of cerebral micro-occlusions in mice: Animal experiments were performed according to the Canadian Council on Animal Care guidelines, as administered by the Université Laval Animal Welfare Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Three months old C57BL6/j male mice were subjected to micro-occlusions to generate sporadic cerebral micro-infarcts via the unilateral injection of microspheres into the common carotid artery (CCA), as previously described [20].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies were used; mouse anti-α-SMA Cy3-conjugated (Sigma-Aldrich; C6198; 1/250)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-α-SMA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, cells were rinsed in 0.1M PBS, followed by a 2-hour incubation with the appropriate secondary antibodies; Cy3 AffiniPure goat anti-mouse IgG (H+L) (Jackson Immunoreasearch), or Cy5 AffiniPure goat anti-rabbit IgG (H+L) (Jackson Immunoreasearch)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies were used; goat anti-ACE2 (R&D systems; AF3437; 1/200)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Millipore Cat# MAB5676, RRID:AB_2223314)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, brain sections were washed with KPBS and then incubated for 2 hours at room temperature in the dark with either a secondary antibody donkey anti-goat Alexa Fluor 647® (Jackson Immunoresearch) or donkey anti-rabbit Alexa Fluor 488® (Jackson Immunoresearch) diluted 1/10000 in KPBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three months old C57BL6/j male mice were subjected to micro-occlusions to generate sporadic cerebral micro-infarcts via the unilateral injection of microspheres into the common carotid artery (CCA), as previously described [20].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL6/j</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Digitized blots were analyzed with ImageJ software, corrected for protein loading by means of β-actin, and expressed as relative values comparing different groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, rabbit anti-fibronectin (Abcam; ab18723; 1/250), rabbit anti-NOTCH3 (Abcam; ab23426; 1/250), rabbit anti-collagen I (Abcam; ab34710; 1/200), and mouse anti-ACE2 (Cell Signaling Technology; 15983; 1/200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cell Signaling Technology</div><div>suggested: (Cell Signaling Technology, RRID:SCR_004431)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired every 10 seconds for 20 minutes and the recorded videos were analyzed using a custom-written script [25] in MATLAB (MathWorks).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using GraphPad Prism Version 8 for Mac (GraphPad Software, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 42. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.01.21256470: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved by the central/local institutional review board or ethics committee at each site.<br>Consent: All subjects provided written informed consent.<br>IACUC: Enrolled participants were randomized 1:1 to receive lenzilumab or matched placebo in addition to current standard treatment per institutional guidelines at each site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Women of childbearing potential were eligible if they had a negative urine or serum pregnancy test at screening/baseline and agreed to adequate contraception following their last dose of study drug.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial Design: The LIVE-AIR trial (NCT04351152) was a phase 3 randomized, double-blind, placebo-controlled study in 520 hospitalized subjects with severe COVID-19 pneumonia across 29 sites in the U.S. and Brazil.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">21-23 The event rate of subjects who required IMV or died by Day 28 in the placebo group was estimated to be approximately 25%, and the event rate in the lenzilumab treatment group was approximated as 15% resulting in a HR of 0.565.24 Using a Cox proportional hazard model to test for inequality of the HR, a total of 100 events were calculated as needed to provide 81.47% power to detect a difference using a two-sided alpha of 5.0% at the final analysis and assuming a fixed follow-up of 28 days.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Disallowed medications were FDA-approved monoclonal antibodies targeting IL-6 or IL-1, kinase inhibitors, and COVID-19 neutralizing monoclonal antibodies if used within 8 weeks prior to randomization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-1</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      LIVE-AIR has two important limitations. First, while it demonstrated an improvement in survival in subjects with CRP<150 mg/L and aged <85, the study was not powered to observe a survival benefit, and indeed did not achieve statistical significance on this key secondary endpoint in the mITT population. Second, the observations pertaining to benefits in the population that had CRP<150 mg/L and age <85 were exploratory. Despite high vaccine efficacy and uptake in some countries, hospitalizations for COVID-19 will continue to occur given the propensity for mutation and escape from protection that occurs through natural immunological selection.34 A proportion of those subjects will unfortunately progress to hypoxia and hospitalization. For them, dexamethasone is currently the only treatment approach shown to provide a survival benefit. This study demonstrates that early neutralization of GM-CSF with lenzilumab, a key initiator and orchestrator of CS, in newly hospitalized hypoxic subjects can improve their likelihood of survival without the need for mechanical ventilation and defines a targeted patient population most likely to derive the greatest benefit over and above that of steroids and/or remdesivir.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04351152</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase 3 Study to Evaluate Efficacy and Safety of Lenzilumab …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280705</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial (ACTT)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04376684</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Investigating Otilimab in Patients With Severe Pulmonary COV…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.03.21256437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.6 Ethics approval: This study was performed as per the Declaration of Helsinki and was approved by the Ethical Review Board of the University of Toyama (approval numbers: R2019167 and R2020146) and Nihon University (School of Pharmacy, approval number: 20-005).<br>Consent: Written informed consent was obtained from all patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using JMP Pro version 15.0.0 software (SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The number of patients involved was quite small, which was a limitation of this study. Thus, representativeness is relatively insufficient, and the samples can only represent the general situation to a certain extent. However, our findings indicate a difference in serum favipiravir concentrations between patients with and without favipiravir-induced liver injury. Additionally, large variations in favipiravir concentrations were observed (steady-state Cmin: 3.1–72.4 mg/L) in this study of patients without renal and underlying hepatic impairment. The Cmin values in patient 3 decreased from 115.5 (55.5–144.8) mg/L to 5.4 (3.8–44.6) mg/L after introducing CHDF. Although the influence of continuous renal replacement therapy (CRRT) on the clearance of favipiravir is unclear, this case suggests that evaluating the influence of CRRT could be significant for considering the optimum dose of favipiravir. These findings indicate that a pharmacokinetic multinational study should be performed with larger samples to reveal the significant covariates and elucidate the potentially exposure-dependent favipiravir-induced liver injury.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.01.21255576: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed by the UCSF Committee for Human Research and determined to meet the definition of research as defined in 46.102(l) but did not involve human subjects based on anonymization of data and routine consent for blood donation testing that includes use of residual samples for research purposes (as defined in 46.103(e)(1) consistent with applicable federal law and CDC policy (<br>Consent: The study was reviewed by the UCSF Committee for Human Research and determined to meet the definition of research as defined in 46.102(l) but did not involve human subjects based on anonymization of data and routine consent for blood donation testing that includes use of residual samples for research purposes (as defined in 46.103(e)(1) consistent with applicable federal law and CDC policy (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">About 1000 serum specimens were randomly selected monthly from allogeneic blood donors from March/April through August 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beginning in June 2020, the blood collection organizations associated with four regions (San Francisco, Los Angeles, Minneapolis, and Boston) began screening all blood donors for SARS-CoV-2 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Vitros CoV2T and Elecsys CoV2T assays were selected based on their double antigen-sandwich design, which enables durable detection of total Ig and employed as an orthogonal algorithm to detect antibodies to different SARS-CoV-2 antigens (S1 and NC, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens ( S1</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.30.21256060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The number of replicates carried out for each experiment is described in the figure/table legends.<br>IRB: Sample acquisition from COVID-19 patients: The Ethics Committee of Huoshenshan Hospital approved the study (HSSLL036).<br>Consent: Given the urgency of the COVID-19 pandemic, the need for informed consent forms was waived by the ethics boards of the hospitals.<br>IACUC: All animal experiments were performed at the AMMS Animal Center (Beijing, China) and were approved by the Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">decompensated chronic renal insufficiency, or severe congestive heart failure), were pregnant or had malignancy (Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Fasting blood glucose and random blood glucose levels were measured weekly.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested for mycoplasma contamination were incubated in DMEM at 37°C in a humidified atmosphere with 5% CO2.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Anti-α-tubulin (T6074, 1:5,000 dilution) and anti-Flag (A8592, 1:5,000 dilution) antibodies were purchased from Sigma-Aldrich (Missouri, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-α-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T6074</div><div>suggested: (Sigma-Aldrich Cat# T6074, RRID:AB_477582)</div></div><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div><div style="margin-bottom:8px"><div>A8592</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">dilution), anti-insulin (ab6995, 1:200 dilution), anti-CREB-phospho S133 (ab32096, 1:1000 dilution), and anti-CREB (ab32515, 1:1000 dilution) antibodies were purchased from Abcam (Illinois, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-insulin</div><div>suggested: (Abcam Cat# ab6995, RRID:AB_305690)</div></div><div style="margin-bottom:8px"><div>anti-CREB-phospho</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CREB</div><div>suggested: (Abcam Cat# ab32515, RRID:AB_2292301)</div></div><div style="margin-bottom:8px"><div>ab32515</div><div>suggested: (Abcam Cat# ab32515, RRID:AB_2292301)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-GP73 antibody (F-12, sc-393372, 1:200 dilution) was purchased from Santa Cruz (Texas, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sc-393372</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-His antibody (KM8001, 1:1000 dilution) was purchased from Taihua Lekang Biotechnology (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C129774-1000, RRID:AB_10832018)</div></div><div style="margin-bottom:8px"><div>KM8001</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">dilution), anti-Akt (9272, 1:1000 dilution), anti-phospho-PKA-C-α (Thr197, 5661, 1:1000 dilution), anti-phospho-PKA substrate (RRXpS/T, 9624, 1:1000 dilution), and anti-PKA-C-α (5842, 1:1000 dilution) antibodies were purchased from Cell Signaling Technology (Danvers, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-phospho-PKA substrate ( RRXpS/T , 9624</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PKA-C-α ( 5842</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-rabbit HRP-IgG (ZB-2301, 1:5000 dilution) and anti-mouse HRP-IgG (ZB-2305, 1:5000 dilution) secondary antibodies were purchased from ZSGB-BIO (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-rabbit HRP-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ZB-2301</div><div>suggested: (ZSGB-Bio Cat# ZB-2301, RRID:AB_2747412)</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sandwich ELISA and Western blot analysis: For endogenous GP73 sandwich ELISA, two custom-made rat monoclonal anti-GP73 antibodies were used as the capture antibody and the detection antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GP73</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HepG2 (CRL-10741), Vero E6 (CRL-1568), HK-2 (CRL-2190), 293T (CRL-3216) and L6 (CRL-1658) cell lines were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To knock out human GP73 in Huh-7 cells, two small guide RNAs (sgRNAs) targeting GP73 were designed and inserted into the LentiCrispr v2 vector to construct transfer plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected with pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GP73 KO mice (T20200316-18[D25]) were generated by Southern Model Biotechnology (Shanghai, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GP73 KO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male C57 BLKS/J db/db and BKS control mice (8 weeks, 36-40 g) were purchased from GemPharma Tech Co. Ltd. (Jiangsu, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57 BLKS/J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STZ (40 mg/kg) in citric acid buffer (0.1 mol/L, pH 4.2) was administered to male C57BL/6N mice via intraperitoneal injection, and the same dose of STZ was injected 24 h later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cell culture: Mammalian expression vectors encoding Flag-tagged human, mouse and rat GP73 were constructed by inserting the corresponding PCR-amplified fragments into pcDNA3 (Invitrogen, Massachusetts, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected with pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G, psPAX2 and the corresponding transfer plasmid to produce lentivirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant GP73 protein purification: Human, mouse, and rat GP73 cDNAs, each with a six-amino-acid His tag on the N-terminus, were cloned into the pCDNA3.1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">triglyceride (TG, 200224) and cholesterol (CHO, 200224) biochemical test kits were purchased from Ruierda Biological Technology (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ruierda Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The network was represented using Cytoscape ver 3.6.2 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">https://cytoscape.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://cytoscape.org/</div><div>suggested: (CluePedia Cytoscape plugin, RRID:SCR_015784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interactions were retrieved from STRING App (v1.51) (https://string-db.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For KEGG and GO enrichment analysis, DAVID Bioinformatics Resources 6.8 (https://david.ncifcrf.gov/home.jsp) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The present study used GraphPad Prism 8.0 for statistical calculations and data plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.30.21256406: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: Clinical serum samples from COVID-19 patients were collected as part of a cross-sectional study registered with the Panama Ministry of Health (No.1462) and was approved by the National Research Bioethics Committee (CNBI; No. EC-CNBI-2020-03-43).<br>Consent: All the study participants were enrolled after informed consent was given.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISAs: The ELISA assays were implemented to detect SARS-CoV-2-specific IgG and IgM antibodies specific to S and RBD antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific IgG and IgM antibodies were detected with anti-human HRP conjugates: goat anti-human IgG (H+L), Thermo Fisher No. H10307, or goat anti-human IgM (Heavy chain), Thermo Fisher No. A18835, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human HRP</div><div>suggested: (Thermo Fisher Scientific Cat# H10307, RRID:AB_2536551)</div></div><div style="margin-bottom:8px"><div>anti-human IgG (H+L)</div><div>suggested: (Thermo Fisher Scientific Cat# H10307, RRID:AB_2536551)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (Thermo Fisher Scientific Cat# A18835, RRID:AB_2535612)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific IgG and IgM antibodies were detected with anti-human HRP conjugates: goat anti-human IgG (H+L), Thermo Fisher No. H10307, or goat anti-human IgM (Heavy chain), Thermo Fisher No. A18835, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher No.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were carried out using Prism v9.1.0 (GraphPad, USA) and easyROC online calculator (http://www.biosoft.hacettepe.edu.tr/easyROC/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The performance of the tests was assessed by calculating sensitivity, specificity, and positive- and negative predictive values, associated P values and their 95% confidence intervals using Fisher exact test as implemented in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on cutoff calculated in the ROC analysis for each test, samples were classified as positive or negative, and agreement between RT-PCR test and ELISAs was assessed using Cohen`s kappa statistic, calculated as described by Fleiss et al 200326, using an online calculator (GraphPad QuickCalcs, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study presents however some limitations. The number of samples analyzed is still low. Additionally, to assess the relationship between positivity and evolution time we used the available date of RT-PCR confirmation, and this may not be a good surrogate of infection time. When available, studies should try to use the date of symptoms onset for better estimation of seroconversion time. It is also important to note that our COVID-19 cohort only include mild to moderate patients, and this fact may have influenced the strength of the immune response observed in our study. It has been shown that severity correlates with a more intense immune response and production of specific antibodies41,42,43,44,45. A more complete picture of the serology would have been obtained with patients from all the spectrum of the disease. Next steps should include testing of RT-PCR positive, asymptomatic subjects to characterize whether the tests are able to detect lower antibody levels likely expected in such situation. Nevertheless, our results confirm previous reports indicating the usefulness of these antigens for assays to measure seroconversion after SARS-CoV-2 infections22,46,47,48. The ELISA tests are simple to perform and very robust once optimized. Besides, since only a very small amount of sample is required, they are very convenient. Our results are consistent with those shown by others, suggesting that these serology assays have a very good potential for studies about measuring virus ex...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. O’Connor, D. B., Aggleton, J. P., Chakrabarti, B., Cooper, C. L., Creswell, C., Dunsmuir, S., Fiske, S. T., Gathercole, S., Gough, B., Ireland, J. L., Jones, M. V., Jowett, A., Kagan, C., Karanika‐Murray, M., Kaye, L. K., Kumari, V., Lewandowsky, S., Lightman, S., Malpass, D., … Armitage, C. J. (2020). Research priorities for the COVID‐19 pandemic and beyond: A call to action for psychological science. British Journal of Psychology. https://doi.org/10.1111/bjop.12468

    1. Adjiwanou, V., Alam, N., Alkema, L., Asiki, G., Bawah, A., Béguy, D., Cetorelli, V., Dube, A., Feehan, D., Fisker, A. B., Gage, A., Garcia, J., Gerland, P., Guillot, M., Gupta, A., Haider, M. M., Helleringer, S., Jasseh, M., Kabudula, C., … You, D. (2020). Measuring excess mortality during the COVID-19 pandemic in low- and lower-middle income countries: The need for mobile phone surveys [Preprint]. SocArXiv. https://doi.org/10.31235/osf.io/4bu3q

    1. Williamson, E. J., Walker, A. J., Bhaskaran, K., Bacon, S., Bates, C., Morton, C. E., Curtis, H. J., Mehrkar, A., Evans, D., Inglesby, P., Cockburn, J., McDonald, H. I., MacKenna, B., Tomlinson, L., Douglas, I. J., Rentsch, C. T., Mathur, R., Wong, A. Y. S., Grieve, R., … Goldacre, B. (2020). OpenSAFELY: Factors associated with COVID-19 death in 17 million patients. Nature, 1–11. https://doi.org/10.1038/s41586-020-2521-4

    1. SciScore for 10.1101/2021.04.30.441968: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal infections/Live-attenuated vaccination: Animal infections were performed using age-matched C57BL/6J (Jackson Labs 000664) or B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (Jackson Labs 034860) in accordance with Duke University IACUC approved protocol numbers A189-18-08 and A081-20-04.<br>Euthanasia Agents: Euthanasia was performed via a primary method of CO2 asphyxiation and bilateral thoracotomy as a secondary confirmation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were visualized using AlexFluor594-conjugated anti-mouse/anti-rabbit secondary antibodies (Thermo cat. no. A-11032/R37117) at a dilution of 1:500 for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse/anti-rabbit</div><div>suggested: (Vector Laboratories Cat# BA-1400, RRID:AB_2336187)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used for protein detection; PY102 (HA, 1 μg/mL), 4A5 (NA, 0.45 μg/mL), anti-matrix protein [E10] (M1 and M2, 1:1,000, Kerafast cat. no. EMS009), and anti-SARS-CoV-2 spike protein (RBD) polyclonal antibody (RBD, 1:1,000, Invitrogen cat. no. PA5-114451).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA, 1 μg/mL</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-matrix protein</div><div>suggested: (Kerafast Cat# EMS009, RRID:AB_2687434)</div></div><div style="margin-bottom:8px"><div>M2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike protein (RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse (1:20,000, Thermo cat. no. A16072) and anti-rabbit (1:10,000, Thermo cat. no. A16104) secondary antibodies were diluted in PBST + 5% milk and applied to membranes for 60 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were diluted using PBS + 3% BSA and incubated with immobilized proteins/viruses for ≥1 hour at room temperature (anti-RBD ProSci cat. no. 9087, anti-HA PY102 a kind gift from Dr. Tom Moran (Icahn School of Medicine at Mount Sinai), DH1041 and DH1044 kind gift from Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human (1:10,000 Thermo cat. no. A18805), anti-mouse (1:5,000, Thermo cat. no. A16072), and anti-rabbit (1:5,000, Thermo cat. no. A16104) secondary antibodies were diluted in PBS + 3% BSA and incubated with immobilized proteins/virus for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and viruses: Human embryonic kidney cells (HEK293T, ATCC) were grown in Dulbecco’s Modified Eagle Medium supplemented with 5% fetal bovine serum, GlutaMAX (Gibco cat. no. 35050079), and penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The allantoic fluid was then harvested from and titer determined via plaque assay on MDCK cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stocks were frozen at −80 °C and were titered by serially diluting virus in virus infection media then infecting a confluent monolayer of Vero E6 cells growing in 6-well, poly-L-lysine treated, plates for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque reduction neutralization assays: MDCK and Vero cells were used for influenza and SARS-CoV-2 plaque reduction assays, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were diluted using PBS + 3% BSA and incubated with immobilized proteins/viruses for ≥1 hour at room temperature (anti-RBD ProSci cat. no. 9087, anti-HA PY102 a kind gift from Dr. Tom Moran (Icahn School of Medicine at Mount Sinai), DH1041 and DH1044 kind gift from Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DH1041</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal infections/Live-attenuated vaccination: Animal infections were performed using age-matched C57BL/6J (Jackson Labs 000664) or B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (Jackson Labs 034860) in accordance with Duke University IACUC approved protocol numbers A189-18-08 and A081-20-04.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once this was done, the codon optimized RBD was PCR amplified and cloned into the bicistronic pDZ rescue plasmid system for A/Puerto Rico/8/1934 using the NEBuider HiFi DNA assembly kit (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDZ</div><div>suggested: RRID:Addgene_38952)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, approximately 500 PFU of each plaque-purified stock was injected in 10-day old embryonated hen eggs purchased from Charles River Laboratories, Inc. and incubated for 72 hours at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Charles River Laboratories</div><div>suggested: (Charles River Laboratories, RRID:SCR_003792)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral protein extracts were probed for M1 and normalized via densitometry (ImageJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.29.442060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocol was reviewed and approved by the Institutional Animal Care and Use Committee of Hokkaido University (approval no. 20-0060).<br>Euthanasia Agents: At 2, 4 or 19 dpi, a subset of the infected hamsters were euthanized under deep anesthesia by isoflurane inhalation, and tissue samples (nasal turbinate, lung and blood) were harvested.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster infection: For virological and histopathological analyses in single infection, 4-to 6-week-old male Syrian hamsters (Japan SLC, Shizuoka, Japan) were inoculated intranasally with 1.5×104 plaque forming units (pfu) of wild-type WK-521 (WT), del2 or R685H viruses in 200 μl of PBS.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunohistochemical analysis, slides were heated in citrate buffer for 5 min using a pressure cooker for antigen retrieval and blocking with Block Ace (KAC, Kyoto, Japan), followed by staining with anti-SARS-CoV-2 spike antibody (GTX632604, GeneTex, Hsinchu, Taiwan),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-SARS-CoV-2 nucleocapsid antibody (GTX635679, GeneTex), anti-CD3 (ab16669, Abcam, Cambridge, UK), anti-MPO (A039829-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid antibody ( GTX635679</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: (Abcam Cat# ab16669, RRID:AB_443425)</div></div><div style="margin-bottom:8px"><div>anti-MPO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: Vero (Vero E6, ATCC, Manassas, VA) and Vero-TMPRSS2 [18] cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Saijyo, Shimojima and Ito (National Institute of Infectious Diseases, Japan); the original stock of these virus strains was prepared by inoculation of Vero-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were infected with either WT, del2 or R685H viruses at an MOI of 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed by One-way analysis of variance (ANOVA) with Tukey’s test using GraphPad Prism 8 (GraphPad Prism Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Hall, V. J., Foulkes, S., Saei, A., Andrews, N., Oguti, B., Charlett, A., Wellington, E., Stowe, J., Gillson, N., Atti, A., Islam, J., Karagiannis, I., Munro, K., Khawam, J., Chand, M. A., Brown, C. S., Ramsay, M., Lopez-Bernal, J., Hopkins, S., … Heeney, J. L. (2021). COVID-19 vaccine coverage in health-care workers in England and effectiveness of BNT162b2 mRNA vaccine against infection (SIREN): A prospective, multicentre, cohort study. The Lancet, 0(0). https://doi.org/10.1016/S0140-6736(21)00790-X

    1. SciScore for 10.1101/2021.04.29.442061: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The animal care and study protocols were approved by the Institutional Animal Care and Use Committees of Northwestern University and The University of Illinois at Chicago.<br>IRB: Human specimens: All experiments with human tissue samples were performed under protocols approved by the Institutional Review Boards at the University of Chicago and Ann & Robert H.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both male and female mice were used in the experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Fifteen 63X fields each section were randomly selected and examined.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse lung cryosections were stained overnight with anti-BrdU (1:3, BD Biosciences, or 1:1000 Cell Signaling Technology, Danvers, MA) and incubated with Alexa Fluo 488-conjugated secondary antibody (1:200, Thermal Fisher Scientific, Waltham, MA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-BrdU</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lung vascular ECs were immunostained with anti-vWF (1:300, Sigma-Aldrich, St Louis, MO) and anti-CD31 (1:100, BD Bioscience) antibodies at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-vWF</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot analysis was performed using an anti-FoxM1 antibody (1:800, sc-376471, Santa Cruz Biotechnology, Santa Cruz, CA) and the same blot was incubated with anti-β-actin antibody (1:3000, BD Biosciences) as a loading control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FoxM1</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-376471, RRID:AB_11150135)</div></div><div style="margin-bottom:8px"><div>sc-376471 , Santa Cruz Biotechnology , Santa Cruz , CA </div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After RNAscope assay, the slides were incubated in blocking buffer (3% BSA, 1% FBS and 0.1% normal donkey serum) for 1 h followed by with a primary antibody against CD31 (Cat # Ab28364, Abcam, Cambridge, MA) at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD31</div><div>suggested: (Abcam Cat# ab28364, RRID:AB_726362)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sections were washed and incubated with appropriate anti-rabbit secondary antibody labeled with Alexa Fluor 488 for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Foxm1 transgenic (Foxm1Tg) mice driven by the Rosa26 promoter were described previously (35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Foxm1Tg</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 WT mice (2 mos.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 3h following irradiation, the mice were transplanted with 10 million of bone marrow cells (200 μl of EBM2 medium) freshly isolated from EndoSCL-CreERT2 transgenic mice (2 mos. old) through tail vein injection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndoSCL-CreERT2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nuclei were counterstained with DAPI (Thermal Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermal Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance was determined by one-way ANOVA with a Dunnett post hoc analysis that calculates P values corrected for multiple comparisons for equal variance or Kruskal-Wallis test for unequal variance using Prism 7 (Graphpad Software, Inc. La Jolla, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04482621</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Decitabine for Coronavirus (COVID-19) Pneumonia- Acute Respi…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 44. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.26.21255893: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study design and population: We conducted a cross-sectional survey9 from late November, 2020 to January, 2021, nested within two longitudinal cohort studies of prevalence and incidence of SARS CoV-2 among (1) community-residing adults (the TrackCOVID study) and (2) medical center employees (the COVID-19 Healthcare Worker Antibody and Reverse Transcription (RT) PCR Tracking study, CHART).<br>IRB: The TrackCOVID study was designated as a public health surveillance study and not human subjects research under 45 CFR 46.102(l) by Stanford University School of Medicine Administrative Panel on Human Subjects in Medical Research and UCSF Institutional Review Board; the CHART study protocol was approved by the UCSF Institutional Review Board and the Stanford University School of Medicine Panel on Human Subjects in Medical Research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The TrackCOVID study recruited randomly selected community members residing in six San Francisco Bay Area counties, with enrollment occurring between July and December, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants in both cohorts were sent an electronic survey about COVID-19 vaccination with Research Electronic Data Capture Software (REDCap).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study limitations include sampling dates that were relatively early after the arrival of the Pfizer and Moderna vaccines to the US landscape. As such, they represent early views of healthcare workers and the general public and may not account for shifts in viewpoints, increasing confidence, or other changes in opinions in recent months as the US vaccination campaign has expanded greatly. Our survey sample was drawn from people sufficiently concerned about their risk of COVID-19 and trusting of research to volunteer for studies involving repeated COVID-19 testing. Self-selection may bias our results towards greater willingness to be vaccinated compared with the vaccine willingness of all medical center employees and community residents in the region studied. However, self-selection is less likely to introduce bias when testing associations of variables within the study cohorts, such as associations between race-ethnicity and vaccine intentions or between perceptional factors and intentions. It is striking that even within groups of individuals motivated to participate in longitudinal COVID-19 surveillance, large racial-ethnic differences exist in COVID-19 vaccination intentions and reasons not to get vaccinated. Our sample is from a single region in California, which may limit generalizability. Our survey may not have addressed certain domains that might influence intentions, such as concerns about access to vaccines. Our primary outcome was self-reported vaccine intention and...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

  4. Apr 2021
    1. SciScore for 10.1101/2021.04.28.441474: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All studies were performed in accordance with Wistar Institutional Animal Care and Use Committees under approved animal protocols.<br>Euthanasia Agents: For cellular responses, mice were euthanized under CO2 overdose.<br>Field Sample Permit: Serum samples were collected at indicated timepoints via saphenous vein blood collection throughout the experiment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Hartley guinea pigs (8 weeks old, Elm Hill Labs, Chelmsford MA) were housed at Acculab (San Diego CA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the lethal challenge study, Texas Biomed were blinded to identity of vaccination groups and weight loss cutoff for euthanasia was 20%.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocking Buffer (LI-COR) for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS) Antibody Diluent (LI-COR) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag C-term</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then incubated in a 1:10000 IRDye 800CW goat anti-rabbit IgG (LI-COR Biosciences) in Intercept T20 (PBS) Antibody Diluent (LI-COR) at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human IgG-Fc fragment cross-adsorbed antibody HRP conjugated (Bethyl Laboratories) secondary at a 1:10,000 dilution for 1 hour at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Goat anti-Human IgG-Fc fragment cross-adsorbed antibody HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For BL6, BALB/c, and K18 ACE2 mouse studies, goat anti-mouse IgG h+l HRP-tagged antibody (Bethyl Laboratories) diluted 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment Goat Anti-Rat IgM, μ chain specific (Jackson ImmunoResearch) at 1:10000, Goat anti-Human Kappa Light Chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:10000,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rat IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human Kappa Light Chain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human Lambda Light Chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:10000, and Goat anti-Mouse IgG-heavy and light chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:20000, and Goat anti-guinea pig IgG whole molecule (Sigma) at 1:10,000 were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human Lambda Light Chain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG-heavy</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-guinea pig IgG whole molecule ( Sigma )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Hamster HRP antibody (Sigma) was diluted in diluent buffer 1:10,000 and were incubated for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Hamster HRP antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Hamster HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular cytokine staining and Flow cytometry: Splenocytes were processed as described in the previous section and stimulated with RBD peptides for 5 hours at 37°C with protein transport inhibitor (Invitrogen) and anti-mouse CD107a-FITC antibody (BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD107a-FITC</div><div>suggested: (SouthernBiotech Cat# 1920-02, RRID:AB_2795531)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse CD4-BV510, CD8-APC-Cy7, CD44-A700, and CD62L-BV711 antibodies were used for surface staining and CD3e-PE-Cy5, IFN-γ-APC, and TNF-α-BV605 (all from BioLegend) were used for intracellular staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse CD4-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8-APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD44-A700</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD62L-BV711</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3e-PE-Cy5 , IFN-γ-APC ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α-BV605</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ExpiF293 cells were transfected with the pVAX plasmid vector either carrying the nanoparticles or the His-Tagged monomer transgene with PEI/Opti-MEM and harvested 6-7 days post transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExpiF293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization Assay: HEK293T (CRL-3216) and CHO cells (CRL-12023: double check) were obtained from ATCC (Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO-ACE2 cells were seeded at 10,000 cells/well in 96-well plates and incubated for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To grow a stock of virus, 3 million Vero cells were seeded in a T-75 flask for overnight incubation (37⍰C, 5% CO2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For BL6, BALB/c, and K18 ACE2 mouse studies, goat anti-mouse IgG h+l HRP-tagged antibody (Bethyl Laboratories) diluted 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal Studies: C57BL/6, BALBc, and K18-hACE2 mice were obtained from Charles River Laboratories (Malvern, PA) and The Jackson Laboratory (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All animals were housed in the Wistar animal facility in ventilated cages and given free access to food and water.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar</div><div>suggested: RRID:MGI:5657554)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA encoding the variants were codon optimized for homo sapiens and cloned with a IgE secretion sequence into the pVAX vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVAX</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody production, heavy and light chains were encoded in pFUSEss-CHIg-hG1, and pFUSE2ss-CLIg-hk or pFUSEss-CLIg-hL2 respectively and were co-transfected in equal parts using ExpiFectamine™ 293 Transfection Kit(Gibco) according to manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSEss-CHIg-hG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFUSE2ss-CLIg-hk</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFUSEss-CLIg-hL2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6μg S_IgE_deltaCterm19_plasmid (Genscript), and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curves were analyzed in GraphPad Prism 8 with Sigmoidal, 4PL, X is concentration and AUC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For variant pseudoviruses, cells were similarly treated with GeneJammer and backbone with 6μg of S_SA_IgE_deltaCterm19, S_UK_IgE_deltaCterm19, or S_Brazil_IgE_deltaCterm19 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneJammer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus titer (TCID50/ml) was calculated using the Reed-Munch method and the Microsoft Excel based calculator published by Lei et al[73] For neutralization assays, Vero cells were seeded in DMEM with 1% FBS at 20,000 cells/well in 96 well flat bottom plates for overnight incubation (37C, 5% CO2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed in Relion v3.1.2[74]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were run on an 18-color LSRII flow cytometer (BD Biosciences) and analyzed by FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After being washed, the plates were further incubated at room temperature for 1 hour with goat-anti human IgG-Fc fragment cross-adsorbed Ab (A80-340P; Bethyl Laboratories) at a 1: 10,000 dilution, followed by addition of TMB substrates (ThermoFisher), and then quenched with 1M H2SO4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.27.441655: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was carried out in accordance with the recommendations for care and use of animals by the Office of Laboratory Animal Welfare (OLAW), National Institutes of Health and the Institutional Animal Care and Use Committee (IACUC) of University of North Carolina (UNC permit no. A-3410-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and challenge viruses: Eleven-month-old female BALB/c mice were purchased from Envigo (#047) and were used for the SARS-CoV, SARS-CoV-2 B1.351, and RsSHC014-CoV protection experiments. 8-10-week-old hACE2-transgenic mice were bred at UNC Chapel Hill and were used for WIV-1-CoV protection experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">In a blinded manner, three random fields of lung tissue were chosen and scored for the following: (A) neutrophils in the alveolar space (none = 0, 1–5 cells = 1, > 5 cells = 2), (B) neutrophils in the interstitial septa (none = 0, 1–5 cells = 1, > 5 cells = 2), (C) hyaline membranes (none = 0, one membrane = 1, > 1 membrane = 2), (D) Proteinaceous debris in air spaces (none = 0, one instance = 1, > 1 instance = 2), (E) alveolar septal thickening (< 2x mock thickness = 0, 2–4x mock thickness = 1, > 4x mock thickness = 2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Analyses and scoring were performed by a board vertified veterinary pathologist who was blinded to the treatment groups as described previously 48.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP conjugated goat anti-mouse IgG secondary antibody (SouthernBiotech 1030-05) was diluted to 1:10,000 in assay diluent without azide, incubated at for 1 hour at room temperature, washed and detected with 20μl SureBlue Reserve (KPL 53-00-03) for 15 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (SouthernBiotech Cat# 1030-05, RRID:AB_2619742)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-virus and virus only mixtures were then incubated at 37°C with 5% CO2 for one hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-virus</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the 96-well neutralization assay, Vero E6 USAMRID cells were plated at 20,000 cells per well the day prior in clear bottom black walled plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals and challenge viruses: Eleven-month-old female BALB/c mice were purchased from Envigo (#047) and were used for the SARS-CoV, SARS-CoV-2 B1.351, and RsSHC014-CoV protection experiments. 8-10-week-old hACE2-transgenic mice were bred at UNC Chapel Hill and were used for WIV-1-CoV protection experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hACE2-transgenic</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RELION 3.0 program was used for all negative stain image processing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed using cryoSPARC 39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model building and refinement was done using Phenix 40,41</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Coot 42</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Pymol 43, Chimera 44, ChimeraX 45 and Isolde 46.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: All statistical analyses were performed using GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 46. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.27.441606: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot analysis: Protein extracts, separated by SDS-PAGE and transferred onto PVDF membranes, were probed with antibodies against FLAG (F1804, Sigma), ACE2 (ab15248, Abcam) or GAPDH (2275-PC-100, Trevigen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Abcam Cat# ab15248, RRID:AB_301789)</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (R and D Systems Cat# 2275-PC-100, RRID:AB_2107456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins of interest were detected with HRP-conjugated secondary IgG antibody and visualized with ECL Western blotting substrate (Thermo Scientific) according to the provided protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated secondary IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Sino Biological Cat# 40150-R007, RRID:AB_2827979)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and virus propagation: Vero, A549 and Caco2 cells were cultured in Minimum Essential Medium (MEM) supplemented with 10% fetal calf serum (FCS), 2% L-glutamine, 100 IU/ml of penicillin and 100 μg/ml of streptomycin at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interferon stimulation: Vero, Caco2 and A549 cells were stimulated with the type I-III interferons (500 U / mL and 10 ng / mL, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids construction and cloning: Total RNA (1 μg) was isolated from HEK293T cells and reverse transcribed into cDNA using random hexamers and SuperScript II RT (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative proliferation and trypsinization assay: CaCo2 and A549-based cells were seeded in 12-well plates (2×104 A549-AT and 1×105 Caco2 / well, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-based</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All amplimers were cloned into the PCR2.1-Topo-TA vector (Invitrogen) for Sanger sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PCR2.1-Topo-TA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correct amplimers were digested with Sfi1 and cloned into the pSBbi-RB (ACE2) or pSBbi-BH (TMPRSS2) Sleeping Beauty plasmids (Kowarz et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSBbi-RB</div><div>suggested: RRID:Addgene_60522)</div></div><div style="margin-bottom:8px"><div>pSBbi-BH</div><div>suggested: RRID:Addgene_60515)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Red object count, Confluency and roughness were analyzed using ImageAnalyzer Software v.1.1 (Tecan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageAnalyzer</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Integration into genome occurs preferentially at TA-sites, however a certain limitation remains since a targeted integration at a predetermined location in the genome is not possible. Through precise dosing of the vector and the transposase-encoding plasmid scalable number of integrations can be achieved (Skipper et al., 2013). A further conceivable development of the system would be a construct expressing eGFP enabling the parallel expression of an inducible shRNA-mediated knock-down cassette. This would allow loss-of-function experiments to be carried out in addition to gain-of-function experiments. In conclusion, we developed a reporter cell system with optimal ACE2/TMPRSS2 ratio for high SARS-CoV-2 susceptibility, syncytia and CPE formation. The confluency and particularly roughness of A549-AT cells represents a highly sensitive marker for early syncytia formation and cytopathic effects. Thus, A549-AT cells allow the infection and readout of an experiment on the same working day. Using 1 MOI the system theoretically allows infection and read-out within one working day performed via non-invasive roughness factor analysis.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. F A M I L I E N E R B E

      Der Titel "Das Familienerbe" ist ziemlich beschreibend aber gleichzeitig verwirrend, eine effektive Mikrokosmos der ganze Geschichte. Das Erbe, laut duden.de, bedeutet das Vermögen dass man wegen des Todes, seinen Kinder hinterlässt. Hier wird Lena nichts hinterlassen weil sie auch von ihr Mutter scheinbar ermordet wurde. Gideon ist der einzige Figur der scheint noch am Leben zu sein ohne Verletzungen zu haben, also der einzige Mensch dass eine Familienerbe bekommen könnte.

      Duden, s.v. "das Erbe," Accessed April 28, 2021, https://www.duden.de/rechtschreibung/Erbe_Nachlass_Ueberlieferung

    Tags

    Annotators

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      Bhide and colleagues present an insightful study of how cellular mechanics influences differential cell behaviour during morphogenesis despite apparent genetic homogeneity of the cellular ensembles. They dissect the extensively studied system of mesoderm invagination in Drosophila, focussing on the differences in cell behaviours between the cells in the middle of the infolding tissue and on the periphery that, as far as we know, share a common gene expression profile. They describe sub-cellular dynamics of major effector of apical constriction morphogenesis, the myosin motor distribution, in the invaginating cells and conclude that differences in myosin levels alone cannot account for the observed differences in cell behaviours. In order to understand the cell behaviour inhomogeneity, they turn to biophysical simulation and in an impressively exhaustive manner substantiate the idea that non-linear effects are required for explaining the phenomenon. This theoretical treatment fits well with the notion that the genetic identity of the cells but rather cell-cell mechanical coupling determine the differences in invaginating cell's behaviours. Additionally, the modelling is consistent with the myosin asymmetry and dynamics in the cells whose behaviours is being contrasted. Complementary, and beautifully executed filament-based modelling of microscopic actomyosin contractility further corroborates this view. Finally, the proposed model of non-linear actomyosin contractility dynamics governing the differential cell behaviour across genetically homogenous cellular field, is challenged by two complementary laser ablation and optogenetic experimental approaches. Overall, the results represent convincing evidence that points the tissue mechanics field of Drosophila mesoderm into an interesting new direction and has general implications for the understanding of the interplay between genetic regulation and emergent behaviours of cells operating in mechanically complex multicellular embryonic context. The study is meticulously executed, highly quantitative and combines effectively experiment and theory. I have only minor comments that concern in particular the presentation of the results.

      The paper is very dense and the text does not complement well the results presented in the main figures. Many panels in the Figures are not referred to explicitly. Figure elements are referenced out of order both within and across Figures. Sometimes, particularly, in the last two Figures (3 and 4) the reader is left alone to figure out what the data show (with the appropriately terse legends and without the clear narrative in the text, it is an uphill battle for non-specialists). Some key results are hidden in the sea of elements within the Figure 2 that contains the most important, relevant and impressive data.

      We have split this figure in two, moved some of the results from Suppl. Fig. 5 into one of its parts and included new calculations and data. We have also extended the description of these results in the main text and in the figure legends.

      As an example, on line the authors point to panel 2F to demonstrate the asymmetry of myosin distribution in some cells. To the best of my understanding, this phenomenon is actually shown in Fig 2E which is curiously not referenced at all.

      We have corrected the references to the panels

      Similarly, Figure 2K and L provide crucial data substantiating much of the conclusions of the paper. It requires a major effort to understand what the graphs mean. The following simulation results are quite impressive and would deserve a separate Figure which could provide more space for explaining what the parameter maps actually show. What is for instance plotted on the Y axis as steepness?

      We have added the following explanation: “The ‘width’ of the profile is the number of cells with maximum value; the ‘steepness’ is the slope between minimal and maximal values (equation 2 in materials and methods).”

      Secondly, I find the overall narrative of the manuscript needing some reorganisation. The main question is set-up extremely well, however in the middle of the manuscript the focus on the connection between cell behaviours and genetic programs is lost. New conclusions on force transmission between cells emerge, however they are not obviously connected with the question posed from the onset and addressed in the discussion section.

      To us, the section on force transmission seemed like an important component of the issue of intrinsic versus extrinsically determined cell behaviours. We had seen that the intrinsic programme of the cells, as reflected in their myosin levels, might not be sufficient to explain the difference between stretching and constricting. If their behaviour is not intrinsically determined, then there must be something acting from the outside, and we are looking here at what that might be, i.e. we need to find out how the potential constriction is influenced. The first model tests under which conditions differential contractility leads to different ‘cell’ behaviours. This in turn leads directly to the question of the forces the cells in the epithelium exert on each other.

      My impression is that the authors are conservative in their reasoning, however it does compromise the overall message of the story that should ideally focus on one subject. I find the combined evidence presented sufficiently supportive of the model that is beautifully and eloquently presented in the concluding sentence of the paper:

      "This mechanism, which we propose corresponds to the non-linear behaviour predicted by the models, would apply both to central and to lateral cells, with a catastrophic 'flip' being stochastic and rare in central cells, but reproducible in lateral cells because of the temporal and spatial gradient in which contractions occur."

      This may not turn out to be the entire story or even entirely correct, but it is certainly and exciting way of thinking about the problem. I wish that the manuscript would stay more on this subject throughout and provide intermediate conclusions supporting this model as the story develops.

      Few more minor comments:

      We have corrected all of the typos, mistakes and omissions and adapted the text, as mentioned below.

      Line 36 - typo > Line 97 - starting bracket missing > Line 126 - data on intensity are presented here. There is also a panel on concentration (Fig 1H). Where is this discussed?

      An explanation (definition) has been added to the main text.

      Line 132 - panel 2G - disruptive out of sequence reference to a future figure > Line 135 - with this regard - please spell out this important conclusion

      We have expanded this part, basically introducing the conclusion more clearly (we hope).

      Line 183 - typo > Line 210 - insects do not have intermediate filaments

      We have added ‘mammalian‘ to the reported experiment in the text, to make it clear that this does not refer to Drosophila cells

      Line 238 - please provide a hint of how such global ablations are performed > We have added this – both explicitly, and the relevant references.

      Line 240 - walk us through the Figure, it is too complex to figure it out alone > We have added a more extensive explanation both in the text and in the new figure legend.

      Line 245 - why is the clear hypothesis mentioned above (point 2) rephrased? > Line 273 - vague statement

      We have changed the text in response to these useful pointers.

      **Significance:

      The results represent convincing evidence that points the tissue mechanics field of Drosophila mesoderm into an interesting new direction and has general implications for the understanding of the interplay between genetic regulation and emergent behaviours of cells operating in mechanically complex multicellular embryonic context.

      Reviewer #2

      Bhide and colleagues explore the mechanisms of cell expansion in epithelial morphogenesis. During the invagination of the Drosophila mesoderm, cells in the center of the prospective mesoderm constrict under the action of actomyosin pulses, while lateral cells elongate towards the center of the mesodermal placode to accommodate the reduction in apical surface of the central cells. Central and lateral cells display strong similarities in terms of gene expression. How are thus this different behaviors (contraction and expansion) accomplished? The authors found that both central and lateral cells assemble actomyosin networks, although lateral cells do it with a certain delay. Mathematical models of cell constriction across the mesoderm using different strain-stress responses showed that strain-induced cell softening was necessary recapitulate the patterns of constriction and expansion observed in vivo. Furthermore, modelling predicts that cells can stretch until the actin networks yield and break. Laser ablation and optogenetic reduction of contractility in central cells results in a reduction in the apical surface area of lateral cells. An optogenetic increase in contractility in lateral cells caused an increase in apical area in central cells. Together, these data suggest that mechanical cues can override and contribute to sculpting genetically defined morphogenetic domains.

      I propose to address the following points before further considering the manuscript:

      Major

      1. Figure 3: following laser ablation of central cells, lateral cells reduce their apical surface. How do the authors know that this reduction in lateral cell apical surface area is an active process, driven by actomyosin-based contraction, rather than a passive response to the expansion of the wound induced by laser ablation?

        A similar argument could explain the constriction of lateral cells after optogenetic inhibition of actomyosin networks: the central cells relax, expand and compress the lateral cells.

      With regard to the comparison to wounds, it is important to note that the epithelium is not actually wounded by either ablation method. Thus, while the treatments ablate the actyomyosin meshwork, they do not ablate or kill the cells. Perhaps the term is an unfortunate choice, since it is more commonly used in developmental biology for killing cells. However, here the cells remain intact and when the optogenetic or laser treatment is released the cells resume their physiological activities.

      We have added a note in the text and now refer to ‘laser microdissection’, a term of art in the field, for more clarity.

      Regarding the more important question of what is the active process, expansion of the central cells or constriction of the lateral cells, a contribution from expanding central cells is of course in theory not impossible.

      However, for this scenario to work, in the absence of pulling from the lateral cells, there would have to be a force that is generated in the central cells, in this case a pushing force that would expand the cells and act on the lateral cells. We have shown in our previous work that if the actomyosin is dissected in dorsal cells, which are not surrounded by potentially contractile cells, the cells do not expand (Rauzi et al, 2017). This shows that ‘relaxing’ by itself does not have ‘expansion’ as a consequence. One would therefore have to consider how such a pushing force could arise in these cells. We can think of only two possibilities: hydrostatic pressure or an active force from the subcellular molecular machinery.

      Considering hydrostatic pressure, if the apical actomyosin that is ablated was responsible for maintaining such a pressure inside the cell (a reasonable assumption), then releasing the actomyosin would allow the cell volume to push against the neighbouring cell. However, such a recoil would occur on a very short time scale (seconds), whereas we see the contraction of the lateral cells continuing over extended periods (minutes).

      Alternatively, expansive forces could be generated by the cytoskeleton. Cytoskeletal pushing forces can come from microtubules (classical example: mitotic spindle; epithelial morphogenesis: work from T. Harris and B. Baum labs: PMID 18508861 and 20647372), or from continuous creation of new cross-linked or branching actin networks pushing against plasma membranes, as in the leading edge of crawling cells. But the microtubules in the blastoderm cells are not oriented in such a way they could provide a force in the correct dimension in these cells (the majority is oriented along the apical-basal axis). In addition, the connection between MT and the plasma membrane depends on the cortical actin meshwork (involving, for example, the actin-binding proteins P120-Catenin or patronin/Shot; Roeper lab, PMID 24914560, StJohnston Lab, PMID: 27404359) but the connection of actin with the plasma membrane has been severed in the optogenetically manipulated cells.

      By contrast, we show that normal lateral mesodermal cells possess a contractile actin network. So the only sustained force generated in the system at this point is the contractile force in lateral cells (which is normally counteracted by the stronger contractile force from central cells).

      Thus, we conclude that the expansion of central cells is a passive response to a contractile force from lateral cells, not an active process and conversely, the constriction of lateral cells is an active autonomous process.

      To demonstrate active responses of the lateral cells upon laser ablation and optogenetic manipulations of central cells, at the very least the authors should show the distribution of myosin in the lateral cells that constrict and demonstrate the assembly of contractile networks.

      We have now included the requested data for the experiments with laser ablations. Suppl. Fig. 8 and Suppl. video 3 show the myosin that accumulates in lateral cells. It would be nice also to be able to show this for the optogenetic experiments. However, despite trying hard, we have not succeeded in generating healthy embryos that carry the entire set of transgenes that are necessary to carry out the optogenetic experiments and at the same time visualize myosin (see also response to referee 2, point 3).

      1. Modelling suggests that actin networks yield and break in lateral cells. Does this occur in vivo?

      We postulate that the skewed and inhomogeneous distribution of myosin and the large myosin-free areas in stretched cells (lines 170 – 172 in the original text) are indications of a yielding meshwork, or at least of uneven force distribution in the network that leads to ineffective contraction or even release – i.e. functionally correspond to yielding. We have made this more explicit now.

      We have also added an additional panel quantifying more clearly the proportion of low- myosin areas in lateral cells (now Fig. 3H).

      Work from the Lecuit lab has recently shown beautifully that it is the connectivity of the myosin mesh rather than the underlying actin meshwork that affects apical forces in epithelial cells (PMID: 32483386), and our own findings are entirely consistent with that.

      1. Lines 166-175: The authors propose that constriction of a cell affects the localization of myosin in its neighbors. However, this is not directly measured. The authors should quantify the relative myosin offset in the cells around constricting cells, and show that that offset is greater (and oriented towards the constricting cell) than in cells around expanding cells. There should be a correlation between the relative size change of a cell and the myosin offset (not just concentration) in their neighbours. We now provide measurements of the rate of cell area change against the offset of surrounding myosin (the distance of myosin from a cellular border). We see that surrounding myosin is closer to the border of constricting cells and tends to be further away from the borders of expanding cells.

      We have added these data to the new Fig. 3I.

      In addition, does optogenetic activation of constriction in lateral cells affect the offset of myosin networks in central cells?

      This is technically challenging. For such an experiment we would need an embryo to express membrane and myosin markers in addition to the two optogenetic constructs and the GAL4 driver. We tried multiple times to generate such a cross, but obtained either no embryos or, at best, deformed embryos. We also tried to use the MCP-MS2 system in parallel to CRY2-RhoGEF2 but the crosses had the same problem. This sensitivity to additional genetic load was also observed in the DeRenzis lab, who generated these strains and tested and used them extensively.

      1. Fig. 2E-F: the authors argue that the mean myosin concentration in lateral cells at certain times is equivalent to that of central cells earlier in the invagination process. However, the fraction of apical surface area covered by myosin network is consistently lower for lateral cells (and also for central cells that remain unconstricted!). Have the authors considered this fact, and if not, why? Wouldn't this explain, at least in part, why some cells constrict and others do not, if medial myosin networks drive the disassembly of the apical surface?

      We believe in fact that this is precisely part of the picture and it was what we had meant to propose, but the text was perhaps indeed just to condensed. Thus, we had stated in line of the original document:

      “While the asymmetry is visible in all cell rows, there are larger areas without myosin and the distance of displacement is greater in lateral cells (Fig. 2G-J)”,

      and in the discussion (line 277 – 285):

      “Despite the homogeneous actin meshwork in stretching cells, the areas that are free of active myosin occupy a large proportion of the apical surface – similar to ectodermal or amnioserosa cells in which the connection of pulsatile foci to the underlying actin meshwork is lost. ... Dilution of cortical myosin may compromise a cell’s ability to make sufficient physical connections, in particular along the dorso-ventral axis, so that even if sufficient force is generated, it cannot shorten the cell in the long dimension. In other words, even though the cells have enough myosin to create force, the system is not properly engaged and its force is not transmitted to the cell boundary.”

      However, we didn’t state this with sufficient clarity in the results section and have added an extra sentence to this effect.

      If myosin activity were increased in laterals cells once central cells begin constricting, would that lead to an increased fraction of lateral cell surfaces covered by actomyosin networks and to reduced lateral cell elongation?

      This is a really nice experiment, and we have indeed tried to induce activation at later time points, but unfortunately this did not yield unambiguous results. If we did the manipulation after the central cells had clearly constricted, then activating lateral cells did not lead to their contraction. However, since this is a negative result and we have no independent criterion for knowing how 'strong' the induced contraction was (as explained above, we are unfortunately not able to visualize the myosin in these experiments), and why it might not have been sufficient to overcome the pull from central cells.

      In this context it is worth remembering that in mutants in which myosin is overactivated as a result of defective upstream signalling, lateral cells stretch less or not at all. See PMID: 24026125 for gprk2 mutants and our own results for active Rho1:

      {{images cannot be displayed}}

      Figure: Confocal Z-section of embryos expressing sqh::GFP (myosin; green) and GAP43::mCherry (membrane; magenta) imaged ventrally. A constitutively active form of Rho1 is ectopically expressed using a maternal Gal4 driver, inducing activation of myosin in more lateral cells. White dots mark the mesectoderm determined by backtracing after ventral furrow invagination. Yellow arrows in B are constricted cells in row 7/8.

      Minor

      1. Image panels are missing scale bars in many figures. > 2. Fig. 1C'-D': The authors should include a color bar to provide some indication of the scale of the apical areas measured. Same comment for other figures in which apical area is color-coded.

      We have added the missing elements

      1. Supp. Fig. 2E-F, G-H and Supp. Fig. 6: what is the difference between myosin intensity and myosin concentration? Junctional vs medial localization? Or summed vs mean pixel value? Please be specific, the difference between intensity and concentration is not clear.

      In the cases where we talk about myosin ‘amount’ we have now exchanged the term ‘intensity’, i.e the physical term for the amount of light, for ‘amount’ (i.e. that for which we use the light intensity as a proxy) and have explained in the main text how we define total apical myosin amount and apical myosin concentration (amount over area). However, in the cases where we are describing the actual image analysis, as in Suppl. Fig. 3, we use ‘intensity’ as the term of art that is used for the methods employed here. Similarly, the terms ‘sum intensity’ and ‘mean intensity’ are terms used for image in analysis in Fiji.

      The definitions of “junctional” and “medial” actin were introduced by the Lecuit lab (PMID: 21068726), and we have included the appropriate reference.

      1. Line 118: Supp. Fig. 2 does not have panels I and K. > 5. Line 223: the authors reference data at sec, but Supp. Fig. 6 does not show any images at that time point. They should be added or a different time point indicated.

      These errors have been corrected.

      Typos

      1. Abstract: "[in a supracellular context" should be "in a supracellular context". > 2. Line 145: should this be a reference to Supp. Fig. 5 instead of Supp. Fig. 4? > 3. Line 166: I am not sure how Supp. Fig. 5 supports this statement. Is this the right figure reference? Should it be Supp. Fig. 4 instead? > 4. Line 881: "representing on line" should be "representing one line".

      These errors have been corrected.

      Optional

      Tony Harris' lab showed that the Arf-GEF Steppke antagonizes myosin and facilitates cell deformation at the leading edge of the embryonic epidermis during Drosophila dorsal closure (West et al., Curr Biol, 2017). Does Steppke localize to junctions in lateral but not central mesoderm cells? Does the pattern of Steppke localization in the mesoderm change with manipulations to the contractility of central cells?

      This is certainly interesting, and we have ordered the protein trap, UAS constructs and RNAi lines. However, these will be long-term and time-consuming experiments.

      Significance:

      This is an interesting study, and one that makes uses of beautiful tools, including quantitative microscopy and image analysis, mathematical modeling and optogenetic manipulations. The prediction that embryonic cells display non-linear stress-strain responses is exciting, as linearity has been the predominant assumption so far. However, I find that model predictions are not well supported by the data, and that alternative interpretations of some results are possible. Additionally, the paper lacks insight into the molecular mechanisms that facilitate stretching (although that could be the subject of a follow-up study).

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary:

      In this study, the authors explore potential mechanisms for why some cell constrict while other cells expand, despite similar intrinsic genetic programs, during Drosophila ventral furrow formation at the onset of gastrulation. The authors combine quantitative analyses of cell shapes and myosin levels from multiphoton confocal and Multi-View SPIM imaging, optogenetic and laser perturbation experiments, and mechanical models to argue that nonlinear mechanical interactions between cells are required to explain the cell behaviors. Based on microscopic models of the actomyosin cytoskeleton in the tissue the authors argue that the required nonlinear mechanical behavior is consistent with actomyosin network reorganization.

      Major comments:

      • Although the area of investigation is exciting and the results are interesting, unfortunately the quality of the results and comparison between experiment and modeling in the current version of the manuscript are not convincing. Although it is not clearly explained in the manuscript, the experimental results on cell shapes, myosin intensity, laser manipulation, optogenetic perturbations appear to be from a single embryo or small number of embryos for each experiment (Figures 1, 3, 4).

      We had analysed a much larger number of embryos, but only included those for presentation that provided the most extensive data. It is extremely difficult to obtain absolutely ‘perfect’ embryos at high resolution for full quantification over long periods. ‘Perfect’ means that the embryos are mounted in such a way that they are imaged from an angle of 45 degrees off the dorso-ventral axis, so that initially mesodermal rows 3 to 7 are seen, and then, as furrow formation progresses, the more lateral rows move through the field of vision. It is difficult to mount in this perfect manner for two reasons: the shape of the embryo means that the embryo does not ‘like’ to be balanced in this position, but instead prefers to fall back on its side. Secondly, the embryo has to be mounted at a time point before visible differentiation along the D-V axis, so no visual cues exist to get the positioning right. This means that many of our recordings lack either the more ventral or the lateral cell rows. While the findings for these more restricted observations are fully consistent with our reports, they cannot be quantified with a full comparison across all cell rows over the entire imaging period. Nevertheless, we have processed and analysed further examples which we have now included in Suppl. Fig. 2 and Suppl. Fig. 8.

      The authors state that the cell stretching pattern "was best recapitulated by a superelastic response", but did not provide direct quantitative comparisons of the different mechanical models to the experimental data to clearly demonstrate this.

      Data that illustrate this were shown in Suppl. Fig 5 – but, admittedly, were not well explained, or rather, not at all. We have now added better explanations, expanded the figure, included new analyses, and now present some of these data in the new Fig. 2. Briefly, the figure shows that superelastic and elastoplastic responses are the only curves that successfully reproduce the pattern of stretching lateral cells (last 3 cells stretching with the inner cell stretching most and the last cell stretching least) while at the same time matching the ratio between the cell sizes of the most stretching cells to the least stretching cell.

      The top row of the parameter scans in Suppl. Fig. 5 (now Fig. 2) shows how many cells stretch for each combination of myosin curve steepness (y-axis) and width (x-axis) with shades of blue indicating the number of cells, and the red outline in the field where 3 cells stretch outlining those conditions where the inner cell stretches most. The bottom row shows the resulting size ratios of largest to smallest cell. High ratios in the region outlined in red in the top row are only reached for the superelastic and elastoplastic responses, with the elastomeric tending in the right direction.

      We have now also quantified a goodness-of-fit (root mean squared error, RMSE) measurement between our experimental data and the simulated data of all our models. This is shown now in the new Fig. 2.[1]

      We also note that only the parameter maps of the superelastic and elastoplastic models (Fig. 2J,K) resemble the equivalent parameter maps of the microscopic model (Fig. 3Q).

      Moreover, the local optogenetic myosin recruitment experiments in Figure 4 do not provide sufficient information on optogenetic tool recruitment,

      We have included images that illustrate the optogenetic construct in the illuminated cells, but not in the central cells in Suppl. Fig. 8. It is impossible to show the construct in the ‘dark’ cells, because illuminating them would activate the construct.

      myosin localization,

      As explained above, this is unfortunately technically not feasible. The best we can do is refer to the description of the construct by Izquierdo et al. (PMID: 29915285), which shows the accuracy of the tool and the highly specific membrane recruitment of myosin.

      or cell behaviors

      We have added quantitative comparisons between the experimental and control areas. to justify the claim that the central cells are not activated by the optogenetic perturbation and are only responding to the forces from neighboring cells.

      • The authors should provide direct quantitative comparisons of the models and experiments to clearly demonstrate their claims that the superelastic model is better than the linear model or other nonlinear models.

      See response above.

      • The authors should do additional experiments and/or provide more details for the existing experiments (to include several embryos per condition) on myosin quantification, photo-manipulation, and optogenetics experiments.

      We have provided data for more embryos for all cases.

      Additional controls would like be necessary for claims resulting from the optogenetics experiments in Figure 4.

      This has been addressed above – we have provided additional data and controls.

      • The additional time and resources required to address these concerns would depend on the experimental details, N values, and statistics in the current studies, which unfortunately were not described in the current manuscript.

      We have been able to add substantial additional data and have added the requested numbers. For many of the experiments each recording can be very time consuming and for the reasons explained in this response, it is not always easy to obtain precisely the desired recording from the desired imaging angle with the manipulations having been done precisely in the desired position. The numbers of embryos are therefore not high, but multiple shorter recordings provide a body of results that support the findings, but are not easily comparable statistically.

      • Methods descriptions for reproducibility are generally adequate, with the exception of N values and statistics

      See above.

      • Are the experiments adequately replicated and statistical analysis adequate?

      No, see above.

      Minor comments:

      1) Scale bars for images are missing throughout.

      We have added these

      2) Number of embryos and cells analyzed missing throughout text and figure legends. We have added additional embryos for all conditions and have included the numbers of cells analysed for all quantifications (except in cases where each data point represents a cell).

      3) Units are missing for many quantities in figures and tables throughout.

      We have added these

      4) Many figure references in the main text are incorrect, pointing either to the wrong figure or wrong figure panel.

      These have been corrected

      5) Line 728. What time point was used for myosin concentrations used in the model?

      We have added this information to the figure legend.

      How might myosin dynamics influence these findings?

      As regards the subcellular dynamics of myosin, these are included in the microscopic model (see ref Belmonte et al.;PMID: 28954810). Preliminary results showed that small changes in myosin stall force and unloaded myosin speed have little effect in our general results. This is now shown in a new supplemental figure (Suppl. Fig. 6). However, if the referee is referring to the dynamics of myosin accumulation over time, this is an interesting question.

      We had begun to explore this topic, but then realized for the linear stress-strain model that it is in fact expected that myosin accumulation would ultimately not affect the outcome. This is because in a linear model the final state of the system is determined by the final shape of the governing myosin profile regardless of the time evolution of the profile, and our simulations confirm this. A systematic analysis for all other stress- strain curves with temporal changes in myosin profiles (where a dependency on the profile temporal evolution is expected) is very time-consuming and will be interesting to pursue in future.

      The main conclusion here that linear models do not recapitulate the observed data as well as the non-linear ones stands regardless of how the temporal dynamics of myosin accumulation may affect the non-linear systems.

      6) The authors show a few examples of myosin pulsing in lateral cells and then conclude that myosin pulsing is not qualitatively different from central cells (lines 135- 136). The author should quantify the number of pulsing lateral cells as well as period and amplitude of pulsing, or discuss relevant results from prior studies in more detail to justify this conclusion.

      By ‘not qualitatively different’ we had meant only ‘in the sense that they are capable of generating contractile forces’, and we have made that more explicit in the text now. The quantitative differences have already been analysed and reported by the Martin lab (https://doi.org/10.1101/2020.04.15.043893; the pulses are slower and less persistent), and our point was that in spite of these known differences, the pulses are able to mediate constriction.

      7) Lines 145-150. The authors very briefly describe the results of the linear-stress strain response and conclude this did not yield outputs corresponding to in vivo data and leave this largely to the supplementary figures. This is a key point in the paper and deserves much more discussion and space in the main text.

      We have included a more extensive description and interpretation of the results in the main text, as detailed in several responses above

      As mentioned in main comments above, a quantitative comparison of the different mechanical models to show that the superelastic model better describes the observations should be included (potentially as an inset to Fig 2D showing a quantitative measure of the quality of model fit to the data).

      These comparisons have now been expanded and explained more extensively and moved to the main Figures.

      8) Lines 162-163. Provide more rationale for why strain-softening would most likely manifest as permanent or reversible cytoskeletal reorganization.

      The only component of the cell that can likely mediate this physical property and also respond at the observed time scales is the cytoskeleton. In these cells it is the main mechanical determinant. Other components that could in principle contribute to the nonlinearity of stress-strain response might be the viscosity of the cytosol, or the plasma membrane. However, stress responses of fluids to shear are usually in the direction of increasing stiffness, and rarely, if ever, with shear thinning. The same is mostly true for colloidal solutions. Therefore it is more likely that the stress-strain relationships at the apical surface of the cells are dominated by the dynamics of the actin cytoskeleton given that even the shape of the plasma membrane is in general determined by the cytoskeleton. We have added a note to this effect in the text.

      9) Lines 187-188. "This shows that forces acting on each cell from its neighbors have an important role in determining the cell's behavior." This seems somewhat obvious; perhaps a bit more explanation would help the reader to understand the importance of these results.

      We have expanded the explanations of these findings and added a sentence to relate them to the main model of the paper

      10) Lines 196-198. How were the concentrations and lengths of F-actin chosen? How were the concentration and properties of linkers chosen?

      The parameters were chosen on the basis of our earlier studies on simulated contractile meshworks and the theory underlying their behaviour. We had reported the conditions under which such meshes are able to contract, and also shown that the underlying theory correctly predicts behaviour of experimental meshworks (for those few conditions for which they have been reported).

      Unfortunately, there are practically no measurements for the length of F-actin filaments in vivo and estimates vary widely. Reliable data on the density of the cortical network are equally sparse.

      Based on our own previous work we chose concentrations of cross-linkers, myosin motors and transmembrane connectors that are able to ensure optimal contraction and force. Our in vivo measurements reported here show that the amounts of F-actin do not vary significantly across the mesoderm, so we used the same concentration of actin, crosslinkers and membrane connectors in all cells of the model, varying only myosin concentration. Taking into account the cell diameter of the mesodermal cells (~7um) and to ensure that the meshwork is sufficiently cross-connected (dense) to generate contraction and transmit forces between cells we used a model where each cell contains F-actin filaments of 1.5 um.

      We have expanded our supplemental material to make these points clearer.

      How sensitive are the results to these details of the cytoskeletal composition?

      We varied both the amounts of cytoskeletal components and the parameters controlling their dynamics (such as myosin stall force and viscosity) and found little impact on model predictions. These data are now presented in Suppl Fig. 6.

      11) Lines 238-244. It would be helpful to include some additional quantification that clearly shows the reader the differences in cell behaviors in control and perturbed tissue.

      We have added quantitative comparisons of the cells in the perturbed region with cells in an equivalent control region, together with evaluations of two additional embryos.

      For the optogenetics experiment, it would be important to show quantification that the lateral cells are not being directly perturbed during photoactivation of neighboring cells (e.g. due to light leakage).

      We have included this information, as described above.

      In both perturbations, it would be helpful to quantify how many cells in rows 7 and 8 constricted and by how much did they constrict? How reproducible were these effects?

      The perturbation experiments were those where it was most difficult to obtain a large number of identical-looking embryos that would allow broad statistics to be applied. For this to work, we would have to have embryos that were identically mounted and illuminated in the identical area of precisely rows 1 to 6 on each side of the midline – at a resolution of one cell row of 6.2 um width. And all this blind, because at the start of the manipulation there are no visual cues for orientation. Morphology gives no cues at this stage. The MS2-MCP-GFP works for laser ablations, but cannot be used for the optogenetics, because the embryo must not be exposed to blue light. This means we cannot predetermine precisely which rows we target.

      We have however added data and quantifications for the control and two further laser- manipulated embryos, which are now shown in suppl. Fig. 8. It is evident from both that our perturbations were slightly asymmetric and included the outer rows on only one side and on that side several cells that would normally have stretched are now strongly constricted. While by no means true for all lateral cells, this is a case of one black swan disproving the hypothesis that all swans are white: any constricting cell within two cell diameters of the mesectoderm, i.e. ones that would normally stretch proves that lateral cells do have the capacity to constrict.

      12) Lines 245-252. A key assumption in interpreting this experiment seems to be that the central cells are not directly perturbed by the optogenetic activation. Additional quantifications of RhoGEF2-CRY2 and/or myosin should be shown to support this.

      We have included an image of the optogenetically activated construct in this experiment in Fig. 5, but we cannot show its behaviour in the non-activated part because if we illuminated it, it would be activated. We were unable to create the embryos necessary to document the behaviour of myosin.

      It would be helpful to include some additional quantification that clearly shows the reader the differences in cell behaviors in control and experimental regions. How reproducible were these effects?

      We now provide the results from two additional embryos in Suppl. Fig. 8, and include quantitative comparisons between the control and experimental regions for these and for the embryos that are currently shown in Fig. 5 E.

      13) A section on statistics is missing from the methods section.

      We have added descriptions of the quantifications and statistics.

      14) Line 615. Ensure that Eq. 1 is dimensionally consistent; crucially, what units are used for 'M'? If the model is non-dimensionalized, provide the reference scales.

      Apart from the initial distance between membrane positions (set to 6.2 um) all other units in our visco-elastic model are arbitrary. In order to make this clearer, instead of using the term “viscosity” in equation 1, we now call it a “damping constant”.

      15) Line 675: The investigated stress-strain relationships are presented in Table S1. What are the definitions of xpl and xsh?

      We have included these definitions in materials and methods:

      All stress-strain curves are linear for extensive strains (∆𝑥) lower than the proportionality limit (𝑥!"), with some curves (elastoplastic and superelastic) undergoing a strain-softening to strain-hardening change after a given strain-hardening limit (𝑥#$).

      16) Line 678: Parameter values for the stress-strain relationships are given in Table S2. Can you provide more information on how these values were selected and their units? How sensitive are the results to changes in these values? Provide references when possible.

      The values for xpl and xsh were chosen to be within the range of the observed lengths of stretching cells, with xpl < xsh. Changing the values of each parameter listed in Table S2 does change the results quantitatively, but over the ranges we tested them, never to the point of making the linear or the other non-linear models reproduce the target pattern of stretching.

      We have stated this in the materials and methods section.

      17) Line 697. Please comment on why the embryo appears skewed to the right. Embryos are not always ‘perfect’, unfortunately. In addition, they can get slightly squashed during mounting and imaging. In spite of its imperfection, we showed this particular one, because we had imaging data for a long period without drift or other interference, and with good contrast at great depth.

      18) Line 712. A color-bar corresponding to this color-code is missing in the figure.

      This has been corrected.

      19) Lines 715-717. It seems panels E and E' are swapped in the legend.

      corrected

      20) Line 724 (Fig 2). It is difficult to read anything in panel K inset or Panel L inset.

      We have rearranged this figure and replaced some panels for greater clarity, and to remove redundancy.

      21) Line 728. What does "embryo 1" refer to?

      This was a remainder from an old plan where each embryo was numbered and listed in a table so that it could be cross-referred to. We have now described in the supplementary table the genotypes and imaging technique for each group of embryos. Where we show data or analyses of the same embryo in different figures, we refer directly to the relevant panels. We have made sure the embryos are referred to correctly in the figure legends.

      22) Line 732. A quantitative measure of the quality of the fits of the models to the experimental data should be included.

      We have done this, and the new data are now included in the new Figure 2.

      23) Line 739. What exactly does "Embryo 2" refer to?

      See comment 21

      24) Line 779. Why is a z-plane of 15 microns below surface chosen? > 25) Line 797. Why is a z-plane of 25 microns below the surface chosen?

      The planes were chosen in each case to show the reader in one single plane rows 7 and 8 along with the central cells > 26) Line 900. Panel G in Supp Fig 5 is not described in figure description.

      The panel captions were wrongly numbered. This has now been corrected, and more information on this figure has been included in the text. > - Are prior studies referenced appropriately?

      Yes.

      • Are the text and figures clear and accurate?

      No (see details listed above).

      • It would be very helpful to the reader to show direct quantitative comparison of the different mechanical models with the experimental observations to show how much better the nonlinear model is compared to the linear model.

      We have included this.

      An extended explanation of experiments and experimental results within the main text would improve the manuscript.

      We have expanded our explanations in many places.

      Significance:

      The key advance in this work is in identifying a potential role of nonlinear mechanical properties in contributing to distinct cell behaviors within a tissue during development in vivo. This contributes to a growing body of work highlighting the importance of cell and tissue mechanical properties in regulating cell behaviors during the formation of tissue structure.

      This work adds to a growing body of work connecting actomyosin contractility in cells to tissue-scale behavior during development. This work provides a unique mechanical modeling perspective to the study of apical constriction during Drosophila ventral furrow invagination, highlighting a potential role for superelastic cell mechanical behaviors during morphogenesis in vivo.

      The finding would be of interest to researchers working in the areas of morphogenesis, mechanobiology, the cytoskeleton, and active matter.

      This reviewer's expertise is in experimental studies of the cytoskeleton and cell mechanics during morphogenesis.

    1. SciScore for 10.1101/2021.04.23.440619: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: model: Human airway epithelial cells (hAECs) were purchased from Lonza or were expanded directly from either bronchial brushings from a main airway at bronchoscopy or a nasal brushing from the inferior turbinate from patients at Cambridge University Hospitals NHS Trust (Research Ethics Committee Reference 19/SW/0152).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Specific cells used were human bronchial epithelial cells (HBECs) derived from a non-smoking donor (Lonza; Cat# CC-2540, male); human bronchial epithelial cells from a male smoking donor undergoing bronchoscopy for a non-cancer indication, and nasal epithelial cells (MOD006) from a male patient.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Permeabilised cells were pelleted, stained for 15 minutes at room temperature in 100 μL of sheep anti-SARS-CoV-2 nucleoprotein antibody (MRC-PPU, DA114) at a concentration of 0.7 μg/mL, washed and incubated in 100 μL AF488 donkey anti-sheep (Jackson ImmunoResearch #713-545-147) at a concentration of 2 μg/mL for 15 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleoprotein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-sheep</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 713-545-147, RRID:AB_2340745)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used: Anti-ACE2 antibody (Anti-ACE2 antibody - N-terminal, ab228349 was originally used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral titre was determined by 50% tissue culture infectious dose (TCID50) in Huh7-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">% Cytotoxicity was calculated:

      Quantification and statistical analysis: Statistical analyses of mRNA expression assays and infection quantification data were performed using Prism 8 software (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04446429</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Anti-Androgen Treatment for COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04475601</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Enzalutamide Treatment in COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04455815</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial Looking at the Use of Camostat to Reduce Progression…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04608266</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">CAMOVID : Evaluation of Efficacy and Safety of Camostat Mesy…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 32, 29, 30 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Skip To ContentG6SearchBrowseYour ContentAssignmentsBinder 1110LSportsA few choose to climb world's tallest mountain without bottled oxygenSaveRead AloudShareGoogle ClassroomRemindEmailFacebookTwitterPinterestCopy LinkPrintIn this May 2013 photo, tents are pitched on Camp 2 as climbers rest on their way to the summit of 29,035-foot-tall Mount Everest. May is the most popular month for Everest climbs because of more favorable weather. AP Photo/ Pasang Geljen SherpaBy Washington Post, adapted by NewselaPublished:05/27/2016Word Count:972Take a step, stop, breathe in 15 times, breathe out 15 times, take another step and stop. This is how one of the world's most accomplished mountaineers describes approaching the summit of Mount Everest without the benefit of bottled oxygen."I'd be literally having to force myself after that 15th breath to take the next step," said Ed Viesturs, the only American who has stood atop all 14 of the world's 8,000-meter peaks. He scaled them all without using extra oxygen. In the thin air, he said, one wrong movement and "all of a sudden you lay there for 10 minutes trying to catch your breath."Most people who climb Everest begin using bottled oxygen, or just "oxygen" in climbing terms, at around 23,000 feet. Above 26,000 feet, nearly everyone uses it. Only 3 percent of the climbers who make it to the top of Everest don't use oxygen, according to Richard Salisbury of the Himalayan Database. These climbers make up almost a quarter of deaths taking place above 26,000 feet on Everest.Until this month, no one had been on top of Everest for two years. A catastrophic earthquake in Nepal triggered an avalanche that killed 24 climbers on the mountain last year.Most Climbers Need To Use Extra OxygenThis month, several hundred climbers reached the top of Everest, at least four died, and more are still climbing. Very few will reach the peak without oxygen.Among those trying are two U.S. climbers, veteran expedition guide Adrian Ballinger of Squaw Valley, California, and National Geographic photographer Cory Richards of Boulder, Colorado. In the thin atmosphere on Everest's peak, 29,035 feet up, each breath pulls in less than a third of the oxygen of a breath at sea level.Many science and medical professionals assumed climbing without oxygen was suicidal until 1978, when Reinhold Messner and Peter Habeler did it. Messner later wrote that he felt like "nothing more than a single narrow gasping lung, floating over the mists and summits" during his desperate crawl to the top.A Mexican climber reached the top of Everest without oxygen on May 12. Before that, the most recent summit without oxygen, and the most recent death without it, occurred four days apart in May 2013."Even if you're on oxygen at extreme altitude, you can't get nearly enough oxygen to feel good or be completely safe," said Peter Hackett, founder of the Institute for Altitude Medicine in Telluride, Colorado. "Without oxygen, your body is slowly dying."Lack Of Oxygen Results In Chain Reaction Of Negative EffectsThe lack of oxygen, called hypoxia, causes a chain reaction of physical effects, Hackett said. Breathing rate increases as the body tries to pull in more oxygen, physical tasks become harder because muscles require oxygen and breathing starts to take extra effort. Appetite is diminished and food isn't absorbed efficiently. Not getting enough food makes climbers ever more tired. They become too exhausted to melt snow for water and become dehydrated.Blood thickens as the body produces more oxygen-carrying red cells. Frostbite is more likely as the body pushes oxygen-rich blood toward its core and away from its limbs. Sleeping is difficult because less oxygen reaches the sleep centers of the brain. Lack of sleep and lack of oxygen combine to impair thinking and cloud judgment.People may hallucinate, take risks they shouldn't or become too tired. They might sit down and never get up.Many climbers get sick, starting with a headache and nausea. It can progress to poor body control, confusion, swelling in the brain, fluid in the lungs, coma and death. Some climbers who appear fine discover later they've suffered permanent brain damage.So Why Try? For The ChallengeGiven these risks, why would anyone want to try to go up Everest without oxygen?"If I'm going to go to a mountain that's 29,000 feet high like Everest, I want to climb that 29,000-foot mountain," said Viesturs, 56. He last climbed Everest in 2009. "In respect for the mountain, I try to climb it under its terms. ... It's not as intriguing if I bring the mountain down."In terms of the how it affects the body, bringing the mountain down is exactly what extra oxygen does. Some hardcore climbers consider it cheating.Biophysicist Thomas F. Hornbein climbed Everest in 1963. He calculated that the summit feels only half as high to a person resting on top, breathing bottled oxygen at three liters per minute. Even working hard and breathing hard rather than resting, the mountain would still seem a mile lower than it actually is."People always say it feels like you're Superman, and you can go faster and you stay warmer," said Viesturs of the feeling of breathing bottled oxygen. For him, though, the oxygen had an unpleasant side effect. Wearing the oxygen mask made him claustrophobic.U.S. Climbers Are Taking Extra PrecautionsBallinger and Richards insist they are not being overly dangerous. They spent weeks acclimating to the altitude. Ballinger slept in a hypoxic tent to mimic they altitude they are going to face. They are in constant contact with medical professionals through satellite Internet. They have a supply of emergency bottled oxygen stashed at 26,000 feet.Ballinger has summited Everest six times, all with oxygen. Richards hoped to climb without oxygen in 2012 but became ill and was airlifted off the mountain."What scares me is how I will walk that fine line between success and death," Ballinger said before the climb. "I want to try to find that line and stay on the correct side of it."This may not be up to him, said Hackett. Extreme altitude tolerance may depend more on genetics than fitness or preparation. "Without oxygen," Viesturs said, "99 percent of the people who have climbed Everest wouldn't have climbed Everest." Cancel Save AnnotateReproduced with permission. Copyright © 2016 Washington Post. All rights reserved.ActivitiesRelatedRelated ArticlesArticleNepali climber summits world's 14 highest mountains in record time12/04/2019, December 04 2019ArticleAfter deadly avalanche, Nepal's sherpa guides think twice about their jobs03/02/2015, March 02 2015ArticleTallest peak or tallest pigsty: Nepal struggles with trash on Everest03/05/2014, March 05 2014Help & Educator CenterTerms of UsePrivacy PolicyAbout Newsela AdsPartners©2021 Newsela Annotation       Unable to save at this time. REPLY PUBLISH UNPUBLISH  DISCARD SAVE DELETE UNDO var deg=deg||{};deg.gtm=deg.gtm||{}; deg.gtm.setCookie=deg.gtm.setCookie=function(k,l,b,d,e,f){try{b||(b=0);d||(d=!1);e||(e=!1);f||(f=!1);if(0<b){var g=new Date;g.setTime(g.getTime()+864E5*b);var h=g.toUTCString()}var a=k+"\x3d"+encodeURIComponent(l)+";";h&&(a+="expires\x3d"+h+";");if(!0===d&&!document.location.host.match(/^[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}$/)){var c=document.location.host.split(".");a+="domain\x3d"+c[c.length-2]+"."+c[c.length-1]+";"}e&&(a+="secure\x3dtrue;");f&&(a+="samesite\x3dstrict;");document.cookie= a+"path\x3d/"}catch(m){console.log("deg.gtm.setCookie Error",m)}}; deg.gtm.setCookie("trk_student_signed_in","true",365,!1,!0,!0);

      Central idea: Explorers do dumb things that they can die to just for glory

    2. Skip To ContentG6SearchBrowseYour ContentAssignmentsBinder 1110LSportsA few choose to climb world's tallest mountain without bottled oxygenSaveRead AloudShareGoogle ClassroomRemindEmailFacebookTwitterPinterestCopy LinkPrintIn this May 2013 photo, tents are pitched on Camp 2 as climbers rest on their way to the summit of 29,035-foot-tall Mount Everest. May is the most popular month for Everest climbs because of more favorable weather. AP Photo/ Pasang Geljen SherpaBy Washington Post, adapted by NewselaPublished:05/27/2016Word Count:972Take a step, stop, breathe in 15 times, breathe out 15 times, take another step and stop. This is how one of the world's most accomplished mountaineers describes approaching the summit of Mount Everest without the benefit of bottled oxygen."I'd be literally having to force myself after that 15th breath to take the next step," said Ed Viesturs, the only American who has stood atop all 14 of the world's 8,000-meter peaks. He scaled them all without using extra oxygen. In the thin air, he said, one wrong movement and "all of a sudden you lay there for 10 minutes trying to catch your breath."Most people who climb Everest begin using bottled oxygen, or just "oxygen" in climbing terms, at around 23,000 feet. Above 26,000 feet, nearly everyone uses it. Only 3 percent of the climbers who make it to the top of Everest don't use oxygen, according to Richard Salisbury of the Himalayan Database. These climbers make up almost a quarter of deaths taking place above 26,000 feet on Everest.Until this month, no one had been on top of Everest for two years. A catastrophic earthquake in Nepal triggered an avalanche that killed 24 climbers on the mountain last year.Most Climbers Need To Use Extra OxygenThis month, several hundred climbers reached the top of Everest, at least four died, and more are still climbing. Very few will reach the peak without oxygen.Among those trying are two U.S. climbers, veteran expedition guide Adrian Ballinger of Squaw Valley, California, and National Geographic photographer Cory Richards of Boulder, Colorado. In the thin atmosphere on Everest's peak, 29,035 feet up, each breath pulls in less than a third of the oxygen of a breath at sea level.Many science and medical professionals assumed climbing without oxygen was suicidal until 1978, when Reinhold Messner and Peter Habeler did it. Messner later wrote that he felt like "nothing more than a single narrow gasping lung, floating over the mists and summits" during his desperate crawl to the top.A Mexican climber reached the top of Everest without oxygen on May 12. Before that, the most recent summit without oxygen, and the most recent death without it, occurred four days apart in May 2013."Even if you're on oxygen at extreme altitude, you can't get nearly enough oxygen to feel good or be completely safe," said Peter Hackett, founder of the Institute for Altitude Medicine in Telluride, Colorado. "Without oxygen, your body is slowly dying."Lack Of Oxygen Results In Chain Reaction Of Negative EffectsThe lack of oxygen, called hypoxia, causes a chain reaction of physical effects, Hackett said. Breathing rate increases as the body tries to pull in more oxygen, physical tasks become harder because muscles require oxygen and breathing starts to take extra effort. Appetite is diminished and food isn't absorbed efficiently. Not getting enough food makes climbers ever more tired. They become too exhausted to melt snow for water and become dehydrated.Blood thickens as the body produces more oxygen-carrying red cells. Frostbite is more likely as the body pushes oxygen-rich blood toward its core and away from its limbs. Sleeping is difficult because less oxygen reaches the sleep centers of the brain. Lack of sleep and lack of oxygen combine to impair thinking and cloud judgment.People may hallucinate, take risks they shouldn't or become too tired. They might sit down and never get up.Many climbers get sick, starting with a headache and nausea. It can progress to poor body control, confusion, swelling in the brain, fluid in the lungs, coma and death. Some climbers who appear fine discover later they've suffered permanent brain damage.So Why Try? For The ChallengeGiven these risks, why would anyone want to try to go up Everest without oxygen?"If I'm going to go to a mountain that's 29,000 feet high like Everest, I want to climb that 29,000-foot mountain," said Viesturs, 56. He last climbed Everest in 2009. "In respect for the mountain, I try to climb it under its terms. ... It's not as intriguing if I bring the mountain down."In terms of the how it affects the body, bringing the mountain down is exactly what extra oxygen does. Some hardcore climbers consider it cheating.Biophysicist Thomas F. Hornbein climbed Everest in 1963. He calculated that the summit feels only half as high to a person resting on top, breathing bottled oxygen at three liters per minute. Even working hard and breathing hard rather than resting, the mountain would still seem a mile lower than it actually is."People always say it feels like you're Superman, and you can go faster and you stay warmer," said Viesturs of the feeling of breathing bottled oxygen. For him, though, the oxygen had an unpleasant side effect. Wearing the oxygen mask made him claustrophobic.U.S. Climbers Are Taking Extra PrecautionsBallinger and Richards insist they are not being overly dangerous. They spent weeks acclimating to the altitude. Ballinger slept in a hypoxic tent to mimic they altitude they are going to face. They are in constant contact with medical professionals through satellite Internet. They have a supply of emergency bottled oxygen stashed at 26,000 feet.Ballinger has summited Everest six times, all with oxygen. Richards hoped to climb without oxygen in 2012 but became ill and was airlifted off the mountain."What scares me is how I will walk that fine line between success and death," Ballinger said before the climb. "I want to try to find that line and stay on the correct side of it."This may not be up to him, said Hackett. Extreme altitude tolerance may depend more on genetics than fitness or preparation. "Without oxygen," Viesturs said, "99 percent of the people who have climbed Everest wouldn't have climbed Everest." Cancel Save AnnotateReproduced with permission. Copyright © 2016 Washington Post. All rights reserved.ActivitiesRelatedRelated ArticlesArticleAfter deadly avalanche, Nepal's sherpa guides think twice about their jobs03/02/2015, March 02 2015ArticleNepali climber summits world's 14 highest mountains in record time12/04/2019, December 04 2019ArticleTallest peak or tallest pigsty: Nepal struggles with trash on Everest03/05/2014, March 05 2014Help & Educator CenterTerms of UsePrivacy PolicyAbout Newsela AdsPartners©2021 Newsela Annotation       Unable to save at this time. REPLY PUBLISH UNPUBLISH  DISCARD SAVE DELETE UNDO var deg=deg||{};deg.gtm=deg.gtm||{}; deg.gtm.setCookie=deg.gtm.setCookie=function(k,l,b,d,e,f){try{b||(b=0);d||(d=!1);e||(e=!1);f||(f=!1);if(0<b){var g=new Date;g.setTime(g.getTime()+864E5*b);var h=g.toUTCString()}var a=k+"\x3d"+encodeURIComponent(l)+";";h&&(a+="expires\x3d"+h+";");if(!0===d&&!document.location.host.match(/^[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}$/)){var c=document.location.host.split(".");a+="domain\x3d"+c[c.length-2]+"."+c[c.length-1]+";"}e&&(a+="secure\x3dtrue;");f&&(a+="samesite\x3dstrict;");document.cookie= a+"path\x3d/"}catch(m){console.log("deg.gtm.setCookie Error",m)}}; deg.gtm.setCookie("trk_student_signed_in","true",365,!1,!0,!0);

      Central Idea: Explorers do dumb things just to get fame even if that means dying

    1. SciScore for 10.1101/2021.04.20.440658: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethic committees and institutional review boards from participating centres approved the study protocol considering it a minimal-risk research using data collected for routine clinical practice and waived the requirement to obtain informed consent.<br>Consent: Ethic committees and institutional review boards from participating centres approved the study protocol considering it a minimal-risk research using data collected for routine clinical practice and waived the requirement to obtain informed consent.<br>Field Sample Permit: Faecal samples were collected with a stool collection kit (EasySampler, ALPCO) containing RNAlater (Sigma-Aldrich).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Missing data management: Considering that multiple imputation can give rise to biased results when missing data are not random (22), regression analyses were based on complete data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">In order to achieve a statistical power of 80% and a two-sided significance level of 0.05, and considering the total sample size of 115 individuals, the study was powered to detect a mean difference of 0.15 in the Shannon’s Diversity Index between mild-to-moderate and severe COVID-19 patients.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data was filtered for length (cutadapt -m 80) and for quality (fastx_trimmer -l 280) after which the V3 and V4 regions were extracted (Mothur align.seqs and screen.seqs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mothur</div><div>suggested: (mothur, RRID:SCR_011947)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The taxonomy of each sample was determined using Kraken2 (https://ccb.jhu.edu/software/kraken2/) and Bracken (https://ccb.jhu.edu/software/bracken) softwares, using our custom 16S database (GutHealth_DB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Kraken2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This database was manually curated by enriching GreenGenes (versions 13_5 and 13_8) with clinically relevant taxa from NCBI RefSeq 16s rRNA sequences (04/2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GreenGenes</div><div>suggested: (Greengenes, RRID:SCR_002830)</div></div><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using the SPSS version 27 software (SPSS Inc.) and R statistical software package, version V.3.5.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Univariate and multivariate weighted logistic regression models were used in order to evaluate risk factors associated with the severity of COVID-19 (a score of 6 or more in WHO Clinical Progression Scale).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WHO Clinical Progression Scale</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04355741</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Gut Microbiota, "Spark and Flame" of COVID-19 Disease</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.22.440848: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral production: Low-passage HEK 293FT cells were grown in DMEM supplemented with 10% FBS (D10 media) and passaged using TrypLE (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">150,000 cells/cm2 of 293FT cells in suspension were mixed with the PEI-DNA DMEM mixture and allowed to incubate for 5 minutes at room temperature and then plated in D10 for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The original stock from BEI was passaged through a 0.45 μM syringe filter and then 5 μl was inoculated onto an 80% confluent T175 flasks (Nunc) of Vero-E6 cells to produce our p1 stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 hours, viral supernatant was harvested, centrifuged at 800xg for 5 minutes to remove cell debris, and used to transduce 800,000 Cas9-expressing Calu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was rescued and passaged in Huh7.5.1 cells multiple times until widespread GFP fluorescence and cytopathic effects were observed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5.1</div><div>suggested: RRID:CVCL_E049)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To rescue the VSVdG-RABV-G, 293FT cells (Thermo Fisher Scientific) were co-cultured with VeroE6 cells in a 6-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce p2 working SARS-CoV-2 stocks, 5 μl of the p1 stock was inoculated onto 80% confluent T175 flasks of Vero-E6 cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PEI (0.71ug PEI/cm2 cell culture area) was mixed with 1 mL of DMEM. pMD2.G, PAX and library plasmid (0.178ug/cm2, at a 0.25 (pMD2.G): 0.5 (psPAX): 1(Library plasmid) ratio were thoroughly mixed with 1 mL DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2.G</div><div>suggested: RRID:Addgene_12259)</div></div><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In short, VSVdG-eGFP (Addgene, Plasmid #31842) was modified to insert in frame with the deleted VSV-G a codon optimized SARS-CoV-2-S based on the Wuhan-Hu-1 isolate (GenBank:MN908947.3), which was mutated to remove a putative ER retention domain (K1269A and H1271A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSVdG-eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This gene was assembled into VSV-eGFP-dG (Addgene, Plasmid #31842) in frame with the G coding sequence between MluI and NotI to generate VSV-eGPF-RABV-G.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-eGFP-dG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV-eGPF-RABV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected with pCAGEN-VSV-N (300ng), pCAGEN-VSV-P (500ng), pCAGEN-VSV-L (200ng), pCAGEN-VSV-G (800ng), pCAGGS-T7 (200ng), and VSV-eGFP-dG-RABV-G (500ng) using JetPrime (Polyplus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGEN-VSV-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGEN-VSV-P</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGEN-VSV-L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGEN-VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-T7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Any genes that exhibited depletion or enrichment in the top 500 hits between the plasmid library and the uninfected control were removed from STRING analysis as they are likely confounded by affecting cellular growth or survival unrelated to viral infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.21.21255473: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This activity was reviewed by CDC and was conducted consistent with applicable federal law and CDC policy (see e.g., 45 C.F.R. part 46.102(l)(2), 21 C.F.R. part 56; 42 U.S.C. §241(d); 5 U.S.C. §552a; 44 U.S.C. §3501 et seq.) Sites participating in COVID-NET obtained approval from their respective state and local Institutional Review Boards, as applicable.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Detailed clinical data are collected for a random sample of cases aged ≥18 years stratified by age and surveillance site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data on race and ethnicity were categorized as follows: non-Hispanic White (White), non-Hispanic Black (Black), Hispanic or Latino (Hispanic), non-Hispanic Asian or Pacific Islander (Asian/PI), non-Hispanic American Indian or Alaska Native (AI/AN) and people of more than one race/ethnicity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using SAS 9.4 software (SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This analysis has several limitations. Because COVID-NET covers approximately 10% of the U.S. population, our findings may not be generalizable to the entire country. This analysis presented data for the entire network and did not account for differences across sites; several factors, including peaks in hospitalization rates and the racial/ethnic distribution of cases varied by site. Since SARS-CoV-2 testing was conducted at the discretion of healthcare providers, COVID-NET may not have captured all COVID-19-associated hospitalizations. Changes in testing practices over the course of the pandemic may have influenced trends as sicker patients were more likely to be tested early in the pandemic when testing capacity was limited. The relative standard errors for some estimates were >0.3, particularly for interventions or outcomes with low prevalence, such as RRT or in-hospital deaths among patients aged 18-49 years. Lastly, sample sizes were not sufficient to fully explore differences in interventions and outcomes by race/ethnicity or to produce estimates for all racial/ethnic groups including AI/AN and Asian/PI patients. In future analyses, COVID-NET will combine additional months of data to characterize trends in severe outcomes among these racial/ethnic groups. This analysis describes changes in characteristics, interventions and outcomes among U.S. adults hospitalized with COVID-19 over the first 10 months of the pandemic. Large declines in the percentage of patients with CO...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.22.441007: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent to take part in the study.<br>IRB: This study “Fatores de susceptibilidade genética e proteçao imunológica à COVID-19” was approved on the 25th of May 2020 by the Ethics committee of the Centro Hospitalar Lisboa Ocidental, in compliance with the Declaration of Helsinki, and follows international and national guidelines for health data protection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of ACE2 expression, cells were stained with a primary antibody against ACE2 (4µg/ml, R&D Systems, catalog no. AF933) followed by a secondary antibody labelled with Alexa Fluor 568 (1:1000; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C347-1000, RRID:AB_1271963)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times as previously and goat anti-human IgG-HRP secondary antibodies (Abcam, ab97215) were added at 1:25,000 and incubated 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess the specificity of our assay, an anti-Spike antibody neutralization assay and an RBD competition assay were performed in SARS-CoV-2 S pseudotyped and vesicular stomatitis virus (VSV) G pseudotyped lentiviral particles, in parallel (fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and plasmids: Human hepatocellular carcinoma HuH-7 cells (a kind gift from Dr Colin Adrain, Instituto Gulbenkian de Ciência,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuH-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Portugal), Human Embryonic Kidney 293T (provided by Prof Paul Digard, Roslin Institute, UK) and 293ET cells (from Dr Colin Adrain) were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, 21969035) supplemented with 10 % fetal bovine serum (FBS, Gibco, 10500064), 1% penicillin/streptomycin solution (Biowest, L0022) and 2mM L- glutamine (ThermoFisher, 25030024), at 37°C and 5% CO2 atmosphere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293ET</div><div>suggested: RRID:CVCL_6996)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of 293T cells stably expressing human ACE2 receptor: To produce VSV-G pseudotyped lentiviruses encoding the human ACE2, 293ET cells were transfected with pVSV-G, psPAX2 and pLEX-ACE2 using jetPRIME (Polyplus), according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK 293T and 293T-ACE2 cells were prepared for flow cytometry analysis by detaching from the wells with trypsin, followed by fixation with 4% paraformaldehyde).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the RBD competition assay, 293T-ACE2 cells were pre-incubated with three-fold serial dilutions of SARS-CoV-2 spike’s receptor binding domain, starting with a concentration of 400 µg/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MSC was purchased from Thermo Scientific; psPAX2 and pVSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G were a kind gift from Dr Luís Moita (Instituto Gulbenkian de Ciência, Portugal); pEGFP-N1 was provided by Dr Colin Crump (University of Cambridge, UK); and pCAGGS containing the SARS-Related Coronavirus 2, Wuhan-Hu-1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEGFP-N1</div><div>suggested: RRID:Addgene_111933)</div></div><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amplified sequence was cloned back into pCAGGS-SARS-CoV-2-S, between AgeI and SacI restriction sites, generating the expression vector pCAGGS-SARS-CoV-2-Strunc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SARS-CoV-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-SARS-CoV-2-Strunc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral reporter plasmid pLEX-GFP was produced by PCR amplifying GFP from pEGFP-N1 (primers in Table 1) and cloning the insert into BamHI–XhoI restriction sites in the multi-cloning site of pLEX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLEX-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For lentiviral plasmid pLEX-ACE2 production, human ACE2 coding sequence was amplified from Huh7 cDNA and cloned into pLEX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLEX-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLEX</div><div>suggested: RRID:Addgene_117987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of 293T cells stably expressing human ACE2 receptor: To produce VSV-G pseudotyped lentiviruses encoding the human ACE2, 293ET cells were transfected with pVSV-G, psPAX2 and pLEX-ACE2 using jetPRIME (Polyplus), according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production and titration of spike pseudotyped lentiviral particles: To generate spike pseudotyped lentiviral particles, 3×106 293ET cells were co-transfected with 8.89ug pLex-GFP reporter, 6.67ug psPAX2, and 4.44ug pCAGGS-SARS-CoV-2-S WT or mutants (or pVSV.G, as a control), using jetPRIME according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSV . G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MSC was purchased from Thermo Scientific; psPAX2 and pVSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Scientific</div><div>suggested: (Thermo Scientific Wellwash Wellwash, RRID:SCR_020569)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G were a kind gift from Dr Luís Moita (Instituto Gulbenkian de Ciência, Portugal); pEGFP-N1 was provided by Dr Colin Crump (University of Cambridge, UK); and pCAGGS containing the SARS-Related Coronavirus 2, Wuhan-Hu-1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Portugal)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of cell populations was performed in a Becton Dickinson (BD) LSR Fortessa X-20 equipped with FACS Diva and FlowJo (BD, Franklin Lakes, NJ) software’s</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentration (IC50) was determined using four-parameter nonlinear regression (least squares regression without weighting; constraints: bottom=0) (GraphPad Prism 9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This was done for all PDB structures using in-house Python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the numerical python library (NumPy (97)) was used to calculate the frequency of contact for each spike protein residue with an antibody residue, from the sample of PDB structures analyzed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NumPy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MD simulation of the RBD-ACE2 complex: Molecular dynamics (MD) simulations of the RBD bound to the ACE2 protein were performed with the GROMACS 2020.3 package (98), using the Amber14sb (99) force field, starting from the 6m0j structure (12), in a truncated dodecahedron box filled with water molecules (minimum of 1.2 nm between protein and box walls).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our approach has some caveats. Regarding the neutralization assays, and despite spike being the immunodominant protein targeted by antibodies (7–11), other viral proteins may contribute, even if in a small proportion to neutralization activity in vivo, which we are unable to detect using spike-pseudotyped particles. In addition, the sera/plasma we used was obtained at a fixed time interval. Future experiments should repeat the analysis using sera/plasma of people infected with known genotypes, or from different geographical areas and obtained at different times along the epidemics dynamic. Finally, we inspected a handful of mutations and not a comprehensive mutational map across spike (2, 4). However, we traced several mutations across spike in single and multiple combinations, and thus, we conclude that our analysis is relevant to inform on mutation-driven escape viruses to antibodies. The analysis of frequency of interactions between spike-antibodies or ACE2 has some issues associated as well. The pool of complexes spike protein/RBD and antibodies analyzed here is not necessarily representative of the universe of antibodies found in COVID-19 patients, since it is limited by the availability of structural information and is biased to monoclonal antibodies (table S4). All the antibodies analyzed are neutralizing antibodies, which is not the case in nature (53). Additionally, many structural studies have focused on the interaction with the RBD, while other regions have not bee...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.20.440722: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Georgia (Protocol A2019-03-032-Y1-A3) and performed following the IACUC Guidebook of the Office of Laboratory Animal Welfare and PHS policy on Humane Care and of Use of Laboratory Animals.<br>Field Sample Permit: Studies were performed in an animal Biosafety level 3 containment facility at the Animal Health Research Center (AHRC) at the University of Georgia. Cells and Virus: The SARS-CoV-2 (Isolate USA-WA1/2020) isolate, kindly provided by Dr. S. Mark Tompkins, Department of Infectious Diseases, University of Georgia, was used for virus challenge in the animal studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse experiments: Female K18-hACE2 mice (6 weeks old) were randomly distributed into six groups (n=6/group for controls and n=9/group for challenged), anesthetized and challenged intranasally with 50 µL of phosphate buffer saline (PBS), 1×103 TCID50/mouse (Low virus dose) or 1×105 TCID50/mouse (High virus dose).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse experiments: Female K18-hACE2 mice (6 weeks old) were randomly distributed into six groups (n=6/group for controls and n=9/group for challenged), anesthetized and challenged intranasally with 50 µL of phosphate buffer saline (PBS), 1×103 TCID50/mouse (Low virus dose) or 1×105 TCID50/mouse (High virus dose).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the virus was grown in Vero E6 Pasteur cells provided by Maria Pinto (Center for Virus research, University of Glasgow, Scotland, UK), and maintained in Dulbecco’s Modified Eagles Medium (DMEM, Sigma-Aldrich, St Louis, MO) containing 10% fetal bovine serum (FBS, Sigma-Aldrich, St Louis, MO), 1% antibiotic/antimycotic (AB, Sigma-Aldrich, St Louis, MO) and 1% L-Glutamine (Sigma-Aldrich, St Louis, MO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse experiments: Female K18-hACE2 mice (6 weeks old) were randomly distributed into six groups (n=6/group for controls and n=9/group for challenged), anesthetized and challenged intranasally with 50 µL of phosphate buffer saline (PBS), 1×103 TCID50/mouse (Low virus dose) or 1×105 TCID50/mouse (High virus dose).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicon concentration was measured using the Qubit dsDNA HS Assay kit (ThermoFisher, Waltham, MA) on the Qubit 3.0 fluorometer (ThermoFisher, Waltham, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amplicon</div><div>suggested: (Amplicon, RRID:SCR_003294)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment size distribution was analyzed on a subset of samples using the Agilent Bioanalyzer 2100 DNA-HS assay (Agilent, Santa Clara, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Taxonomy was assigned in ‘dada2’ using the native implementation of the naïve Bayesian classifier using Silva v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Silva</div><div>suggested: (SILVA, RRID:SCR_006423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hierarchal cluster analysis of the Bray-Curtis distances was created using command hclust with agglomeration method “average” (UPGMA) producing a cophenetic correlation coefficient of 0.79.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hclust</div><div>suggested: (HCLUST, RRID:SCR_009154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dendrogram was created using the function plot and shading/group colors were added using Adobe Illustrator (Version 25.0.1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some limitations of this study must be noted. While the environment was stable and controlled, the sample size for each group at each time point was small and the potential contribution of cage effect on the microbiome was not analyzed. The high mortality observed in the high virus dose groups only allowed for collection of two time points (2 and 5 dpc, only one sample was collected at 14 dpc from the only survivor in the High/GC-376 group). As indicated above, ceca samples were only collected for mice not treated with GC-376. In contrast, lung samples from mock inoculation/vehicle treated control mice did not yield sufficient amplifiable microbial DNA for sequencing, so the comparison focused on SARS-CoV-2 dose-dependent responses in GC-376 treated mice. The microbiome of the cecum showed significant decreases in Shannon and Inv Simpson index comparing the control to the low-dose and high-dose infected groups (Fig. 2B and 2C). The low virus dose group shared a higher number of ASVs with the control group compared to the high virus dose group (Fig. 2D). These observations suggest a virus dose-dependent effect of the ceca microbial diversity in mice infected with SARS-CoV-2. While preparing the manuscript, a report was published that analyzed the small intestine microbiome of hACE2 mice among unvaccinated and vaccinated mice challenged with a high dose of SARS-CoV-2 (47). While we compare control mice to low and high doses of non-vaccinated mice challenged with SARS-CoV-2 in t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.21.21255881: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were reviewed and ethical approval was given by the Yale University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human subjects: Volunteers from the CT Army and Air National Guard were recruited to have their SARS-CoV-2 spike antigen-specific antibody levels tested.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μL of HRP anti-Human IgG Antibody (Pharmingen/BD Biosiences, San Jose, CA) or HRP anti-human IgA (BioLegend, San Diego, CA) were added at 1:2000-fold dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral titers were measured by standard plaque assay using Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.21.440697: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Both studies were approved by the Institutional Review Board at Benaroya Research Institute (IRB20-036 and IRB07109 respectively).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody (Table S3) incubation with antibodies against OAS1 (CST)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OAS1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">24h after transfection, cells were lysed in Co-IP (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.5% NP40; 1 mM EDTA) buffer and OAS1 proteins were immunoprecipitated from the lysate using 20 µg anti-FLAG antibody (Sigma) and Dynabeads Protein G.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed three times with PBS and then stained with the secondary antibodies goat anti-rabbit IgG Alexa Fluor 488 (Themo Fisher) and goat anti-mouse IgG Alexa Fluor 648 (Thermo Fisher) in PBS containing 1% BSA and 0.3% Triton X-100 for 1 hour in the dark at room temperature (Table S2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-648F4B, RRID:AB_10276759)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">WNV infected cells were washed three times with PBS and then stained with the secondary antibodies goat anti-rabbit IgG Alexa Fluor 488 (Themo Fisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T, A549, Vero, PH5CH8, Huh7, and HeLa cells were grown in DMEM (Sigma) containing 10% heat-inactivated fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin-glutamine (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">OAS1 and RNASEL KO 293T were generated using lentiviral transduction as described previously followed by selection in 2 μg/mL puromycin or blasticidin (Lau et al., 2015)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RNASEL KO 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G into 293FT cells for lentiviral packaging.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transduced with ACE2-expressing lentivirus and selected with puromycin (2 mg/mL) for 4 days to generate 293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were differentiated with PMA for 24h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For EMCV, WNV, CVB, and IAV infections, OAS1 KO 293T cells were seeded in 12 well plates coated with 10 μg/mL poly-L-ornithine hydrobromide (Sigma) and allowed to adhere overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OAS1 KO 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For EMCV and WNV, titration was performed on Vero cells grown to 90% confluency in 6-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IAV was titered on MDCK cells grown to 90% confluency in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infections, 293T-ACE2 cells seeded in 24-well plates (100,000 cells/well) were transfected with 250ng of plasmid (Empty vector, p42, p46, and p46 ATIL) using the TransIT X2 kit (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants were harvested at 48hpi, and serial dilutions were tittered on Vero E6 cells seeded at 90% confluency in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA immunoprecipitation: OAS1 KO Huh7 cells were seeded the day before transfection with FLAG-p42, FLAG-p42CTIL, FLAG-p46, FLAG-p46ATIL or an EV control using TransIT-X2 (Mirus Bio).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of knockout cell lines using CRISPR/Cas9 gene editing: Cloning of OAS1 targeting guide RNA (gRNA) 5′-GTGCATGCGGAAACACGTGTCTGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Puro vector or RNase L targeting gRNA 5′-GTTATCCTCGCAGCGATTGCGGGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Blast was achieved using the In-Fusion enzyme mix (Clontech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRRLU6-empty-gRNA-MND-Cas9-t2A-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRRLU6-empty-gRNA-MND-Cas9-t2A-Blast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This amplicon was cloned into a pLEX lentiviral backbone cut with BamHI and XhoI using the InFusion HD kit (Takara).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLEX</div><div>suggested: RRID:Addgene_117987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLEX-ACE2 was co-transfected with psPAX2 and pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLEX-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">N-terminal FLAG-tagged versions of OAS1 p42 and p46 were generated by cutting pcDNA3.1 OAS1 p42, p42CTIL, p46 and p46ATIL with BamHI and cloning of a 3xFLAG fragment by PCR amplification from pEF FLAG-ZAP-L (Schwerk et al., 2019) and Gibson assembly using primers 5′-CGACTCACTATAGGGAGACCCAAGCTTGGTACCGAGCTCGATGGACTACAAAGAC-3′ and 5′-GTCCAGAGATTTGGCTGGGGTATTTCTG AGATCCATCATGCTTGTCATCGTCATCCTTGTAATCGATG-3′ (Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 OAS1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEF FLAG-ZAP-L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression plasmids encoding p42DADA, p46DADA in pCDNA3.1 were generated by site-directed mutagenesis on pCDNA3.1 p42 or p46.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pCDNA3.1 p42</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pcDNA3.1 FLAG-OAS1 p46 was cut with KflI and ApaI. gBlocks were PCR-amplified using the following primer pair 5′-TAAGAATTGGGATGGGTCCCCAG-3′ and 5′-GACACTATAGAATAGGGCCCTCTAGA-3′ and then cut with with KflI and ApaI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 FLAG-OAS1 p46</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T OAS1 KO cells were incubated with 25 µM geranylgeranylalcohol azide (GGAA) and transfected with 250 ng/mL pCDNA3.1 FLAG-tagged OAS1 expression constructs 3h after addition of GGAA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1 FLAG-tagged</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gibson assembly compatible sequences for the unique portions for p46, p46ATIL, and p48, were generated by PCR amplification of gBlocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>gBlocks</div><div>suggested: (Gblocks, RRID:SCR_015945)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed on a BD FACS Canto II. % VSV-GFP+ cells were quantified using FlowJo (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of co-localization was performed using the Fiji Coloc 2 plugin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tests for association between cases and controls were performed by logistic regression using PLINK, with sex, age (as of April 1, 2020), deprivation score of residential postal code, and the first 10 principal components as covariates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PLINK</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses (other than genetic analysis) were performed with Prism 8 and the specific statistical analyses performed are indicated in the figure legends.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.20.440678: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All cells were maintained at 37°C with 5% CO2 Source of Primary Human T cells: Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Surface expressed proteins were assayed for using Alexa Fluor 647 Anti-Myc tag antibody (Cell Signaling Technologies #2233S)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Myc tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells expressing ACE2 and TMPRSS2, a generous gift of Hannah S Sperber and Dr. Satish Pillai, were cultured in DMEM High Glucose (Gibco #10569-010) supplemented with 10% FBS, 1% of Antibiotic-Antimycotic,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of Stable Cell Lines: Lenti-X 293T cells (Takara Bio #632180) were seeded at approximately 7e5 cells/well in a 6-well plate to yield ~80% confluency the following day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was changed after 24 hours, and at 48 hours the viral supernatant was filtered through a 0.45μm PVDF filter and added to Jurkat or K562 cells seeded at approximately 1e5 cells/well in a 12-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K562</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to the flow cytometry, cells were seeded at densities described below in a 96 well plates, using flat-bottom plates (Falcon #353072) for experiments involving BHK-21 cells and U bottom plates for all other experiments (Falcon #877217) and incubated for 24-72 hours as specified by the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day cells were transfected with 1.5μg of transfer vector containing the desired expression cassette, and the lentiviral packaging plasmids pMD2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G (170ng) and pCMV-dR8.91 (1.33μg) using 10μl of Lipofectamine 2000 (Invitrogen #11668-027) according to manufacturer protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with plasmid DNA (340 ng of Spike vector, 1μg CMV-Gag-Pol (pCMV-dΔR8.91), 125 ng pAdvantage (Promega), 1 μg Luciferase reporter (per 6-well plate)) for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dΔR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For positive control, Spike vector was replaced with pMD2.G and for negative control this vector was omitted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2.G</div><div>suggested: RRID:Addgene_12259)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For LCB1 and LCB3, protein sequences were translated to human optimized coding sequences using Benchling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Benchling</div><div>suggested: (Benchling, RRID:SCR_013955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were collected using FACSDiva (BD Biosciences) Flow Cytometry: Flow cytometry was performed using a LSR-Fortessa (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein concentration was estimated based on the protein absorbance at 280nm with a spectrophotometer (Nanodrop One, Thermo), flash frozen, and stored in −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data analysis was conducted using custom Python scripts, available on github (https://github.com/weinberz/sarsnotch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was conducted in Jupyter59 and relied on numpy60, matplotlib, seaborn, pandas, SciPy61, scikit-learn62 and fcsparser.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.20.440651: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was conducted in Mayo Clinic’s AAALAC (Association for the Assessment and Accreditation of Laboratory Animal Care)- accredited facilities and were approved by the Institutional Animal Care and Use Committee (<br>Euthanasia Agents: Mice were euthanized via CO2 gas, then sterilized with 70% ethanol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody ELISAs: Binding IgG and IgA antibody responses in mouse serum, hamster serum, and bronchoalveolar lavage fluid were measured by ELISA against spike S1 protein and SARS-CoV-2 receptor binding domain variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For hamster samples, the secondary antibodies used were: Peroxidase Conjugated Affinity Purified Anti-Golden Syrian Hamster IgG (H&L) Goat (Rockland Inc.), and Rabbit Anti-Hamster IgA (Brookwood Biomedical).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Golden Syrian Hamster IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Hamster IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mouse samples, the secondary antibodies used were: GOXMO HRP HIGH XADS (Invitrogen), and HRP-Goat Anti-Mouse IgA (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 h, cells were transferred to nitrocellulose plates, coated with anti-IFN-γ antibody, and incubated for 24 more hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blotting: Human A549 lung cells were infected with RD- or SC-Ad spike at the indicated multiplicities of infection (MOI) and harvested 24 hours later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: BALB/c mice were purchased from Charles River Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This full-length sequence was inserted into the shuttle plasmid pAd6-NdePfl-CMV-MCS-3X-LZL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAd6-NdePfl-CMV-MCS-3X-LZL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This sequence was recombined into pAd6-ΔE1-ΔE3 and pAd6-ΔIIIa-ΔE3 by red recombination as in (20–22) to generate RD-Ad6-spike and SC-Ad-Spike, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAd6-ΔE1-ΔE3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pAd6-ΔIIIa-ΔE3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cycle Adenovirus Expressing Wild-type SARS-CoV-2 spike: A codon-optimized cDNA encoding the original wild-type spike protein from severe acute respiratory syndrome coronavirus 2 isolate 2019-nCoV_HKU-SZ-002a_2020, accession number MN938384.1 was synthesized by Genewiz.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Prism 9 Graphical software was used for all statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Analysis: Prism</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.19.440481: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The original studies to obtain blood samples after written informed consent were previously described and had been approved by the Ethics Board of ChongQing Medical University24.<br>IRB: The original studies to obtain blood samples after written informed consent were previously described and had been approved by the Ethics Board of ChongQing Medical University24.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six-to eight-week-old female hACE2 mice were treated with 58G6 or 510A5 monoclonal antibody at a concentration of 10 mg/kg by intraperitoneal route, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAbs: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific mAbs: IMGT/V-QUEST ( http://www.imgt.org/IMGT_vquest/vquest )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A CM5 chip (GE Healthcare) was linked with anti-human IgG-Fc antibody to capture about 9000 response units of the neutralizing Abs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next days, the membranes were washed with TBST and incubated with HRP-conjugated Goat-anti-human Fc antibody (Abcam, ab99759, 1:10000) for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ab99759</div><div>suggested: (Abcam Cat# ab99759, RRID:AB_10673762)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISA plates were washed 4 times by blocking buffer and 50 μL Goat F(ab’)2 Anti-Human IgG (Fab’)2 secondary antibody conjugated with ALP (Abcam, ab98532, 1:2000) was incubated with the plate at RT for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the mixtures were then transferred into 96-well plates, which were seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 72 hrs, the luciferase activities of infected HEK293T/ACE2 cells were detected by the Bright-Luciferase Reporter Assay System (Promega, E2650)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells (Thermo Fisher Scientific, USA) cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, USA) were maintained at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 and B.1.351 viruses and animal study: Authentic SARS-CoV-2 (WIV04) and B.1.351 (NPRC 2.062100001) viruses were propagated on the Vero-E6 cells and titrated by single layer plaque assay with standard procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudovirus bearing S protein: pVSVG expressing SARS-CoV-2 S protein was constructed as previously described29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVG</div><div>suggested: RRID:Addgene_85140)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: To express the prefusion S ectodomain, the gene encoding residues 1-1208 of SARS-CoV-2 S (GenBank: MN908947.3) with a C-terminal T4 fibritin trimerization motif, an HRV-3C protease cleavage site, a Twin-Strep-tag and an 8 × His-tag was synthesized, and cloned into the mammalian expression vector pcDNA3.1, which was a kind gift from L.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 and IC80 of the evaluated mAbs was and calculated by a four-parameter logistic regression using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAbs: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2605 micrographs were collected in a single session with a defocus range comprised between 1.0 and 2.8 μm using SerialEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data processing: All dose-fractioned images were motion-corrected and dose-weighted by MotionCorr2 software32 and their contrast transfer functions were estimated by cryoSPARC patch CTF estimation33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCorr2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following 2D, 3D classifications, and refinements were all performed in cryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both of the 58G6 and 13G9 Fab models were first predicted using Phyre226 and then manually built in Coot 0.936 with the guidance of the cryo-EM electron density maps, and overall real-space refinements were performed using Phenix 1.1837.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>