The “shared” schema is effectively the API schema. These are the fields exchanged in the API, common to client and server.

Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)

React is an isomorphic/universal framework. That means that there is a virtual representation of the UI component tree, and that is separate from the actual rendering that it outputs in the browser.

Now it is much clearer that id is really a family of infinitely many functions. It is fair to say that it is an abstract function (as opposed to a concrete one), because its type abstracts over the type variable a. The common and proper mathematical wording is that the type is universally quantified (or often just quantified) over a.

Quantified Types

Write programs to handle text streams, because that is a universal interface.

zxcvbn works identically on the server

The “universal” label that has been slapped on to it is superfluous, but it does have its merits. Now that we have a commonly known term to refer to environment agnostic JavaScript code, it allows library authors to list it as a feature and be fashionable doing it. I’m happy with the term “universal” being fashionable because it makes developers think about their dependencies on the runtime environment. In the end this will help the JavaScript ecosystem mature and allow libraries to be used everywhere.

The “universal” label that has been slapped on to it is superfluous

Running the same code in the browser and on the server in order to avoid code duplication is a very different problem. It is simply a matter of good development practices to avoid code duplication. This however is not limited to isomorphic applications. A utility library such as Lodash is “universal”, but has nothing to do with isomorphism. Sharing code between environments does not give you an isomorphic application. What we’re referring to with Universal JavaScript is simply the fact that it is JavaScript code which is environment agnostic. It can run anywhere. In fact most JavaScript code will run fine on any JavaScript platform.

Maybe we should distinguish between: The technique of asssembling pages on either client or server. Here, “isomorphic” and “full stack” (as proposed by Rodrigo Medeiros) seem good choices. JavaScript that runs in all (or most) JavaScript environments, especially browsers and Node.js. Here, “universal” seems a good choice.

And they have largely moved beyond the mental model of universal design (UD) in the physical environment, which is static, bounded, and predictable—instead designing interactions according to UDL, which sees interactions as dynamic, open, and emergent.

They typically chop off the end of the word "accessibility," focusing their efforts on expanding access, regardless of the ability profiles of their learners

Mandate: The gov’t mandates that everyone buy health insurance, funding comes from payroll taxes.

2-Tier: The gov’t pays two-thirds, and the private sector pays one-third.  

Single-Payer: The gov’t taxes its citizens to pay for health care.

Single-Payer, 2-Tier, and Mandate systems.

He is a bit disturbed by this notion that salaries have to be at the high levels expected by US developers, which seems to permeate the FOSS sustainability effort. He said that he is often accused of wanting developers to starve, but that is not true at all: he wants people to get reasonable pay for reasonable work, to have health care, be able to live a comfortable middle-class life, and so on. But if being sustainable as a project means paying salaries at Silicon Valley levels, it simply will not work—it is not something we should bring back to FOSS, he said. We should look at what people need to live comfortably, while working on something they enjoy.

Mahatma Gandhi, the father of our nation was a very benevolent and expert political master and observer that he had a great vision for the country. He was a man who fought for the upliftment of the poorer classes of society and thought of reforms in their favour.

Since online learning has a different setting from the conventional classroom,online educators need to use some special techniques and perceptions to leadto success. Moreover, adults have special needs and requirements as learnerscompared with children and adolescents, thus online educators should knowhow adults can learn best because of their special characteristics. Philosophicaland methodological shifts also affect instruction. Many researchers havesuggested that constructivism should be applied in distance education. Thus,this paper attempts to examine the impact of constructivism in online learningenvironments when focusing on adult learners. The author develops the con-nection between constructivism and adult learning theory. In addition, thepaper proposes instructional guidelines using the constructivist approach inonline learning for adults.

oever removed from the best. It is one property of this system of notation. that whilst it furnishes the means of recording each person's ideas of gesture. it docs not presume lo dictate. It is a language, which may be used to express

Complex ideas are not universal, as .. we can see by the difficulties of translating from one language to another.

universal propositions, and would settle in their minds universal truths,

ideas, which are also universally the same

including the universal language from which all languages spring

university

"universal

Defect

cumenical

This means developing a flexible learning environment in which information is presented in multiple ways, students engage in learning in a variety of ways, and students are provided options when demonstrating their learning.

“We know that poverty is a major driver of ill-health. We also know that poor people trust doctors. It’s a free service. Many other services they won’t access because they worry about the cost,” said Prosper Canada CEO Liz Mulholland.

However, we are willing to work with you on what's really bothering you if you stop behaving like Subhuman sacks of dog shit. Let's fight the influence of big business and Electoral Corruption together. Let's get Universal Basic Income done so not just you, but every American is always secure. Let's end the pointless wars. Let's revitalize and stimulate our inner cities

At the core of human rights are the ideals and goals of the “four freedoms” articulated by US President Franklin Delano Roosevelt—freedom of speech, freedom of worship, freedom from fear, and freedom from want—and also the primary goal of self-determination. To achieve these conditions, it is also understood that while all rights are “interrelated, interdependent and indivisible,” the absolute basics of life (e.g., water, food, clothing, and shelter) must first be met.

problematiccategory

Perelman and Olbrechts-Tyteca emphasize that there is no actual universal audience, nor any unimpeachable facts or truths that could be presented to it, but rather, only an idea in the speaker's mind about what such an audience would be were it to exist.

O you

Gentile or Jew

naive realism,

Nowhere are there as many bullshit jobs, however, as in Silicon Valley. A survey of 5,000 software developers and engineers last year found that, in the words of The Economist, “many of them feel alienated, trapped, underappreciated and otherwise discombobulated.” Only 19% of tech employees say they are satisfied with their jobs. A mere 17% feel valued. Or, as a former math whiz working at Facebook lamented a few years ago: “The best minds of my generation are thinking about how to make people click ads.”

while e-mail dissolves barriers to the exchange of data, we need another solvent to dissolve the barriers to collaborative use of that data. Applied in the right ways, that solvent creates what I like to call the “universal canvas” – an environment in which data and applications flow freely on the Web.

while e-mail dissolves barriers to the exchange of data, we need another solvent to dissolve the barriers to collaborative use of that data. Applied in the right ways, that solvent creates what I like to call the “universal canvas” -- an environment in which data and applications flow freely on the Web.

A universal definition of intellectual property might begin by identifying it as nonphysical property which stems from, is identified as, and whose value is based upon some idea or ideas. Furthermore, there must be some additional element of novelty. Indeed, the object, or res, of intellectual property may be so new that it is unknown to anyone else. The novelty, however, does not have to be absolute. What is important is that at the time of propertization the idea is thought to be generally unknown. The re

There are two universal, general gifts be-stowed by nature upon man, Reason and Speech; dialectic is the theory of the former, grammar and rhetoric of the latte

show that the good or the harm, the honour or disgrace, the justice or injustice, is great or small, either absolutely or relatively; and therefore it is plain that we must also have at our command propositions about greatness or smallness and the greater or the lesser -- propositions both universal and particular.

Accordingly all men make use, more or less, of bot