- Last 7 days
-
Local file Local file
-
A few hourslater, when I remembered that he had just finished writing a book onHeraclitus and that “reading” was probably not an insignificant part of hislife, I realized that I needed to perform some clever backpedaling and lethim know that my real interests lay right alongside his
Oliver wrote a book on Heraclitus, the main connector between his ideology, characterization, and the theory of universal flux, that one may not necessarily be one's past temporal part -- but one who continues it, like an illusion of movement.
-
- Mar 2024
-
Local file Local file
-
It was said (76) that it isimpossible to devise a system wliich could be applied universally,the card registers give a very clear illustration of tliis.
This is a restatement that a particular system should be customized to its users.
There is potential that a system could be applied universally, but it requires a very large amount of data and metadata to suit the needs of a greater number of people and use cases. It also requires a reasonable amount of work in practical use to make it operate as expected.
The Mundaneum was likely close on paper and Google comes close to this, but still isn't perfect.
quote via ¶76 and 92
-
- Feb 2024
-
Local file Local file
-
Most of these enthusiasts were idealists who wanted to create auniversal language which would help international relations and unite theworld. This noble hope stood in contrast with – and probably in reaction to –the rise of nationalisms in the late nineteenth century. Over 150 newlanguages were created in this period, the best-known being Volapük (1879),Pasilingua (1885), Esperanto (originally called Lingvo Internacia) (1887),Spelin (1888), Spokil (1889), Mundolingue (1889), and Ido (1907).
-
- Jan 2024
-
sakai.claremont.edu sakai.claremont.edu
-
thosewho have made it for themselves are twice as fond of it as those whochaven’t
money and relationship with it
-
A good person wouldn’t easily bear old age ifhe were poor, but a bad one wouldn’t be at peace with himself even if hewere wealthy
aging and money
-
they remember from their youth, those of sex, drinking parties, feasts, andthe other things that go along with them, and they get angry as if theyhad been deprived of important things
major universal truth! ppl do this now
-
-
-
6c CAACGCGARGAACCTTACC 966–984
967F primer
Tags
Annotators
URL
-
-
www.youtube.com www.youtube.com
-
Some of Newton's notes come from a 1654 edition of: Gregory, Francis. Ονομαστικὸν βραχύ; sive, Nomenclatura brevis, Anglo-Latino-Græca, in usum Scholæ Westmonasteriensis. Per F. G. [i.e. Francis Gregory.] Editio vigesima secunda, etc. John Meredith, in trust for Royston and Elizabeth Meredith, 1710.
-
-
journals.asm.org journals.asm.org
-
PCR primers F-968-GC (59-CGC CCG GGG CGC GCC CCG GGCGGG GCG GGG GCA CGG GGG GAA CGC GAA GAA CCT TAC-39)
968f
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
968f968–984AACGCGAAGAACCTTACNübel et al., 1996
968F
-
- Nov 2023
-
docdrop.org docdrop.org
-
we've talked a lot about zooming in down and back on the evolutionary ladder like there's no obvious point at which intelligence emerges and there's a nice Elegance to pan psychism like it's 00:39:53 all always there and it's just on a continuum and maybe there's some bare minimum unit of Consciousness but if you scale it upwards again past humans even past social 00:40:06 networks at the at the most extreme level you would have okay treat the entire universe as a single system you get this kind of pantheist Cosmos psyche mind of God in Spinoza's terms what do 00:40:19 you think of that
- for: panpsychism, Spinoza, universal consciousness
-
- Oct 2023
-
static.igem.org static.igem.org
-
Making universal media for bacterial strains
Universal media
-
- Sep 2023
-
-
- for: symbiocene, ecozoic, ecocivilization, eco-civilization, animal communication, inter-species communication, Azi Raskin, Earth Species Project, umwelt
-
summary
- Very interesting talk given by Aza Raskin, founder of:
- https://www.earthspecies.org/
- cofounder of https://www.humanetech.com/
- on two main themes:
- how AI is being used to decode language communication of many different plant and animal species, including inter-fauna, inter-flora and fauna-flora cross communication
- how AI used to study human languages has detected a universal meaning shape between all languages.
- Very interesting talk given by Aza Raskin, founder of:
-
reference
-
can we build one of these kinds of shapes for animal communication
-
for: question, question - universal meaning shape for animal communication
-
comment
- this would be an amazing project for TPF and BEing journeys. Could we actually talk to animals and plants to ask them about how we humans are treating them?
-
-
pretty much every human language that's been tried ends up fitting in a kind of universal human meaning shape 00:15:40 which I think is just so profound especially in this time of such deep division that there is a universal hidden structure underlying us all
-
for: language, quote, quote - Aza Raskin, quote - universal language shape, quote - universal meaning shape, CHD, CHD - language - universal meaning shape
-
quote
- pretty much every human language that's been tried ends up fitting in a kind of universal human meaning shape
- which I think is just so profound especially in this time of such deep division that there is a universal hidden structure underlying us all
-
Tags
- Earth Species Project
- language - universal meaning shape
- quote - language - universal meaning shape
- ecozoic
- eco-civilization
- animal communication
- universal meaning shape
- symbiocene
- umwelt
- quote
- question
- ecological civilization
- CHD
- question - universal meaning shape for animal communication
- Azi Raskin
- quote - Aza Raskin
- question - talk to animals and plants about human impacts
- quote - universal meaning shape
Annotators
URL
-
-
www.britannica.com www.britannica.com
-
R.U.R.: Rossum’s Universal Robots, drama in three acts by Karel Čapek, published in 1920 and performed in 1921. This cautionary play, for which Čapek invented the word robot (derived from the Czech word for forced labour), involves a scientist named Rossum who discovers the secret of creating humanlike machines. He establishes a factory to produce and distribute these mechanisms worldwide. Another scientist decides to make the robots more human, which he does by gradually adding such traits as the capacity to feel pain. Years later, the robots, who were created to serve humans, have come to dominate them completely.
-
-
www.euronews.com www.euronews.com
-
“In a few months’ time, this government will not be accountable for the severe consequences that may follow from the Schiphol decision, particularly with respect to relations with the Netherlands’ trading partners, and lost jobs and prosperity at home,”
- for: KLM cap, air travel cap, flight cap, degrowth
- comment
- “In a few months’ time, this government will not be accountable for the severe consequences that may follow from the Schiphol decision, particularly with respect to relations with the Netherlands’ trading partners, and lost jobs and prosperity at home,”
- This comment ONLY refers to things economic, and NOTHING to climate boiling, which air travel is a significant contributor to.'
- If they saw it coming from years ago, why did they not adapt? It is their failure to adapt itself that places themselves in a self-created position of vulnerability
- During a transition as unprecedented as this, the governments of the world must invoke policy that gives protection to workers in industries such as the airline industry and all industries downstream of it so that they can survive the transition as such jobs vanish or morph.
- Indeed, this is one of the major tenets of degrowth advocates. A Universal Basic Income and job retraining to sustainable jobs is the responsible thing to do to protect from job losses.
-
- Aug 2023
-
danallosso.substack.com danallosso.substack.com
-
Remember ChatGPT? It is going to do to the white collar world what robotics and offshoring did to blue collar America. So maybe this isn't the best time to be abandoning the Humanities to focus on vocational training?
This is one of the things that doesn't seem to be being explored enough presently, or at least I'm not seeing it outside of the SAG and WGA strikes where it seems to be a side issue rather than a primary issue.
-
-
-
category theory + zettelkasten... hmmm... feels a bit like Leibniz chasing a universal language
what is a zettelkasten monad?
-
- Jul 2023
-
davidkorten.org davidkorten.org
-
Labor in a fully func-tioning Ecological Civilization will include three essentialelements.
- for:UBI, universal basic income
- for: UBI, universal basic income, futures
- The physical labor required to maintain life’s essential conditions against the forces of entropy.
- The intellectual labor required to constantly test and advance the individual and collective maps of our ever-evolving territory.
-
The spiritual labor required to continuously renew our sense of individual and collective connection to all that is.
-
comment
- two of these are articulating the entanglement of the individual and collective.
-
- Jun 2023
-
osf.io osf.io
-
The use of innovative Web-based technologies, including open source software, data-sharing archives, open collaboration methods, and the liberation of thousands of relevant research articles from proprietary sources show us that the fundamental components of a fully open system are readily available, technologically efficient and cost-effective.
The technology is here, now the governance of the UN to make all science open. Until that time, add +'sci-hub.se'. (Or any other link that works (sci-hub.ru, sci-hub.li)
Tags
Annotators
URL
-
- May 2023
-
www.washingtonpost.com www.washingtonpost.com
-
Hans H. Wellisch died on 2004-02-06.
-
-
www.reddit.com www.reddit.com
-
I went to that website and he mentions the Dewey Decimal Classification System. I have look around and only found examples/files that goes a few levels deep. He gives an example: 516.375 Finsler geometry BUT I can not find any DDC files that goes to that level of classification. The DDC is finer grain than the what the AOoD system goes so for me I am going with the DDC for possible keywords list.Any ideas where I can find a complete DDC listing I can download?
reply to drogers8 at https://www.reddit.com/r/antinet/comments/13eyg8p/comment/jkaksn4/?utm_source=reddit&utm_medium=web2x&context=3
You can find some basic top level or second level DDC listings online, but to get the full set of listings, you've got to subscribe to the system which is updated every few years, something only library systems and large publishers typically do. To give yourself an idea of how deep this rabbit hole goes the DDC 23 is four volumes long and each volume is in the 1,000 page range. The DDC 23 self-identifies as 0.25.4'31-dc22. For most categories DDC generally only goes as deep as the thousands place (like Finsler geometry) though others will go slightly deeper usually to designate locations/cities. Most libraries only categorize to the tenths place, and sometimes these numbers can be found on the copyright page of books, often with the DDC volume number. I mentioned the UDC in that piece, but didn't give any links, but you could try:<br /> - https://udcsummary.info/php/index.php?lang=en - https://udcc.org/index.php/site/page?view=subject_coverage - https://en.wikipedia.org/wiki/Universal_Decimal_Classification
Honestly, you're wasting time and making way more work for yourself to adopt one of these numbering methods for a Luhmann-esque zettelkasten. Try asking yourself this question: What benefits/affordances will I get in the long run for having my numbering system mirror the DDC or UDC? (Unless you can come up with a really fantastic answer, you're just making more work to look up headings/numbers on a regular basis.)
In practice the numbers are simply addresses so you can quickly find things again using your index. If you're doing threads of cards (folgezettel), you're going to very quickly have tangentially related ideas of things mixed together anyway. (As an example, I've got lots of science and even some anthropology mixed into my math section, so having DDC numbers on those would be generally useless at the end of the day.) If it helps, Nicolas Gatien has a pretty reasonable and short video which makes this apparent: https://www.youtube.com/watch?v=tdHH3YjOnZE.
-
Extended numbering and why use Outline of Disciplines at all? .t3_13eyg8p._2FCtq-QzlfuN-SwVMUZMM3 { --postTitle-VisitedLinkColor: #9b9b9b; --postTitleLink-VisitedLinkColor: #9b9b9b; --postBodyLink-VisitedLinkColor: #989898; } Several things:Why are there different listings for the Academic Outline of Disciplines? Some starts the top level with Humanities and other start with Arts which changes the numbering?I am createing an Antinet for all things. Some of the levels of the AOOD has more then 9 items so Scott's 4 digit system would not work. For some levels I would have to use two digits. Thoughts?Why even use said system? Why is it a bad reason to just start with #1 that indicates the first subject sequence, #2 for a different subject etc..?
reply to u/drogers8 at https://www.reddit.com/r/antinet/comments/13eyg8p/extended_numbering_and_why_use_outline_of/
Based on my research, Scott Scheper was the one of the original source for people adopting the Academic Outline of Disciplines. I've heard him say before that he recommends it only as a potential starting place for people who are new to the space and need it as a crutch to get going. It's an odd suggestion as almost all of the rest of his system is so Luhmann-based. I suspect it's a quirk of how he personally started and once moving it was easier than starting over. He also used his own ZK for showing others, and it's hard to say one thing in a teaching video when showing people something else. Ultimately it's hard to mess up on numbering choices unless you're insistent on using only whole numbers or natural numbers. I generally wouldn't suggest complex numbers either, but you might find some interesting things within your system if you did. More detail: https://boffosocko.com/2022/10/27/thoughts-on-zettelkasten-numbering-systems/ The only reason to have any standardized base or standardized numbers would be if you were attempting to have a large shared ZK with others. If this is your intent, then perhaps look at the Universal Decimal Classification, though a variety of things might also work including Dewey Decimal.
-
- Feb 2023
-
www.pendrivelinux.com www.pendrivelinux.com
-
www.reddit.com www.reddit.com
-
Are there symbols for 'supported by' or 'contradicted by' etc. to show not quite formal logical relations in a short hand?
reply to u/stjeromeslibido at https://www.reddit.com/r/Zettelkasten/comments/10qw4l5/are_there_symbols_for_supported_by_or/
In addition to the other excellent suggestions, I don't think you'll find anything specific that that was used historically for these, but there are certainly lots of old annotation symbols you might be able to co-opt for your personal use.
Evina Steinova has a great free cheat sheet list of annotation symbols: The Most Common Annotation Symbols in Early Medieval Western Manuscripts (a cheat sheet).
More of this rabbit hole:
- Steinová, Evina. Notam Superponere Studui: The Use of Annotation Symbols in the Early Middle Ages. Brepols, 2019.
- Cappelli, Adriano. The Elements of Abbreviation in Medieval Latin Paleography. University of Kansas Libr., 1984.
- Coulson, Frank, and Robert Babcock. The Oxford Handbook of Latin Palaeography. Oxford University Press, 2020.
- Lindsay, W. M. Notae Latinae. Cambridge University Press, 2013. https://archive.org/download/notaelatinaeacco00lindrich/notaelatinaeacco00lindrich.pdf.
- Bains, Doris. A Supplement to Notae Latinae (Abbreviations in Latin Mss. of 850 to 1050 A.D.). Cambridge [England] University Press, 1936. http://archive.org/details/supplementtonota0000bain.
(Nota bene: most of my brief research here only extends to Western traditions, primarily in Latin and Greek. Obviously other languages and eras will have potential ideas as well.)
Tironian shorthand may have something you could repurpose as well: https://en.wikipedia.org/wiki/Tironian_notes
Some may find the auxiliary signs of the Universal Decimal Classification useful for some of these sorts of notations for conjoining ideas.
Given the past history of these sorts of symbols and their uses, perhaps it might be useful for us all to aggregate a list of common ones we all use as a means of re-standardizing some of them in modern contexts? Which ones does everyone use?
Here are some I commonly use:
Often for quotations, citations, and provenance of ideas, I'll use Maria Popova and Tina Roth Eisenberg's Curator's Code:
- ᔥ for "via" to denote a direct quotation/source— something found elsewhere and written with little or no modification or elaboration (reformulation notes)
- ↬ for "hat tip" to stand for indirect discovery — something for which you got the idea at a source, but modified or elaborated on significantly (inspiration by a source, but which needn't be cited)
Occasionally I'll use a few nanoformats, from the microblogging space, particularly
- L: to indicate location
For mathematical proofs, in addition to their usual meanings, I'll use two symbols to separate biconditionals (necessary/sufficient conditions)
- (⇒) as a heading for the "if" portion of the proof
- (⇐) for the "only if" portion
Some historians may write 19c to indicate 19th Century, often I'll abbreviate using Roman numerals instead, so "XIX".
Occasionally, I'll also throw drolleries or other symbols into my margins to indicate idiosyncratic things that may only mean something specifically to me. This follows in the medieval traditions of the ars memoria, some of which are suggested in Cornwell, Hilarie, and James Cornwell. Saints, Signs, and Symbols: The Symbolic Language of Christian Art 3rd Edition. Church Publishing, Inc., 2009. The modern day equivalent of this might be the use of emoji with slang meanings or 1337 (leet) speak.
Tags
- Tironian shorthand
- paleography
- manuscript studies
- reply
- symbology
- note taking affordances
- nanoformats
- annotation symbols
- Curator's Code
- shorthand
- hat tip
- leet speak
- Universal Decimal Classification
- via
- Maria Popova
- Medieval texts
- Evina Steinova
- ars memoria
- Tina Roth Eisenberg
- emoji
Annotators
URL
-
- Oct 2022
-
writing.bobdoto.computer writing.bobdoto.computer
-
The question often asked: "What happens when you want to add a new note between notes 1/1 and 1/1a?"
Thoughts on Zettelkasten numbering systems
I've seen variations of the beginner Zettelkasten question:
"What happens when you want to add a new note between notes 1/1 and 1/1a?"
asked at least a dozen times in the Reddit fora related to note taking and zettelkasten, on zettelkasten.de, or in other places across the web.
Dense Sets
From a mathematical perspective, these numbering or alpha-numeric systems are, by both intent and design, underpinned by the mathematical idea of dense sets. In the areas of topology and real analysis, one considers a set dense when one can choose a point as close as one likes to any other point. For both library cataloging systems and numbering schemes for ideas in Zettelkasten this means that you can always juxtapose one topic or idea in between any other two.
Part of the beauty of Melvil Dewey's original Dewey Decimal System is that regardless of how many new topics and subtopics one wants to add to their system, one can always fit another new topic between existing ones ad infinitum.
Going back to the motivating question above, the equivalent question mathematically is "what number is between 0.11 and 0.111?" (Here we've converted the artificial "number" "a" to a 1 and removed the punctuation, which doesn't create any issues and may help clarify the orderings a bit.) The answer is that there is an infinite number of numbers between these!
This is much more explicit by writing these numbers as:<br /> 0.110<br /> 0.111
Naturally 0.1101 is between them (along with an infinity of others), so one could start here as a means of inserting ideas this way if they liked. One either needs to count up sequentially (0, 1, 2, 3, ...) or add additional place values.
Decimal numbering systems in practice
The problem most people face is that they're not thinking of these numbers as decimals, but as natural numbers or integers (or broadly numbers without any decimal portions). Though of course in the realm of real numbers, numbers above 0 are dense as well, but require the use of their decimal portions to remain so.
The tough question is: what sorts of semantic meanings one might attach to their adding of additional place values or their alphabetical characters? This meaning can vary from person to person and system to system, so I won't delve into it here.
One may find it useful to logically chunk these numbers into groups of three as is often done using commas, periods, slashes, dashes, spaces, or other punctuation. This doesn't need to mean anything in particular, but may help to make one's numbers more easily readable as well as usable for filing new ideas. Sometimes these indicators can be confusing in discussion, so if ever in doubt, simply remove them and the general principles mentioned here should still hold.
Depending on one's note taking system, however, when putting cards into some semblance of a logical sort-able order (perhaps within a folder for example), the system may choke on additional characters beyond the standard period to designate a decimal number. For example: within Obsidian, if you have a "zettelkasten" folder with lots of numbered and named files within it, you'll want to give each number the maximum number of decimal places so that when doing an alphabetic sort within the folder, all of the numbered ideas are properly sorted. As an example if you give one file the name "0.510 Mathematics", another "0.514 Topology" and a third "0.5141 Dense Sets" they may not sort properly unless you give the first two decimal expansions to the ten-thousands place at a minimum. If you changed them to "0.5100 Mathematics" and "0.5140 Topology, then you're in good shape and the folder will alphabetically sort as you'd expect. Similarly some systems may or may not do well with including alphabetic characters mixed in with numbers.
If using chunked groups of three numbers, one might consider using the number 0.110.001 as the next level of idea between them and then continuing from there. This may help to spread some of the ideas out as surely one may have yet another idea to wedge in between 0.110.000 and 0.110.001?
One can naturally choose almost any any (decimal) number, so long as it it somewhat "near" the original behind which one places it. By going out further in the decimal expansion, one can always place any idea between two others and know that there will be a number that it can be given that will "work".
Generally within numbers as we use them for mathematics, 0.100000001 is technically "closer" by distance measurement to 0.1 than 0.11, (and by quite a bit!) but somehow when using numbers for zettelkasten purposes, we tend to want to not consider them as decimals, as the Dewey Decimal System does. We also have the tendency to want to keep our numbers as short as possible when writing, so it seems more "natural" to follow 0.11 with 0.111, as it seems like we're "counting up" rather than "counting down".
Another subtlety that one sees in numbering systems is the proper or improper use of the whole numbers in front of the decimal portions. For example, in Niklas Luhmann's system, he has a section of cards that start with 3.XXXX which are close to a section numbered 35.YYYY. This may seem a bit confusing, but he's doing a bit of mental gymnastics to artificially keep his numbers smaller. What he really means is 3000.XXX and 3500.YYY respectively, he's just truncating the extra zeros. Alternately in a fully "decimal system" one would write these as 0.3000.XXXX and 0.3500.YYYY, where we've added additional periods to the numbers to make them easier to read. Using our original example in an analog system, the user may have been using foreshortened indicators for their system and by writing 1/1a, they may have really meant something of the form 001.001/00a, but were making the number shorter in a logical manner (at least to them).
The close observer may have seen Scott Scheper adopt the slightly longer numbers in the thousands (like 3500.YYYY) as a means of remedying some of the numbering confusion many have when looking at Luhmann's system.
Those who build their systems on top of existing ones like the Dewey Decimal Classification, or the Universal Decimal Classification may wish to keep those broad categories with three to four decimal places at the start and then add their own idea number underneath those levels.
As an example, we can use the numbering for Finsler geometry from the Dewey Decimal Classification wikipedia page shown as:
``` 500 Natural sciences and mathematics
510 Mathematics 516 Geometry 516.3 Analytic geometries 516.37 Metric differential geometries 516.375 Finsler geometry
```
So in our zettelkasten, we might add our first card on the topic of Finsler geometry as "516.375.001 Definition of Finsler geometry" and continue from there with some interesting theorems and proofs on those topics.
Of course, while this is something one can do doesn't mean that one should do it. Going too far down the rabbit holes of "official" forms of classification this way can be a massive time wasting exercise as in most private systems, you're never going to be comparing your individual ideas with the private zettelkasten of others and in practice the sort of standardizing work for classification this way is utterly useless. Beyond this, most personal zettelkasten are unique and idiosyncratic to the user, so for example, my math section labeled 510 may have a lot more overlap with history, anthropology, and sociology hiding within it compared with others who may have all of their mathematics hiding amidst their social sciences section starting with the number 300. One of the benefits of Luhmann's numbering scheme, at least for him, is that it allowed his system to be much more interdisciplinary than using a more complicated Dewey Decimal oriented system which may have dictated moving some of his systems theory work out of his politics area where it may have made more sense to him in addition to being more productive on a personal level.
Of course if you're using the older sort of commonplacing zettelkasten system that was widely in use before Luhmann's variation, then perhaps using a Dewey-based system may be helpful to you?
A Touch of History
As both a mathematician working in the early days of real analysis and a librarian, some of these loose ideas may have occurred tangentially to Gottfried Wilhelm Leibniz (1646 - 1716), though I'm currently unaware of any specific instances within his work. One must note, however, that some of the earliest work within library card catalogs as we know and use them today stemmed from 1770s Austria where governmental conscription needs overlapped with card cataloging systems (Krajewski, 2011). It's here that the beginnings of these sorts of numbering systems begin to come into use well before Melvil Dewey's later work which became much more broadly adopted.
The German "file number" (aktenzeichen) is a unique identification of a file, commonly used in their court system and predecessors as well as file numbers in public administration since at least 1934. We know Niklas Luhmann studied law at the University of Freiburg from 1946 to 1949, when he obtained a law degree, before beginning a career in Lüneburg's public administration where he stayed in civil service until 1962. Given this fact, it's very likely that Luhmann had in-depth experience with these sorts of file numbers as location identifiers for files and documents. As a result it's reasonably likely that a simplified version of these were at least part of the inspiration for his own numbering system. † ‡
Your own practice
At the end of the day, the numbering system you choose needs to work for you within the system you're using (analog, digital, other). I would generally recommend against using someone else's numbering system unless it completely makes sense to you and you're able to quickly and simply add cards to your system with out the extra work and cognitive dissonance about what number you should give it. The more you simplify these small things, the easier and happier you'll be with your set up in the end.
References
Krajewski, Markus. Paper Machines: About Cards & Catalogs, 1548-1929. Translated by Peter Krapp. History and Foundations of Information Science. MIT Press, 2011. https://mitpress.mit.edu/books/paper-machines.
Munkres, James R. Topology. 2nd ed. 1975. Reprint, Prentice-Hall, Inc., 1999.
-
-
www.reddit.com www.reddit.com
-
Underlining Keyterms and Index Bloat .t3_y1akec._2FCtq-QzlfuN-SwVMUZMM3 { --postTitle-VisitedLinkColor: #9b9b9b; --postTitleLink-VisitedLinkColor: #9b9b9b; --postBodyLink-VisitedLinkColor: #989898; }
Hello u/sscheper,
Let me start by thanking you for introducing me to Zettelkasten. I have been writing notes for a week now and it's great that I'm able to retain more info and relate pieces of knowledge better through this method.
I recently came to notice that there is redundancy in my index entries.
I have two entries for Number Line. I have two branches in my Math category that deals with arithmetic, and so far I have "Addition" and "Subtraction". In those two branches I talk about visualizing ways of doing that, and both of those make use of and underline the term Number Line. So now the two entries in my index are "Number Line (Under Addition)" and "Number Line (Under Subtraction)". In those notes I elaborate how exactly each operation is done on a number line and the insights that can be derived from it. If this continues, I will have Number Line entries for "Multiplication" and "Division". I will also have to point to these entries if I want to link a main note for "Number Line".
Is this alright? Am I underlining appropriately? When do I not underline keyterms? I know that I do these to increase my chances of relating to those notes when I get to reach the concept of Number Lines as I go through the index but I feel like I'm overdoing it, and it's probably bloating it.
I get "Communication (under Info. Theory): '4212/1'" in the beginning because that is one aspect of Communication itself. But for something like the number line, it's very closely associated with arithmetic operations, and maybe I need to rethink how I populate my index.
Presuming, since you're here, that you're creating a more Luhmann-esque inspired zettelkasten as opposed to the commonplace book (and usually more heavily indexed) inspired version, here are some things to think about:<br /> - Aren't your various versions of number line card behind each other or at least very near each other within your system to begin with? (And if not, why not?) If they are, then you can get away with indexing only one and know that the others will automatically be nearby in the tree. <br /> - Rather than indexing each, why not cross-index the cards themselves (if they happen to be far away from each other) so that the link to Number Line (Subtraction) appears on Number Line (Addition) and vice-versa? As long as you can find one, you'll be able to find them all, if necessary.
If you look at Luhmann's online example index, you'll see that each index term only has one or two cross references, in part because future/new ideas close to the first one will naturally be installed close to the first instance. You won't find thousands of index entries in his system for things like "sociology" or "systems theory" because there would be so many that the index term would be useless. Instead, over time, he built huge blocks of cards on these topics and was thus able to focus more on the narrow/niche topics, which is usually where you're going to be doing most of your direct (and interesting) work.
Your case sounds, and I see it with many, is that your thinking process is going from the bottom up, but that you're attempting to wedge it into a top down process and create an artificial hierarchy based on it. Resist this urge. Approaching things after-the-fact, we might place information theory as a sub-category of mathematics with overlaps in physics, engineering, computer science, and even the humanities in areas like sociology, psychology, and anthropology, but where you put your work on it may depend on your approach. If you're a physicist, you'll center it within your physics work and then branch out from there. You'd then have some of the psychology related parts of information theory and communications branching off of your physics work, but who cares if it's there and not in a dramatically separate section with the top level labeled humanities? It's all interdisciplinary anyway, so don't worry and place things closest in your system to where you think they fit for you and your work. If you had five different people studying information theory who were respectively a physicist, a mathematician, a computer scientist, an engineer, and an anthropologist, they could ostensibly have all the same material on their cards, but the branching structures and locations of them all would be dramatically different and unique, if nothing else based on the time ordered way in which they came across all the distinct pieces. This is fine. You're building this for yourself, not for a mass public that will be using the Dewey Decimal System to track it all down—researchers and librarians can do that on behalf of your estate. (Of course, if you're a musician, it bears noting that you'd be totally fine building your information theory section within the area of "bands" as a subsection on "The Bandwagon". 😁)
If you overthink things and attempt to keep them too separate in their own prefigured categorical bins, you might, for example, have "chocolate" filed historically under the Olmec and might have "peanut butter" filed with Marcellus Gilmore Edson under chemistry or pharmacy. If you're a professional pastry chef this could be devastating as it will be much harder for the true "foodie" in your zettelkasten to creatively and more serendipitously link the two together to make peanut butter cups, something which may have otherwise fallen out much more quickly and easily if you'd taken a multi-disciplinary (bottom up) and certainly more natural approach to begin with. (Apologies for the length and potential overreach on your context here, but my two line response expanded because of other lines of thought I've been working on, and it was just easier for me to continue on writing while I had the "muse". Rather than edit it back down, I'll leave it as it may be of potential use to others coming with no context at all. In other words, consider most of this response a selfish one for me and my own slip box than as responsive to the OP.)
Tags
- zettelkasten
- indices
- Niklas Luhmann's index
- multi-disciplinary research
- Universal Decimal Classification
- examples
- The Bandwagon
- bottom-up vs. top-down
- Dewey Decimal System
- commonplace books vs. zettelkasten
- information theory
- hierarchies
- Niklas Luhmann's zettelkasten
- Claude Shannon
- reply
Annotators
URL
-
- Sep 2022
-
thevoroscope.com thevoroscope.com
-
udcc.org udcc.org
-
https://udcc.org/index.php/site/page?view=subject_coverage
Subject coverage of the UDC.
-
-
en.wikipedia.org en.wikipedia.org
- Aug 2022
-
-
Morens, D. M., Taubenberger, J. K., & Fauci, A. S. (2021). Universal Coronavirus Vaccines—An Urgent Need. New England Journal of Medicine, 0(0), null. https://doi.org/10.1056/NEJMp2118468
-
-
www.theguardian.com www.theguardian.com
-
Ball, P. (2022, February 26). Will we get a single, variant-proof vaccine for Covid? The Observer. https://www.theguardian.com/society/2022/feb/26/will-we-get-a-single-variant-proof-vaccine-for-covid
-
-
Local file Local file
-
The most challenging theoretical problem in linguistics is that of discoveringthe principles of universal grammar that interweave with the rules of particulargrammars to provide explanations for phenomena that appear arbitrary andchaotic.
-
In practice, the linguist is always involved in the study of both universal andparticular grammar.
-
-
www.ischool.berkeley.edu www.ischool.berkeley.edu
-
Historical Hypermedia: An Alternative History of the Semantic Web and Web 2.0 and Implications for e-Research. .mp3. Berkeley School of Information Regents’ Lecture. UC Berkeley School of Information, 2010. https://archive.org/details/podcast_uc-berkeley-school-informat_historical-hypermedia-an-alte_1000088371512. archive.org.
https://www.ischool.berkeley.edu/sites/default/files/audio/2010-10-20-vandenheuvel_0.mp3
Interface as Thing - book on Paul Otlet (not released, though he said he was working on it)
- W. Boyd Rayward 1994 expert on Otlet
- Otlet on annotation, visualization, of text
- TBL married internet and hypertext (ideas have sex)
- V. Bush As We May Think - crosslinks between microfilms, not in a computer context
- Ted Nelson 1965, hypermedia
t=540
- Michael Buckland book about machine developed by Emanuel Goldberg antecedent to memex
- Emanuel Goldberg and His Knowledge Machine: Information, Invention, and Political Forces (New Directions in Information Management) by Michael Buckland (Libraries Unlimited, (March 31, 2006)
- Otlet and Goldsmith were precursors as well
four figures in his research: - Patrick Gattis - biologist, architect, diagrams of knowledge, metaphorical use of architecture; classification - Paul Otlet, Brussels born - Wilhelm Ostwalt - nobel prize in chemistry - Otto Neurath, philosophher, designer of isotype
Paul Otlet
- wrote bibliography on law
- book: Something on Bibliography #wanttoread
- universal decimal classification system
- mundaneum
- Le Corbusier - architect worked with Otlet for building for Mundaneum; See: https://socks-studio.com/2019/05/05/the-shape-of-knowledge-the-mundaneum-by-paul-otlet-and-henri-la-fontaine/
Otlet was interested in both the physical as well as the intangible aspects of the Mundaneum including as an idea, an institution, method, body of work, building, and as a network.<br /> (#t=1020)
Early iPhone diagram?!?
(roughly) armchair to do the things in the web of life (Nelson quote) (get full quote and source for use) (circa 19:30)
compares Otlet to TBL
Michael Buckland 1991 <s>internet of things</s> coinage - did I hear this correctly? https://en.wikipedia.org/wiki/Internet_of_things lists different coinages
Turns out it was "information as thing"<br /> See: https://hypothes.is/a/kXIjaBaOEe2MEi8Fav6QsA
sugane brierre and otlet<br /> "everything can be in a document"<br /> importance of evidence
The idea of evidence implies a passiveness. For evidence to be useful then, one has to actively do something with it, use it for comparison or analysis with other facts, knowledge, or evidence for it to become useful.
transformation of sound into writing<br /> movement of pieces at will to create a new combination of facts - combinatorial creativity idea here. (circa 27:30 and again at 29:00)<br /> not just efficiency but improvement and purification of humanity
put things on system cards and put them into new orders<br /> breaking things down into smaller pieces, whether books or index cards....
Otlet doesn't use the word interfaces, but makes these with language and annotations that existed at the time. (32:00)
Otlet created diagrams and images to expand his ideas
Otlet used octagonal index cards to create extra edges to connect them together by topic. This created more complex trees of knowledge beyond the four sides of standard index cards. (diagram referenced, but not contained in the lecture)
Otlet is interested in the "materialization of knowledge": how to transfer idea into an object. (How does this related to mnemonic devices for daily use? How does it relate to broader material culture?)
Otlet inspired by work of Herbert Spencer
space an time are forms of thought, I hold myself that they are forms of things. (get full quote and source) from spencer influence of Plato's forms here?
Otlet visualization of information (38:20)
S. R. Ranganathan may have had these ideas about visualization too
atomization of knowledge; atomist approach 19th century examples:S. R. Ranganathan, Wilson, Otlet, Richardson, (atomic notes are NOT new either...) (39:40)
Otlet creates interfaces to the world - time with cyclic representation - space - moving cube along time and space axes as well as levels of detail - comparison to Ted Nelson and zoomable screens even though Ted Nelson didn't have screens, but simulated them in paper - globes
Katie Berner - semantic web; claims that reporting a scholarly result won't be a paper, but a nugget of information that links to other portions of the network of knowledge.<br /> (so not just one's own system, but the global commons system)
Mention of Open Annotation (Consortium) Collaboration:<br /> - Jane Hunter, University of Australia Brisbane & Queensland<br /> - Tim Cole, University of Urbana Champaign<br /> - Herbert Van de Sompel, Los Alamos National Laboratory annotations of various media<br /> see:<br /> - https://www.researchgate.net/publication/311366469_The_Open_Annotation_Collaboration_A_Data_Model_to_Support_Sharing_and_Interoperability_of_Scholarly_Annotations - http://www.openannotation.org/spec/core/20130205/index.html - http://www.openannotation.org/PhaseIII_Team.html
trust must be put into the system for it to work
coloration of the provenance of links goes back to Otlet (~52:00)
Creativity is the friction of the attention space at the moments when the structural blocks are grinding against one another the hardest. —Randall Collins (1998) The sociology of philosophers. Cambridge, MA: Harvard University Press (p.76)
Tags
- Jane Hunter
- atomic notes
- references
- Ted Nelson
- W. Boyd Rayward
- atomic ideas
- Le Corbusier
- Michael Buckland
- Herbert Van de Sompel
- evidence
- material culture
- listen
- Paul Otlet
- Vannevar Bush
- Emanuel Goldberg
- Universal Decimal Classification
- Tim Cole
- atomist philosophy
- semantic web
- Mundaneum
- Tim Berners-Lee
- hypermedia
- Randall Collins
- index cards
- Wilhelm Ostwalt
- materialization of knowledge
- Otto Neurath
- Herbert Spencer
- S. R. Ranganathan
- Charles van den Heuvel
- octagonal index cards
- memex
- Web 2.0
- Hypothes.is
- mnemonic devices
- Open Annotation Collaboration
- idea links
Annotators
URL
-
-
multimediaman.blog multimediaman.blog
-
After Otlet and La Fontaine received permission from Dewey to modify the DDC, they set about creating the Universal Decimal Classification (UDC).
-
In 1895, the Belgians Paul Otlet (1868-1944) and Henri La Fontaine founded the International Institute of Bibliography (IIB) and began working on something they called the Universal Bibliographic Repertory (UBR), an enormous catalog based on index cards. Funded by the Belgian government, the UBR involved the collection of books, articles, photographs and other documents in order to create a one-of-a-kind international index.
-
- Jul 2022
-
www.reddit.com www.reddit.com
-
Because I wanted to make use of a unified version of the overall universe of knowledge as a structural framework, I ended up using the Outline of Knowledge (OoK) in the Propædia volume that was part of Encyclopedia Britannica 15th edition, first published 1974, the final version of which (2010) is archived at -- where else? -- the Internet Archive.
The Outline of Knowledge appears in the Propædia volume of the Encyclopedia Britannica. It is similar to various olther classification systems like the Dewey Decimal system or the Universal Decimal Classification.
-
-
bafybeiac2nvojjb56tfpqsi44jhpartgxychh5djt4g4l4m4yo263plqau.ipfs.dweb.link bafybeiac2nvojjb56tfpqsi44jhpartgxychh5djt4g4l4m4yo263plqau.ipfs.dweb.link
-
Let us briefly discuss three specific examples of concepts that seem particularly promising for theprospect of ‘good enough world’ and could become synergistically interrelated: (a) the social policy ofunconditional basic income, (b) the development of blockchains and (c) the idea of the offer networks
!- claim : examples of a good enough world * Universal Basic Income (UBI) * Blockchain * Offer network
-
he innovation must modulate the behaviour of the decision-produced socialorganization such that this will result in the realisation of the ‘good enough’ relationship betweenhumans and social systems, that is, it will secure the organic and psychological continuity of thehuman being unconditionally and specifically, irrespective to the continuity of their personware.
!- in other words : enoughness * Universal Basic Income (UBI)
-
-
niklas-luhmann-archiv.de niklas-luhmann-archiv.de
-
https://niklas-luhmann-archiv.de/bestand/zettelkasten/zettel/ZK_2_SW1_001_V
One may notice that Niklas Luhmann's index within his zettelkasten is fantastically sparce. By this we might look at the index entry for "system" which links to only one card. For someone who spent a large portion of his life researching systems theory, this may seem fantastically bizarre.
However, it's not as as odd as one may think given the structure of his particular zettelkasten. The single reference gives an initial foothold into his slip box where shuffling through cards beyond that idea will reveal a number of cards closely related to the topic which subsequently follow it. Regular use and work with the system would have allowed Luhmann better memory with respect to its contents and the searching through threads of thought would have potentially sparked new ideas and threads. Thus he didn't need to spend the time and effort to highly index each individual card, he just needed a starting place and could follow the links from there. This tends to minimize the indexing work he needed to do regularly, but simultaneously makes it harder for the modern person who may wish to read or consult those notes.
Some of the difference here is the idea of top-down versus bottom-up construction. While thousands of his cards may have been tagged as "systems" or "systems theory", over time and with increased scale they would have become nearly useless as a construct. Instead, one may consider increasing levels of sub-topics, but these too may be generally useless with respect to (manual) search, so the better option is to only look at the smallest level of link (and/or their titles) which is only likely to link to 3-4 other locations outside of the card just before it. This greater specificity scales better over time on the part of the individual user who is broadly familiar with the system.
Alternatively, for those in shared digital spaces who may maintain public facing (potentially shared) notes (zettelkasten), such sparse indices may not be as functional for the readers of such notes. New readers entering such material generally without context, will feel lost or befuddled that they may need to read hundreds of cards to find and explore the sorts of ideas they're actively looking for. In these cases, more extensive indices, digital search, and improved user interfaces may be required to help new readers find their way into the corpus of another's notes.
Another related idea to that of digital, public, shared notes, is shared taxonomies. What sorts of word or words would one want to search for broadly to find the appropriate places? Certainly widely used systems like the Dewey Decimal System or the Universal Decimal Classification may be helpful for broadly crosslinking across systems, but this will take an additional level of work on the individual publishers.
Is or isn't it worthwhile to do this in practice? Is this make-work? Perhaps not in analog spaces, but what about the affordances in digital spaces which are generally more easily searched as a corpus.
As an experiment, attempt to explore Luhmann's Zettelkasten via an entryway into the index. Compare and contrast this with Andy Matuschak's notes which have some clever cross linking UI at the bottoms of the notes, but which are missing simple search functionality and have no tagging/indexing at all. Similarly look at W. Ross Ashby's system (both analog and digitized) and explore the different affordances of these two which are separately designed structures---the analog by Ashby himself, but the digital one by an institution after his death.
-
-
udcsummary.info udcsummary.info
-
https://udcsummary.info/php/index.php?lang=en
Interesting defined vocabulary and concatenation/auxiliary signs for putting ideas into proximity.
Could be useful for note taking. Probably much harder to get people to adopt this sort of thing with shared notes/note taking however.
Somewhat similar to the Dewey Decimal classification system.
-
-
Local file Local file
-
there has been a tendency in popular discussion to confuse “deep structure”with “generative grammar” or with “universal grammar.” And a number of pro-fessional linguists have repeatedly confused what I refer to here as “the creativeaspect of language use” with the recursive property of generative grammars, avery different matter.
Noam Chomsky felt that there was a tendency for people to confuse the ideas of deep structure with the ideas of either generative grammar or universal grammar. He also thought that professional linguists confused what he called "the creative aspect of language use" with the recursive property of generative grammars.
-
- Jun 2022
-
www.kcet.org www.kcet.org
-
Lois Weber<br /> - First woman accepted to Motion Picture Director's Association, precursor of Director's Guild<br /> - First directors committee of the Academy of Motion Picture Arts and Sciences<br /> - Mayor of Universal City<br /> - One of the highest paid and most influential directors in Hollywood of her day<br /> - one of first directors to form her own production company
See also: - https://en.wikipedia.org/wiki/Lois_Weber
-
Where are My Children?, Universal's top film of 1916, written and directed by their top director Lois Weber, discussed abortion and birth control. It was added to the National Film Registry in 1993.
See also - Stamp, Shelley. Lois Weber in Early Hollywood. University of California Press, May 2015. ISBN 9780520284463
Watched this last night
-
-
udlguidelines.cast.org udlguidelines.cast.org
-
www.facultyfocus.com www.facultyfocus.com
-
A very brief primer on UDL and how Hypothes.is and social annotation might fit within its framework. There seems to be a stronger familiarity with Hypothes.is as a tool and a bit less familiarity with UDL, or perhaps they just didn't bind the two together as tightly as they might have.
I'm definitely curious to look more closely at the UDL framework to see what we might extract from it.
The title features neurodiversity, but doesn't deliver on the promise.
An interesting reframing would be that of social annotation with the idea of modality shifts, particularly for neurodiverse students.
-
Universal Design for Learning (UDL) framework
Universal Design for Learning framework https://udlguidelines.cast.org/
-
- May 2022
-
archive.wikiwix.com archive.wikiwix.com
-
ART. 2. - La Société n'admet aucune communication concernant, soit l'origine du langage~ soit la création d'une langue universelle.
-
- Apr 2022
-
expositions.mundaneum.org expositions.mundaneum.org
-
http://expositions.mundaneum.org/fr/mundaneum-petite-histoire-dune-grande-idee
Universal Bibliographical Directory (RBU)
-
- Jan 2022
-
www.danielwillingham.com www.danielwillingham.com
-
there’s not much reason to think it’s because kids have different learning styles. Maybe it’s always good for kids to experience any idea in several different ways, even if all the experiences were in the same style. Maybe one of the experiences is especially well-suited to help kids understand the concept. Maybe the repetition is good. If it's a good idea to teach to all styles, great, but I'd like to figure out why kids are learning more that way, given that other predictions of styles theories aren't supported.
This description of "teach[ing] to all the [learning] styles" seems similar to some descriptions of Universal Design for Learning that I have seen.
-
-
-
Liu, C., Yang, Y., Chen, B., Cui, T., Shang, F., & Li, R. (2022). Revealing spatio-temporal interaction patterns behind complex cities. ArXiv:2201.02117 [Physics]. http://arxiv.org/abs/2201.02117
-
-
www.newyorker.com www.newyorker.com
-
The databases include multiple copies of some titles. But they will never provide all the copies of, say, “The Wealth of Nations” and the early responses it provoked.
The exact same could be said of the early web which hasn't been evenly archived or easily searchable, so responses to early blog articles may not be easily found amidst a mountain of noise.
-
- Dec 2021
-
rteworcester.wp.worc.ac.uk rteworcester.wp.worc.ac.uk
-
10 Cultivating Change for Inclusive Practice: Creating a Community of Learners By Lisa Mauro-Bracken, Head of Department Health and Well-being; School of Allied Health and Community This case study illustrates an innovative, department-wide approach to learning and professional development of staff. Higher Education encounters increasing numbers of students from diverse linguistic, cultural and ethnic backgrounds requiring personalised learning (V1; V2). To cultivate a ‘new’ inclusive culture within the Department of Health and Well-being, I organised a workshop introducing Universal Design for Learning (UDL) as part of a team away day (K5). UDL is a framework to improve and optimize teaching and learning for all people based on scientific insights into how humans learn (CAST, 2019). The UDL framework supports inclusive practice and relies on multiple means of: ‘engagement,’ ‘representation’ and ‘action and expression.’ In other words, a focus on personalised learning and meaningful choice to ensure all students can access the curriculum in a way that develops their strengths. To embed this approach within the department, I delivered workshops on implementing University of Worcester’s Inclusive Assessment Policy. This was implemented using Technology Enhanced Learning and Blackboard in an inclusive way and auditing module resources using de Montfort University’s UDL self-assessment checklist. This proved to be an effective reflective tool to further inform learning, teaching and assessment (Bracken, 2019; Moriarty and Scarffe, 2019). The values underpinning our department are student-focused and this was reflected in our approach of implementing new ideas, as it required staff and student involvement and regular consultation with students about inclusive design for learning. Staff enthusiasm for the innovative approach was balanced against accepting a response of hesitancy and fear of change (Dasborough, Lamb and Suseno, 2015). However, one colleague stated ‘UDL allows me... [to] reflect, listen, change my pedagogical approach...getting input from colleagues and feel safe[ty] in questioning
Current practice in UK on UDL- updated references and useful publication linked to HEA accreditation
-
- Nov 2021
-
-
Scott, Jake, Aaron Richterman, and Muge Cevik. ‘Covid-19 Vaccination: Evidence of Waning Immunity Is Overstated’. BMJ 374 (23 September 2021): n2320. https://doi.org/10.1136/bmj.n2320.
-
-
www.amazon.com www.amazon.com
-
will track mounts and fin boxes work together? Do they share standards?
-
-
www.latimes.com www.latimes.com
-
Skimmed opening paragraphs in physical newspaper. Want to revisit. This sounds like the sort of "pulling oneself up by one's bootstraps" that actually works.
-
- Sep 2021
-
www.theguardian.com www.theguardian.com
-
Walker, P., Davis, N., & Grover, N. (2021, September 3). UK vaccines watchdog fails to back Covid jabs for children. The Guardian. http://www.theguardian.com/society/2021/sep/03/uk-rules-out-covid-vaccinations-for-children
-
- Jun 2021
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Nandi, A., Kumar, S., Shet, A., Bloom, D. E., & Laxminarayan, R. (2020). Childhood vaccinations and adult schooling attainment: Long-term evidence from India’s Universal Immunization Programme. Social Science & Medicine (1982), 250, 112885. https://doi.org/10.1016/j.socscimed.2020.112885
-
- Apr 2021
-
en.wikipedia.org en.wikipedia.org
-
"The Analytical Language of John Wilkins" (Spanish: "El idioma analítico de John Wilkins") is a short essay by Argentine writer Jorge Luis Borges originally published in Otras Inquisiciones (1937–1952).[1][2] It is a critique of the English natural philosopher and writer John Wilkins's proposal for a universal language and of the representational capacity of language generally. In it, Borges imagines a bizarre and whimsical (and fictional) Chinese taxonomy later quoted by Michel Foucault, David Byrne, and others.
-
-
en.wikipedia.org en.wikipedia.org
-
He is particularly known for An Essay towards a Real Character and a Philosophical Language (1668) in which, amongst other things, he proposed a universal language and an integrated system of measurement, similar to the metric system.
This may be well worth reading with respect to my research on memory, stenography, shorthand, etc.
-
-
mathshistory.st-andrews.ac.uk mathshistory.st-andrews.ac.uk
-
Hérigone’s only published work of any consequence is the Cursus mathematicus, a six-volume compendium of elementary and intermediate mathematics in French and Latin. Although there is little substantive originality in the Cursus, it shows an extensive knowledge and understanding of contemporary mathematics. Its striking feature is the introduction of a complete system of mathematical and logical notation, very much in line with the seventeenth-century preoccupation with universal languages.
Interesting that this links the idea of universal languages to his mathematical notation and NOT to the idea of translating numbers into words using and early form of the major system.
-
-
wp1.fuchu.jp wp1.fuchu.jp
- Mar 2021
-
covid-19.iza.org covid-19.iza.org
-
Kim, M. J., & Lee, S. (2020). Can Stimulus Checks Boost an Economy under COVID-19? Evidence from South Korea. IZA Discussion Paper, 13567.
-
-
unix.stackexchange.com unix.stackexchange.com
-
(xdg-open seems to be supposed to be the universal one...)
-
-
askubuntu.com askubuntu.com
-
xdg-open should do the same thing - actually, it will call gnome-open, or kde-open, or whatever, depending on your desktop environment. Thus it's more portable.
-
The advantage is that you can use gnome-open for almost all file-types, URIs and directories. It's one command to learn, instead of trying to remember about obscure commands like sensible-browser
-
-
www.kickstarter.com www.kickstarter.com
-
She asked me if I could create international universal design Shogi set for foreign Shogi fans.
-
- Jan 2021
-
pubs.rsc.org pubs.rsc.org
-
Postsecondary chemistry curricula and universal design for learning: planning for variations in learners’ abilities, needs, and interests
Evaluates CLUE, Mastering-SP, and POGIL curricula on universal design for learning checkpoints for making materials accessible for students with disabilities Guidelines for universal design for learning valuable for course design
-
- Dec 2020
-
www.theguardian.com www.theguardian.com
-
editor, P. B. S. policy. (2020, December 9). Covid-driven recession likely to push 2m UK families into poverty. The Guardian. https://www.theguardian.com/society/2020/dec/09/covid-driven-recession-likely-to-push-2m-uk-families-into-poverty
-
- Nov 2020
-
stackoverflow.com stackoverflow.com
-
If you want a reference to the global object that works in any context, you can read this from a directly-called function. const global = (function() {return this})();. This evaluates to window in the browser, self in a service worker and global in nodejs.
-
-
stackoverflow.com stackoverflow.com
-
Universal = code that can run in any JS runtime (browser and/or node). Isomorphic = application that runs the same universal code in multiple runtimes to avoid code duplication.
-
Remember that "JavaScript" does not mean that the DOM API, AJAX, HTML5 <canvas> (and so on) are available - it just means the JavaScript scripting language is being used - that's it.
-
- Oct 2020
-
www.basefactor.com www.basefactor.com
-
Ubiquity: you can also run your validation on the server side (e.g. nodejs)
-
-
learn-us-east-1-prod-fleet01-xythos.s3.amazonaws.com learn-us-east-1-prod-fleet01-xythos.s3.amazonaws.com
-
“Outdoor adult learning can be an antidote and complement to the digital world . . . offering holistic, mentally and physically challenging learning experiences.”
Adult Learning often takes place within walls or in front of a computer screen this can lead to health problems. This article offers reasons and methods for getting adults outdoors and using Universal Design. Outdoor learning can be used to complement digital learning.
-
-
-
Interaction strategies are a type of accommodation that typically go unnamed and unwritten
How many times do we use "accommodations" which dance around the relational issues, instead of dealing directly with them?
-
-
drive.google.com drive.google.com
-
Good article about the importance of Universal Design when designing learning opportunities. The authors use plenty of strong sources to back their findings and keep the information concise.
9/10
-
-
en.wikipedia.org en.wikipedia.org
-
use universal loading to render identical HTML on both the server and client.
-
-
covid-19.iza.org covid-19.iza.org
-
IZA – Institute of Labor Economics. ‘COVID-19 and the Labor Market’. Accessed 6 October 2020. https://covid-19.iza.org/publications/dp13742/.
-
- Sep 2020
-
adamloving.com adamloving.com
-
The “shared” schema is effectively the API schema. These are the fields exchanged in the API, common to client and server.
-
-
journals.plos.org journals.plos.org
-
Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)
Tags
Annotators
URL
-
-
stackoverflow.com stackoverflow.com
-
React is an isomorphic/universal framework. That means that there is a virtual representation of the UI component tree, and that is separate from the actual rendering that it outputs in the browser.
-
- Aug 2020
-
www.thelancet.com www.thelancet.com
-
Lozano, R., Fullman, N., Mumford, J. E., Knight, M., Barthelemy, C. M., Abbafati, C., Abbastabar, H., Abd-Allah, F., Abdollahi, M., Abedi, A., Abolhassani, H., Abosetugn, A. E., Abreu, L. G., Abrigo, M. R. M., Haimed, A. K. A., Abushouk, A. I., Adabi, M., Adebayo, O. M., Adekanmbi, V., … Murray, C. J. L. (2020). Measuring universal health coverage based on an index of effective coverage of health services in 204 countries and territories, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. The Lancet, 0(0). https://doi.org/10.1016/S0140-6736(20)30750-9
-
-
toraritte.github.io toraritte.github.io
-
Original post is here.
This explanation should be combined with 24 Days of GHC Extensions: Rank N Types (see related hypothes.is note).
-
-
ocharles.org.uk ocharles.org.uk
-
Now it is much clearer that id is really a family of infinitely many functions. It is fair to say that it is an abstract function (as opposed to a concrete one), because its type abstracts over the type variable a. The common and proper mathematical wording is that the type is universally quantified (or often just quantified) over a.
This was very neatly put, and
forall
above is also spot on.
-
-
book.purescript.org book.purescript.org
-
Quantified Types
My main issue with this book is that the difficulty is exponentially increasing, and by "keeping it simple" (i.e., trying to use simple terms) it is even harder to do a proper research.
For example:
1. The name of this chapter
This chapter should have been called Explicitly quantified type or Explicit universal quantification as it is too general as is, and doing a search to get to know more when someone has no formal/previous functional programming background, makes very hard.
Most importantly though, even if Haskell not mentioned, the word "explicit" would have been important.
It is also more about generic parameters than about quantification itself, and
forall
is kind of introduced but it is totally misleading.2.
forall
The post “forall” is the type-level “lambda” (saved) is the best, most succinct explanation of
forall
that I ever found. Unfortunately not before going down the rabbit hole.. (See links below.) One still needs to know about- typeclasses
- generic parameters
- constraints
- what pragmas are but after that, it is straightforward.
(Jordan's Reference section on
forall
also doesn't help much.)forall
is also mandatory in PureScript (which is also not mentioned when introducing it), and I believe a comparison (the way the above post did) with Haskell is important, but at the right time. At least Jordan's Reference tries to put it off until later, but still before explaining concepts required to understand it.3. The "rabbit hole" links
These are all good resources, but not for uninitiated mortals, and at a lower level (such as where I am now) they raise more questions than answers.
Explicit
forall
(r/purescript reddit)](Started here initially, but the single sentence there prompted a search for scoped type variables and rank-n types (or Rank N types).)
-
- Jul 2020
-
www.nature.com www.nature.com
-
Arnold, Carrie. ‘Pandemic Speeds Largest Test yet of Universal Basic Income’. Nature, 10 July 2020. https://doi.org/10.1038/d41586-020-01993-3.
-
- Jun 2020
-
www.newscientist.com www.newscientist.com
-
Page Le, M. (2020, June 24). Town in UK takes steps to test entire population for coronavirus. New Scientist. https://www.newscientist.com/article/2246880-town-in-uk-takes-steps-to-test-entire-population-for-coronavirus/
-
-
www.sciencedirect.com www.sciencedirect.com
-
Zhou, B., Lu, X., & Holme, P. (2020). Universal evolution patterns of degree assortativity in social networks. Social Networks, 63, 47–55. https://doi.org/10.1016/j.socnet.2020.04.004
-
-
psyarxiv.com psyarxiv.com
-
Nettle, D., Johnson, E., Johnson, M., & Saxe, R. (2020). Why has the COVID-19 pandemic increased support for Universal Basic Income? [Preprint]. PsyArXiv. https://doi.org/10.31234/osf.io/csr3u
-
- May 2020
-
www.catb.org www.catb.org
-
Write programs to handle text streams, because that is a universal interface.
-
- Apr 2020
-
github.com github.com
-
zxcvbn works identically on the server
-
-
medium.com medium.com
-
The “universal” label that has been slapped on to it is superfluous, but it does have its merits. Now that we have a commonly known term to refer to environment agnostic JavaScript code, it allows library authors to list it as a feature and be fashionable doing it. I’m happy with the term “universal” being fashionable because it makes developers think about their dependencies on the runtime environment. In the end this will help the JavaScript ecosystem mature and allow libraries to be used everywhere.
-
The “universal” label that has been slapped on to it is superfluous
-
Running the same code in the browser and on the server in order to avoid code duplication is a very different problem. It is simply a matter of good development practices to avoid code duplication. This however is not limited to isomorphic applications. A utility library such as Lodash is “universal”, but has nothing to do with isomorphism. Sharing code between environments does not give you an isomorphic application. What we’re referring to with Universal JavaScript is simply the fact that it is JavaScript code which is environment agnostic. It can run anywhere. In fact most JavaScript code will run fine on any JavaScript platform.
-
-
-
cdb.reacttraining.com cdb.reacttraining.com
-
en.wikipedia.org en.wikipedia.org
-
2ality.com 2ality.com
-
Maybe we should distinguish between: The technique of asssembling pages on either client or server. Here, “isomorphic” and “full stack” (as proposed by Rodrigo Medeiros) seem good choices. JavaScript that runs in all (or most) JavaScript environments, especially browsers and Node.js. Here, “universal” seems a good choice.
-
-
-
www.thelancet.com www.thelancet.com
-
Peto, J., Alwan, N. A., Godfrey, K. M., Burgess, R. A., Hunter, D. J., Riboli, E., Romer, P., Buchan, I., Colbourn, T., Costelloe, C., Smith, G. D., Elliott, P., Ezzati, M., Gilbert, R., Gilthorpe, M. S., Foy, R., Houlston, R., Inskip, H., Lawlor, D. A., … Yao, G. L. (2020). Universal weekly testing as the UK COVID-19 lockdown exit strategy. The Lancet, 0(0). https://doi.org/10.1016/S0140-6736(20)30936-3
-
- Nov 2019
-
digitalpromise.org digitalpromise.org
-
Universal design for learning (UDL) is the topic of focus for this webinar hosted by Digital Promise. Multiple experts discuss UDL for adult learners and strategies for UDL. Rating: 6/10
-
- Aug 2019
-
er.educause.edu er.educause.edu
-
And they have largely moved beyond the mental model of universal design (UD) in the physical environment, which is static, bounded, and predictable—instead designing interactions according to UDL, which sees interactions as dynamic, open, and emergent.
Really interesting point here about the limit of the "curb cut" metaphor.
-
They typically chop off the end of the word "accessibility," focusing their efforts on expanding access, regardless of the ability profiles of their learners
Great pull quote.
-
-
www.dailykos.com www.dailykos.com
-
Mandate: The gov’t mandates that everyone buy health insurance, funding comes from payroll taxes.
3
-
2-Tier: The gov’t pays two-thirds, and the private sector pays one-third.
2
-
Single-Payer: The gov’t taxes its citizens to pay for health care.
1
-
Single-Payer, 2-Tier, and Mandate systems.
three definitive models for Universal Health Care
-
- Apr 2019
-
-
We welcome public feedback to strengthen our communique and potential calls to action. Thank you!
-
-
-
He is a bit disturbed by this notion that salaries have to be at the high levels expected by US developers, which seems to permeate the FOSS sustainability effort. He said that he is often accused of wanting developers to starve, but that is not true at all: he wants people to get reasonable pay for reasonable work, to have health care, be able to live a comfortable middle-class life, and so on. But if being sustainable as a project means paying salaries at Silicon Valley levels, it simply will not work—it is not something we should bring back to FOSS, he said. We should look at what people need to live comfortably, while working on something they enjoy.
Bradley Kuhn è d'accordo con me sulla necessità di retribuzioni confortevoli ma non da ricconi quando si tratta di progetti comunitari.
Tags
Annotators
URL
-
-
-
Mahatma Gandhi, the father of our nation was a very benevolent and expert political master and observer that he had a great vision for the country. He was a man who fought for the upliftment of the poorer classes of society and thought of reforms in their favour.
True, but still we are not in right track since 1947 !
-
-
learn-us-east-1-prod-fleet01-xythos.s3.us-east-1.amazonaws.com learn-us-east-1-prod-fleet01-xythos.s3.us-east-1.amazonaws.com04Huang1
-
Since online learning has a different setting from the conventional classroom,online educators need to use some special techniques and perceptions to leadto success. Moreover, adults have special needs and requirements as learnerscompared with children and adolescents, thus online educators should knowhow adults can learn best because of their special characteristics. Philosophicaland methodological shifts also affect instruction. Many researchers havesuggested that constructivism should be applied in distance education. Thus,this paper attempts to examine the impact of constructivism in online learningenvironments when focusing on adult learners. The author develops the con-nection between constructivism and adult learning theory. In addition, thepaper proposes instructional guidelines using the constructivist approach inonline learning for adults.
-
- Mar 2019
-
udlguidelines.cast.org udlguidelines.cast.org
-
UDL guidelines. As I post this, I do not know whether this website will be included in our future course readings or not. This website practices what it preaches and provides the same content in multiple forms. The viewer can select/choose the manner in which items are displayed. This has essential information, such as the need to provide "multiple means" of engagement, representation, action, and expression when teaching. Rating 5/5
-
- Feb 2019
-
static1.squarespace.com static1.squarespace.com
-
oever removed from the best. It is one property of this system of notation. that whilst it furnishes the means of recording each person's ideas of gesture. it docs not presume lo dictate. It is a language, which may be used to express
Unlike Sheridan's method, which was proposed as a universal system. Enlightenment dudes sure love their universal ideas.
-
-
static1.squarespace.com static1.squarespace.com
-
Complex ideas are not universal, as .. we can see by the difficulties of translating from one language to another.
Language shapes the way we think and therefore it has the potential to limit what we are capable of thinking.
-
universal propositions, and would settle in their minds universal truths,
The desire for both universality and essence is interesting. Universality is a concept with breadth, applicable on a large scale and encompassing many things. Essence, on the other hand, is extremely narrow, focused and boiled down to a pinpoint. It's a juggling act to attempt both.
-
ideas, which are also universally the same
I already have a problem.
Is sensation a universal phenomenon? If so, that doesn't mean that human's experience sensations in the same way and therefore the ideas generated from those sensations would naturally vary.
The desire for "universal" anything seems fraught with problem, even for seemingly "simple" ideas.
-
-
static1.squarespace.com static1.squarespace.com
-
including the universal language from which all languages spring
Following lhm8's Fenollosa comment earlier, this was an idea that survived into the early 20th C., as writers like Fenollos and Ezra Pound looked to the Chinese character as a more "natural" state of language, something closer to a universal meaning.
-
university
I hadn't thought about the etymology of university before, but the juxtaposition with "universal grammar" spurred my curiosity about their common roots:
From community, corporation (1214 in Old French; also in Old French as universitei , universiteit , etc.), totality, universality (13th cent.)
http://www.oed.com.ezp.slu.edu/view/Entry/214804?rskey=lzyKTO&result=1&isAdvanced=false#eid
-
"universal
I'm noticing a theme here, with the desire of universal ideals, truths, …people. In a time/place where the world (as people knew it) was still relatively small, there seems a pervading sense of attempted connection, of finding common ground, to unify. In our current time/place with a greatly expanded sense of the world and its variety, have we mostly given up on that desire for uniformity? Do we like to think we have? Recent events indicate that perhaps we haven't given up that desire as much as we had thought, but are those events anomalous outliers or an ugly truth?
-
-
static1.squarespace.com static1.squarespace.com
-
Defect
Language similar to that of Hume, here and in the "General Orations" remark below (where generalities are more likely to be universally true than particulars)
-
- Jan 2019
-
static1.squarespace.com static1.squarespace.com
-
cumenical
Belonging to the whole world; universal, general, world-wide.
http://www.oed.com.ezp.slu.edu/view/Entry/59462?redirectedFrom=ecumenical#eid
-
- Nov 2017
-
www.cte.cornell.edu www.cte.cornell.edu
-
This means developing a flexible learning environment in which information is presented in multiple ways, students engage in learning in a variety of ways, and students are provided options when demonstrating their learning.
These are also best practices in teaching and learning, which says something about human cognition and motivation generally and how we think about people who need "accommodations." In other words, maybe we all need "accommodations" that serve our need for autonomy, mastery, and purpose.
-
- Sep 2017
-
www.catholicregister.org www.catholicregister.org
-
“We know that poverty is a major driver of ill-health. We also know that poor people trust doctors. It’s a free service. Many other services they won’t access because they worry about the cost,” said Prosper Canada CEO Liz Mulholland.
If only this was an issue in the USA, where going to a doctor is not a free service for the patient, in most cases. The same level of trust is not there; this is unacceptable/
-
- Aug 2017
-
foramoreperfectamerica.blogspot.com foramoreperfectamerica.blogspot.com
-
However, we are willing to work with you on what's really bothering you if you stop behaving like Subhuman sacks of dog shit. Let's fight the influence of big business and Electoral Corruption together. Let's get Universal Basic Income done so not just you, but every American is always secure. Let's end the pointless wars. Let's revitalize and stimulate our inner cities
Voters have been known throughout history, most recently in 2016, to vote against their own interests for reasons that are, frankly, stupid.
-
-
www.basicincomecanada.org www.basicincomecanada.org
-
At the core of human rights are the ideals and goals of the “four freedoms” articulated by US President Franklin Delano Roosevelt—freedom of speech, freedom of worship, freedom from fear, and freedom from want—and also the primary goal of self-determination. To achieve these conditions, it is also understood that while all rights are “interrelated, interdependent and indivisible,” the absolute basics of life (e.g., water, food, clothing, and shelter) must first be met.
Canada gets it. The US does not. This must change and quickly.
-
- Apr 2017
-
static1.squarespace.com static1.squarespace.com
-
problematiccategory
Translation: they do not see the audience as a problem to be addressed, but an assumed set of factors. Now I will continue to talk about the problem for a few more pages and only respond with an answer at the very end.
-
- Mar 2017
-
static1.squarespace.com static1.squarespace.com
-
Perelman and Olbrechts-Tyteca emphasize that there is no actual universal audience, nor any unimpeachable facts or truths that could be presented to it, but rather, only an idea in the speaker's mind about what such an audience would be were it to exist.
This is a confusing construction. Summary: purely rational argument is trying to appeal to a "universal audience," but the editors want to clarify that Perelman and Olbrechts-Tyteca did not really believe that a true universal audience exists. Rather, a speaker imagines a universal audience (rather than one that already has a set of shared values that must be appealed to in a specific way), and then tries to make rational arguments that could appeal to the "universal audience" of their imagination.
Tags
Annotators
URL
-
- Oct 2016
-
teaching.lfhanley.net teaching.lfhanley.net
-
O you
This feels like a direct address to the reader. It feels didactic and adds to the overall sense of a religious sermon or teaching that comes from the section as a whole. It implicates the reader in the poem and asks the reader to address their own mortality.
-
Gentile or Jew
this line could be referencing these two groups to give a unifying or universal sense of community. Perhaps a sort of collective or mutual bond between the two because of the drastic “whirlpool” referenced just before this line relating or joining people across boundaries.
-
- Sep 2016
-
lawrenceacademy-my.sharepoint.com lawrenceacademy-my.sharepoint.com
-
naive realism,
almost universal belief that all people define the real world of objects, events, and living creatures in pretty much the same way.
-
- Jun 2016
-
-
Nowhere are there as many bullshit jobs, however, as in Silicon Valley. A survey of 5,000 software developers and engineers last year found that, in the words of The Economist, “many of them feel alienated, trapped, underappreciated and otherwise discombobulated.” Only 19% of tech employees say they are satisfied with their jobs. A mere 17% feel valued. Or, as a former math whiz working at Facebook lamented a few years ago: “The best minds of my generation are thinking about how to make people click ads.”
-
- Apr 2016
-
-
while e-mail dissolves barriers to the exchange of data, we need another solvent to dissolve the barriers to collaborative use of that data. Applied in the right ways, that solvent creates what I like to call the “universal canvas” – an environment in which data and applications flow freely on the Web.
Highlight of original quote: https://hypothes.is/a/iKeap_T6TauWGfyf19VW_Q
-
- Jan 2016
-
techblog.netflix.com techblog.netflix.com
- Feb 2015
-
www.infoworld.com www.infoworld.com
-
while e-mail dissolves barriers to the exchange of data, we need another solvent to dissolve the barriers to collaborative use of that data. Applied in the right ways, that solvent creates what I like to call the “universal canvas” -- an environment in which data and applications flow freely on the Web.
-
- Feb 2014
-
www.justinhughes.net www.justinhughes.net
-
A universal definition of intellectual property might begin by identifying it as nonphysical property which stems from, is identified as, and whose value is based upon some idea or ideas. Furthermore, there must be some additional element of novelty. Indeed, the object, or res, of intellectual property may be so new that it is unknown to anyone else. The novelty, however, does not have to be absolute. What is important is that at the time of propertization the idea is thought to be generally unknown. The re
Intellectual property cannot be common currency in the intellectual life of the society at the time of propertization.
What constitutes society at this point; do small groups and communities suffice or does it have to be popularly known beyond a small few?
-
- Nov 2013
-
caseyboyle.net caseyboyle.net
-
There are two universal, general gifts be-stowed by nature upon man, Reason and Speech; dialectic is the theory of the former, grammar and rhetoric of the latte
Language is probably the greatest tool human kind has. Reasoning exists in many animals, but extensive communication networks and language is ours! Also, poor use of the word "Universal" here. If it was a universal gift, it would be for everyone and not just man.
-
- Sep 2013
-
rhetoric.eserver.org rhetoric.eserver.org
-
show that the good or the harm, the honour or disgrace, the justice or injustice, is great or small, either absolutely or relatively; and therefore it is plain that we must also have at our command propositions about greatness or smallness and the greater or the lesser -- propositions both universal and particular.
There are degrees of goodness and justice, relativity
-
-
rhetoric.eserver.org rhetoric.eserver.org
-
Accordingly all men make use, more or less, of bot
Rhetoric is necessary. It surrounds us and is used by all
Tags
Annotators
URL
-