- Apr 2021
-
mathshistory.st-andrews.ac.uk mathshistory.st-andrews.ac.uk
-
Hérigone’s only published work of any consequence is the Cursus mathematicus, a six-volume compendium of elementary and intermediate mathematics in French and Latin. Although there is little substantive originality in the Cursus, it shows an extensive knowledge and understanding of contemporary mathematics. Its striking feature is the introduction of a complete system of mathematical and logical notation, very much in line with the seventeenth-century preoccupation with universal languages.
Interesting that this links the idea of universal languages to his mathematical notation and NOT to the idea of translating numbers into words using and early form of the major system.
-
-
wp1.fuchu.jp wp1.fuchu.jp
- Mar 2021
-
covid-19.iza.org covid-19.iza.org
-
Kim, M. J., & Lee, S. (2020). Can Stimulus Checks Boost an Economy under COVID-19? Evidence from South Korea. IZA Discussion Paper, 13567.
-
-
unix.stackexchange.com unix.stackexchange.com
-
(xdg-open seems to be supposed to be the universal one...)
-
-
askubuntu.com askubuntu.com
-
xdg-open should do the same thing - actually, it will call gnome-open, or kde-open, or whatever, depending on your desktop environment. Thus it's more portable.
-
The advantage is that you can use gnome-open for almost all file-types, URIs and directories. It's one command to learn, instead of trying to remember about obscure commands like sensible-browser
-
-
www.kickstarter.com www.kickstarter.com
-
She asked me if I could create international universal design Shogi set for foreign Shogi fans.
-
- Jan 2021
-
pubs.rsc.org pubs.rsc.org
-
Postsecondary chemistry curricula and universal design for learning: planning for variations in learners’ abilities, needs, and interests
Evaluates CLUE, Mastering-SP, and POGIL curricula on universal design for learning checkpoints for making materials accessible for students with disabilities Guidelines for universal design for learning valuable for course design
-
- Dec 2020
-
www.theguardian.com www.theguardian.com
-
editor, P. B. S. policy. (2020, December 9). Covid-driven recession likely to push 2m UK families into poverty. The Guardian. https://www.theguardian.com/society/2020/dec/09/covid-driven-recession-likely-to-push-2m-uk-families-into-poverty
-
- Nov 2020
-
stackoverflow.com stackoverflow.com
-
If you want a reference to the global object that works in any context, you can read this from a directly-called function. const global = (function() {return this})();. This evaluates to window in the browser, self in a service worker and global in nodejs.
-
-
stackoverflow.com stackoverflow.com
-
Universal = code that can run in any JS runtime (browser and/or node). Isomorphic = application that runs the same universal code in multiple runtimes to avoid code duplication.
-
Remember that "JavaScript" does not mean that the DOM API, AJAX, HTML5 <canvas> (and so on) are available - it just means the JavaScript scripting language is being used - that's it.
-
- Oct 2020
-
www.basefactor.com www.basefactor.com
-
Ubiquity: you can also run your validation on the server side (e.g. nodejs)
-
-
learn-us-east-1-prod-fleet01-xythos.s3.amazonaws.com learn-us-east-1-prod-fleet01-xythos.s3.amazonaws.com
-
“Outdoor adult learning can be an antidote and complement to the digital world . . . offering holistic, mentally and physically challenging learning experiences.”
Adult Learning often takes place within walls or in front of a computer screen this can lead to health problems. This article offers reasons and methods for getting adults outdoors and using Universal Design. Outdoor learning can be used to complement digital learning.
-
-
-
Interaction strategies are a type of accommodation that typically go unnamed and unwritten
How many times do we use "accommodations" which dance around the relational issues, instead of dealing directly with them?
-
-
drive.google.com drive.google.com
-
Good article about the importance of Universal Design when designing learning opportunities. The authors use plenty of strong sources to back their findings and keep the information concise.
9/10
-
-
en.wikipedia.org en.wikipedia.org
-
use universal loading to render identical HTML on both the server and client.
-
-
covid-19.iza.org covid-19.iza.org
-
IZA – Institute of Labor Economics. ‘COVID-19 and the Labor Market’. Accessed 6 October 2020. https://covid-19.iza.org/publications/dp13742/.
-
- Sep 2020
-
adamloving.com adamloving.com
-
The “shared” schema is effectively the API schema. These are the fields exchanged in the API, common to client and server.
-
-
journals.plos.org journals.plos.org
-
Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)
Tags
Annotators
URL
-
-
stackoverflow.com stackoverflow.com
-
React is an isomorphic/universal framework. That means that there is a virtual representation of the UI component tree, and that is separate from the actual rendering that it outputs in the browser.
-
- Aug 2020
-
www.thelancet.com www.thelancet.com
-
Lozano, R., Fullman, N., Mumford, J. E., Knight, M., Barthelemy, C. M., Abbafati, C., Abbastabar, H., Abd-Allah, F., Abdollahi, M., Abedi, A., Abolhassani, H., Abosetugn, A. E., Abreu, L. G., Abrigo, M. R. M., Haimed, A. K. A., Abushouk, A. I., Adabi, M., Adebayo, O. M., Adekanmbi, V., … Murray, C. J. L. (2020). Measuring universal health coverage based on an index of effective coverage of health services in 204 countries and territories, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. The Lancet, 0(0). https://doi.org/10.1016/S0140-6736(20)30750-9
-
-
toraritte.github.io toraritte.github.io
-
Original post is here.
This explanation should be combined with 24 Days of GHC Extensions: Rank N Types (see related hypothes.is note).
-
-
ocharles.org.uk ocharles.org.uk
-
Now it is much clearer that id is really a family of infinitely many functions. It is fair to say that it is an abstract function (as opposed to a concrete one), because its type abstracts over the type variable a. The common and proper mathematical wording is that the type is universally quantified (or often just quantified) over a.
This was very neatly put, and
forallabove is also spot on.
-
-
book.purescript.org book.purescript.org
-
Quantified Types
My main issue with this book is that the difficulty is exponentially increasing, and by "keeping it simple" (i.e., trying to use simple terms) it is even harder to do a proper research.
For example:
1. The name of this chapter
This chapter should have been called Explicitly quantified type or Explicit universal quantification as it is too general as is, and doing a search to get to know more when someone has no formal/previous functional programming background, makes very hard.
Most importantly though, even if Haskell not mentioned, the word "explicit" would have been important.
It is also more about generic parameters than about quantification itself, and
forallis kind of introduced but it is totally misleading.2.
forallThe post “forall” is the type-level “lambda” (saved) is the best, most succinct explanation of
forallthat I ever found. Unfortunately not before going down the rabbit hole.. (See links below.) One still needs to know about- typeclasses
- generic parameters
- constraints
- what pragmas are but after that, it is straightforward.
(Jordan's Reference section on
forallalso doesn't help much.)forallis also mandatory in PureScript (which is also not mentioned when introducing it), and I believe a comparison (the way the above post did) with Haskell is important, but at the right time. At least Jordan's Reference tries to put it off until later, but still before explaining concepts required to understand it.3. The "rabbit hole" links
These are all good resources, but not for uninitiated mortals, and at a lower level (such as where I am now) they raise more questions than answers.
Explicit
forall(r/purescript reddit)](Started here initially, but the single sentence there prompted a search for scoped type variables and rank-n types (or Rank N types).)
-
- Jul 2020
-
www.nature.com www.nature.com
-
Arnold, Carrie. ‘Pandemic Speeds Largest Test yet of Universal Basic Income’. Nature, 10 July 2020. https://doi.org/10.1038/d41586-020-01993-3.
-
- Jun 2020
-
www.newscientist.com www.newscientist.com
-
Page Le, M. (2020, June 24). Town in UK takes steps to test entire population for coronavirus. New Scientist. https://www.newscientist.com/article/2246880-town-in-uk-takes-steps-to-test-entire-population-for-coronavirus/
-
-
www.sciencedirect.com www.sciencedirect.com
-
Zhou, B., Lu, X., & Holme, P. (2020). Universal evolution patterns of degree assortativity in social networks. Social Networks, 63, 47–55. https://doi.org/10.1016/j.socnet.2020.04.004
-
-
psyarxiv.com psyarxiv.com
-
Nettle, D., Johnson, E., Johnson, M., & Saxe, R. (2020). Why has the COVID-19 pandemic increased support for Universal Basic Income? [Preprint]. PsyArXiv. https://doi.org/10.31234/osf.io/csr3u
-
- May 2020
-
www.catb.org www.catb.org
-
Write programs to handle text streams, because that is a universal interface.
-
- Apr 2020
-
github.com github.com
-
zxcvbn works identically on the server
-
-
medium.com medium.com
-
The “universal” label that has been slapped on to it is superfluous, but it does have its merits. Now that we have a commonly known term to refer to environment agnostic JavaScript code, it allows library authors to list it as a feature and be fashionable doing it. I’m happy with the term “universal” being fashionable because it makes developers think about their dependencies on the runtime environment. In the end this will help the JavaScript ecosystem mature and allow libraries to be used everywhere.
-
The “universal” label that has been slapped on to it is superfluous
-
Running the same code in the browser and on the server in order to avoid code duplication is a very different problem. It is simply a matter of good development practices to avoid code duplication. This however is not limited to isomorphic applications. A utility library such as Lodash is “universal”, but has nothing to do with isomorphism. Sharing code between environments does not give you an isomorphic application. What we’re referring to with Universal JavaScript is simply the fact that it is JavaScript code which is environment agnostic. It can run anywhere. In fact most JavaScript code will run fine on any JavaScript platform.
-
-
-
cdb.reacttraining.com cdb.reacttraining.com
-
en.wikipedia.org en.wikipedia.org
-
2ality.com 2ality.com
-
Maybe we should distinguish between: The technique of asssembling pages on either client or server. Here, “isomorphic” and “full stack” (as proposed by Rodrigo Medeiros) seem good choices. JavaScript that runs in all (or most) JavaScript environments, especially browsers and Node.js. Here, “universal” seems a good choice.
-
-
-
www.thelancet.com www.thelancet.com
-
Peto, J., Alwan, N. A., Godfrey, K. M., Burgess, R. A., Hunter, D. J., Riboli, E., Romer, P., Buchan, I., Colbourn, T., Costelloe, C., Smith, G. D., Elliott, P., Ezzati, M., Gilbert, R., Gilthorpe, M. S., Foy, R., Houlston, R., Inskip, H., Lawlor, D. A., … Yao, G. L. (2020). Universal weekly testing as the UK COVID-19 lockdown exit strategy. The Lancet, 0(0). https://doi.org/10.1016/S0140-6736(20)30936-3
-
- Nov 2019
-
digitalpromise.org digitalpromise.org
-
Universal design for learning (UDL) is the topic of focus for this webinar hosted by Digital Promise. Multiple experts discuss UDL for adult learners and strategies for UDL. Rating: 6/10
-
- Aug 2019
-
er.educause.edu er.educause.edu
-
And they have largely moved beyond the mental model of universal design (UD) in the physical environment, which is static, bounded, and predictable—instead designing interactions according to UDL, which sees interactions as dynamic, open, and emergent.
Really interesting point here about the limit of the "curb cut" metaphor.
-
They typically chop off the end of the word "accessibility," focusing their efforts on expanding access, regardless of the ability profiles of their learners
Great pull quote.
-
-
www.dailykos.com www.dailykos.com
-
Mandate: The gov’t mandates that everyone buy health insurance, funding comes from payroll taxes.
3
-
2-Tier: The gov’t pays two-thirds, and the private sector pays one-third.
2
-
Single-Payer: The gov’t taxes its citizens to pay for health care.
1
-
Single-Payer, 2-Tier, and Mandate systems.
three definitive models for Universal Health Care
-
- Apr 2019
-
-
We welcome public feedback to strengthen our communique and potential calls to action. Thank you!
-
-
-
He is a bit disturbed by this notion that salaries have to be at the high levels expected by US developers, which seems to permeate the FOSS sustainability effort. He said that he is often accused of wanting developers to starve, but that is not true at all: he wants people to get reasonable pay for reasonable work, to have health care, be able to live a comfortable middle-class life, and so on. But if being sustainable as a project means paying salaries at Silicon Valley levels, it simply will not work—it is not something we should bring back to FOSS, he said. We should look at what people need to live comfortably, while working on something they enjoy.
Bradley Kuhn è d'accordo con me sulla necessità di retribuzioni confortevoli ma non da ricconi quando si tratta di progetti comunitari.
Tags
Annotators
URL
-
-
-
Mahatma Gandhi, the father of our nation was a very benevolent and expert political master and observer that he had a great vision for the country. He was a man who fought for the upliftment of the poorer classes of society and thought of reforms in their favour.
True, but still we are not in right track since 1947 !
-
-
learn-us-east-1-prod-fleet01-xythos.s3.us-east-1.amazonaws.com learn-us-east-1-prod-fleet01-xythos.s3.us-east-1.amazonaws.com04Huang1
-
Since online learning has a different setting from the conventional classroom,online educators need to use some special techniques and perceptions to leadto success. Moreover, adults have special needs and requirements as learnerscompared with children and adolescents, thus online educators should knowhow adults can learn best because of their special characteristics. Philosophicaland methodological shifts also affect instruction. Many researchers havesuggested that constructivism should be applied in distance education. Thus,this paper attempts to examine the impact of constructivism in online learningenvironments when focusing on adult learners. The author develops the con-nection between constructivism and adult learning theory. In addition, thepaper proposes instructional guidelines using the constructivist approach inonline learning for adults.
-
- Mar 2019
-
udlguidelines.cast.org udlguidelines.cast.org
-
UDL guidelines. As I post this, I do not know whether this website will be included in our future course readings or not. This website practices what it preaches and provides the same content in multiple forms. The viewer can select/choose the manner in which items are displayed. This has essential information, such as the need to provide "multiple means" of engagement, representation, action, and expression when teaching. Rating 5/5
-
- Feb 2019
-
static1.squarespace.com static1.squarespace.com
-
oever removed from the best. It is one property of this system of notation. that whilst it furnishes the means of recording each person's ideas of gesture. it docs not presume lo dictate. It is a language, which may be used to express
Unlike Sheridan's method, which was proposed as a universal system. Enlightenment dudes sure love their universal ideas.
-
-
static1.squarespace.com static1.squarespace.com
-
Complex ideas are not universal, as .. we can see by the difficulties of translating from one language to another.
Language shapes the way we think and therefore it has the potential to limit what we are capable of thinking.
-
universal propositions, and would settle in their minds universal truths,
The desire for both universality and essence is interesting. Universality is a concept with breadth, applicable on a large scale and encompassing many things. Essence, on the other hand, is extremely narrow, focused and boiled down to a pinpoint. It's a juggling act to attempt both.
-
ideas, which are also universally the same
I already have a problem.
Is sensation a universal phenomenon? If so, that doesn't mean that human's experience sensations in the same way and therefore the ideas generated from those sensations would naturally vary.
The desire for "universal" anything seems fraught with problem, even for seemingly "simple" ideas.
-
-
static1.squarespace.com static1.squarespace.com
-
including the universal language from which all languages spring
Following lhm8's Fenollosa comment earlier, this was an idea that survived into the early 20th C., as writers like Fenollos and Ezra Pound looked to the Chinese character as a more "natural" state of language, something closer to a universal meaning.
-
university
I hadn't thought about the etymology of university before, but the juxtaposition with "universal grammar" spurred my curiosity about their common roots:
From community, corporation (1214 in Old French; also in Old French as universitei , universiteit , etc.), totality, universality (13th cent.)
http://www.oed.com.ezp.slu.edu/view/Entry/214804?rskey=lzyKTO&result=1&isAdvanced=false#eid
-
"universal
I'm noticing a theme here, with the desire of universal ideals, truths, …people. In a time/place where the world (as people knew it) was still relatively small, there seems a pervading sense of attempted connection, of finding common ground, to unify. In our current time/place with a greatly expanded sense of the world and its variety, have we mostly given up on that desire for uniformity? Do we like to think we have? Recent events indicate that perhaps we haven't given up that desire as much as we had thought, but are those events anomalous outliers or an ugly truth?
-
-
static1.squarespace.com static1.squarespace.com
-
Defect
Language similar to that of Hume, here and in the "General Orations" remark below (where generalities are more likely to be universally true than particulars)
-
- Jan 2019
-
static1.squarespace.com static1.squarespace.com
-
cumenical
Belonging to the whole world; universal, general, world-wide.
http://www.oed.com.ezp.slu.edu/view/Entry/59462?redirectedFrom=ecumenical#eid
-
- Nov 2017
-
www.cte.cornell.edu www.cte.cornell.edu
-
This means developing a flexible learning environment in which information is presented in multiple ways, students engage in learning in a variety of ways, and students are provided options when demonstrating their learning.
These are also best practices in teaching and learning, which says something about human cognition and motivation generally and how we think about people who need "accommodations." In other words, maybe we all need "accommodations" that serve our need for autonomy, mastery, and purpose.
-
- Sep 2017
-
www.catholicregister.org www.catholicregister.org
-
“We know that poverty is a major driver of ill-health. We also know that poor people trust doctors. It’s a free service. Many other services they won’t access because they worry about the cost,” said Prosper Canada CEO Liz Mulholland.
If only this was an issue in the USA, where going to a doctor is not a free service for the patient, in most cases. The same level of trust is not there; this is unacceptable/
-
- Aug 2017
-
foramoreperfectamerica.blogspot.com foramoreperfectamerica.blogspot.com
-
However, we are willing to work with you on what's really bothering you if you stop behaving like Subhuman sacks of dog shit. Let's fight the influence of big business and Electoral Corruption together. Let's get Universal Basic Income done so not just you, but every American is always secure. Let's end the pointless wars. Let's revitalize and stimulate our inner cities
Voters have been known throughout history, most recently in 2016, to vote against their own interests for reasons that are, frankly, stupid.
-
-
www.basicincomecanada.org www.basicincomecanada.org
-
At the core of human rights are the ideals and goals of the “four freedoms” articulated by US President Franklin Delano Roosevelt—freedom of speech, freedom of worship, freedom from fear, and freedom from want—and also the primary goal of self-determination. To achieve these conditions, it is also understood that while all rights are “interrelated, interdependent and indivisible,” the absolute basics of life (e.g., water, food, clothing, and shelter) must first be met.
Canada gets it. The US does not. This must change and quickly.
-
- Apr 2017
-
static1.squarespace.com static1.squarespace.com
-
problematiccategory
Translation: they do not see the audience as a problem to be addressed, but an assumed set of factors. Now I will continue to talk about the problem for a few more pages and only respond with an answer at the very end.
-
- Mar 2017
-
static1.squarespace.com static1.squarespace.com
-
Perelman and Olbrechts-Tyteca emphasize that there is no actual universal audience, nor any unimpeachable facts or truths that could be presented to it, but rather, only an idea in the speaker's mind about what such an audience would be were it to exist.
This is a confusing construction. Summary: purely rational argument is trying to appeal to a "universal audience," but the editors want to clarify that Perelman and Olbrechts-Tyteca did not really believe that a true universal audience exists. Rather, a speaker imagines a universal audience (rather than one that already has a set of shared values that must be appealed to in a specific way), and then tries to make rational arguments that could appeal to the "universal audience" of their imagination.
Tags
Annotators
URL
-
- Oct 2016
-
teaching.lfhanley.net teaching.lfhanley.net
-
O you
This feels like a direct address to the reader. It feels didactic and adds to the overall sense of a religious sermon or teaching that comes from the section as a whole. It implicates the reader in the poem and asks the reader to address their own mortality.
-
Gentile or Jew
this line could be referencing these two groups to give a unifying or universal sense of community. Perhaps a sort of collective or mutual bond between the two because of the drastic “whirlpool” referenced just before this line relating or joining people across boundaries.
-
- Sep 2016
-
lawrenceacademy-my.sharepoint.com lawrenceacademy-my.sharepoint.com
-
naive realism,
almost universal belief that all people define the real world of objects, events, and living creatures in pretty much the same way.
-
- Jun 2016
-
-
Nowhere are there as many bullshit jobs, however, as in Silicon Valley. A survey of 5,000 software developers and engineers last year found that, in the words of The Economist, “many of them feel alienated, trapped, underappreciated and otherwise discombobulated.” Only 19% of tech employees say they are satisfied with their jobs. A mere 17% feel valued. Or, as a former math whiz working at Facebook lamented a few years ago: “The best minds of my generation are thinking about how to make people click ads.”
-
- Apr 2016
-
-
while e-mail dissolves barriers to the exchange of data, we need another solvent to dissolve the barriers to collaborative use of that data. Applied in the right ways, that solvent creates what I like to call the “universal canvas” – an environment in which data and applications flow freely on the Web.
Highlight of original quote: https://hypothes.is/a/iKeap_T6TauWGfyf19VW_Q
-
- Jan 2016
-
techblog.netflix.com techblog.netflix.com
- Feb 2015
-
www.infoworld.com www.infoworld.com
-
while e-mail dissolves barriers to the exchange of data, we need another solvent to dissolve the barriers to collaborative use of that data. Applied in the right ways, that solvent creates what I like to call the “universal canvas” -- an environment in which data and applications flow freely on the Web.
-
- Feb 2014
-
www.justinhughes.net www.justinhughes.net
-
A universal definition of intellectual property might begin by identifying it as nonphysical property which stems from, is identified as, and whose value is based upon some idea or ideas. Furthermore, there must be some additional element of novelty. Indeed, the object, or res, of intellectual property may be so new that it is unknown to anyone else. The novelty, however, does not have to be absolute. What is important is that at the time of propertization the idea is thought to be generally unknown. The re
Intellectual property cannot be common currency in the intellectual life of the society at the time of propertization.
What constitutes society at this point; do small groups and communities suffice or does it have to be popularly known beyond a small few?
-
- Nov 2013
-
caseyboyle.net caseyboyle.net
-
There are two universal, general gifts be-stowed by nature upon man, Reason and Speech; dialectic is the theory of the former, grammar and rhetoric of the latte
Language is probably the greatest tool human kind has. Reasoning exists in many animals, but extensive communication networks and language is ours! Also, poor use of the word "Universal" here. If it was a universal gift, it would be for everyone and not just man.
-
- Sep 2013
-
rhetoric.eserver.org rhetoric.eserver.org
-
show that the good or the harm, the honour or disgrace, the justice or injustice, is great or small, either absolutely or relatively; and therefore it is plain that we must also have at our command propositions about greatness or smallness and the greater or the lesser -- propositions both universal and particular.
There are degrees of goodness and justice, relativity
-
-
rhetoric.eserver.org rhetoric.eserver.org
-
Accordingly all men make use, more or less, of bot
Rhetoric is necessary. It surrounds us and is used by all
Tags
Annotators
URL
-