5,018 Matching Annotations
  1. Jul 2020
    1. SciScore for 10.1101/2020.06.17.156554: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test this , we generated an N-terminal deletion construct lacking the first 41 amino acids ( 3aΔN ) and compared its localization to wild-type 3a in HEK cells .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK</div> <div>suggested: CLS Cat# 300192/p777_HEK293, CVCL_0045</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein purification For preparation of the 3a dimer and mutant constructs , infected Sf9 cells from 1 L of culture ( 15-20 mL of cell pellet ) were thawed in 100 mL of Lysis Buffer containing 50 mM Tris , 150 mM KCl , 1mM EDTA pH 8 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Sf9</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Constructs (2 µg) were transfected into HEK293 cells on glass coverslips using Fugene HD (Promega, Madison, WI) per manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK293</div> <div>suggested: CLS Cat# 300192/p777_HEK293, CVCL_0045</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data processing For the apo 3a dimer , motion-correction and dose-weighting were performed on all 6,309 movies using RELION 3.1’s implementation of MotionCor2 , and 2x “binned” to 1.137 Å per pixel30-32 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>RELION</div> <div>suggested: (RELION, SCR_016274)</div> </div>

            <div style="margin-bottom:8px">
              <div><b>MotionCor2</b></div>
              <div>suggested: (MotionCor2, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016499">SCR_016499</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the tetramer, the highest resolution reconstruction came from cryoSPARC v2 non-uniform refinement with a tightened mask, which was subsequently used for dimer-docking and figure preparation.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>cryoSPARC</b></div>
              <div>suggested: (cryoSPARC, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016501">SCR_016501</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molprobity39 was used to evaluate the stereochemistry and geometry of the structure for subsequent rounds of manual adjustment in Coot and refinement in Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Phenix</b></div>
              <div>suggested: (Phenix, <a href="https://scicrunch.org/resources/Any/search?q=SCR_014224">SCR_014224</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cavity measurements were made with HOLE41 implemented in Coot.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Coot</b></div>
              <div>suggested: (Coot, <a href="https://scicrunch.org/resources/Any/search?q=SCR_014222">SCR_014222</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using PyMOL, Chimera, ChimeraX43 , Fiji, Prism, GNU Image Manipulation Program, and Adobe Photoshop and Illustrator software.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>PyMOL</b></div>
              <div>suggested: (PyMOL, <a href="https://scicrunch.org/resources/Any/search?q=SCR_000305">SCR_000305</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>Fiji</b></div>
              <div>suggested: (Fiji, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002285">SCR_002285</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>Image Manipulation Program</b></div>
              <div>suggested: (GNU Image Manipulation Program, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003182">SCR_003182</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>Adobe Photoshop</b></div>
              <div>suggested: (Adobe Photoshop, <a href="https://scicrunch.org/resources/Any/search?q=SCR_014199">SCR_014199</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>Illustrator</b></div>
              <div>suggested: (Adobe Illustrator, <a href="https://scicrunch.org/resources/Any/search?q=SCR_010279">SCR_010279</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were excited with 488nm argon laser and image analysis was performed using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>ImageJ</b></div>
              <div>suggested: (ImageJ, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003070">SCR_003070</a>)</div>
            </div>
          </td></tr></table>
      


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.


      Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.06.17.157982: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We cloned the RBDs into a vector for yeast cell surface display, induced RBD expression, and incubated with a fluorescent antibody targeting a C-terminal epitope tag and varying concentrations of fluorescently labeled human ACE2 (Figure 1B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>ACE2</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following overnight equilibration of ACE2 binding at room temperature , cells were washed in icecold PBS-BSA , and resuspended in PBS-BSA containing 1:200 diluted FITC-conjugated anti c-Myc antibody ( Immunology Consultants Lab , CMYC-45F ) to label for RBD surface expression via a C-terminal c-Myc epitope tag , and 1:200 diluted PEconjugated streptavidin ( Thermo Fisher S866 ) to detect bound biotinylated ACE2 ligand.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti c-Myc</div> <div>suggested: None</div> </div>

            <div style="margin-bottom:8px">
              <div><b>c-Myc epitope tag ,</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For library expression experiments , 45 OD units yeast were washed twice with PBS-BSA and labeled in 3mL 1:100 diluted anti-Myc-FITC antibody for 1hr at 4°C with gentle mixing .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>anti-Myc-FITC</b></div>
              <div>suggested: (Sigma-Aldrich Cat# SAB4700448, <a href="https://scicrunch.org/resources/Any/search?q=AB_10896411">AB_10896411</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody epitopes were mapped from crystal structures 6W41 ( Yuan et al. , 2020b) , 6WAQ ( Wrapp et al. , 2020b) , 2DD8 ( Prabakaran et al. , 2006) , 3BGF ( Pak et al. , 2009) , 2GHW ( Hwang et al. , 2006) , 7BZ5 ( Wu et al. , 2020) , and cryo-EM structures 6NB6 and 6NB7 ( Walls et al. , 2019) , and 6WPS ( Pinto et al. , 2020) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>6NB7</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly , 2.5e5 293T cells per well were seeded in 12-well plates in 1 mL D10 growth media ( DMEM with 10 % heat-inactivated FBS , 2 mM lglutamine , 100 U/mL penicillin , and 100 μg/mL streptomycin) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>293T</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was removed from the 293TACE2 cells and replaced with fresh D10 containing 50 μL of pseudovirus supernatant in a final volume of 150 μL .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>293TACE2</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were transfected into 150mL suspension expi293F or HEK293F cells at 37°C in a humidified 8% CO2 incubator rotating at 130 rpm and harvested 3 days later.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>HEK293F</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods Data and Code Availability We provide all data and code in the following ways: ● Raw data tables of our replicate functional scores at the level of single mutations ( Supplemental File 3 , and GitHub: https://github.com/jbloomlab/SARS-CoV-2-RBD_DMS/blob/master/results/single_mut_effects/single_mut_effects.csv ) ● Raw data tables of our replicate functional scores among sarbecovirus homologs ( Supplemental File 1 and GitHub: https://github.com/jbloomlab/SARS-CoV-2-RBD_DMS/blob/master/results/single_mut_effects/homolog_effects.csv ) ● Illumina sequencing counts for each barcode among FACS bins ( https://github.com/jbloomlab/SARS-CoV-2RBD_DMS/blob/master/results/counts/variant_counts.csv ) ● The complete variant:barcode lookup table ( https://github.com/jbloomlab/SARS-CoV-2RBD_DMS/blob/master/results/variants/codon_variant_table.csv ) ● The complete computational workflow to generate and analyze these data , including reproducible code within a programmatically constructed computational environment ( https://github.com/jbloomlab/SARS-CoV-2-RBD_DMS ) ● A Markdown summary of the organization of analysis steps , with links to key data files and Markdown summaries of each step in the analysis pipeline ( https://github.com/jbloomlab/SARS-CoV-2RBD_DMS/blob/master/results/summary/summary.md) , with specific Markdown summaries linked in the relevant Methods sections below ● All raw sequencing data are uploaded to the NCBI Short Read Archive ( BioProject PRJNA639956)</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>NCBI Short Read Archive</b></div>
              <div>suggested: None</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>BioProject</b></div>
              <div>suggested: (NCBI BioProject, <a href="https://scicrunch.org/resources/Any/search?q=SCR_004801">SCR_004801</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For one bin in which the number of HiSeq reads was less than the number of cells sorted into a bin , we re-amplified PCR product from a newly purified plasmid aliquot , and obtained reads via a single lane of MiSeq 50bp single end sequencing .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>MiSeq</b></div>
              <div>suggested: (A5-miseq, <a href="https://scicrunch.org/resources/Any/search?q=SCR_012148">SCR_012148</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization The interactive heatmap of mutational effects shown at https://jbloomlab.github.io/SARS-CoV-2-RBD_DMS/ was made using the altair ( VanderPlas et al. , 2018 ) Python package.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Python</b></div>
              <div>suggested: (IPython, <a href="https://scicrunch.org/resources/Any/search?q=SCR_001658">SCR_001658</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural images were rendered in PyMol .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>PyMol</b></div>
              <div>suggested: (PyMOL, <a href="https://scicrunch.org/resources/Any/search?q=SCR_000305">SCR_000305</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD nucleotide sequences were aligned via mafft with a gap opening penalty of 4.5 , and the maximum likelihood phylogeny was inferred in RAxML ( Stamatakis , 2014 ) under the GTR model with 4 gamma-distributed discrete categories of among-site rate variation .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>RAxML</b></div>
              <div>suggested: (RAxML, <a href="https://scicrunch.org/resources/Any/search?q=SCR_006086">SCR_006086</a>)</div>
            </div>
          </td></tr></table>
      


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      • . To some degree, these caveats are universal of experimental studies, as even sophisticated animal models are imperfect proxies for true fitness
      • </ul></p>

        Results from OddPub: Thank you for sharing your code and data.


        About SciScore

        SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.05.12.088716: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Safety and efficacy of monoclonal antibody VIS410 in adults with uncomplicated influenza A infection: Results from a randomized, double-blind, phase-2, placebo-controlled study.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">COSCA1 (47-yearold male) and COSCA2 (44-year-old female) showed symptoms of an upper respiratory tract infection and mild pneumonia, respectively (Table 1).</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several of these antibodies were able to potently inhibit live SARS-CoV-2 infection at concentrations as low as 0.007 µg/mL, making them the most potent human SARS-CoV-2 antibodies described to date.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>SARS-CoV-2</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Indeed, therapeutic antibody cocktails with a variety of specificities have been used successfully against Ebola virus disease (7) and are being tested widely in clinical trials for HIV-1 (28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HIV-1 (28</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A hallmark of antibody diversity is the heavy chain complementarity determining region 3 (CDRH3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>CDRH3</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average length of CDRH3 in the naive human repertoire is 15 amino acids (34), but for a subset of influenza virus and HIV-1 broadly neutralizing antibodies, long CDRH3 regions of 20-35 amino acids are crucial for high affinity antigen-antibody interactions (35, 36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HIV-1 broadly neutralizing antibodies, long CDRH3</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With IC50s of 0.008 µg/mL the RBD-targeting antibodies COVA1-18 and COVA2-15, in particular, were remarkably potent while being quite different in other aspects such as their heavy chain V gene usage (VH3-66 vs. VH3-23), light chain usage (VL7-46 vs. VK2-30), HC sequence identity (77%) and CDRH3 length (12 vs. 22 amino acids).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>COVA2-15</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In conclusion, convalescent COVID-19 patients showed strong anti-SARS-CoV-2 S protein specific B cell responses and developed memory and antibody producing B cells that may have participated in the control of infection and the establishment of humoral immunity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-SARS-CoV-2 S</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human monoclonal antibodies block the binding of SARS-CoV-2 spike protein to angiotensin converting enzyme 2 receptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>angiotensin converting enzyme 2 receptor.</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of human neutralizing antibodies against MERS-CoV and their role in virus adaptive evolution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>human neutralizing antibodies against MERS-CoV</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nat Commun 8, 15371 (2017). L. Yu, Y. Guan, Immunologic Basis for Long HCDR3s in Broadly Neutralizing Antibodies Against HIV-1. Front Immunol 5, 250 (2014). F. Chen, N. Tzarum, I. A. Wilson, M. Law, VH1-69 antiviral broadly neutralizing antibodies: genetics, structures, and relevance to rational vaccine design.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>VH1-69</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HIV-1 antibody from an elite neutralizer implicates the fusion peptide as a site of vulnerability.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HIV-1</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, all HC and LC pairs were transiently expressed in HEK 293T cells and screened for binding by ELISA to SARS-CoV-2 S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK 293T</div> <div>suggested: KCB Cat# KCB 200744YJ, CVCL_0063</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">84 mAbs that showed potent binding were selected for small-scale expression in HEK 293F cells and purified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK 293F</div> <div>suggested: CVCL_6642</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural and functional analysis of a potent sarbecovirus neutralizing antibody. bioRxiv, 2020.2004.2007.023903 (2020). X. Chen et al.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>bioRxiv</div> <div>suggested: (bioRxiv, SCR_003933)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">N. R. Voss, C. K. Yoshioka, M. Radermacher, C. S. Potter, B. Carragher, DoG Picker and TiltPicker: software tools to facilitate particle selection in single particle electron microscopy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>TiltPicker</div> <div>suggested: (TiltPicker, SCR_016674)</div> </div> </td></tr></table>

      We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.05.11.088179: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blotting Western blotting was performed as described (Kobayashi et al., 2014; Konno et al., 2018; Nakano et al., 2017; Yamada et al., 2018) using an HRP-conjugated anti-HA rat monoclonal antibody (clone 3F10; Roche) and an anti-alpha-tubulin (TUBA) mouse monoclonal antibody (clone DM1A; Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-HA</div> <div>suggested: None</div> </div>

            <div style="margin-bottom:8px">
              <div><b>anti-alpha-tubulin (TUBA)</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials and Methods Cell Culture HEK293 cells (a human embryonic kidney cell line; ATCC CRL-1573) were maintained in Dulbecco’s modified Eagle's medium (Sigma-Aldrich) containing fetal calf serum and antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>HEK293</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We first aligned the viral genomes using the L-INS-i program of MAFFT version 7.453 (Katoh and Standley, 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>MAFFT</b></div>
              <div>suggested: (MAFFT, <a href="https://scicrunch.org/resources/Any/search?q=SCR_011811">SCR_011811</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We visualized the tree using a FigTree software (http://tree.bio.ed.ac.uk/software/figtree).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>FigTree</b></div>
              <div>suggested: (FigTree, <a href="https://scicrunch.org/resources/Any/search?q=SCR_008515">SCR_008515</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide sequences were determined by a DNA sequencing service (Fasmac), and the sequence data were analyzed by Sequencher v5.1 software (Gene Codes Corporation).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Sequencher</b></div>
              <div>suggested: (Sequencher, <a href="https://scicrunch.org/resources/Any/search?q=SCR_001528">SCR_001528</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis Data analyses were performed using Prism 7 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Prism</b></div>
              <div>suggested: (PRISM, <a href="https://scicrunch.org/resources/Any/search?q=SCR_005375">SCR_005375</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>GraphPad</b></div>
              <div>suggested: (GraphPad Prism, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002798">SCR_002798</a>)</div>
            </div>
          </td></tr></table>
      

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.04.28.067363: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Interlaboratory comparison of N1-STOP-LAMP A panel of 20 blinded clinical samples (13 positive and 7 negative) with cycle threshold (Ct) values previously established by E-gene RT-qPCR were aliquoted and distributed to three different laboratories for independent testing by N1-STOP-LAMP assay (Table S2).</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, serial dilutions of the stock virus were added to washed monolayers of Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Vero</div> <div>suggested: CLS Cat# 605372/p622_VERO, CVCL_0059</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After this quality control step , homology searches were then conducted using NCBI BLAST+ blastn using Genepuller . pl ( https://github.com/tseemann/bioinfo-scripts/blob/master/bin/gene-puller.pl ) to find the region in each of the remaining 2738 genomes matching the 5’ region of the N1 sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>NCBI BLAST+</div> <div>suggested: (Japan Bioinformatics, SCR_012250)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment was visualised with Mesquite ( v3.61) .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Mesquite</div> <div>suggested: (Mesquite, SCR_017994)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis Data analysis was managed using GraphPad Prism ( v8.4.1) .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>GraphPad Prism</div> <div>suggested: (GraphPad Prism, SCR_002798)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess the exclusivity criterion , we used a nucleotide BLAST search of the N1 region against the NCBI Genbank nt database and observed no non-SARS-CoV-2 sequence matches above 80 % nucleotide identity , in-line with FDA cross-reactivity requirement .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>BLAST</div> <div>suggested: (BLASTX, SCR_001653)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">OptiGene Genie II and III , BioRad CFX and ThermoFisher Quantstudio 7 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>ThermoFisher Quantstudio</div> <div>suggested: (Primer Express Software, SCR_017376)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BioRxiv 2020 . doi: https://doi.org/10.1101/2020.04.13.039941. 35 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>BioRxiv</div> <div>suggested: (bioRxiv, SCR_003933)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, showing inhibitory impact of 5 μL of a neat sample matrix on LAMP and the effect of diluting the UTM in water .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>LAMP</div> <div>suggested: (LAMP, SCR_001740)</div> </div> </td></tr></table>


      Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.04.29.069054: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Site V367 is at the opposite end from where RBD binds to ACE2 receptor; it is on the same face as the epitope of CR3022 , a neutralizing antibody that was isolated from a convalescent SARS-CoV patient when at least two of the RBD regions of the Spike trimer are “up” , ( Fig .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>ACE2</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tree shown here was created using PAUP ( Swofford , 2003); the trees generated for the website pipeline updates are based on parsimony ( Goloboff , 2014) . 2 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>PAUP</div> <div>suggested: (PAUP, SCR_014931)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots were generated with Python Matplotlib ( Hunter , 2007) .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Python</div> <div>suggested: (IPython, SCR_001658)</div> </div>

            <div style="margin-bottom:8px">
              <div><b>Matplotlib</b></div>
              <div>suggested: (MatPlotLib, <a href="https://scicrunch.org/resources/Any/search?q=SCR_008624">SCR_008624</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STAR METHODS RESOURCE AVAILABILITY Lead Contact Further information and requests for resources should be directed to and will be fulfilled by the Lead Contact , Bette Korber ( btk@lanl . gov) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>STAR</b></div>
              <div>suggested: (STAR, <a href="https://scicrunch.org/resources/Any/search?q=SCR_015899">SCR_015899</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">KEY RESOURCES TABLE The R Foundation for Statistical Computing , http://www.R-project.org R packages ( https://cran.r-project.org/ except as noted ) The R Foundation for Statistical Computing , http://www.R-project.org R packages ( https://cran.r-project.org/ except as noted ) phangorn ( version 2.5.5 ) ggplot2 ( version 3.3.0 ) beeswarm</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>https://cran.r-project.org/</b></div>
              <div>suggested: (CRAN, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003005">SCR_003005</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>ggplot2</b></div>
              <div>suggested: (ggplot2, <a href="https://scicrunch.org/resources/Any/search?q=SCR_014601">SCR_014601</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">l VMD: Visual Molecular Dynamics: https://www.ks.uiuc.edu/Research/vmd/ Highlighter: A tool to highlight matches, mismatches, and specific mutations in aligned protein or nucleotide sequences. https://www.hiv.lanl.gov/content/sequence/HIGHLIGHT/highlighter_top.html Rainbow Tree: https://www.hiv.lanl.gov/content/sequence/RAINBOWTREE/rainbowtree.html Aliview, a sequence alignment viewer and editor: https://ormbunkar.se/aliview/ Add COVID tools Sequence resconstruction: ARTIC network protocol (accessed the 19th of April, https://artic.network/ncov-2019.) Base call resolution: Nanopolish (https://github.com/jts/nanopolish) Matplotlib: A 2D Graphics Environment (Hunter, 2007) PAUP https://paup.phylosolutions.com</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>https://www.ks.uiuc.edu/Research/vmd/</b></div>
              <div>suggested: (Visual Molecular Dynamics, <a href="https://scicrunch.org/resources/Any/search?q=SCR_001820">SCR_001820</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>Aliview</b></div>
              <div>suggested: (AliView, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002780">SCR_002780</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>https://github.com/jts/nanopolish</b></div>
              <div>suggested: (Nanopolish, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016157">SCR_016157</a>)</div>
            </div>
          </td></tr></table>
      


      Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.04.27.062315: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect SARS-CoV and SARS-CoV-2 , hAEC cultures were immunostained with a rabbit polyclonal antibody against SARS-CoV nucleocapsid protein ( Rockland , 200-401-A50) , which also cross-react with SARS-CoV-2 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>SARS-CoV-2</div> <div>suggested: (Sino Biological Cat# 40143-R019, AB_2827973)</div> </div>

            <div style="margin-bottom:8px">
              <div><b>SARS-CoV nucleocapsid protein ( Rockland , 200-401-A50)</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell distribution of ACE2 were detected with a rabbit polyclonal antibody against ACE2 ( ab15348 , Abcam) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>ACE2</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">488-labeled donkey anti-rabbit IgG ( H + L ) ( Jackson Immunoresearch ) was used as secondary antibody .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>488-labeled donkey anti-rabbit IgG</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and human airway epithelial cell (hAEC) culturesVero-E6 cells (kindly provided by Doreen Muth, Marcel Müller, and Christian Drosten, Charité, Berlin, Germany) were propagated in Dulbecco’s Modified Eagle Medium-GlutaMAX supplemented with 1 mM sodium pyruvate, 10% (v/v) heat-inactivated fetal bovine serum (FBS), 100 mg/ml streptomycin, 100 IU/ml penicillin, 1% (w/v) non-essential amino acids and 15 mM HEPES (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>culturesVero-E6</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titration of apical and basolateral compartmentsViruses released in the apical or basolateral compartments were titrated by plaque assay on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Vero-E6</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All images were processed using Fiji software packages 47</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Fiji</b></div>
              <div>suggested: (Fiji, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002285">SCR_002285</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequencing reads were demultiplexed using the BRB-seqTools suite 30, and were aligned against a concatenation of the human gene annotation of the human genome (hg38), SARS coronavirus Frankfurt 1 (AY291315) and SARS-CoV-2/Wuhan-Hu1/2020 (NC_045512) viral genomes using STAR and HTSeq for producing the count matrices.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>STAR</b></div>
              <div>suggested: (STAR, <a href="https://scicrunch.org/resources/Any/search?q=SCR_015899">SCR_015899</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>HTSeq</b></div>
              <div>suggested: (HTSeq, <a href="https://scicrunch.org/resources/Any/search?q=SCR_005514">SCR_005514</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Library normalization and expression differences between samples were quantified using the DESeq2 package, with a cut-off of fold change (FC) ≥ 1.5 and False Discovery Rate (FDR) ≤ 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>DESeq2</b></div>
              <div>suggested: (DESeq, <a href="https://scicrunch.org/resources/Any/search?q=SCR_000154">SCR_000154</a>)</div>
            </div>
          </td></tr></table>
      


      Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

    1. SciScore for 10.1101/2020.04.25.060947: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">bioRxiv Online Publication ( 2020) . doi:10.1101/2020.03.16.993584 10 . Di , L . et al.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>bioRxiv</div> <div>suggested: (bioRxiv, SCR_003933)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clean data was aligned to GRCm38 genome and known transcript annotation using Tophat2 v2.1.1 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Tophat2</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ribosome-removed aligned reads were proceeded to calculate FPKM by Cufflinks v2.2.1 and gene body coverage by RSeQC v.2.6.4 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Cufflinks</div> <div>suggested: (Cufflinks, SCR_014597)</div> </div>

            <div style="margin-bottom:8px">
              <div><b>RSeQC</b></div>
              <div>suggested: (RSeQC, <a href="https://scicrunch.org/resources/Any/search?q=SCR_005275">SCR_005275</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing For metagenomic RNA-seq data , raw reads were quality controlled using BBmap ( version 38.68 ) and mapped to the human genome reference ( GRCh38 ) using STAR ( version 2.6.1d ) with default parameters .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>BBmap</b></div>
              <div>suggested: (BBmap, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016965">SCR_016965</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>STAR</b></div>
              <div>suggested: (STAR, <a href="https://scicrunch.org/resources/Any/search?q=SCR_015899">SCR_015899</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All unmapped reads were collected using samtools ( version 1.3 ) for microbial taxonomy assignment by Centrifuge ( version 1.0.4) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>samtools</b></div>
              <div>suggested: (SAMTOOLS, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002105">SCR_002105</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Custom reference was built from all complete bacterial , viral and any assembled fungal genomes downloaded from NCBI RefSeq database ( viral and fungal genomes were downloaded on February 4th , 2020 , and bacterial genomes were downloaded on November 14th , 2018) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>RefSeq</b></div>
              <div>suggested: (RefSeq, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003496">SCR_003496</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For SARS-CoV-2 genome analysis, raw reads were trimmed to remove sequencing adaptors and low-quality bases with Cutadapt v1.15.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Cutadapt</b></div>
              <div>suggested: (cutadapt, <a href="https://scicrunch.org/resources/Any/search?q=SCR_011841">SCR_011841</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then we removed duplicates from the primary alignment with Picard Tools v2.17.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Picard</b></div>
              <div>suggested: (Picard, <a href="https://scicrunch.org/resources/Any/search?q=SCR_006525">SCR_006525</a>)</div>
            </div>
          </td></tr></table>
      


      Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.03.21.990770: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">This study received approval from the Research Ethics Committee of Shenzhen Third People 's Hospital , China ( approval number: 2020-084) .</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among a total of 69 antibodies from P#2 , the majority ( 59 % ) were scattered across various branches and the remaining ( 41 % ) were clonally expanded into three major clusters ( Figure 3A) .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>total of 69</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Control antibodies from P#1 demonstrated even lower competing power with ACE2 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>ACE2</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We selected a total of six antibodies with ACE2 competitive capacities of at least 70 % and analyzed them in a pairwise competition fashion using SPR .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>SPR</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The most potent antibody , P2C-1F11 , did not seem target the same epitope as the relatively moderate antibody P2C-1C10 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>P2C-1F11</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally , despite successfully isolating and characterizing a large of number mAbs against SARS-CoV-2 , we cannot draw any firm correlation between antibody response and disease status at this time.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>SARS-CoV-2</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The third staining at 4 °C for 30min involved either: Streptavidin-APC ( eBioscience ) and/or Streptavidin-PE ( BD Biosciences ) to target the Strep tag of RBD , or antihis-APC and anti-his-PE antibodies ( Abcam ) to target the His tag of RBD .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>antihis-APC</div> <div>suggested: None</div> </div>

            <div style="margin-bottom:8px">
              <div><b>anti-his-PE</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG heavy and light chain variable genes were amplified by nested PCR and cloned into linear expression cassettes or expression vectors to produce full IgG1 antibodies as previously described 29,41 .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>full IgG1</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR products were purified and cloned into the backbone of antibody expression vectors containing the constant regions of human IgG1 .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>human IgG1</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies ( S230 and m396 ) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>SARS-CoV</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV-1 antibody VRC01 was a broadly neutralizing antibody directly isolated from a patient targeting the CD4 binding site of envelope glycoprotein 40 .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>CD4 binding site of envelope glycoprotein 40</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then stained with PE labeled anti-human IgG Fc secondary antibody ( Biolegend ) at a 1:20 dilution in 50 μl staining buffer at room temperature for 30 minutes .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>anti-human IgG</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VRC01 is negative control antibody targeting HIV-1 envelope glycoprotein.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>HIV-1 envelope glycoprotein.</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant RBD was labeled with either a Strep or His tag and used alone or in combination to identify and isolate RBD-specific single B cells through staining with the Streptavidin-APC and/or Streptavidin-PE, or anti-His- APC and anti-His-PE antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>anti-His- APC</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 , SARS-CoV and MERS-CoV pseudovirus were generated by cotransfection of human immunodeficiency virus backbones expressing firefly luciferase ( pNL43R-E-luciferase ) and pcDNA3.1 ( Invitrogen ) expression vectors encoding the respective S proteins into 293T cells ( ATCC ) 37,38,44,45</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>293T</b></div>
              <div>suggested: KCB Cat# KCB 200744YJ, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0063">CVCL_0063</a></div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells ( ATCC ) ( approximately 1.5 × 104 per well ) were added in duplicate to the virusantibody mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Huh7</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isolate was amplified in Vero cell lines to make working stocks of the virus ( 1 × 105 PFU/ml) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Vero</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of mAbs were mixed separately with 100 PFU of SARS-CoV-2 , incubated at 37 °C for 1 h , and added to the monolayer of Vero E6 cells in duplicates .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Vero E6</b></div>
              <div>suggested: <a href="https://scicrunch.org/resources/Any/search?q=CVCL_XD71">CVCL_XD71</a></div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genes encoding the heavy and light chains of isolated antibodies were separately cloned into expression vectors containing IgG1 constant regions and the vectors were transiently transfected into HEK293T or 293F cells using polyethylenimine ( PEI ) ( Sigma) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>293F</b></div>
              <div>suggested: <a href="https://scicrunch.org/resources/Any/search?q=CVCL_D615">CVCL_D615</a></div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T cells transfected with expression plasmid encoding the full length spike of SARS-CoV-2, SARS-CoV or MERS-CoV were incubated with 1:100 dilutions of plasma from the study subjects.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>HEK 293T</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic and biologic characterization indicates that these antibodies are derived from broad and diverse families of antibody heavy and light chains .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Bioinformatic</b></div>
              <div>suggested: (QFAB Bioinformatics, <a href="https://scicrunch.org/resources/Any/search?q=SCR_012513">SCR_012513</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally , the cells were re-suspended and analyzed with FACS Calibur instrument ( BD Biosciences , USA ) and FlowJo 10 software ( FlowJo , USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>FlowJo</b></div>
              <div>suggested: (FlowJo, <a href="https://scicrunch.org/resources/Any/search?q=SCR_008520">SCR_008520</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations ( IC50 ) of the evaluated mAbs were determined by luciferase activity 48h after exposure to virusantibody mixture using GraphPad Prism 6 ( GraphPad Software Inc . ) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>GraphPad Prism</b></div>
              <div>suggested: (GraphPad Prism, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002798">SCR_002798</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>GraphPad</b></div>
              <div>suggested: (GraphPad Prism, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002798">SCR_002798</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG heavy and light chain variable genes were aligned using Clustal W in the BioEdit sequence analysis package ( https://bioedit.software.informer.com/7.2/).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>BioEdit</b></div>
              <div>suggested: (BioEdit, <a href="https://scicrunch.org/resources/Any/search?q=SCR_007361">SCR_007361</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analyses were performed by the Maximum Likelihood method using MEGA X ( Molecular Evolutionary Genetics Analysis across computing platforms) .</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>MEGA X</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr></table>
      


      Results from OddPub: Thank you for sharing your data.


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.03.11.20031096: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Ethical approval This study received approval from the Research Ethics Committees of the participating institutions , which waivered informed patient consent because the study only involved retrospective review of clinical data and because of the urgent nature of the study to investigate a new serious infections disease.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The ABO blood group distribution was also similar between male and female patients with COVID-19 ( Table S1) .</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">*Corresponding authors: Yang (yanggy@sjtu.edu.cn); Wang (wangxinghuan@whu.edu.cn); Zhang (zhangli080806@163.com); Zhou (xiaoyangzh@whu.edu.cn); Xing (xingmz@sustech.edu.cn); Wang (wangp6@sustech.edu.cn) Running Title: ABO blood group and COVID-19 Key Words: ABO blood group, coronavirus, SARS-CoV-2, COVID-19, disease susceptibility Abstract: The novel coronavirus disease-2019 (COVID-19) has been spreading around the world rapidly and declared as a pandemic by WHO.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patrice et al. found that anti-A antibodies specifically inhibited the adhesion of SARS-CoV S protein-expressing cells to ACE2-expressing cell lines7 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-A</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Given the nucleic acid sequence similarity8 and receptor angiotensin-converting enzyme 2 ( ACE2 ) binding similarity between SARS-CoV and SARS-CoV-29-11 , the lower susceptibility of blood group O and higher susceptibility of blood group A for COVID-19 could be linked to the presence of natural anti-blood group antibodies , particularly anti-A antibody , in the blood.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>ACE2</div> <div>suggested: None</div> </div>

            <div style="margin-bottom:8px">
              <div><b>SARS-CoV-29-11</b></div>
              <div>suggested: None</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>anti-blood group</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inhibition of the interaction between the SARS-CoV spike protein and its cellular receptor by anti-histo-blood group antibodies . Glycobiology . 2008 Dec;18 ( 12):1085-93 . 8 . Lu R , Zhao X , Li J , Niu P , Yang B , Wu H , Wang W , Song H , Huang B , Zhu N , Bi Y , Ma X , Zhan F , Wang L , Hu T , Zhou H , Hu Z , Zhou W , Zhao L , Chen J , Meng Y , Wang J , Lin Y , Yuan J , Xie Z , Ma J , Liu WJ , Wang D , Xu W , Holmes EC , Gao GF , Wu G , Chen W , Shi W</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>anti-histo-blood group antibodies .</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS software (version 16.0) and STATA software (version 13).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>SPSS</b></div>
              <div>suggested: (SPSS, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002865">SCR_002865</a>)</div>
            </div>
      
            <div style="margin-bottom:8px">
              <div><b>STATA</b></div>
              <div>suggested: (Stata, <a href="https://scicrunch.org/resources/Any/search?q=SCR_012763">SCR_012763</a>)</div>
            </div>
          </td></tr></table>
      


      Results from OddPub: Thank you for sharing your data.


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

    1. SciScore for 10.1101/2020.03.11.983056: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">All animal experiments were approved by the Institutional Animal Care and Use Committee of Institut Pasteur of Shanghai and Wuhan University.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice infection and drug treatment BALB/c female mice, 6-8 weeks old, were purchased from LingChang Company and bred in the specific pathogen-free animal facility.</td></tr><tr"><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, singlecell sorting was performed in a 96-well plate to grow single clones, and western blot using the anti-DHODH antibody (Santa Cruz) was performed to detect the expression level of DHODH.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-DHODH</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then incubated with the primary antibody (a polyclonal antibody against the NP of a bat SARS-related CoV) after blocking, followed by incubation with the secondary antibody (Alexa 488-labeled goat anti-rabbit, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-rabbit, Abcam).</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining was performed using an anti-NP polyclonal antibody conjugated with HRP (Antibody Research Center, Shanghai Institute of Biological Science).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-NP</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed and permeabilized for staining with anti-viral NP antibody, followed by staining with Alexa 488-labeled secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-viral NP</div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials & Methods Cell lines, virus, and drugs MDCK, A549, Vero E6, Huh7 cells were obtained from the American Type Culture Collection (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Huh7</div> <div>suggested: CLS Cat# 300156/p7178_HuH7, CVCL_0336</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BSR T7/5 cells stably expressing the T7 RNA polymerase gene were kindly provided by Gang Zou (Institute Pasteur of Shanghai, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>BSR T7/5</div> <div>suggested: CCLV Cat# CCLV-RIE 0583, CVCL_RW96</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK, A549, Vero E6, Huh7, 293FT cells were cultured in DMEM (Gibco) supplemented with 10%FBS (Gibco) and 1% P/S (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>MDCK</div> <div>suggested: None</div> </div>

            <div style="margin-bottom:8px">
              <div><b>293FT</b></div>
              <div>suggested: ATCC Cat# PTA-5077, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_6911">CVCL_6911</a></div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influenza mini-replicon system and DHODH substrates assay The 293T cells were seeded into 24-well plates at 1×105 cells per well and were transfected with influenza A/WSN/33 virus PB1-, PB2-, PA- and NP- expressing plasmids (100 ng each), the influenza virus-specific RNA polymerase I driven firefly luciferase reporter (pPoⅡ-NP-luc) (100 ng, provide by Han-D Klenk, Marburg University), and the Renilla luciferase reporter pRLSV40 10 ng, Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>293T</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BSR-T7/5 cells were transfected with the EBOV mini-genome replication system (NP, VP35, VP30, MG, and L) in the presence of increasing concentrations of Teriflunomide, Brequinar, S312 and S416 respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>BSR-T7/5</b></div>
              <div>suggested: CCLV Cat# CCLV-RIE 0583, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_RW96">CVCL_RW96</a></div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Aliquots of Vero E6 cells were seeded in 96-well plates and then infected with Beta CoV/Wuhan/WIV04/2019 at MOI of 0.03.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Vero E6</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 (WT or DHODH-/-) cells were infected with WSN virus with MOI of 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>A549</b></div>
              <div>suggested: NCI-DTP Cat# A549, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0023">CVCL_0023</a></div>
            </div>
          </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were processed with Graphpad prism software to calculate EC50 and CC50 values of the compounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Graphpad prism</b></div>
              <div>suggested: (GraphPad Prism, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002798">SCR_002798</a>)</div>
            </div>
          </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data availability The protein structure data has been uploaded to the Protein Data Bank with accession number 6M2B. Acknowledgments: This work was supported in part by the National Key Research and Development Program (grant 2018FYA0900801, 2018ZX10101004003001, 2016YFA0502304), the National Natural Science Foundation (NSFC) of China (grants 31922004, 81825020, 81772202), the National Science & Technology Major Project “Key New Drug Creation and Manufacturing Program” China (grant 2018ZX09711002), Application & Frontier Research Program of Wuhan Government (2019020701011463).</td><td style="min-width:100px;border-bottom:1px solid lightgray">
            <div style="margin-bottom:8px">
              <div><b>Frontier Research Program</b></div>
              <div>suggested: None</div>
            </div>
          </td></tr></table>
      


      Results from Barzooka: We also found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from OddPub: Thank you for sharing your data.


      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

  2. Jun 2020
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank all reviewers for their comments and suggestions, which will make our manuscript a much better one. Accordingly, we have already made changes to the manuscript (marked in yellow) and we will perform all the experiments requested. Below, we answer the reviewers point by point.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): This study provides solid evidences showing a role for the spectraplakin Short-stop (Shot) in subcellular lumen formation in the Drosophila embryonic and larval trachea. This subcellular morphogenetic process relies on an inward membrane growth that depends on the proper organization of actin and microtubules (MTs) in terminal cells (TCs). Shot depletion leads to a defective or absent lumen while conversely, Shot overexpression promotes excessive branching, independently on the regulation of centrosome numbers previously shown to be important for the regulation of the lumen formation process (Ricolo, D., Deligiannaki, M., Casanova, J. & Araújo, S. J. Centrosome Amplification Increases Single-Cell Branching in Post-mitotic Cells. Current Biology 26, 2805-2813 (2016)). Shot is rather important to regulate the organization of the cytoskeleton by crosslinking MTs and actin. Shot expression in TCs is controlled by the Drosophila Serum Response Factor (DSRF) transcription factor. Finally Shot functionally overlaps with the MT-stabilizing protein Tau to promote lumen morphogenesis. The figures are clear and the questions well addressed with carefully designed and controlled experiments. However, I would have few suggestions that will hopefully make some points clearer. **Major comments:** -Statistical analyses should be added for comparisons of proportions, including Fig. 1E, 1L, Fig. 2G-I, Fig. 6L, Fig. 7K, Fig. 8C-D and Fig. 9G.

      We agree with this and have now redone all graphs and revised all quantifications from this study. We have added error bars in all above mentioned graphs and have provided statistical analysis where appropriate. We have also redone all graphics and phenotype reporting, which is done now in relation to total TCs (rather than embryos or GBs and DBs TCs). This was suggested also by reviewer #2 and we agree because this is a more stringent and comparable way of quantifying our results.

      -It is not always clear what genotype has been used as the "wt" genotype, as in Fig. S2 or Fig. 3 for example, this should be added to figure legends.

      We have now clarified which flies are used as controls in each experiment throughout the paper. We have left wt where flies were wt, and changed all other cases to either the genotype or “control”.

      -Live imaging of Shot has been performed with ShotC-GFP, that cannot bind actin. Don't the authors think ShotA-GFP would reflect more accurately Shot endogenous behavior as it interacts both with actin and MTs? It would be better to show this, even if the results shown here tend to be consistent with Shot endogenous localization shown with Shot antibody staining.

      We agree and we will analyse movies with both ShotC and ShotA and present them in the revised version.

      -It is of course not possible to generate CRISPR mutant flies with mutations in putative DSRF binding sites in a reasonable amount of time, to confirm that Shot transcription is controlled by DSRF. It would thus be nice to reveal shot mRNA expression with in situ hybridization experiments in wt vs. bs embryos. This would confirm that Shot mRNA is downregulated upon DSRF inhibition and rule out a possible indirect effect on Shot protein stability for example.

      We believe the presented 3-way approach (in silico, protein quantification and phenotype rescue) is sufficient to show that Shot expression is regulated by DSRF. It is unlikely that we are dealing with protein stability or other issues, because we can rescue the lumen elongation phenotype by solely expressing Shot in TCs. However, we agree it would be nice to show this in an in situ hybridization experiment, and we will try to provide a conclusive one for resubmission. In situ detection methods, however, may not be accurate enough to detect such differences in single-cells.

      -In the same figure, it would also be interesting to show what happens to actin and MTs in bs TCs and to which extent their organization is rescued by Shot overexpression.

      We are working on this for resubmission. These experiments were frozen by the current COVID-19 pandemic and this is why they were not submitted with the first version.

      -UAS-EB1GFP does not seem to be an appropriate control in Figure 9 (A and B) since it can affect MT dynamics (Vitre, B. et al. EB1 regulates microtubule dynamics and tubulin sheet closure in vitro. Nat. Cell Biol. 10, 415-421 (2008)). Why not simply use an UAS-GFP?

      We have not detected any notorious larval TC phenotypes by overexpressing UASEB1GFP in TCs. Their branching is comparable to that in previous studies (for example Schotenfeld-Roames, et al Current Biology 2014) and there were no detectable luminal branching phenotypes. However, we agree it is more correct to analyse cells with a plain GFP and have repeated the controls for this experiment using DSRFGAL4UASGFP. This is now shown in figure 9.

      -Shot and probably Tau crosslinking activities are important for lumen morphogenesis with a striking increase in the number of embryos without lumen in shot3 and shot3 tauMR22 mutant embryos. The rescue experiments clearly show that Shot binding to both MT and actin is essential for efficient rescue. The same might apply to Tau since it is able to crosslink actin and MTs (Elie, A. et al. Tau co-organizes dynamic microtubule and actin networks. Sci Rep 5, 1-10 (2015)). I believe showing actin and MTs organization in these rescue experiments would be necessary.

      We agree and we will provide these experiments upon resubmission.

      Second, the overexpression experiments indicate that Shot is able to induce extra lumen formation even when unable to bind actin as shown with the increase in the number of supernumerary lumina (ESLs) under overexpression of ShotC and ShotCtail to a lesser extent. This phenotype is also observed under Tau overexpression. This suggest that not crosslinking anymore but rather making MTs more stable could be sufficient to promote extra lumen formation in a wt context. Stabilising MTs by treatment with Taxol might thus be sufficient to promote ESL formation. I am fully aware of the difficulty of treating Drosophila embryos with drugs, making this experiment hard to do, but I think this dual function of Shot and Tau (crosslinking actin and MTs to promote branching vs. stabilizing MTs leading to excessive branching) should be discussed.

      In Figure 2 we show not just that UASShotC is able to induce ESl but also that UAS-ShotCtail containing only the MT binding domain of Shot is enough to induce ESLs in TCs, whereas UAS-deltaCtail is not. We agree Taxol treatment would be a nice experiment to do, however we also think we provide enough evidence that MT stability is enough for ESL whereas de novo lumen formation requires crosslinking of MTs to actin. As advised, we will discuss better both Shot and Tau dual function in ESL generation and de novo lumen formation for resubmission.

      **Minor comments:**

      We have already addressed most these minor comments in the manuscript (text revised and changes in yellow). And we provide answers to some of the comments below.

      -p2 line 1: 'acentrosomal luminal branching points' may be better than 'acentrosomal branching points' to describe the phenotype. -p4, line 16: the reference 23 is not properly inserted (should be after 'closure'). -p5, line 16: Please mention what the abbreviations Bnl and Btn stand for. -p5, line 20: these 80% of TCs cells with defects in subcellular lumen formation should appear on the graph in Fig. 1E (as shown in graph 1L).

      We have added shot RNAi results to graph E in figure 1.

      -p5, line 26: this 36% value does not seem to correspond to anything on the graph in Fig. 1N. According to the figure legend, 20% of TCs did not elongate at all and the lumen was completely absent (class IV), which is consistent with the result shown in Fig. 1L. Also, I am not sure why only 25 TCs were analysed in Fig. 1N while there are the data to analyse more as shown in Fig. 1E (400 TCs), this would make the graph more representative.

      Figure 1 N represents a detail of the different phenotypes present in shot mutant embryos. Whereas for most of the paper we consider only complete lack of TC lumen, here we show the different types of affected TCs and not just the ones with a complete lack of subcellular lumen. We apologise because it was not explained in the original manuscript that types III and IV are the “no lumen” class (they were subdivided into 2 classes because they have different cell enlongation phenotypes). 36% of the total of affected TCs displayed the lack of lumen phenotype (this means a 22,5 % of the total number of TCs, because total affected TCs are 62,5% only). Numbers are similar but not exactly the same because this analysis was done using confocal microscopy and cells analysed one by one in detail, which is not possible using colorimetric methods and only luminal markers. This is also the reason we only analysed 25 TCs in this case. We thank the reviewer for pointing this out and have better described it in the manuscript.

      -p6, line 8: ShotA-GFP is indeed a long isoform but is not the full-length Shot, as it does not contain the plakin repeat exon which would add another ~3000aa.

      We have corrected this.

      -p6, lines 21-23: ShotA-GFP localisation is not shown in FigS1. The authors should refer to Fig. 2. Enlarged areas/arrows might help the reader to better visualise the different localisations of ShotA-GFP and ShotC-GFP.

      We thank the reviewer for this request and we will change the figure providing enlarged areas upon resubmission. In this version of the manuscript we have already changed the error in figure referral in the text.

      -p7, line 23: Rca1 mutants should be better introduced here.

      We have added one sentence of introduction to the Rca1 phenotype.

      -p8, line 6: Shot colocalizes/associates with stable MTs and actin would be a more appropriate title for this paragraph.

      We thank the reviewer for this alternative, and we have changed this title in the manuscript.

      -p16, line 18: 'Shot is able to mediate crosstalk' would be better than 'Shot is able to crosstalk'. -p40, lines 6 and 7: L, M and N should be K', K' and K' respectively. -p41, Fig 10D: It is quite hard to see on the cartoon what the phenotype is for Shot OE.

      We will make this clearer for resubmission.

      -The following reference shows an important role for Shot in crosslinking actin and MTs during morphogenesis of the Drosophila embryo and should be cited in this manuscript (Booth, A. J. R., Blanchard, G. B., Adams, R. J. & Röper, K. A Dynamic Microtubule Cytoskeleton Directs Medial Actomyosin Function during Tube Formation. Developmental Cell 29, 562-576 (2014)).

      We thank the reviewer for pointing this out, because this is of course an important reference known to us, which we forgot to add. We have now added this to the manuscript.

      -FigS3. It would be good to add the labels on the figure (ShotC-GFP in green, and MoeRFP/lifeActinRFP in Magenta).

      We will do this for resubmission.

      Reviewer #1 (Significance (Required)): The findings shown in this manuscript shed an important light on the way subcellular morphogenesis occurs. It was known that both actin and MTs were required in this process, particularly during the formation of Drosophila trachea (JayaNandanan, N., Mathew, R. & Leptin, M. Guidance of subcellular tubulogenesis by actin under the control of a synaptotagmin-like protein and Moesin. Nature Communications 1-10 (2019). doi:10.1038/ncomms4036; Gervais, L. & Casanova, J. In Vivo Coupling of Cell Elongation and Lumen Formation in a Single Cell. Current Biology 20, 359-366 (2010)). This work provides additional molecular insights into the way branching morphogenesis from a single cell occurs in vivo, clearly demonstrating a requirement for actin-MT crosslinking mediated by Shot and Tau. This could be of great interest in the field of branching morphogenesis and lumen formation, not only in invertebrates but also in vertebrates where such a crosslinking might occur in the vasculature, the lung, the kidney or the mammary gland for example (Ochoa-Espinosa, A. & Affolter, M. Branching Morphogenesis: From Cells to Organs and Back. Cold Spring Harb Perspect Biol 4, a008243-a008243 (2012)). *Field of expertise:* morphogenesis, Drosophila, cytoskeleton, microtubules. Reviewer #2 (Evidence, reproducibility and clarity (Required)): **Summary:** The development of branched structures with intracellular lumen is widely observed in single cells of circulatory systems. However the molecular and cellular mechanisms of this complex morphogenesis are largely unknown. In previous study, the authors revealed that centrosome as a microtubule organizing center (MTOC) located at the apical junction contributes subcellular lumen formation in the terminal cells of Drosophila tracheal system. The microtubule bundles organized by MTOC are suggested to serve as trafficking mediators and structural stabilizers for the newly elongated lumen. In this manuscript, they focused on a Drosophila spectraplakin, Shot, which have been reported to crosslink MT minus-ends to actin network, in the subcellular lumen formation. The paper started by description of lumen elongation defect of the tracheal terminal cells in the shot[3] null mutant. The overexpression of full-length and series of truncated form of shot exhibited extra-subcellular lumina (ESL) in TCs, suggesting that Shot is required for the lumen formation in dose dependent manner. They next addressed whether Shot overexpression induces ESL through the supernumerary centrosomes as in Rca1 mutant, however the number of centrosomes was not affected. Moreover, the ESL were sprouted distally from the apical junction, suggesting that Shot operate in different way from the Rca1-dependent microtubule organization. To get mechanistic insight of Shot in the luminal formation, they checked localization of the Shot and found it localized with stable MTs around the nascent lumen and with the F-actin at the tip of the cell during the cell elongation and subcellular lumen formation. In shot[3] mutant, the MT-bundles were no longer localized to apical region and the actin accumulation at the tip of the cell was also reduced. The rescue experiments using several truncated forms of Shot, and well-designed genetic analysis using various shot mutants revealed that both MT binding domain and actin binding domains are needed to develop the lumen. The expression of shot was under the regulation by terminal cell-specific transcription factor bs/DSRF, and the overexpression of shot in bs LOF mutant suppressed its phenotype, indicated that part of the luminal phenotype of bs mutant in terminal cells are due to lower levels of the activity of shot. Finally, they checked whether Tau can compensate the function of shot in the subcellular lumen formation. The lumen elongation defect in shot mutant was suppressed by tau expression, and tau overexpression phenocopied the shot overexpression-induced ESL. Although tau mutant did not show the lumen formation defects, the double mutant of shot and tau exhibited synergistic effect. Shot was also required for subcellular luminal branching at larval stages. Overall, this work highlighted the importance of Shot as a crosslinker between MT and actin that acts in downstream of the FGF signaling-induced bs/DSRF expression for the subcellular lumen formation. An excess of Shot is sufficient for ESL formation from ectopic acentrosomal branching points. Furthermore, the Tau protein can functionally replace Shot in this context. **Major comments:** *- Are the key conclusions convincing?* *- Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?* The conclusions were basically supported by the set of data presented in this article, but following points need to be clarified. The truncated form ShotC lacks only half of calponin domain that are essential for the actin binding, thus it is still possible to bind actin to some extent. Although the actin binding activity is reported as "very weak" in the cited references, the quantitative analysis has not been done. Thus, the interpretation and claims based on the experiments using ShotC should be reviewed carefully.

      We agree with the reviewer and will revise all the text for resubmission in order to make this unambiguous. However, we would like to remark that our claims are not only based on UAS-ShotC but also in the shotkakP2 allele, which does not contain one of the calponin domains and in isoforms such UAS-Shot C-tail which do not have any ABD.

      Data set in some places seems fragmented. For example, overexpression study of shot constructs (Fig. 2) lacks phenotypic comparison of control (btl Gal4 driven control FP) to compare if phenotypes of shot constructs expression are different from control. Different methods of phenotypic quantification are employed. One was counting embryo number with at least one abnormality among 20 TCs of DB or GB, or the other counting every TC for the presence of lumen/branching conditions. The latter is more stringent measure and is more appropriate for the study of single cell morphogenesis.

      We totally agree with the reviewer. We have now revised all quantifications and graphs:

      1) We have used btl>GFP as control to all overexpression experiments in embryos and DSRFGAL4UASGFP in control larvae.

      2) We have made the paper uniform regarding quantifications, which are now all done in relation to total TCs and not embryos.

      For this reason, many of the graphs, figure legends and quantification values in the the manuscript text are now changed.

      *- Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.* The all movies were using ShotC isoform which lacks half of the actin binding domain. The truncated isoform is not suitable to observe the localization, especially the colocalization with actin. The movies need to be retaken using full-length Shot at the dosage that does not interfere with normal TC development.

      We agree and we will analyse movies with both ShotC and ShotA for resubmission.

      Some statements on Moesin and Tau localization sound as if the authors studied Shot interaction with nascent Moe and Tau molecules. This is confusing because fragments of Moe and Tau, but not functional full length proteins, were used.

      We will revise the text to make this unambiguous fir resubmission.

      *- Are the suggested experiments realistic in terms of time and resources?* It would help if you could add an estimated cost and time investment for substantial experiments. Because the transgenic fly is already present, we assume it would be done in 4 weeks. However, it would be influnced under social circumstances whether the lab facilities are able to access or not. *- Are the data and the methods presented in such a way that they can be reproduced?* *- Are the experiments adequately replicated and statistical analysis adequate?* The methods provided seem to be sufficient for reproducing the data by competent researchers, and most of the data are solid and the sample numbers are sufficient for the claims. However, the criteria for phenotypic evaluation differs among graphs and figures, that possibly confuse the readers. Standardized measurement methods are desirable. **Minor comments:** *- Specific experimental issues that are easily addressable.* In the rescue experiments shown in Figure 6, only full-length Shot rescued the subcellular lumen formation, but either of truncated Shot did not. The localization study of MT and actin in those conditions will reveal whether proper localizations of actin and MT are critical for the lumen formation.

      We are working on this for resubmission. These experiments were stalled by the current COVID-19 pandemic and this is why they were not submitted with the first version. We will provide MT and actin localization for the rescue experiments with ShotA and ShotC.

      *- Are prior studies referenced appropriately?* The references are cited appropriately. *- Are the text and figures clear and accurate?* There are several typos: Remodelling -> remodeling, signalling -> signaling. In the figure 2, G and H seem redundant. Scale bars are missing in Fig1 F-K, Fig2 K-L, Fig6 A-I, Fig7 E-J and Fig8 E-J.

      We have changed the graphs in figure 2. Typos have been corrected. We will provide errors bars for resubmission.

      The author often called shot+ genotype as "wild type". They are transgenic strains with some mutations, and cannot be found in the wild. They should be simply called with genotype or "control" for experiments.

      We thank the reviewer for pointing these typos and incoherences with control genotypes. We have partly revise the text and figures and will finish for resubmission.

      *- Do you have suggestions that would help the authors improve the presentation of their data and conclusions?* In Figure 4, as the localization of Shot is difficult to see in detail, enlarged insets might help. In addition, the green and cyan in C'-E' is difficult to distinguish.

      We will change this for resubmission.

      With Figure 5, the authors claimed that Shot LOF leads to disorganized MT-bundles and actin localization. We feel this is an overstatement and the Figure should be backed up with better data, or removed. F-actin and microtubule localizations are highly dynamic and the snapshot pictures are insufficient for demonstrating defective localization. It is also possible that (potential) difference in the marker localization is due to indirect effect of Shot LOF in cell shape.

      We agree with the reviewer that fixed samples are not the best to analyse cytoskeletal components, but we observe clear differences in MT bundles and specially in actin localization in shot mutants as compared to controls and we believe it is important to show these results. Cell shape might of course alter the analysis which is why we present 3 different cell shapes in Figure 5. In addition, there are many previous studies where localization of MTs and actin was done in fixed mutant embryos, where cell shape is also affected, and revealed important steps in TC formation (Gervais and Casanova, 2010; JayanNadanan et al. 2014).Nonetheless, we have revised the text in order to avoid overstatements.

      Reviewer #2 (Significance (Required)): *- Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.* *- Place the work in the context of the existing literature (provide references, where appropriate).* In blood capillary and insect trachea, the branching process of single vessel cells involves sprouting of cell protrusions, followed by the lumen extension from the main vessels. The lumen formation involves assembly of plasma membrane components inside of the cytoplasm. Since the luminal membrane is associated with protein complexes common to apical cell membrane, lumen formation is believed to involve redirection of apical trafficking of membranes to intracellular sites (Sigurbjörnsdóttir, Mathew, Leptin 2014, 10.1038/nrm3871). The authors previously demonstrated that centrosome is an important link of preexisting lumen to de novo lumen formation, leading to the hypothesis that centrosome-derived microtubules organize lumen membrane assembly. *- State what audience might be interested in and influenced by the reported findings.* In this manuscript, the authors addressed this issue by looking at the function of Shot/Plakin that has both microtubule and actin binding activities. Shot is an ideal candidate for linking actin-rich cell protrusions in the leading edge to centrosome- associated lumen tip. Indeed the authors clearly showed that shot is required for lumen extension and overexpressed shot protein associates with intracellular tract rich in microtubules and F-actin. Their findings are definitely a progress in the field of Drosophila tracheal development. Having said that, how Shot links leading edge protrusions and centrosomes, how it is organized into pre-lumen tract, and how it contribute to further assembly of luminal membrane and directed secretion, are not well understood yet. Without clues to those fundamental questions, I believe this paper is most appropriate for experts readers of Drosophila cell biology and tracheal development. Finally I feel that the paper include many data sets and some pictures are not easy to grasp essential points, such as three movies showing localization of overexpressed shot-C, RFP-moesin, and Lifeact. *- Define your field of expertise with a few keywords to help the authors contextualize your point of view.* Drosophila, tracheal cell biology. *- Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.* No Reviewer #3 (Evidence, reproducibility and clarity (Required)): **Summary** In their manuscript entitled "Coordinated crosstalk between microtubules and actin by a spectraplakin regulates lumen formation and branching" Ricolo and Araujo characterize the requirement for Short Stop (Shot) in the formation of subcellular tubes in tracheal terminal cells. The authors examined embryos homozygous for shot3, a presumed null allele of shot. They found an 80% penetrant defect in seamless tube formation or growth. The phenotype resembles that reported for mutations in blistered, which encodes the Drosophila SRF ortholog. The authors find that expression of SRF is not blocked by mutations in shot and later find that bs mutants have decreased levels of shot expression and that shot overexpression can partly suppress the bs tube formation defects. The authors then examine whether the requirement for shot is autonomous to the trachea and find that it is, as pan-tracheal shot RNAi replicates the seamless tube defects. The authors find that overexpression of various Shot isoforms results in the formation of ectopic seamless tubes within terminal cells. Using the various transgenic constructs available for shot, the authors show that the overexpression phenotype is dependent upon the interaction between Shot and microtubules, and is dose-dependent. Previous work had shown that ectopic terminal cell tubes also can arise due to increased centrosome number; the authors show that centrosome number is not altered in shot mutants. Shot has well characterized actin and microtubule binding functions, and the authors show that Shot localization overlaps both with microtubules and with actin, and that both cytoskeletal elements are aberrant in shot mutant cells. In a series of experiments utilizing various shot mutant backgrounds and shot transgenes, the authors identify requirements for both Shot-cytoskeleton interactions in the formation and branching of seamless tubes in terminal cells. Finally, the authors examine the requirement for Tau in the same processes. Tau and Shot had previously been found to work together in neurons, and this seems to be true in terminal cells as well. Tau overexpression induces ectopic seamless tubes and can partially suppress shot loss of function. Embryos mutant for tau showed seamless tube directionality defects, but not lumen formation or branching. Embryos doubly mutant for tau and shot showed a more severe seamless tube defect than shot mutants alone - an increase in terminal cells with no lumen from 22% to 85%. Authors also examined terminal cells in larval stages using dsrf-Gal4 to knockdown shot in terminal cells (rather than pan-tracheal knockdown with breathless). The authors conclude from their studies that Shot, through its interactions with microtubules and the actin cytoskeleton coordinate the outgrowth and branching of subcellular tubes. Overlapping function of Tau and possibly other additional MAPs also act in these processes. The work is largely well done and the conclusions are supported by the data. **Minor concerns:** -If one were to start this work today, crispr knockout and knockins would be preferred. While shot^3 is widely considered a null allele, there are indications that some shot function is still present in shot^3 embryos. This would also be relevant to the penetrance of the defects. The transgenes are useful, but given the dosage effects noted in various of the authors experiments, interpretation of some experiments is complicated as compared to a knockin. For overexpression experiments, landing site constructs would be preferable. I do not mean to suggest that the authors necessarily go this route, but am just pointing out a limitation of the approach.

      We agree, but we also think that with the amount of data and tools generated by other labs over recent years, regarding shot function in the nervous system (Voelzmann et al 2017), we are in a position to be able to take the conclusions of this work based on these transgenic and different shot alleles.

      -Insight into function at higher resolution than altered microtubule and actin organization would significantly increase the impact. -cell autonomy (line 19, p5) is not the correct term. Pan-tracheal knockdown tests tissue autonomy. Mosaic analysis or terminal cell specific knockdown would address cell autonomy.

      We have changed the manuscript accordingly.

      -line 14 p6 acting should be actin -dsrf-Gal4 transgenes were made by Mark Metzstein

      We have corrected these.

      -there also appears to be rescue of the fusion cell defects of shot by Tau overexpression. Authors should comment on this and what it means for the seamless tubulogenesis program in terminal cells vs fusion cells.

      We will reanalyse shot rescued with tau embryos focusing on fusion phenotypes and discuss this in the revised version.

      Reviewer #3 (Significance (Required)): The findings will be of interest to a broad cell biology community as they provide a conceptual advance and may help to focus future work on seamless tubulogenesis. The authors do a good job of placing the results in the context of previous studies. *Field of expertise:* Drosophila, tracheal tubulogenesis, developmental biology

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This study provides solid evidences showing a role for the spectraplakin Short-stop (Shot) in subcellular lumen formation in the Drosophila embryonic and larval trachea. This subcellular morphogenetic process relies on an inward membrane growth that depends on the proper organization of actin and microtubules (MTs) in terminal cells (TCs). Shot depletion leads to a defective or absent lumen while conversely, Shot overexpression promotes excessive branching, independently on the regulation of centrosome numbers previously shown to be important for the regulation of the lumen formation process (Ricolo, D., Deligiannaki, M., Casanova, J. & Araújo, S. J. Centrosome Amplification Increases Single-Cell Branching in Post-mitotic Cells. Current Biology 26, 2805-2813 (2016)). Shot is rather important to regulate the organization of the cytoskeleton by crosslinking MTs and actin. Shot expression in TCs is controlled by the Drosophila Serum Response Factor (DSRF) transcription factor. Finally Shot functionally overlaps with the MT-stabilizing protein Tau to promote lumen morphogenesis.

      The figures are clear and the questions well addressed with carefully designed and controlled experiments. However, I would have few suggestions that will hopefully make some points clearer.

      Major comments:

      -Statistical analyses should be added for comparisons of proportions, including Fig. 1E, 1L, Fig. 2G-I, Fig. 6L, Fig. 7K, Fig. 8C-D and Fig. 9G.

      -It is not always clear what genotype has been used as the "wt" genotype, as in Fig. S2 or Fig. 3 for example, this should be added to figure legends.

      -Live imaging of Shot has been performed with ShotC-GFP, that cannot bind actin. Don't the authors think ShotA-GFP would reflect more accurately Shot endogenous behavior as it interacts both with actin and MTs? It would be better to show this, even if the results shown here tend to be consistent with Shot endogenous localization shown with Shot antibody staining.

      -It is of course not possible to generate CRISPR mutant flies with mutations in putative DSRF binding sites in a reasonable amount of time, to confirm that Shot transcription is controlled by DSRF. It would thus be nice to reveal shot mRNA expression with in situ hybridization experiments in wt vs. bs embryos. This would confirm that Shot mRNA is downregulated upon DSRF inhibition and rule out a possible indirect effect on Shot protein stability for example.

      -In the same figure, it would also be interesting to show what happens to actin and MTs in bs TCs and to which extent their organization is rescued by Shot overexpression.

      -UAS-EB1GFP does not seem to be an appropriate control in Figure 9 (A and B) since it can affect MT dynamics (Vitre, B. et al. EB1 regulates microtubule dynamics and tubulin sheet closure in vitro. Nat. Cell Biol. 10, 415-421 (2008)). Why not simply use an UAS-GFP?

      -Shot and probably Tau crosslinking activities are important for lumen morphogenesis with a striking increase in the number of embryos without lumen in shot3 and shot3 tauMR22 mutant embryos. The rescue experiments clearly show that Shot binding to both MT and actin is essential for efficient rescue. The same might apply to Tau since it is able to crosslink actin and MTs (Elie, A. et al. Tau co-organizes dynamic microtubule and actin networks. Sci Rep 5, 1-10 (2015)). I believe showing actin and MTs organization in these rescue experiments would be necessary.

      Second, the overexpression experiments indicate that Shot is able to induce extra lumen formation even when unable to bind actin as shown with the increase in the number of supernumerary lumina (ESLs) under overexpression of ShotC and ShotCtail to a lesser extent. This phenotype is also observed under Tau overexpression. This suggest that not crosslinking anymore but rather making MTs more stable could be sufficient to promote extra lumen formation in a wt context. Stabilising MTs by treatment with Taxol might thus be sufficient to promote ESL formation. I am fully aware of the difficulty of treating Drosophila embryos with drugs, making this experiment hard to do, but I think this dual function of Shot and Tau (crosslinking actin and MTs to promote branching vs. stabilizing MTs leading to excessive branching) should be discussed.

      Minor comments:

      -p2 line 1: 'acentrosomal luminal branching points' may be better than 'acentrosomal branching points' to describe the phenotype.

      -p4, line 16: the reference 23 is not properly inserted (should be after 'closure').

      -p5, line 16: Please mention what the abbreviations Bnl and Btn stand for.

      -p5, line 20: these 80% of TCs cells with defects in subcellular lumen formation should appear on the graph in Fig. 1E (as shown in graph 1L).

      -p5, line 26: this 36% value does not seem to correspond to anything on the graph in Fig. 1N. According to the figure legend, 20% of TCs did not elongate at all and the lumen was completely absent (class IV), which is consistent with the result shown in Fig. 1L.

      Also, I am not sure why only 25 TCs were analysed in Fig. 1N while there are the data to analyse more as shown in Fig. 1E (400 TCs), this would make the graph more representative.

      -p6, line 8: ShotA-GFP is indeed a long isoform but is not the full-length Shot, as it does not contain the plakin repeat exon which would add another ~3000aa.

      -p6, lines 21-23: ShotA-GFP localisation is not shown in FigS1. The authors should refer to Fig. 2. Enlarged areas/arrows might help the reader to better visualise the different localisations of ShotA-GFP and ShotC-GFP.

      -p7, line 23: Rca1 mutants should be better introduced here.

      -p8, line 6: Shot colocalizes/associates with stable MTs and actin would be a more appropriate title for this paragraph.

      -p16, line 18: 'Shot is able to mediate crosstalk' would be better than 'Shot is able to crosstalk'.

      -p40, lines 6 and 7: L, M and N should be K', K' and K' respectively.

      -p41, Fig 10D: It is quite hard to see on the cartoon what the phenotype is for Shot OE.

      -The following reference shows an important role for Shot in crosslinking actin and MTs during morphogenesis of the Drosophila embryo and should be cited in this manuscript (Booth, A. J. R., Blanchard, G. B., Adams, R. J. & Röper, K. A Dynamic Microtubule Cytoskeleton Directs Medial Actomyosin Function during Tube Formation. Developmental Cell 29, 562-576 (2014)).

      -FigS3. It would be good to add the labels on the figure (ShotC-GFP in green, and MoeRFP/lifeActinRFP in Magenta).

      Significance

      The findings shown in this manuscript shed an important light on the way subcellular morphogenesis occurs. It was known that both actin and MTs were required in this process, particularly during the formation of Drosophila trachea (JayaNandanan, N., Mathew, R. & Leptin, M. Guidance of subcellular tubulogenesis by actin under the control of a synaptotagmin-like protein and Moesin. Nature Communications 1-10 (2019). doi:10.1038/ncomms4036; Gervais, L. & Casanova, J. In Vivo Coupling of Cell Elongation and Lumen Formation in a Single Cell. Current Biology 20, 359-366 (2010)). This work provides additional molecular insights into the way branching morphogenesis from a single cell occurs in vivo, clearly demonstrating a requirement for actin-MT crosslinking mediated by Shot and Tau.

      This could be of great interest in the field of branching morphogenesis and lumen formation, not only in invertebrates but also in vertebrates where such a crosslinking might occur in the vasculature, the lung, the kidney or the mammary gland for example (Ochoa-Espinosa, A. & Affolter, M. Branching Morphogenesis: From Cells to Organs and Back. Cold Spring Harb Perspect Biol 4, a008243-a008243 (2012)).

      Field of expertise: morphogenesis, Drosophila, cytoskeleton, microtubules.

    1. Long, Q.-X., Tang, X.-J., Shi, Q.-L., Li, Q., Deng, H.-J., Yuan, J., Hu, J.-L., Xu, W., Zhang, Y., Lv, F.-J., Su, K., Zhang, F., Gong, J., Wu, B., Liu, X.-M., Li, J.-J., Qiu, J.-F., Chen, J., & Huang, A.-L. (2020). Clinical and immunological assessment of asymptomatic SARS-CoV-2 infections. Nature Medicine, 1–5. https://doi.org/10.1038/s41591-020-0965-6

    1. Rosenberg, E. S., Tesoriero, J. M., Rosenthal, E. M., Chung, R., Barranco, M. A., Styer, L. M., Parker, M. M., John Leung, S.-Y., Morne, J. E., Greene, D., Holtgrave, D. R., Hoefer, D., Kumar, J., Udo, T., Hutton, B., & Zucker, H. A. (2020). Cumulative incidence and diagnosis of SARS-CoV-2 infection in New York. Annals of Epidemiology. https://doi.org/10.1016/j.annepidem.2020.06.004

    1. Free B lacks r emained o verwhelmingly a gainst colonization. T heir resistance to the concept partly accounted for t he identifier “Negro” replacing “African” in common usage in the 1820s. Free Blacks theorized that i f t hey called themselves “ African,” t hey would be giv-ing credence t o the notion that t hey should be sent back to Africa. Their own racist i deas were also behind the shift i n terminology. They considered Africa and its cultural practices to be backward, having accepted r acist n otions o f t he c ontinent. S ome l ight-skinned B lacks preferred “colored,” t o separate t hemselves f rom dark-skinned Negroes or Africans.

      Negro, colored word origins.

    2. Notes on the State of Virginia was replete with other contradictory ideas about Black people. “ They are at l east as brave, and more adven-turesome” than Whites, b ecause they lacked the forethought to s ee “danger t ill i t be present,” J efferson wrote. Africans f elt l ove more, but they felt pain less, he said, and “their existence appears to participate more of sensation than reflection.” That i s why they were disposed “to sleep when abstracted from their diversions, and unemployed in labour. An animal whose body is at rest, and who does not reflect, must be disposed to sleep of course.” But on the previous page, J ef-ferson cast Blacks as requiring “less sleep. A black, after hard labour through the day, will be induced by the slightest amusements to sit up till midnight.” I n Jefferson’s vivid imagination, l azy Blacks desiredto sleep more than Whites, but, as physical s avants, t hey required l ess sleep.

      Examples of Jefferson's contradictory racist ideas about African Americans.

    1. Applications Gas chromatography is a physical separation method in where volatile mixtures are separated. It can be used in many different fields such as pharmaceuticals, cosmetics and even environmental toxins. Since the samples have to be volatile, human breathe, blood, saliva and other secretions containing large amounts of organic volatiles can be easily analyzed using GC. Knowing the amount of which compound is in a given sample gives a huge advantage in studying the effects of human health and of the environment as well. Air samples can be analyzed using GC. Most of the time, air quality control units use GC coupled with FID in order to determine the components of a given air sample. Although other detectors are useful as well, FID is the most appropriate because of its sensitivity and resolution and also because it can detect very small molecules as well. GC/MS is also another useful method which can determine the components of a given mixture using the retention times and the abundance of the samples. This method be applied to many pharmaceutical applications such as identifying the amount of chemicals in drugs. Moreover, cosmetic manufacturers also use this method to effectively measure how much of each chemical is used for their products. Equations “Height equivalent to a theoretical plate” (HETP) use to calculate the flow rate by usingthe total number of theoretical plates (N) and column length (L). Some application, HETP concepts is used in industrial practice to convert number of theoretical plates to packing height. HETP can be calculate with the Van Deemter equation, which is given by HETP=A+Bυ+Cv(1)(1)HETP=A+Bυ+Cv HETP= A + \dfrac{B}{υ} + Cv \tag{1} Where A and B and C are constants and v is the linear velocity (carrier flow rate). A is the "Eddy-Diffusion" term and causes the broadening of the solute band. B is the "Longitudinal diffusion" term whereby the concentration of the analyte, in which diffuses out from the center to the edges.This causes the broadering of the analyte band. C is the "Resistance to Mass Transfer " term and causes the band of the analyte broader. HETP=LN(2)(2)HETP=LN HETP= \dfrac{L}{N} \tag{2} L is the length of the column, where N is the number of theoretical plates, tR is the retention time, and ω is the width of the elution peak at its base. N=16(tRω)2(3)(3)N=16(tRω)2 N= 16 \left (\dfrac{tR}{ω} \right)^2 \tag{3} In which, the more plates give a better resolution and more efficiency. Resolution can be determined by   R=2[(tR)B–(tR)AWA+WB](4)(4)R=2[(tR)B–(tR)AWA+WB]R= 2\left[ \dfrac{(tR)B – (tR)A}{ WA +WB}\right] \tag{4} A relationship between the plates and resolution is giving by, R=(N)1/2/4)(α−1α)(1+K′BK′B)(5)(5)R=(N)1/2/4)(α−1α)(1+K′BK′B) R= (N)1/2 /4) ( \alpha -\dfrac{1}{\alpha}) ( 1+ \dfrac{K’B}{ K’B}) \tag{5} Where the selectivity, a, and k' is the capacity factors take places of the two solutes. The selectivity and capacity factors can be control by improving separation, such as changing mobile/ stationary phase composition, column temperature and use a special chemical effect. References Skoog, D. A.; Holler, F. J.; Crouch, S. R. Principles of Instrumental Analysis. Sixth Edition, Thomson Brooks/Cole, USA, 2007. Krugers, J. Instrumentation in Gas Chromatography. Centrex Publishing Company-Eindhoven, Netherlands, 1968. Hubschmann, H. Handbook of GC/MS: Fundamentals and Applications. Wiley-VCH Verlag, Germany, 2001. Scott, R. P. W. Chromatographic Detectors: Design, Function, and Operation. Marcel Dekker, Inc., USA, 1996. J.N. Driscoll. REview of Photoionization Detection in Gas Chromatography: The first Decade. Journal of CHromatographic Science , Vol 23. November 1985. 488-492. Boer, H. , "Vapour phase Chromatography", ed. Desty, D. H., 169 (Butterworths Sci. Pub., London, 1957). Dimbat, M. , Porter, P. E. , and Stross, F. H. , Anal. Chem., 28, 290 (1956). | Article | ISI | ChemPort | Contributors Kyaw Thet (UC Davis), Nancy Woo (UC Davis) /*<![CDATA[*/ $(function() { if(!window['autoDefinitionList']){ window['autoDefinitionList'] = true; $('dl').find('dt').on('click', function() { $(this).next().toggle('350'); }); } });/*]]>*/ /*<![CDATA[*/ var front = "auto"; if(front=="auto"){ front = "Gas Chromatography"; if(front.includes(":")){ front = front.split(":")[0]; if(front.includes(".")){ front = front.split("."); front = front.map((int)=>int.includes("0")?parseInt(int,10):int).join("."); } front+="."; } else { front = ""; } } front = front.replace(/_/g," "); MathJaxConfig = { TeX: { equationNumbers: { autoNumber: "all", formatNumber: function (n) { if(false){ return front + (Number(n)+false); } else{return front + n; } } }, macros: { PageIndex: ["{"+front+" #1}",1], test: ["{"+front+" #1}",1] }, Macros: { PageIndex: ["{"+front+" #1}",1], test: ["{"+front+" #1}",1] }, SVG: { linebreaks: { automatic: true } } } }; MathJax.Hub.Config(MathJaxConfig); MathJax.Hub.Register.StartupHook("End", ()=>{if(activateBeeLine)activateBeeLine()}); /*]]>*/ /*<![CDATA[*/window.addEventListener('load', function(){$('iframe').iFrameResize({warningTimeout:0, scrolling: 'omit'});})/*]]>*/ Back to top Chromatography High Performance Liquid Chromatography Recommended articles There are no recommended articles. 3.1: Principles of Gas ChromatographyNowadays, gas chromatography is a mature technique, widely used worldwide for the analysis of almost every type of organic compound, even those that a...10.23: ChromatographyChromatography is an efficient way for chemists to separate and analyze mixtures. Read on to find out how this critical process works.2.4: Gas Chromatography (GC)Gas chromatography (GC) is a powerful instrumental technique used to separate and analyze mixtures. A gas chromatograph is a standard piece of equipme...2.4D: Quantitating with GCPeak integrations are useful because it is possible to correlate the area under a peak to the quantity of material present in a sample. Note it is the...2.4A: Overview of GCGas chromato

      application

    1. Goldman, P. S., Ijzendoorn, M. H. van, Sonuga-Barke, E. J. S., Goldman, P. S., Ijzendoorn, M. H. van, Bakermans-Kranenburg, M. J., Bradford, B., Christopoulos, A., Cuthbert, C., Duchinsky, R., Fox, N. A., Grigoras, S., Gunnar, M. R., Ibrahim, R. W., Johnson, D., Kusumaningrum, S., Ken, P. L. A., Mwangangi, F. M., Nelson, C. A., … Sonuga-Barke, E. J. S. (2020). The implications of COVID-19 for the care of children living in residential institutions. The Lancet Child & Adolescent Health, 0(0). https://doi.org/10.1016/S2352-4642(20)30130-9

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      R-We would like to thank the reviewers for their constructive feedback. We respond to all the reviewers points below. We highlighted major changes introduced to the manuscript in response to both reviewers’ comments in the attached revised version of the manuscript.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The work described in this manuscript by Tan and Marques aims to address if the splicing of enhancer-associated long noncoding RNAs (elncRNAs) has a direct impact on enhancer activity or just reflects their cognate's enhancer's high activity.

      For this purpose, the authors started by integrating RNA-seq data for human lymphoblastoid cell lines with ENCODE enhancer annotations and ChIP-seq data for enhancer function-associated chromatin modifications to show that multi-exonic elncRNAs are more transcriptionally active than single-exonic elncRNAs and eRNAs. They then show that regions flanking elncRNA splice sites are enriched in splicing-associated sequence elements and that these are under stronger purifying selection (suggesting some functional relevance), both when compared to promoter-associated lncRNAs. They also show the concomitance of cis-disrupted splicing in elncRNAs and drops in expression in their target genes. Finally, they use causal inference analysis of joint seQTLs and joint scQTLs to investigate the causal relationship between splicing of elncRNAs and expression of putative gene targets and chromatin states at elncRNA cognate enhancers, respectively. They conclude that, in both cases, most associations are causally mediated by splicing of elncRNAs and therefore that this contributes to their enhancer activity.

      This manuscript is generally well written, targets an original question and potentially sets the seeds for a new exciting line of research on transcriptional regulation, by providing some evidence for the functional relevance of the splicing of elncRNAs. However, the overlooking of some important aspects of the regulation of RNA splicing led to biases in the design of data analyses and in the interpretation of the biological implications of some results that need to be dealt with before the described work can be considered sound enough for publication.

      R:We would like to thank the reviewer for taking the time to assess our manuscript and for the constructive comments.

      **Essential revisions:**

      1.Results, page 10, lines 21-24: The statement that "the impact of SS variants on gene splicing efficiency depends on the total number of alternative transcripts and exons" is not properly substantiated. The four examples given in Figure S3 do not illustrate any dependence or trend. If such dependence is "expected" the underlying concept must be explained, i.e. why the impact of SS variants on splicing efficiency should depend on the number of alternative transcripts and exons. The reader is unrealistically expected to be used to the chosen splicing efficiency metric to intuit its dependence on the number of exons. Moreover, it is not obvious where the dependence on the number of alternative transcripts comes from, particularly given that alternative splicing (e.g. the skipping of a neighbouring exon, if internal) is not profiled.

      R-In the previous version of the manuscript, we estimated gene level changes in splicing, which includes all alternative splicing events within a gene. Therefore, the more exons an elncRNA has, the more “diluted” we expect the overall impact of SS variant on elncRNA splicing efficiency to be. After considering the reviewer’s comment, we realized that only splicing events directly impacted by the SS variant should be considered in this analysis.

      In the revised version of the manuscript, we considered only alternative splicing events that include the splice donor acceptor site changed by the SS variant, and are therefore a direct consequence, of the SS variant. As suggested by the reviewer, for these splicing events, we report the fold difference in Percentage-Spliced-In (PSI) (estimated by Leafcutter (Li et al. 2018)) between samples that carry reference and alternative alleles at these SS variants. To further illustrate these changes, we now include a diagram, for each SS variant, with differential splicing information and the fold difference in PSI for each affected splicing events (Figure 3B,C, Supplementary Figure S3). In addition, the overall change across all affected splicing events is also plotted in Figure 3D and Supplementary Figure S4.

      We have modified this section to account for this and the next comment from the reviewer.

      To estimate the impact of SS variant on splicing efficiency, we calculated the Percentage-Spliced-In (PSI) (Li et al. 2018) per individual and for each elncRNA splicing event involving the splice donor or acceptor site disrupted by the SS variants (Figure 3B,C, Supplementary Figure S3). PSI measures exon inclusion and considers spliced reads spanning exon junctions (Li et al. 2018). We compared the average difference in PSI, as a proxy for change in splicing efficiency, of all affected splicing events between individuals that carry the reference and alternative canonical splice donor/acceptor sites (GT-AG). Alongside decreased exon inclusion, SS variants can also promote exon skipping events (Figure 3B,C, Figure S3). Despite some increase in exon skipping, SS variants are associated with an overall decrease in splicing efficiency (Figure 3D and Supplementary Figure S4).” (Page 10).

      Along these same lines, and more importantly, why haven't the authors looked at the possibility that a variant disrupting a splice site would lead to skipping of the neighbouring exon (if internal)? Given how the spliceosome operates (in terms of intron and exon recognition), wouldn't this be the most likely scenario? When calculating the splicing index, are reads spanning junctions between non-consecutive exons considered? Otherwise, not profiling alternative isoforms generated by exon skipping will necessarily bias splicing efficiency quantifications by overlooking fully efficient splicing associated with such isoforms. Similarly, how did the authors make sure that splicing changes did not bias elncRNA expression estimates? How was the effective transcript length determined for the calculation of RPKMs? The authors need to make these methodological clarifications, as well as why exon skipping was not considered as a splicing disruption with potential functional implications. Calculating the percent spliced-in (PSI) for all internal exons would be much informative.

      R-Regarding the methodology, what we refer to as splicing efficiency is Percentage-Spliced-In (PSI). We calculated PSI for all, including alternative, splicing events. We now make this clearer throughout the manuscript and in the figure axis/legends.

      As detailed in the methods section, to minimize the impact of alternative splicing on gene expression estimates, we quantified expression at the gene, and not at the transcript, level using HTSeq across all annotated exons. This approach allows us to assess elncRNA and target gene expression while masking differences in alternative transcript abundance, which are not relevant in the context of this analysis.

      As suggested by the reviewer, instead of considering PSI of all possible splicing events of the gene, in the revised version of the manuscript, we considered only splicing events that are directly impacted by the SS variant. This change does not impact our conclusions, but certainly provides a better understanding of how SS variants impact splicing and we would like to thank the reviewer for raising this point. As predicted by the reviewer and as expected given how the spliceosome operates, exon skipping is a frequent outcome of SS variants. However, the increase in exon skipping is not sufficient to compensate for the decrease in the inclusion of these exons, which is directly impacted by the SS variants. This is demonstrated by the lower overall splicing efficiency for each elncRNAs in individuals that carry SS variants that disrupt canonical splice/donor acceptor sites (Figure 3D and Supplementary Figure S4).

      3.All results in panels 3B-F are presented as fold differences. It is actually not clear what those differences refer to. For instance, the grey boxes are the distributions of the fold differences in splicing index / expression between individuals carrying reference alleles and what?

      R-The boxplots represent the distribution of the fold difference in PSI or expression for each individual relative to the median PSI or expression in individuals with the reference genotype. As expected, the distribution of log fold difference in either PSI or expression for individuals carrying the reference allele is centered at 0.

      We have clarified this in the methods section and figure legends.

      4.It is expectable that most joint seQTLs result from variants directly impacting splicing in cis. As the quantification of splicing is noisier than that of expression, a stronger effect is required for the detection of an sQTL than an eQTL. In other words, joint seQTLs are essentially sQTLs. This illustrated by the example in Figure 4A, with the SNP in an intronic region of the elncRNA being associated with strong differences in splicing and tiny (R-We agree with the reviewer that the quantification of splicing is noisier than that of expression. However, and in contrast with the reviewer’s hypothesis, higher “noise” in splicing quantification compared to expression led to weaker associations between splicing and seQTLs, as illustrated in the figure below. This is in line with splicing being measured with higher error rate, which would ultimately lead to smaller detectable sQTL effect than what they would be with perfect measurements. This also demonstrates that since a priori, eQTLs association are stronger, if a bias exists in the causal inference analysis, it should favour detection of non-causal associations. Therefore, our approach is not biased in detecting causal seQTLs.

      We agree with the reviewer that this potential bias may be a concern to readers and should be addressed. We have added this analysis to the text (Supplementary Figure S7E) and explained why the causal inference testing approach is not biased in detecting causal seQTLs.

      “To assess whether this approach was biased towards the detection of causal seQTLs we compared the slope and adjusted p-value of the associations between the variant and splicing or expression for all causal seQTLs. As illustrated in Supplementary Figure S7E this analysis revealed there is no evidence that stronger sQTLs would favour causal model predictions.” (Page 16).

      5.It is not totally clear what message the authors intend to convey with the result of panel 4D. Are they talking about the relative position of the variant to the elncRNA transcript or the target transcript? If the former, shouldn't the known synergy between transcription and 5´ end splicing reflect on elncRNA expression? If the latter, it is not obvious how the result connects to the mentioned synergy.

      R:In Figure 4D, we show the relative position, within a transcript, of the exonic splicing junction which is associated with causal seQTLs. The enrichment in associations with splicing junctions located at 5’ end of elncRNAs is consistent with the synergy between 5’ end splicing and transcription. We clarify this in the text:

      Importantly, 90% of seQTL associations that support elncRNA splicing as a mediator of target expression are associated with splicing junctions located at the 5´ end of the transcript, which is consistent with the known synergy between transcription and 5´ end splicing (Furger et al. 2002; Damgaard et al. 2008)(Figure 4D).” (Page 17).

      **Proofreading edits:**

      R:We would like to thank the reviewer for identifying all the typos listed below. We have corrected them in the revised version of the manuscript.

      6.Introduction, page 3, line 13: double "in".

      7.Figure S2A, leftmost panel X-axis label: "intrno" instead of "intron".

      8.Results, page 10, line 30: remove "of".

      9.It is 5´ and 3´(prime) not 5' and 3' (apostrophe).

      **Other suggestions:**

      10.Violin plots (with included boxplots) would more comprehensively convey the differences in distributions than the chosen notched boxplots.

      R-We thank the reviewer for this suggestion. Although we appreciate the added information a violin plot can provide, this also renders, in our opinion, their interpretation less intuitive. Because boxplots are simpler and easier to interpret, after consideration, we decided to continue using these to represent the distribution of the data.

      Reviewer #1 (Significance (Required)):

      It is hard for me to assess the significance of this work (beyond some evidence for the potential functional relevance of the splicing of elncRNAs) until the aforementioned concerns are addressed but it is of potential interest to the broad RNA research community.

      I am a computational biologist with experience in the analysis of high-throughput transcriptomic data and a focus on transcriptional and alternative splicing regulation.

      ========================================================================

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      This manuscript addresses an interesting question - whether the splicing of transcriptional enhancer-associated RNAs influences their transcriptional enhancement activity. The analyses appear carefully done, using appropriate datasets and statistical methods. The authors find, for example, that marks of active chromatin are enriched near spliced elncRNAs, that splicing-related motifs of elncRNAs are under selective constraint, and that splicing of elncRNAs is associated with higher elncRNA expression and to very slightly higher expression of target genes.

      R:We thank the reviewer for the constructive feedback on our manuscript. We have extended our analysis to address the reviewers concerns that we detail in our response to the comments below.

      However, I did not find the main results convincing of the main conclusion for the following reasons:

      1.The most direct evidence is shown in Figure 3, where SNPs that occur in 3' splice sites of elncRNA introns are explored, and it is shown that variants predicted to disrupt splicing of elncRNA introns are associated with reduced expression of target but not non-target genes. But the fold difference in expression of target genes is extremely small - a few percent - and is actually less than the fold difference in expression of the elncRNAs themselves (which appears closer to 10%), raising the question of whether elncRNA expression rather than splicing may be more important for activity. Furthermore, the entire analysis has an anecdotal quality, being based on only 4 splice-disrupting elncRNA variants. I did not find the figure at all convincing of the conclusion the authors draw from it.

      R:We agree with the reviewer that our analysis is limited by the available genotyping data that is restricted to common genetic variants. Our evolutionary constraint analysis (Figure 2) indicates that variants that disrupt elncRNA splicing are depleted by natural selection and so we expected to identify a relatively small number of elncRNAs (n=4) suitable for this analysis. Despite the anticipated challenges in identifying elncRNA splice site mutations, we nevertheless believe this unbiased natural mutational analysis is analogous to experimentally disrupting splice sites of these 4 elncRNA candidates.

      Regarding the strength of impact of splicing on target expression: in the absence of a comparable experiment, we could not anticipate the magnitude of the effect. We acknowledge that previous studies, which sought to completely remove splicing by either deleting all elncRNA introns (Yin et al. 2015) or terminating transcription after its 1st exon (Engreitz et al. 2016), were both associated with significantly stronger impact on elincRNA splicing and target expression than what we report here. The analysis we present here involves single nucleotide polymorphisms and so it is not surprising to have resulted in more moderate impact on overall splicing. Furthermore, whether the differences in the impact on target expression between this and previous analysis is the result of stronger effect of complete removal of splicing or a consequence of the genetic changes introduced remains unclear. The small yet consistent decrease in target expression we observed, even with minimal changes in splicing of an unbiased set of 4 candidates, is in our opinion strong evidence that modulation in elncRNA splicing is sufficient to impact, albeit moderately, target expression.

      Importantly, we replicated the impact of decreased splicing on target expression of the 4 elncRNA candidates using 89 samples of Yoruba (YRI) population from the Geuvadis dataset (Supplementary Figure S5). The robustness of the mutational study consistently supports the physiologically relevant effect of elncRNA splicing on cognate enhancer function.

      As pointed out by the reviewer, elncRNA SS variants led to stronger impact on the expression of the elncRNAs compared to that of their targets (Figure 3F,H and Supplementary Figure S4), which suggests that target expression regulation is likely a consequence of changes in elncRNA expression as a result of changes in its splicing. This is described as our working model in the discussion section of the manuscript.

      2.Figure 4 uses a causal inference approach and involves larger datasets. While causal inference can be a useful tool to identify candidate causal relationships, it does not prove causality, which still requires some sort of experimental perturbation. Thus, I found these results suggestive but still not satisfying to justify, e.g., the title of the paper or claims made in the abstract. As in Figure 3, the specific example shown in Fig. 4A again shows a relatively tiny effect on target gene expression, which again appears to be a few percent at most.

      R:For the reasons explained above, we had no expectation that the effect size of the association between elncRNA splicing and target expression would be high. It is nevertheless key that these associations are robust, which would provide reliable support for our hypothesis. To assess this, we used 2 independent datasets to replicate elncRNA target associations with sQTL variants associated with elncRNA splicing: 1) 147 LCL samples from GTEx and 2) 31,684 blood samples from eQTLgen. Using these datasets, we replicated the association between sQTL and target expression for targets of up to 77% of elncRNAs. As expected, replicated associations have significantly higher effect size in both datasets (Supplementary Figure S9) and 1.2 times more associations can be replicated in the eQTLgen blood samples with a larger cohort size. LCL-specific effect of elncRNA splicing likely explains why not all associations are replicated in these blood samples. We report these analyses in the manuscript (Supplementary Figure S9).

      We agree with the reviewer that the causal inference analysis is only suggestive per se. However, we would argue that conclusions of the present manuscript do not rely on this analysis alone, but instead on the combined evidence of several experiments, including the natural mutational analysis that is analogous to the experiment the reviewer proposes.

      Considering the reviewers concern, we realized that previous version of Figure 4A did not reflect the average strength of the association between seQTL variant and target expression (median=0.319, ranging from 0.16 to 0.81, Rebuttal Figure 1). For this reason, we replaced the previous illustration by a more representative example (Figure 4A).

      The text illustrating reproducibility of our results in GTEx and eQTLgen have been added to Page 17 of the manuscript.

      We used two independent datasets to assess the robustness of elncRNA target association with sQTL variants we predict to be associated with the splicing of these elncRNAs in LCLs. Using a smaller cohort of LCLs (n=147 (GTEx Consortium 2013)), we found a significant association in the same direction between sQTL and target expression for targets of 70% of elncRNAs (45% of variants). A larger fraction of associations (77% of elncRNAs and 52% of variants) could be replicated in a larger cohort of blood samples (n=31,684 (Võsa et al. 2018)). The difference in size between these two cohorts is likely to explain the difference in replication rate. The association between elncRNA splicing variants and target expression that were replicated have significantly higher effect size relative to non-replicated associations (Supplementary Figure S9). Furthermore, LCL-specific effect also likely explains why not all associations can be replicated in the large blood cohort.” (Page 17).

      3.Figure 2 shows that splicing-related signals are under selective constraint in spliced elncrRNAs, which is convincing. But this does not prove that splicing of elncRNAs is directly related to enhancer activity. It is equally plausible that elncRNA expression directly impacts enhancer activity and that elncRNA splicing is conserved because it boost elncRNA expression, for example.

      R:The reviewer is right and the sentence “If splicing of elncRNAs is important for enhancer function, …” does not faithfully describe the conclusions that can be drawn from the analysis reported in Figure 2. This portion of the text now reads: “If splicing of elncRNAs is functionally relevant, one would expect selection to have prevented the accumulation of deleterious mutations in their splicing-associated motifs during evolution” (Page 8). We would like to thank the reviewer for pointing this out.

      Other points:

      4.Are the ChiP profiles in Figures 1A-E significantly different from each other in a statistical sense? Probably yes, but a specific test should be done.

      R:We now added boxplots representing the distribution of read density centered at transcript promoters. Statistical difference in the distribution is also tested. We show this in the revised Figure 1A-E and Supplementary Figure S1B-C.

      5.This sentence (p. 10) was hard to follow and should be clarified: "As expected, the impact of SS variants on gene splicing efficiency depends on the total number of alternative transcripts and exons and ranges from 11% to 24% for elncRNA with 6 to 2 number of exons, respectively (Supplementary Figure S3)."

      R:We had previously estimated the average amount of change in splicing for all alternative splicing events at each elncRNA candidate. To calculate this, we considered the difference in Percentage-Spliced-In (PSI) for all splicing events and divided this by the total number of considered events. Given that only a subset of events is affected by a splice site variant, the more exons an elncRNA has, the more alternative splicing events are likely to occur and the lower the average impact of a SS variant on overall gene splicing efficiency is expected to be. Following a comment from reviewer 1 (comment 1), we now only consider splicing events directly disrupted by the SS variant. We agree this sentence was not clear and have removed it from the manuscript.

      6.Related to point 5 above, Supplementary Figure 3 is somewhat confusing because two splicing change and three expression change plots are shown for each locus, without labels of what each one is, or explanation of what the red and green colors mean.

      R:We apologize for the confusion and thank the reviewer for pointing this out. In the figure, we plot the fold difference in elncRNA splicing, target gene splicing, target gene expression, non-target gene expression, and elncRNA expression. elncRNA features are plotted in red and target gene features are plotted in green. We have added labels to clarify the relevant plots (Figure 3D-H, Supplementary Figure S4,5).

      **Minor points:**

      1.Top of p. 16: "90% of those that support elncRNA splicing as a mediator 3 of target expression are located at the 5' end of the transcript, which is 4 consistent with the known synergy between transcription and 5' end splicing" - a reference is needed

      R:We thank the reviewer for pointing this out and we have now added the appropriate reference.

      Importantly, 90% of seQTL associations that support elncRNA splicing as a mediator of target expression are associated with splicing junctions located at the 5´ end of the transcript, which is consistent with the known synergy between transcription and 5´ end splicing (Furger et al. 2002; Damgaard et al. 2008)(Figure 4D).” (Page 17)

      2.Figure 5B,C y-axes indicate "fold difference", but scales include negative numbers, which is confusing. Probably should redo the analysis showing log of fold difference.

      R:We thank the reviewer for the suggestion. Since the fold difference in Percentage-Spliced-In (PSI) used to estimate the amount of splicing at each exon junction can be of both positive and negative values, we now plot the log modulus transformation (John and Draper, 1980) of the data, which is equivalent to a log transformation while preserving the sign of the data. The analysis has been redone for Figure 3D-H, 5B,C, and Supplementary Figure S4, S5. This change does not impact the conclusions and makes the interpretation of the results more intuitive.

      3.p. 20 Describes U1 snRNP as "a protein essential for the 4 recognition of nascent RNA 5' splice site and assembly of the spliceosome". U1 is a large RNA-protein complex, not a protein.

      R:We thank the reviewer for pointing this out and this has now been corrected.

      Chromatin-bound lncRNAs have been recently shown to be enriched in U1 small nuclear ribonucleoprotein (snRNP) RNA-protein complex, a protein essential for the recognition of nascent RNA 5´ splice site and assembly of the spliceosome (Yin et al. 2020).” (Page 22)

      4.Typo: p. 11, l. 2 missing word (genes): "expression levels of other nearby was unaffected"

      R:This has been corrected.

      Reviewer #2 (Significance (Required)):

      The question addressed is very interesting, given recent work the significance of transcription from enhancers, and work addressing functional relationships between splicing and expression. The work is suggestive of effects of enhancer splicing on expression but I did not find it fully convincing as the effects observed are extremely small, and other explanations are not ruled out, as discussed above.

      Prior literature has shown that many active enhancers are transcribed, that enhancer transcription can preced and is positively correlated with target gene expression, and work from both Ulitsky and from the authors indicates that splicing of enhancer-associated lncRNAs is positively correlated with enhancer activity. A variety of studies have also shown that splicing of protein-coding genes generally has a strong positive effect on gene expression. Here, the authors attempt to go further and show that splicing of enhancers causes increased transcriptional enhancement of target genes. A variety of public genotype, expression, chromatin and other types of data are analyzed to address this question. The statistical genetics crowd may find the work of interest, but molecular biologists will not be convinced of the conclusions. My expertise is in computational biology, genomics and RNA biology.

      Engreitz JM, Haines JE, Perez EM, Munson G, Chen J, Kane M, McDonel PE, Guttman M, Lander ES. 2016. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature 539: 452-455.

      John, J., & Draper, N. (1980). An Alternative Family of Transformations. Journal of the Royal Statistical Society. Series C (Applied Statistics), 29(2), 190-197. doi:10.2307/2986305

      Li YI, Knowles DA, Humphrey J, Barbeira AN, Dickinson SP, Im HK, Pritchard JK. 2018. Annotation-free quantification of RNA splicing using LeafCutter. Nature genetics 50: 151-158.

      Yin Y, Yan P, Lu J, Song G, Zhu Y, Li Z, Zhao Y, Shen B, Huang X, Zhu H et al. 2015. Opposing Roles for the lncRNA Haunt and Its Genomic Locus in Regulating HOXA Gene Activation during Embryonic Stem Cell Differentiation. Cell stem cell 16: 504-516.

    1. Clark, A., Jit, M., Warren-Gash, C., Guthrie, B., Wang, H. H. X., Mercer, S. W., Sanderson, C., McKee, M., Troeger, C., Ong, K. L., Checchi, F., Perel, P., Joseph, S., Gibbs, H. P., Banerjee, A., Eggo, R. M., Nightingale, E. S., O’Reilly, K., Jombart, T., … Jarvis, C. I. (2020). Global, regional, and national estimates of the population at increased risk of severe COVID-19 due to underlying health conditions in 2020: A modelling study. The Lancet Global Health, S2214109X20302643. https://doi.org/10.1016/S2214-109X(20)30264-3

    1. Marshall, J. C., Murthy, S., Diaz, J., Adhikari, N., Angus, D. C., Arabi, Y. M., Baillie, K., Bauer, M., Berry, S., Blackwood, B., Bonten, M., Bozza, F., Brunkhorst, F., Cheng, A., Clarke, M., Dat, V. Q., de Jong, M., Denholm, J., Derde, L., … Zhang, J. (2020). A minimal common outcome measure set for COVID-19 clinical research. The Lancet Infectious Diseases, S1473309920304837. https://doi.org/10.1016/S1473-3099(20)30483-7

    1. Barry, D., Buchanan, L., Cargill, C., Daniel, A., Delaquérière, A., Gamio, L., Gianordoli, G., Harris, R., Harvey, B., Haskins, J., Huang, J., Landon, S., Love, J., Maalouf, G., Matthews, A., Mohamed, F., Moity, S., Royal, D.-C., Ruby, M., & Weingart, E. (2020, May 27). Remembering the 100,000 Lives Lost to Coronavirus in America. The New York Times. https://www.nytimes.com/interactive/2020/05/24/us/us-coronavirus-deaths-100000.html

    1. References1. World Population Ageing 2007. New York: United Nations; 2007. [2015-11-13]. webcite Magnitude and speed of population ageing http://www.un.org/en/development/desa/population/publications/pdf/ageing/WorldPopulationAgeingReport2007.pdf. [Google Scholar]2. Victor C, Bowling A, Bond J, Scambler S. Loneliness, social isolation and living alone in later life. Sheffield, UK: University of Sheffield: Economic and Social Research Council Growing Older Programme; 2003. [Google Scholar]3. Iliffe S, Kharicha K, Harari D, Swift C, Gillmann G, Stuck AE. Health risk appraisal in older people 2: the implications for clinicians and commissioners of social isolation risk in older people. Br J Gen Pract. 2007 Apr;57(537):277–82. http://bjgp.org/cgi/pmidlookup?view=long&pmid=17394730. [PMC free article] [PubMed] [Google Scholar]4. Tomaszewski W, Barnes M. Banks J, Breeze E, Lessof C, Nazroo J. editors. Living in the 21st century: older people in England. The 2006 English Longitudinal Study of Ageing (wave 3) London: Institute of Fiscal Studies; 2008. Investigating the dynamics of social detachment in old age; pp. 150–185. [Google Scholar]5. Hawthorne G. Measuring Social Isolation in Older Adults: Development and Initial Validation of the Friendship Scale. Soc Indic Res. 2006 Feb 13;77(3):521–548. doi: 10.1007/s11205-005-7746-y. [CrossRef] [Google Scholar]6. Hawthorne G. Perceived social isolation in a community sample: its prevalence and correlates with aspects of peoples' lives. Soc Psychiatry Psychiatr Epidemiol. 2008 Feb;43(2):140–150. doi: 10.1007/s00127-007-0279-8. [PubMed] [CrossRef] [Google Scholar]7. Saito M, Fujiwara Y, Kobayashi E, Fukaya T, Nishi M, Shinkai S. [Prevalence and characteristics of social isolation in the elderly in a dormitory suburb according to household composition] Nihon Koshu Eisei Zasshi. 2010 Sep;57(9):785–795. [PubMed] [Google Scholar]8. Cornwell EY, Waite LJ. Social disconnectedness, perceived isolation, and health among older adults. J Health Soc Behav. 2009 Mar;50(1):31–48. http://europepmc.org/abstract/MED/19413133. [PMC free article] [PubMed] [Google Scholar]9. Mulvaney-Day NE, Alegría M, Sribney W. Social cohesion, social support, and health among Latinos in the United States. Soc Sci Med. 2007 Jan;64(2):477–495. doi: 10.1016/j.socscimed.2006.08.030. http://europepmc.org/abstract/MED/17049701. [PMC free article] [PubMed] [CrossRef] [Google Scholar]10. Fiori KL, Smith J, Antonucci TC. Social network types among older adults: a multidimensional approach. J Gerontol B Psychol Sci Soc Sci. 2007 Nov;62(6):P322–P330. [PubMed] [Google Scholar]11. Kharicha K, Iliffe S, Harari D, Swift C, Gillmann G, Stuck AE. Health risk appraisal in older people 1: are older people living alone an “at-risk” group? Br J Gen Pract. 2007 Apr;57(537):271–276. http://bjgp.org/cgi/pmidlookup?view=long&pmid=17394729. [PMC free article] [PubMed] [Google Scholar]12. Dorfman RA, Lubben JE, Mayer-Oakes A, Atchison K, Schweitzer SO, De Jong FJ, Matthias RE. Screening for depression among a well elderly population. Soc Work. 1995 May;40(3):295–304. [PubMed] [Google Scholar]13. Hanson BS. Social network, social support and heavy drinking in elderly men--a population study of men born in 1914, Malmö, Sweden. Addiction. 1994 Jun;89(6):725–732. [PubMed] [Google Scholar]14. Eng PM, Rimm EB, Fitzmaurice G, Kawachi I. Social ties and change in social ties in relation to subsequent total and cause-specific mortality and coronary heart disease incidence in men. Am J Epidemiol. 2002 Apr 15;155(8):700–709. http://aje.oxfordjournals.org/cgi/pmidlookup?view=long&pmid=11943687. [PubMed] [Google Scholar]15. Berkman LF, Glass T, Brissette I, Seeman TE. From social integration to health: Durkheim in the new millennium. Soc Sci Med. 2000 Sep;51(6):843–857. [PubMed] [Google Scholar]16. Locher JL, Ritchie CS, Roth DL, Baker PS, Bodner EV, Allman RM. Social isolation, support, and capital and nutritional risk in an older sample: ethnic and gender differences. Soc Sci Med. 2005 Feb;60(4):747–761. doi: 10.1016/j.socscimed.2004.06.023. http://europepmc.org/abstract/MED/15571893. [PMC free article] [PubMed] [CrossRef] [Google Scholar]17. Havens B, Hall M. Social isolation, loneliness, and the health of older adults in Manitoba, Canada. Indian J Gerontol. 2001;1(15):126–144. [Google Scholar]18. Boden-Albala B, Litwak E, Elkind MSV, Rundek T, Sacco RL. Social isolation and outcomes post stroke. Neurology. 2005 Jun 14;64(11):1888–1892. doi: 10.1212/01.WNL.0000163510.79351.AF. [PubMed] [CrossRef] [Google Scholar]19. Sum S, Mathews MR, Pourghasem M, Hughes I. Internet technology and social capital: How the Internet affects seniors' social capital and wellbing. J Comput Mediat Commun. 2008;14(1):202–220. doi: 10.1111/j.1083-6101.2008.01437.x. [CrossRef] [Google Scholar]20. Dickens AP, Richards SH, Greaves CJ, Campbell JL. Interventions targeting social isolation in older people: a systematic review. BMC Public Health. 2011;11:647. doi: 10.1186/1471-2458-11-647. http://www.biomedcentral.com/1471-2458/11/647. [PMC free article] [PubMed] [CrossRef] [Google Scholar]21. Cattan M, White M, Bond J, Learmouth A. Preventing social isolation and loneliness among older people: a systematic review of health promotion interventions. Ageing and Society. 1999;25(1):41–67. doi: 10.1017/S0144686X04002594. [CrossRef] [Google Scholar]22. Nicholson NR. Social isolation in older adults: an evolutionary concept analysis. J Adv Nurs. 2009 Jun;65(6):1342–1352. doi: 10.1111/j.1365-2648.2008.04959.x. [PubMed] [CrossRef] [Google Scholar]23. Wenger GC, Burholt V. Changes in levels of social isolation and loneliness among older people in a rural area: a twenty-year longitudinal study. Can J Aging. 2004;23(2):115–127. [PubMed] [Google Scholar]24. Findley RA. Interventions to reduce social isolation amongst older people: where is the evidence? Ageing and Society. 2003;23(5):647–658. doi: 10.1017/S0144686X03001296. [CrossRef] [Google Scholar]25. Morris ME, Adair B, Ozanne E, Kurowski W, Miller KJ, Pearce AJ, Santamaria N, Long M, Ventura C, Said CM. Smart technologies to enhance social connectedness in older people who live at home. Australas J Ageing. 2014 Sep;33(3):142–152. doi: 10.1111/ajag.12154. [PubMed] [CrossRef] [Google Scholar]26. Quality Assessment Tool for Quantitative Studies: Effective Public Health Practice Project. 2009. [2015-05-01]. webcite http://www.ephpp.ca/PDF/Quality%20Assessment%20Tool_2010_2.pdf.27. Salmon P. Assessing the quality of qualitative research. Patient Educ Couns. 2013 Jan;90(1):1–3. doi: 10.1016/j.pec.2012.11.018. [PubMed] [CrossRef] [Google Scholar]28. Lipsey MW, Wilson DB. Practical meta-analysis. Thousand Oaks, Calif: Sage; 2001. [Google Scholar]29. Clark DJ. Older adults living through and with their computers. Comput Inform Nurs. 2002;20(3):117–124. [PubMed] [Google Scholar]30. Fokkema T, Knipscheer K. Escape loneliness by going digital: a quantitative and qualitative evaluation of a Dutch experiment in using ECT to overcome loneliness among older adults. Aging Ment Health. 2007 Sep;11(5):496–504. doi: 10.1080/13607860701366129. [PubMed] [CrossRef] [Google Scholar]31. Mellor D, Firth L, Moore K. Can the Internet improve the well-being of the elderly? Ageing Int. 2008 Feb 9;32(1):25–42. doi: 10.1007/s12126-008-9006-3. [CrossRef] [Google Scholar]32. Nahm ES, Resnick B, Mills ME. A model of computer-mediated social support among older adults. AMIA Annu Symp Proc. 2003:948. http://europepmc.org/abstract/MED/14728453. [PMC free article] [PubMed] [Google Scholar]33. Richardson M, Weaver CK, Zorn Jr TE. 'Getting on': older New Zealanders' perceptions of computing. New Media & Society. 2005 Apr 01;7(2):219–245. doi: 10.1177/1461444805050763. [CrossRef] [Google Scholar]34. Savolainen L, Hanson E, Magnusson L, Gustavsson T. An Internet-based videoconferencing system for supporting frail elderly people and their carers. J Telemed Telecare. 2008;14(2):79–82. doi: 10.1258/jtt.2007.070601. [PubMed] [CrossRef] [Google Scholar]35. Shapira N, Barak A, Gal I. Promoting older adults' well-being through Internet training and use. Aging Ment Health. 2007 Sep;11(5):477–484. doi: 10.1080/13607860601086546. [PubMed] [CrossRef] [Google Scholar]36. Slegers K, van Boxtel MPJ, Jolles J. Effects of computer training and Internet usage on the well-being and quality of life of older adults: a randomized, controlled study. J Gerontol B Psychol Sci Soc Sci. 2008 May;63(3):P176–P184. [PubMed] [Google Scholar]37. Sum S, Mathews RM, Hughes I, Campbell A. Internet use and loneliness in older adults. Cyberpsychol Behav. 2008 Apr;11(2):208–211. doi: 10.1089/cpb.2007.0010. [PubMed] [CrossRef] [Google Scholar]38. Torp S, Hanson E, Hauge S, Ulstein I, Magnusson L. A pilot study of how information and communication technology may contribute to health promotion among elderly spousal carers in Norway. Health Soc Care Community. 2008 Jan;16(1):75–85. doi: 10.1111/j.1365-2524.2007.00725.x. [PubMed] [CrossRef] [Google Scholar]39. White H, McConnell E, Clipp E, Branch LG, Sloane R, Pieper C, Box TL. A randomized controlled trial of the psychosocial impact of providing internet training and access to older adults. Aging Ment Health. 2002 Aug;6(3):213–221. doi: 10.1080/13607860220142422. [PubMed] [CrossRef] [Google Scholar]40. Aarts S, Peek STM, Wouters EJM. The relation between social network site usage and loneliness and mental health in community-dwelling older adults. Int J Geriatr Psychiatry. 2015 Sep;30(9):942–949. doi: 10.1002/gps.4241. [PubMed] [CrossRef] [Google Scholar]41. Blažun H, Saranto K, Rissanen S. Impact of computer training courses on reduction of loneliness of older people in Finland and Slovenia. Computers Hum Behav. 2012 Jul;28(4):1202–1212. doi: 10.1016/j.chb.2012.02.004. [CrossRef] [Google Scholar]42. Cattan M, Kime N, Bagnall A. The use of telephone befriending in low level support for socially isolated older people--an evaluation. Health Soc Care Community. 2011 Mar;19(2):198–206. doi: 10.1111/j.1365-2524.2010.00967.x. [PubMed] [CrossRef] [Google Scholar]43. Cotten SR, Anderson WA, McCullough BM. Impact of internet use on loneliness and contact with others among older adults: cross-sectional analysis. J Med Internet Res. 2013;15(2):e39. doi: 10.2196/jmir.2306. http://www.jmir.org/2013/2/e39/ [PMC free article] [PubMed] [CrossRef] [Google Scholar]44. Delello JA, McWhorter RR. Reducing the digital divide: Connecting older adults to iPad technology. J Appl Gerontol. 2015 Jun 17;:1–26. doi: 10.1177/0733464815589985. [PubMed] [CrossRef] [Google Scholar]45. Dhillon JS, Ramos CR, Wunsche BC, Lutteroth C. Designing a Web-based telehealth system for elderly people: An interview study in New Zealand. Proceedings of the 24th International Symposium on Computer-Based Medical Systems -- CBMS 2011 Bristol; the 24th International Symposium on Computer-Based Medical Systems; 27-30 June 2011; Bristol. IEEE; 2011. Jun, pp. 1–6. http://ieeexplore.ieee.org/xpls/abs_all.jsp?arnumber=5999157. [CrossRef] [Google Scholar]46. Heo J, Chun S, Lee S, Lee KH, Kim J. Internet use and well-being in older adults. Cyberpsychol Behav Soc Netw. 2015 May;18(5):268–272. doi: 10.1089/cyber.2014.0549. [PubMed] [CrossRef] [Google Scholar]47. Kahlbaugh PE, Sperandio AJ, Carlson AL, Hauselt J. Effects of playing Wii on well-being in the elderly: Physical activity, loneliness, and mood. Activities, Adaptation & Aging. 2011 Oct;35(4):331–344. doi: 10.1080/01924788.2011.625218. [CrossRef] [Google Scholar]48. Karimi A, Neustaedter C. From high connectivity to social isolation: communication practices of older adults in the digital age. Computer Supported Cooperative Work; February 11-15, 2012; Seattle WA. Association for Computing Machinery; 2012. [Google Scholar]49. Khvorostianov N, Elias N, Nimrod G. 'Without it I am nothing': The internet in the lives of older immigrants. New Media & Society. 2011 Nov 11;14(4):583–599. doi: 10.1177/1461444811421599. [CrossRef] [Google Scholar]50. Machesney D, Wexler SS, Chen T, Coppola JF. Gerontechnology Companion: Virutal pets for dementia patients. Systems, Applications and Technology Conference (LISAT), 2014 IEEE Long Island; 2-2 May 2014; New York. IEEE; 2014. pp. 1–3. [CrossRef] [Google Scholar]51. Tsai HH, Tsai YF, Wang HH, Chang YC, Chu HH. Videoconference program enhances social support, loneliness, and depressive status of elderly nursing home residents. Aging Ment Health. 2010 Nov;14(8):947–954. doi: 10.1080/13607863.2010.501057. [PubMed] [CrossRef] [Google Scholar]52. Tsai HH, Tsai YF. Changes in depressive symptoms, social support, and loneliness over 1 year after a minimum 3-month videoconference program for older nursing home residents. J Med Internet Res. 2011;13(4):e93. doi: 10.2196/jmir.1678. http://www.jmir.org/2011/4/e93/ [PMC free article] [PubMed] [CrossRef] [Google Scholar]53. Winstead V, Anderson WA, Yost EA, Cotten SR, Warr A, Berkowsky RW. You can teach an old dog new tricks: a qualitative analysis of how residents of senior living communities may use the web to overcome spatial and social barriers. J Appl Gerontol. 2013 Aug;32(5):540–560. doi: 10.1177/0733464811431824. [PMC free article] [PubMed] [CrossRef] [Google Scholar]54. Helsper EJ, Eynon R. Distinct skill pathways to digital engagement. European Journal of Communication. 2013 Sep 16;28(6):696–713. doi: 10.1177/0267323113499113. [CrossRef] [Google Scholar]55. de Jong-Gierveld J, Kamphuls F. The development of a Rasch-type loneliness scale. Applied Psychological Measurement. 1985 Sep 01;9(3):289–299. doi: 10.1177/014662168500900307. [CrossRef] [Google Scholar]56. de Jong-Gierveld J, van Tilburg T. A 6-item scale for overall, emotional, and social loneliness confirmatory tests on survey data. Res Aging. 2006;28(5):582–598. [Google Scholar]57. Schuster TL, Kessler RC, Aseltine RH. Supportive interactions, negative interactions, and depressed mood. Am J Community Psychol. 1990 Jun;18(3):423–438. [PubMed] [Google Scholar]58. Russell D, Peplau LA, Cutrona CE. The revised UCLA Loneliness Scale: concurrent and discriminant validity evidence. J Pers Soc Psychol. 1980 Sep;39(3):472–480. [PubMed] [Google Scholar]59. Andersson L. Intervention against loneliness in a group of elderly women: A process evaluation. Human Relations. 1984 Apr 01;37(4):295–310. doi: 10.1177/001872678403700402. [CrossRef] [Google Scholar]60. Lubben J, Blozik E, Gillmann G, Iliffe S, von Renteln Kruse W, Beck JC, Stuck AE. Performance of an abbreviated version of the Lubben Social Network Scale among three European community-dwelling older adult populations. Gerontologist. 2006 Aug;46(4):503–513. [PubMed] [Google Scholar]61. Sansoni J, Marosszeky N, Sansoni E, Fleming G. Final report: Effective assessment of social isolation. Centre for Health Service Development, University of Wollongong; 2010. Jan 1, [2015-05-01]. webcite http://www.adhc.nsw.gov.au/__data/assets/file/0007/236329/24_Social_Isolation_Report.pdf. [Google Scholar]62. Lubben J E, Gironda M. Centrality of social ties to the health and well-being of older adults. In: Berkman B, Harooytoan L K, editors. Social Work and Health Care in an Aging World. New York: Springer; 2003. pp. 319–350. [Google Scholar]63. Lubben J, Gironda M. Measuring social networks and assessing their benefits. In: Phillipson C, Allan G, Morgan D, editors. Social Networks and Social Exclusion: Sociological and Policy Perspectives. Burlington, VT: Ashgate Publishing Company; 2004. pp. 20–34. [Google Scholar]64. Lubben J, Blozik E, Gillmann G, Iliffe S, von Renteln Kruse W, Beck JC, Stuck AE. Performance of an abbreviated version of the Lubben Social Network Scale among three European community-dwelling older adult populations. Gerontologist. 2006 Aug;46(4):503–513. [PubMed] [Google Scholar]65. Sherbourne CD, Stewart AL. The MOS social support survey. Soc Sci Med. 1991;32(6):705–714. [PubMed] [Google Scholar]66. Zimet GD, Powell SS, Farley GK, Werkman S, Berkoff KA. Psychometric characteristics of the Multidimensional Scale of Perceived Social Support. J Pers Assess. 1990;55(3-4):610–617. doi: 10.1080/00223891.1990.9674095. [PubMed] [CrossRef] [Google Scholar]67. Harley D, Fitzpatrick G. YouTube and intergenerational communication: the case of Geriatric1927. Univ Access Inf Soc. 2008 May 29;8(1):5–20. doi: 10.1007/s10209-008-0127-y. [CrossRef] [Google Scholar]68. Nielsen J. Seniors as Web users. Nielsen Norman Group; 2013. [2015-05-01]. webcite http://www.nngroup.com/articles/usability-for-senior-citizens/ [Google Scholar]

      The citations include references from other sources.

    1. The emergence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the virus that causes COVID-19, poses a tremendous threat to human health.1Chan JFW Yuan S Kok KH et al.A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster.Lancet. 2020; 395: 514-523Summary Full Text Full Text PDF PubMed Scopus (663) Google Scholar,  2Huang C Wang Y Li X et al.Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China.Lancet. 2020; 395: 497-506Summary Full Text Full Text PDF PubMed Scopus (1926) Google Scholar,  3Wu JT Leung K Leung GM Nowcasting and forecasting the potential domestic and international spread of the 2019-nCoV outbreak originating in Wuhan, China: a modelling study.Lancet. 2020; 395: 689-697Summary Full Text Full Text PDF PubMed Scopus (254) Google Scholar There were more than 4 million confirmed cases and 300 000 reported deaths worldwide as of May 11, 2020. There have been warnings of a major coronavirus pandemic since the SARS outbreak in 2002–04, and in 2020 that threat has been realised. Now we need to consider the challenges ahead; the current prevalence, the incidence of asymptomatic infections, and the true mortality remains unclear. We also need to ascertain the probable effectiveness of current control measures so future strategies can be prioritised accordingly.At the end of 2019, the COVID-19 outbreak was first reported in the city of Wuhan, China, and has since spread worldwide.4Tian H Liu Y Li Y et al.An investigation of transmission control measures during the first 50 days of the COVID-19 epidemic in China.Science. 2020; 368: 638-642Crossref PubMed Scopus (18) Google Scholar To contain the spread of the disease, a cordon sanitaire was imposed on Wuhan city on Jan 23, 2020, and travel restrictions were subsequently imposed on other cities across Hubei province the next day.5Kraemer MUG Yang C-H Gutierrez B et al.The effect of human mobility and control measures on the COVID-19 epidemic in China.Science. 2020; 368: 493-497Crossref PubMed Scopus (21) Google Scholar After 61 days of lockdown in Hubei province, the province reopened again on March 25, 2020, and after 76 days of lockdown in Wuhan, the city reopened again on April 8, 2020. The screening of individuals in these areas provides essential information on how immunity, and potentially herd immunity, is shaped in the community that has so far had the longest chain of community transmission but also some of the strongest physical distancing measures.During early-2020, many studies attempted to estimate the reporting rate (or ascertainment rate) of COVID-19 in Wuhan.6Li R Pei S Chen B et al.Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2).Science. 2020; 368: 489-493Crossref PubMed Scopus (107) Google Scholar,  7Pan A Liu L Wang C et al.Association of public health interventions with the epidemiology of the COVID-19 outbreak in Wuhan, China.JAMA. 2020; (published online April 10.)DOI: 10.1001/jama.2020.6130Crossref Scopus (18) Google Scholar,  8Wu JT Leung K Bushman M et al.Estimating clinical severity of COVID-19 from the transmission dynamics in Wuhan, China.Nat Med. 2020; 26: 506-510Crossref PubMed Scopus (38) Google Scholar Seroprevalence surveys of the general population are key to understanding reporting rates, the underlying number of infections, the build-up of immunity, and to reconstruct chains of transmission of SARS-CoV-2. In The Lancet Microbe, Kelvin To and colleagues9To KK-W Cheng VC-C Cai J-P et al.Seroprevalence of SARS-CoV-2 in Hong Kong and in residents evacuated from Hubei province, China: a multicohort study.Lancet Microbe. 2020; (published online June 3.)https://doi.org/10.1016/S2666-5247(20)30053-7Google Scholar present the results of a seroepidemiological survey of SARS-CoV-2 in the general population in Hong Kong and returnees evacuated from Hubei, China. The investigators enrolled 1938 individuals before and after the COVID-19 pandemic between 2018 and 2020, and 452 asymptomatic Hubei returnees in March, 2020. The study showed that as an emergent virus, SARS-CoV-2 had a seroprevalence of 3·8% among Hubei returnees (17 of 452 returnees); very far from any plausible level of herd immunity.Although the study assessed a small sample—452 of approximately 60 million people in Hubei province—it provides an essential baseline for public health authorities when evaluating the effect of current and future interventions. Judging by patterns of circulation of endemic coronaviruses (HCoV-NL63, HCoV-HKU1, HCoV-229E, and HCoV-OC4),10Killerby ME Biggs HM Haynes A et al.Human coronavirus circulation in the United States 2014–2017.J Clin Virol. 2018; 101: 52-56Crossref PubMed Scopus (0) Google Scholar it is probable that broader immunity might build up in the years ahead. However, To and colleagues' study shows that the current level of immunity is far below the herd immunity threshold and will not appreciably slow future spread, so testing, screening, and contact tracing from symptomatic and asymptomatic infections are still key to stopping further infections.We declare no competing interests.
    1. Akhvlediani, T., Ali, S. M., Angus, D. C., Arabi, Y. M., Ashraf, S., Baillie, J. K., Bakamutumaho, B., Beane, A., Bozza, F., Brett, S. J., Bruzzone, R., Carson, G., Castle, L., Christian, M., Cobb, J. P., Cummings, M. J., D’Ortenzio, E., Jong, M. D. de, Denis, E., … Webb, S. (2020). Global outbreak research: Harmony not hegemony. The Lancet Infectious Diseases, 0(0). https://doi.org/10.1016/S1473-3099(20)30440-0

  3. May 2020
    1. Gobbi, S., Plomecka, M., Ashraf, Z., Radziński, P., Neckels, R., Lazzeri, S., Dedić, A., Bakalović, A., Hrustić, L., Skórko, B., Es haghi, S., Almazidou, K., Rodríguez-Pino, L., Alp, A. B., Jabeen, H., Waller, V., Shibli, D., AghiliBehnam, M., Strutt, A. M., … Jawaid, A. (2020). Worsening of pre-existing psychiatric conditions during the COVID-19 pandemic [Preprint]. PsyArXiv. https://doi.org/10.31234/osf.io/x6cyg

    1. Grifoni, A., Weiskopf, D., Ramirez, S. I., Mateus, J., Dan, J. M., Moderbacher, C. R., Rawlings, S. A., Sutherland, A., Premkumar, L., Jadi, R. S., Marrama, D., de Silva, A. M., Frazier, A., Carlin, A., Greenbaum, J. A., Peters, B., Krammer, F., Smith, D. M., Crotty, S., & Sette, A. (2020). Targets of T cell responses to SARS-CoV-2 coronavirus in humans with COVID-19 disease and unexposed individuals. Cell, S0092867420306103. https://doi.org/10.1016/j.cell.2020.05.015

    1. Yong, S. E. F., Anderson, D. E., Wei, W. E., Pang, J., Chia, W. N., Tan, C. W., Teoh, Y. L., Rajendram, P., Toh, M. P. H. S., Poh, C., Koh, V. T. J., Lum, J., Suhaimi, N.-A. M., Chia, P. Y., Chen, M. I.-C., Vasoo, S., Ong, B., Leo, Y. S., Wang, L., & Lee, V. J. M. (2020). Connecting clusters of COVID-19: An epidemiological and serological investigation. The Lancet Infectious Diseases, S1473309920302735. https://doi.org/10.1016/S1473-3099(20)30273-5

    1. Gudbjartsson, D. F., Helgason, A., Jonsson, H., Magnusson, O. T., Melsted, P., Norddahl, G. L., Saemundsdottir, J., Sigurdsson, A., Sulem, P., Agustsdottir, A. B., Eiriksdottir, B., Fridriksdottir, R., Gardarsdottir, E. E., Georgsson, G., Gretarsdottir, O. S., Gudmundsson, K. R., Gunnarsdottir, T. R., Gylfason, A., Holm, H., … Stefansson, K. (2020). Spread of SARS-CoV-2 in the Icelandic Population. New England Journal of Medicine, NEJMoa2006100. https://doi.org/10.1056/NEJMoa2006100

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      I thank the referees for their enthusiasm and time providing critical feedbacks to our manuscript. The novelty of our work is the identification of the importance of Mfn2 in regulating the Rac signaling and neutrophil migration& adhesion, which is significantly relevant to the mitochondrial field and cell biology in general. Below please find our point-to-point response to the comments.

      *Reviewer #1 (Evidence, reproducibility and clarity (Required)):**

      Introduction:

      "Although mitochondria-derived ATP possibly regulates neutrophil chemotaxis in vitro (Bao et al., 2015), removal of extracellular ATP improves neutrophil chemotaxis in vivo (Li et al., 2016). These conflicting reports prompted us to search for mechanisms delineating the role of mitochondria in neutrophil migration outside the realm of ATP or cellular energy (Bi et al., 2014; Schuler et al., 2017; Zanotelli et al., 2018)." This sentence is superficial and misleading: extracellular ATP may interfere with chemotaxis through various energy-independent mechanisms (see for example Zumerle et al. Cell Reports 2019) and this is not conflicting with the role of intracellular ATP in migration.*

      We were not clear in the writing that Bao et al suggest that neutrophils secret ATP at the leading edge and mitochondria at the leading edge is the source of the extracellular ATP. Both studies focused on extracellular ATP. We agree that the reports are not necessarily conflicting since exogenous ATP can induce additional signaling. We rewrote this sentence emphasizing that we are looking for mechanisms in addition to ATP, which is distinct from previous studies.

      Figure 1: The authors didn't show evidence of the genome edition (PCR, RFLP or Sequencing over the sgRNA target) or at least RT-PCR or WB for MFN2. In Fig 1b, 1c the scale bar is missing. "Neutrophils were sorted from both lines and their respective loci targeted by the 4 sgRNAs were deep sequenced." There are no data about sorting strategies for zebrafish neutrophils in the figure. Moreover, only 2 sgRNAs are shown and there are no sequencing data.

      To show evidence of the genome edition, we have deep sequenced this loci of mfn2 and opa1 and the mutation frequencies were stated in the original text. The sorting strategies were described in Methods-Mutational Efficiency Quantification. Each mfn2 KO has 2 individual sgRNAs, and two KO (mfn2 KO and mfn2 KO#2) were shown in Fig 1b, so there are 4 sgRNAs targeting mfn2. Since each embryos have approximately 150 neutrophils, WB is not feasible. Sequencing is the standard method (Ablain et al., 2015; Zhou et al., 2018). We only stated the mutation efficiency in the manuscript because amplifying the genomic DNA from the sorted cells introduces PCR bias and the numbers are not a quantitative reflection of the degree of gene disruption. We will include the sequencing result of the sgRNA target sites in a supplemental Figure.

      We used one scale bar for all the panels in Fig 1b,c. All panels are at the some magnification.

      Figure 2:** In the WB, reconstitution is not obvious. In general, all WBs are not quantified (and they should be quantified). The in vivo experiment does not have proper controls. For example, can the authors exclude that in these mice there is reduced inflammation because neutrophils have defective activation? What about NETs? And cytokines/chemokines? And exocytosis? In the absence of these controls, the experiment cannot be properly interpreted.

      We have quantified all WBs in our study. The results were sometimes stated in the text only. We will add the quantifications to each blot.

      The mice model we chose is used to evaluate in vivo neutrophil migration. We used a neutrophil specific promoter to delete mfn2 in mice and collected data at a very early time point when the tissue inflammatory environment is determined by tissue resident sentinel cells, such as macrophages. Although our results support that mfn2 is required for neutrophil migration in mammals, we agree that we can not fully rule out that other neutrophil functions are also regulated by mfn2.

      To address whether other neutrophil functions are affected by MFN2, we will performed assays to evaluate NETosis and degranulation in MFN2 KD HL-60 cells to evaluate the other neutrophil functions.

      Figure 3: The conclusion of the authors "In summary, Mfn2 modulates the actin cytoskeleton and cell migration in MEFs" should be supported by experiments to distinguish between the specific role of Mfn2 and the role of mitochondrial dynamics (Opa1, Drp1, Mfn1). It is also not clear why the authors decided to use MEFs instead of other cells (more similar to neutrophils which are not adherent cells). The results obtained in MEFs may be irrelevant for neutrophils.

      We agree that MEFs are very different from neutrophils. We chose MEFs since the function of Mfn2 in MEF is well characterized (Chen et al., 2003; de Brito and Scorrano, 2008; Naon et al., 2016). Both Mfn1 and Mfn2 MEF have fragmented mitochondria. Mfn1, which is very similar to Mfn2, serves as the best control. We will confirm the mitochondria structure in the KO cells.

      For specificity, in addition to mfn2, we looked at Mfn1 and opa1 in different systems. We did not select Drp1 since the mitochondrial network in neutrophils is highly fused (Fig 4 and 5)(Maianski et al., 2002; Zhou et al., 2018).

      We have also knocked down Opa 1 in HL-60s. We observed massive cell death in this line and cell migration is affected, possibly due to a depletion of cellular ATP as reported (Amini et al., 2018). We will include the data showing cell death, qRT to show knockdown efficiency and chemotaxis. In zebrafish neutrophils, knocking out Opa1 also reduced cell migration (Fig 1S).

      Figure 4-5: Fig 5a: in ctrl and sh1 the ER seems to be larger than the phalloidin (=cytoskeleton=cell border approximately) in a few regions. Only the sh1+T seems to fit correctly.

      We use the F-actin staining as an indicator of cell front. F-Actin is predominant at cell front, but much less in the cell body and uropod. Here we set the confocal laser power at a certain level to give us a good resolution of brighter signals which may not be strong enough to detect signals in the cell body. That’s why the fluorescence is very dim or even absent in the cell body. However, the majority of ER do fit in the cell border if look closer.

      The TEM image (only 1 in supplementary) is not sufficient to convince that the tethering is lost. Quantification of number of contacts and distance between ER and mitochondria should be included.

      Using EM method, Mfn2 ablation decreases the ER-contacting mitochondrial surface by ∼20–35% (Naon et al., 2017). Using the same cells, different groups reached different conclusions using TEM(Filadi et al., 2017). We reason that ER-mitochondria contact sites are rare events in TEM since the samples are sliced. We will try to take more TEM images to quantify the distance. However, we are not sure that we can come up with a definitive conclusion by TEM. Nevertheless, we observed significant mitochondrial structural changes using IF and observed the changes in cytosolic calcium levels, which is consistent with the known function of Mfn2 as a ER-mitochondrial tether (Naon et al., 2016).

      The title of figure 5 is wrong. However, in these figures, it is clear that cells are beautifully polarized, with mitochondria accumulating at the uropod (and even more in the absence of Mfn2). When comparing these images with those published by Campello et al (JEM 2006), there are 2 observations that can be made: first of all, these data confirm that mitochondrial fission promotes cell polarity; second, they suggest that the defect is not at the level of cell polarity/chemotaxis.

      We have fixed the title of figure 5.

      We agree that mfn2 defective neutrophils does not have a defect in cell polarization. The defects in migration is possibly due to other reasons such as poor adhesion or regulation in the actin cytoskeleton dynamics. However, our data is not sufficient to support that mitochondrial fission promotes cell polarization and chemotaxis.

      Figure 6: Calcium data are, in general, very weak. First of all, controls with ionomycin are missing. Statistical analyses of the curves should be included. As for the use of the MCU inhibitor Ru360, is there any evidence that it is cell-permeant in this context? Is it blocking MCU? Since the authors can show mitochondrial calcium upon FMLP, they should also demonstrate that Ru360 is indeed working and inhibiting mitochondrial calcium uptake. The sentence "The MCU inhibitor Ru360did not cause further reduction of chemotaxis in MFN2 knockdown dHL-60 cells (Supplementary Fig. 6c, d and Supplementary Movie. 12), indicating that MCU and MFN2 lies in the same pathway in terms of regulating chemotaxis in dHL-60 cells" is speculative. In general, there is no solid demonstration that the effect is calcium-mediated.

      We will include the control of ionomycin and include statistics of the results.

      Ru360 is a widely used MCU inhibitor. The fact that Ru360 itself inhibited neutrophil migration supported that the chemical enters cells. We agree that stating “indicating that MCU and MFN2 lies in the same pathway in terms of regulating chemotaxis in dHL-60 cells" is speculative. In addition, we tried to reduce cytosolic calcium levels in mfn2 KD cells either using Ca2+ chelator (BAPTA, in Fig S6) or an IP3 receptor inhibitor. In both cases we observed reduced migration blocking calcium signal alone. The mfn2 KD phenotype was not rescued. This could due to that multiple molecules/pathways are calcium dependent in cell migration. We will include all the negative data. We thus far are still unable to establish a functional link of the calcium with mfn2 regulated signaling.

      We have moved the calcium data to Fig 4. The elevated calcium signal is an indirect evidence to support the loss of ER-mitochondria tether. We have modified our conclusion to leave out calcium as a relevant signal regulated by mfn2 for neutrophil migration.

      As for Rac, it is surprising to see that Rac inhibition has no effect on cell migration. Rac is known to promotes migration in fibroblasts and other cell types and Rac deficiency inhibits migration (see for example Steffen et al, JCS 2013). Two sets of experiments are absolutely required: 1) verify this in fibroblasts since it has been elegantly shown that Rac is essential in these cells for migration; 2) analyse the effect of Rac inhibitors in pPak kinetics.

      Rac is required for cell migration and the growth of branched actin network. The Rac inhibitors we selected here are specific to two rac GEFs, vav and Tiam. Steffen et al, JCS 2013 used Rac1 KO MEF, which is different from ours. Thus the works are not contradictory. MEFs are very different from neutrophils. We chose MEFs since there are knockout cells available and well characterized. The MFN2 KO cells display prominent lamellipodia, which is also consistent with the observation in Steffen et al, JCS 2013. We have used these two inhibitors in MEF wound closure and did not observe a strong phenotype.

      We will analyze the effect of Rac inhibitors in pPak kinetics in the control and Mfn2 deficient dHL-60 cells.

      *Reviewer #1 (Significance (Required)):**

      As presented here, the manuscript has a modest significance. The audience would be specialised: cell migration, cell signalling. My expertise is immunology, cell activation, cell migration, cell signalling.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      **Major comments:**

      Although the results could be very interesting, and could be significantly relevant to the mitochondrial field and the cell biology one in general, major points need to be addressed to fully support conclusions of the authors. Different controls and quantification are missing, Actin dynamics analysis should be improved, effects of the artificial tether is weakly characterized and the demonstration of the specific role of mito-ER contacts via mfn2 in migration should be reinforced.

      -In figure 1, quantification of circulating neutrophils is required in Mfn2 KO embryos. The authors should also show these quantified results for OPA1KO, which are just mentioned in the text. In addition, in figure 1b and d, the neutrophils from the Mfn2KO embryos seem bigger compared to control. Can the authors comment on neutrophils size and potential contribution to the phenotype? Finally, the authors propose a defect in neutrophil migration in Mfn2-KO, however neutrophils are found in the circulation. The authors should explain these results.*

      Since the cells are all in circulation, we can only estimate the percentage. Overall, the phenotype is drastic, shown in movie S1. We will state how many fish embryos we have imaged and how often we observe this phenotype (only 1 or 2 in the tissue (mfn2 KO) or in circulation (control)). The bigger spots are resulted from cells outside the focal plane-zebrafish embryos are thick tissues. We agree that since neutrophils in the KO fish are all circulation, we cannot make a conclusion whether they can migrate in tissue in zebrafish. We conclude that “mfn2 regulates neutrophil tissue retention and extravasation in zebrafish”, but did not comment on chemotaxis.

      -The authors need to reinforce the Mfn2 specificity for their phenotype. In particular in Fig S1, they show that loss of OPA1 significantly decreases neutrophil migration in vivo. However, they then only study the effect of Mfn1 silencing in neutrophil and MFN1 KO MEFs (Sup Fig s3). The authors should perform the same experiments in neutrophil and MEF upon loss of OPA1 (similar to Fig S3). Does loss of OPA1 and Mfn1 decrease neutrophil arrest to activated endothelial cells?

      We knocked down OPA1 in HL-60 cells. The cells appear unhealthy and display a migration defect, consistent with the data in zebrafish. We are not comfortable making conclusions here since secondary affects in dying cells may cause any phenotype not directly attributed to the loss of OPA1. Nevertheless, we will include the data.

      We have decided not to include Opa1 KO MEF since the cell morphology as documented in ATCC is similar to that of WT MEF. Only the MEF2 KO MEF is more circular. MFN1 KO MEF is a better specificity control which we have characterized in depth.

      Since Mfn1 KD HL-60 cells migrate well on surface, they are not expected to have adhesion defects. Nevertheless, we will determine whether loss of Mfn1 decrease neutrophil arrest to activated endothelial cells and include the data.

      -Using their images, the authors should also document on the directionality of the cell during cell migration. Do Mfn2 depleted cells do not migrate because they are arrested or because they are lacking directionality? Environment/chemokine sensing defects?

      We will quantified the directionality of the cells. As pointed out by reviewer 1, mfn2 deficient cells can polarize and not defective in chemokine sensing. We do not expect a significant change in directionality defect.

      -Actin dynamics analysis should be improved. Loss of Mfn1 and Mfn2 lead to cell shape changes. The authors should quantify this phenotype by analysing cell circularity (as well as for Opa1 loss). Stress fibres number or Phalloidin intensity quantification in cell body should also be performed.

      We will quantified the circularity, stress fiber numbers and phalloidin intensity in Mfn1 and Mfn2 KO MEFs.

      -Can the migration defects could be attributed to Focal adhesion protein dynamics defects? The authors shown an hyperactivation of Rac1 and an hyperphosphorylation of PAK, which can control FAP (focal adhesion proteins) dynamics. In addition, immunofluorescence analysis shows a decreased signal and cellular misdistribution of paxillin. The authors should characterize these phenotypes. FAP levels (Paxillin/Phospho-Paxillin and Vinculin) should be analysed by immunoblot, the number of FAP/cell, distribution and size should also be quantified. Their dynamics should also be analysed by live cell imaging. Finally, Paxillin level and distribution seems to be also impacted in Mfn1KO cells. Can the authors comment on that? The different quantifications would help to better understand the effect of different mitofusins in cytoskeleton dynamic.

      We thank the reviewer for the great advices for our follow up work. So far our results supports Rac over activation as a relevant pathway how mfn2 regulates neutrophil migration. Although Rac can regulate focal adhesion dynamics in other cells (Rooney et al., 2010), how Rac activation regulates focal adhesion dynamics in neutrophils is not clear. Mfn2 regulated membrane tether could affect lipid trafficking, cellular metabolism and other signaling molecules. It will take substantial amount of work to make a conclusion and it is more suitable a separate report. This is one of the directions we will pursuit in our future studies.

      -Please perform rescue experiments for cell migration in MFN2KO and MFN1KO MEFs. Immunoblots showing protein levels of these proteins would be appreciated. To really discriminate how Mfn2 regulates cell migration, the authors should also perform rescue experiments using a fusogenic mutant Mfn2 ((K109A). It will help to demonstrate the relevance of mito-ER contacts and not mitochondrial fusion in the phenotype.

      For the reason mentioned above, we do not plan to do additional experiments in MEF cells since this work is focused on neutrophils. It is documented that Mfn2 K109A cannot restore mitochondrial fusion. However, it is not clear whether this construct can restore ER-tether. Result using this construct will be hard to interpret.

      -Figure 4, the authors stipulate that Mfn2 regulates ER-mitochondria tethering. However, the authors present no evidence for this conclusion. The authors should perform manders coefficient in MFN2 KO cells and compared it to control. Also, loss of Mfn2 induces mitochondrial fragmentation, which can lead to problem for mito-er contacts quantification by light microscopy. The authors should use their TEM pictures to quantify mito-ER contacts (Number, length and % of mito perimeter), not only mitochondrial morphology. Mfn1 should be used as negative control. it would be interesting also to determine the status of the mito-ER contact in the different conditions used in the manuscript to stimulate cell migration like fMLP treatment.

      We have performed manders coefficient in the mfn2 KD cells and observed no difference compared with the control. It is possibly due to the prevalent ER structure in the cells-despite the structural change, mitochondria are still mostly on top of ER when examined using IF. Using EM method, Mfn2 ablation decreases the ER-contacting mitochondrial surface by ∼20–35% (Naon et al., 2017). Using the same cells, different groups reached different conclusions using TEM(Filadi et al., 2017). We reason that ER-mitochondria contact sites are rare events in TEM since the samples are sliced. We will try to take more TEM images to quantify the distance. However, we are not sure that we will come up with a definitive conclusion by TEM. Nevertheless, we observed significant mitochondrial structural changes using IF and observed the changes in cytosolic calcium levels, which is consistent with the known function of Mfn2 as a ER-mitochondrial tether (Naon et al., 2016).

      -The authors use an artificial tether to manipulate mito-ER contacts in cellulo. However, no information from its origin, or its design are documented in the manuscript. In addition, the authors should show that this tether efficiently works by analyzing mito-ER contacts upon expression by EM and mitochondrial calcium uptake. Does this tether rescue mito-ER contacts defects induced by loss of Mfn2? How the authors explain that the tether rescues mitochondrial morphology defects in MFN2KO? In these conditions, mitochondria should not be able to fuse anymore as Mfn2 is lost? This is really intriguing results. Does the tether rescue the other parameters? Mitochondrial distribution (with quantification)? Cell shape? Paxillin defects? ROS and membrane potential? These rescue experiments analyses are important to determine which parameters are really involved in cell migration defects due to the decreased tethering. Finally, it would be of great interest to analyse the effect of the tether alone on cell migration, Rac1 activity, cell shape? Gain of function? These results may reinforce the idea that contact sites regulate cell migration.

      The tether is a GFP protein carrying both ER and mitochondrial localization sequences at the ends (Kornmann et al., 2009). The details are now added to the manuscript.

      In HL-60 mfn2 KD cells, tether expression partially rescues mitochondrial distribution (quantified in Fig 5c), cell migration and Rac over activation. Although ROS and membrane potential are slightly affected by Mfn2 deletion in HL-60 cells, it is not clear whether they play any roles in mfn2 regulated cell adhesion or migration. We will attempt to use TEM to determine the mitochondrial structure upon tether rescue.

      Despite multiple attempts, we could not obtain a line over-expressing the tether in wt HL-60 cells. We suspect that further increase in the tether is toxic to the cells.

      -It is well established that a decrease of membrane potential leads to a decrease of mitochondrial calcium uptake. Calcium results obtained by the authors without any information on the roles of the tether could not lead to any conclusion. Does the tether rescues membrane potential and calcium uptake by the mitochondria? So far, the decrease of mitochondrial calcium upon stimulation in Mfn2KO cab be attributed to both mito-ER contact or membrane potential defects. It has been shown that MEFs MFN2 KO can lead to a decrease of MCU provel level leading to a decrease of mitochondrial calcium uptake (PMID: 25870285). The authors should also check MCU protein level.

      We observed that mfn2 deficiency resulted in a minor reduction in membrane potential. Although Mfn2 KO MEF has reduced level of Mcu, Mfn2 silence in MEF does not affect Mcu levels (Filadi et al., 2015). Another group also concluded that Mfn2 deletion does not necessarily affect Mcu levels (Naon et al., 2016). Nevertheless, we will measure the MCU protein level in the Mfn2 knockdown HL-60 cells.

      -Hyperactivation of Rac1 is only based on phosphorylation of PAK, which is quite weak. The authors should better describe the hyperactivation of RAC1 or other RhoGTPases in their Mfn2 KO MEFs. What are the levels of RAC1 and other RhoGTPases? Subcellular distribution in the cell? Kits are also available to determine RhoGTPase activity by pull down assay (Cell biolabs).

      In Mfn2 KO MEFs, Rac overactivation is suggested by the increased lamellipodia formation, classical Rac readouts. Since the current manuscript focuses on neutrophils, we will performed the Rac GFP pull down experiments in HL-60 cells. We will also stain Rac GTP in HL-60 cells.

      *-The references are up-to-date. The text and the figures are clear and accurate.**

      **Minor comments:**

      -The authors should show the efficiency of the KO generated for Mfn2 and Opa1 in zebrafish embryos. Sequencing results to highlight the position of the mutations and their consequences on the coding protein should be shown, as well as immunoblot analysis should be performed to analyse Mfn1, Mfn2 and OPA1 protein levels. The generation of a MFN1-KO transgenic line would have been appreciated to finely compare the roles of the 3 GTPases involved in mitochondrial fusion during neutrophil infiltration and migration in vivo.*

      To show evidence of the genome edition, we have deep sequenced this loci of mfn2 and opa1 and the mutation frequencies were stated in the original text. Since each embryos have approximately 150 neutrophils, WB is not feasible. Sequencing is the standard method (Ablain et al., 2015; Zhou et al., 2018). We only stated the mutation efficiency in the manuscript because amplifying the genomic DNA from the sorted cells introduces PCR bias and the numbers are not a quantitative reflection of the degree of gene disruption. We will include the sequencing result of the sgRNA target sites in a supplemental Figure.

      The mfn1 gene in zebrafish is duplicated. We are not sure whether we can obtain efficient disruption at both loci. We hope the results using Mfn1 KO MEF and MFN1 KD HL-60 cells are enough to show a specific role of Mfn2 in cell migration.

      -MFN1, MFN2, AND OPA1 protein levels should be analysed by immunoblot in the Mfn1 and Mfn2 KO MEFs.

      It is unlikely that mfn1/2 KO will affect OPA1 levels (Saita et al., 2016). Both MFN1 and MFN2 MEF display fragmented mitochondrial network which can be rescued by overexpression of MFN1 or MFN2 (Chen et al., 2003). The level of OPA1 in the cells are not relevant. We will stain mitochondria in the mfn1/2 KO MEFs to make sure that the cells have fragmented mitochondria as expected.

      -In cell spreading assay, it would be great to identify cells during the process, by an asterix for example. "wt MEFs extended transient filopodia and lamellipodia and eventually elongated, whereas Mfn2-null MEFs generated extensive membrane ruffles and retained the circular shape". It would be interesting to quantify these different parameters.

      We will add Asterixes to the cells. We will quantify the percentage of cells that can rearrange their cell shape in the WT and Mfn2 KO MEFs.

      -For all their immunoblot analysis, the authors should use a mitochondrial marker as loading control (VDAC1, TOM20, HSP60...). In figure 5, Vinculin should not be used a loading control, with its role in focal adhesion dynamics.

      Vinculin is stable in HL-60 cells under multiple conditions and selected as a control. The signal intensity correlates well with the amount of protein loaded. Using mitochondrial proteins as loading controls is not common and may be risky as the amount of mitochondria in cells can be variable.

      -Legends for figures 5 and 6 are inverted.

      Thanks, we have changed the heading of figure 5. The legends were correct.

      -Please document in the material and methods section, how confocal images have been acquired: number of z-stacks, reconstitution, 3D analysis...

      We will update in the method the parameters of imaging acquisition.

      -The authors should show their results of blood cell composition quantification in ctrl vs MFn2 depletion.

      We will include the results of blood cell composition in a supplemental figure.

      -The authors should describe all the acronyms used throughout all the manuscript. For example, LTB4, fMLP...

      We have describe all the acronyms in the updated manuscript.

      *Reviewer #2 (Significance (Required)):

      Beyond their role in energy production, mitochondria are involved in numerous cellular functions including cell migration. Mitochondria form a network balanced by fission and fusion events, where membrane contact sites with the endoplasmic reticulum are crucial. These contact sites are also involved in mitochondrial and cellular functions via their capacity to exchange lipids, metabolites and calcium. The role of mitochondria in cell migration has started to emerge where mitochondrial fragmentation and/or mitochondrial calcium homeostasis are acknowledged to drive cancer cell migration and to regulate actin dynamics. In this manuscript, Zhou W and colleagues proposed for the first time the role of mitochondria-ER contacts in cell migration. Mechanistically, this can be associated to the capacity of these contacts to control mitochondrial functions or mitochondrial calcium homeostasis. These findings are physiologically relevant and of particular interest to the mitochondrial and cell migration field but also to general cell biology. It represents a novel function associated to these membrane contact sites and point-out these contacts as signalling platform creating microdomains of metabolites exchanges involved in cell migration.

      Keywords: Mitochondria - Membraned dynamics - calcium homeostasis - Membrane contact sites*

      *Reviewer #3 (Evidence, reproducibility and clarity (Required)):**

      Mitofusin 2 (Mfn2) is a mitochondrial outer membrane protein that is important for mitochondrial fusion and the establishment of mitochondrial ER contacts. It has been published before that these contact sites are important for calcium signaling. Zhou et al. examined the role of Mfn2 in neutrophils. They propose a model in which mitochondrial ER contacts established via Mfn2 are crucial for regulation of Rac, which is a small GTPase driving cell migration by promoting actin polymerization. Loss of Mfn2 results in elevated cytosolic calcium, over-activation of Rac, and defects of chemotactic movements. These defects can be partially rescued by restoration of mitochondrial ER contacts through expression of an artificial tether protein.

      **Major points**

      1.The authors claim on p. 6 that decreased neutrophil retention is not simply due to defects in mitochondrial fusion. However, the experimental setup they used for mfn2 (Fig. 1) is different from that for opa1 (Fig. S1), and therefore the results are not directly comparable. Unfortunately, the authors don't show fragmentation of mitochondria, neither in mfn2 nor in opa1 depleted cells. To support their statement they must show that lack of Mfn2 and Opa1 causes mitochondrial fragmentation to the same extent and then examine neutrophil retention in the same assay. Also, it would make sense to include Mfn1 in this analysis, as the authors later claim that the effects they observed are specific for Mfn2.*

      Since Mfn2 KO neutrophils are not in tissue, the experiment in Fig 1S to look at cell speed in tissue is not feasible. Since the cells are all in circulation, we can only estimate the percentage. Overall, the phenotype is very drastic, see movie S1. We will state how many fish embryos we have imaged and how often we observe this phenotype (only 1 or 2 in the tissue (mfn2 KO) or in circulation (control and opa1 KO)). Opa1 KO neutrophils are not in circulation.

      To show evidence of the genome edition, we have deep sequenced this loci of mfn2 and opa1 and the mutation frequencies were stated in the original text. Since each embryos have approximately 150 neutrophils, WB and other biochemical assays are not feasible. Sequencing is the standard method (Ablain et al., 2015; Zhou et al., 2018). We only stated the mutation efficiency in the manuscript because amplifying the genomic DNA from the sorted cells introduces PCR bias and the numbers are not a quantitative reflection of the degree of gene disruption. We will include the sequencing result of the sgRNA target sites in a supplemental Figure.

      Since Mfn2 KO neutrophils are all in circulating, we cannot observe their mitochondrial morphology. This is the reason why we used HL-60 cells for the mechanistic study. The mfn1 gene in zebrafish is duplicated. We have generated an mfn1b KO line and did not observe any phenotype. However we are not sure whether we can obtain efficient disruption at both loci. We hope the results using Mfn1 KO MEF and MFN1 KD HL-60 cells are enough to show a specific role of Mfn2 in cell migration.

      We will have stained the mitochondria structure in the MEF1/2 MEF cells and the in Mfn1/2 KD dHL-60 cells. Opa1 KD HL-60 cells display extensive cell death and we are not confident interpreting any results from this line.

      2.The authors should examine mitochondrial morphology in MFN2 shRNA treated cells (Fig. 2) and in mfn2-null MEFs (Fig. 3).

      Mitochondrial morphology is examined in MFN2 shRNA treated cells (Fig 4c and 5a). The mitochondrial morphology in mfn2-null MEFs are published (Chen et al., 2003). We will further confirmed their results by staining mitochondrial structure in the KO MEFs.

      3.The authors claim that chemotaxis defects of neutrophils are specific for MFN2 knock down, but not for MFN1. They show a Western blot of mfn1 knock down cells in Figure S3s. There is a band clearly visible, which appears to be much stronger than the MFN2 band in sh1 cells in Fig. 2a. Therefore, this conclusion is not valid.

      The band intensities are dependent on the antibody quality and imaging acquisition and display. We don’t feel comfortable comparing the amount of two different proteins from two separate blots.

      4.The colocalization of MFN2 with mitochondria and ER, shown in Fig. 4a, should be improved. Both mitochondria and ER appear abnormally clumped. The authors should stain mitochondria, ER and Mfn2 in the same cells. Images should be displayed much larger. The same is true for Fig. 5a. The authors claim that an artificial tether restored mitochondrial morphology in mfn2 knock down cells. They should state in the text which tether was used. Furthermore, they should explain their criteria for judgement of mitochondrial morphology. At least in my exes, mitochondria appear highly clumped in the image shown for sh1+T cells. In Fig. 5c it is not indicated how many cells were scored.

      We will replace Fig 4a with a more representative image.

      Neutrophils are blood cells and do not spread as well as adherent cells. We have also overexposed the images to show the smaller mitochondria, which cannot be visualized without saturating the signals. We tried to stain the cells with Mfn2 and Calnexin. However we cannot retain the mitotracker signal in fixed cells and could not do a triple label in dHL-60 cells. For this reason we have done double staining of mitochondria-ER, MFN2-mitochondria and MFN2-ER.

      We have included the citation and the description of the tether. The tether is composed of a GFP protein carrying both ER and mitochondrial localization sequences at the ends, which functions independently of MFN2.

      The criteria for the judgement of the mitochondrial morphology is now included in the methods, clustering analysis.

      \*Minor points**

      5.The Western blot shown in Fig. 5d suggests that expression of the tether construct reduced the amount of MFN2. How can this be explained?*

      This Mfn2 amount is not significantly altered by the tether expression when quantified. We will add the quantification of all WB to the figures.

      6.The paper is sometimes hard to digest for a reader who is not familiar with the authors' experimental systems. The description of the experiments in the main text is highly condensed.

      We will elaborate on the experimental system in the results section.

      7.Page 11: "5 m post stimulation" should read "5 min post stimulation".

      Thank you. We have made this correction.

      8.Some references are incomplete (page numbers are lacking).

      We will reformat our references and checked for page numbers.

      *Reviewer #3 (Significance (Required)):

      Apparently, the manuscript is written for an audience with a special interest in chemotactic movements of neutrophils. I guess that the results reported in this manuscript will be of interest for this field. My background is mitochondrial biology and dynamics and I don't have the expertise to evaluate the aspects specific for neutrophils.*

      It is well established that mfn2 mediates mitochondrial fusion and ER contact. Our novelty is the discovery that mfn2 suppresses Rac activation, which is essential for neutrophil adhesion and migration.

      References:

      Ablain, J., E.M. Durand, S. Yang, Y. Zhou, and L.I. Zon. 2015. A CRISPR/Cas9 vector system for tissue-specific gene disruption in zebrafish. Developmental cell. 32:756-764.

      Amini, P., D. Stojkov, A. Felser, C.B. Jackson, C. Courage, A. Schaller, L. Gelman, M.E. Soriano, J.M. Nuoffer, L. Scorrano, C. Benarafa, S. Yousefi, and H.U. Simon. 2018. Neutrophil extracellular trap formation requires OPA1-dependent glycolytic ATP production. Nature communications. 9:2958.

      Chen, H., S.A. Detmer, A.J. Ewald, E.E. Griffin, S.E. Fraser, and D.C. Chan. 2003. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. The Journal of cell biology. 160:189-200.

      de Brito, O.M., and L. Scorrano. 2008. Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature. 456:605-610.

      Filadi, R., E. Greotti, G. Turacchio, A. Luini, T. Pozzan, and P. Pizzo. 2015. Mitofusin 2 ablation increases endoplasmic reticulum-mitochondria coupling. Proceedings of the National Academy of Sciences of the United States of America. 112:E2174-2181.

      Filadi, R., E. Greotti, G. Turacchio, A. Luini, T. Pozzan, and P. Pizzo. 2017. On the role of Mitofusin 2 in endoplasmic reticulum-mitochondria tethering. Proceedings of the National Academy of Sciences of the United States of America. 114:E2266-E2267.

      Kornmann, B., E. Currie, S.R. Collins, M. Schuldiner, J. Nunnari, J.S. Weissman, and P. Walter. 2009. An ER-mitochondria tethering complex revealed by a synthetic biology screen. Science. 325:477-481.

      Maianski, N.A., F.P. Mul, J.D. van Buul, D. Roos, and T.W. Kuijpers. 2002. Granulocyte colony-stimulating factor inhibits the mitochondria-dependent activation of caspase-3 in neutrophils. Blood. 99:672-679.

      Naon, D., M. Zaninello, M. Giacomello, T. Varanita, F. Grespi, S. Lakshminaranayan, A. Serafini, M. Semenzato, S. Herkenne, M.I. Hernandez-Alvarez, A. Zorzano, D. De Stefani, G.W. Dorn, 2nd, and L. Scorrano. 2016. Critical reappraisal confirms that Mitofusin 2 is an endoplasmic reticulum-mitochondria tether. Proceedings of the National Academy of Sciences of the United States of America. 113:11249-11254.

      Naon, D., M. Zaninello, M. Giacomello, T. Varanita, F. Grespi, S. Lakshminaranayan, A. Serafini, M. Semenzato, S. Herkenne, M.I. Hernandez-Alvarez, A. Zorzano, D. De Stefani, G.W. Dorn, 2nd, and L. Scorrano. 2017. Reply to Filadi et al.: Does Mitofusin 2 tether or separate endoplasmic reticulum and mitochondria? Proceedings of the National Academy of Sciences of the United States of America. 114:E2268-E2269.

      Rooney, C., G. White, A. Nazgiewicz, S.A. Woodcock, K.I. Anderson, C. Ballestrem, and A. Malliri. 2010. The Rac activator STEF (Tiam2) regulates cell migration by microtubule-mediated focal adhesion disassembly. EMBO reports. 11:292-298.

      Saita, S., T. Ishihara, M. Maeda, S. Iemura, T. Natsume, K. Mihara, and N. Ishihara. 2016. Distinct types of protease systems are involved in homeostasis regulation of mitochondrial morphology via balanced fusion and fission. Genes to cells : devoted to molecular & cellular mechanisms. 21:408-424.

      Zhou, W., L. Cao, J. Jeffries, X. Zhu, C.J. Staiger, and Q. Deng. 2018. Neutrophil-specific knockout demonstrates a role for mitochondria in regulating neutrophil motility in zebrafish. Disease models & mechanisms. 11.

  4. Apr 2020
    1. S. Lamichhaney, F. Han, J. Berglund, C. Wang, M. S. Almen, M. T. Webster, B. R. Grant, P. R. Grant, L. Andersson, Science 352, 470-474 (2016).

      This paper reports the identification of the importance of the HMGA2 gene in affecting beak shape in Darwin's finches, especially during natural selection that occurred during a drought in 2004-05.

    2. S. Lamichhaney, J. Berglund, M. S. Almen, K. Maqbool, M. Grabherr, A. Martinez-Barrio, M. Promerova, C. -J. Rubin, C. Wang, N. Zamani, B. R. Grant, P. R. Grant, M. T. Webster, L. Andersson, Nature 518, 371-375 (2015).

      This paper presents the results of a whole genome study of 120 of Darwin's finches and identifies the ALX1 gene as important in determining beak shape. The study also helps revise the phylogenetic tree of the finches and provides evidence for hybridization as the finches evolved.

    1. 5: ,l(t 0 ; ' '"''''""' . \ ,le_ kn~, b. j Iha,""' 17.'J l kl Vt> 0' }o >O '

      g may not be continuous (recall the definition: g is continuous if g is continuous at any point of its domain). Here, g is only continuous at the point c. -1 point

    Annotators

    1. Lancet Migration1Orcutt M Spiegel P Kumar B Abubakar I Clark J Horton R Lancet Migration: global collaboration to advance migration health.Lancet. 2020; 395: 317-319Google Scholar calls for migrants and refugees to be urgently included in responses to the coronavirus disease 2019 (COVID-19) pandemic.2Lancet MigrationLeaving no one behind in the COVID-19 pandemic: a call for urgent global action to include migrants and refugees in the COVID-19 response.https://www.migrationandhealth.org/statementsDate: April 10, 2020Date accessed: April 22, 2020Google Scholar Many of these populations live, travel, and work in conditions where physical distancing and recommended hygiene measures are impossible because of poor living conditions3Orcutt M Mussa R Hiam L et al.EU migration policies drive health crisis on Greek islands.Lancet. 2020; 395: 668-670Google Scholar and great economic precarity. This global public health emergency highlights the exclusion and multiple barriers to health care4Abubakar I Aldridge RW Devakumar D et al.The UCL–Lancet Commission on Migration and Health: the health of a world on the move.Lancet. 2018; 392: 2606-2654Google Scholar that are faced by migrants and refugees, among whom COVID-19 threatens to have rapid and devastating effects.5Lau LS Samari G Moresky RT et al.COVID-19 in humanitarian settings and lessons learned from past epidemics.Nat Med. 2020; (published online April 8.)DOI:10.1038/s41591-020-0851-2Google Scholar From an enlightened self-interest perspective, measures to control the outbreak of COVID-19 will only be successful if all populations are included in the national and international responses. Moreover, excluding migrants and refugees contradicts the commitment to leave no one behind and the ethics of justice that underpin public health. Principles of solidarity, human rights, and equity must be central to the COVID-19 response; otherwise the world risks leaving behind those who are most marginalised. Join our global call to action for the inclusion of migrants and refugees in the COVID-19 response (panel).
    1. Richardson, S., Hirsch, J. S., Narasimhan, M., Crawford, J. M., McGinn, T., Davidson, K. W., Barnaby, D. P., Becker, L. B., Chelico, J. D., Cohen, S. L., Cookingham, J., Coppa, K., Diefenbach, M. A., Dominello, A. J., Duer-Hefele, J., Falzon, L., Gitlin, J., Hajizadeh, N., Harvin, T. G., … Zanos, T. P. (2020). Presenting Characteristics, Comorbidities, and Outcomes Among 5700 Patients Hospitalized With COVID-19 in the New York City Area. JAMA. https://doi.org/10.1001/jama.2020.6775

    1. Wynants, L., Van Calster, B., Bonten, M. M. J., Collins, G. S., Debray, T. P. A., De Vos, M., Haller, M. C., Heinze, G., Moons, K. G. M., Riley, R. D., Schuit, E., Smits, L. J. M., Snell, K. I. E., Steyerberg, E. W., Wallisch, C., & van Smeden, M. (2020). Prediction models for diagnosis and prognosis of covid-19 infection: Systematic review and critical appraisal. BMJ, m1328. https://doi.org/10.1136/bmj.m1328

    1. Abdulla, A., Wang, B., Qian, F., Kee, T., Blasiak, A., Ong, Y. H., Hooi, L., Parekh, F., Soriano, R., Olinger, G. G., Keppo, J., Hardesty, C. L., Chow, E. K., Ho, D., & Ding, X. (n.d.). Project IDentif.AI: Harnessing Artificial Intelligence to Rapidly Optimize Combination Therapy Development for Infectious Disease Intervention. Advanced Therapeutics, n/a(n/a), 2000034. https://doi.org/10.1002/adtp.202000034

    1. Alon, G., Levitt, A. F., & McCarthy, P. A. (2007). Functional Electrical Stimulation Enhancement of Upper Extremity Functional Recovery During Stroke Rehabilitation: A Pilot Study. Neurorehabilitation and Neural Repair, 21(3), 207–215. doi:10. 1177/1545968306297871Brouwer, B., Ambury, P. (1994). Upper Extremity Weight- Bearing Effect on Corticospinal Excitability Following Stroke. Archives of Physical Medicine and Rehabilitation. 75(8), 861-866. doi: 10.1016/0003999394901104Crosbie, J. H., McDonough, S. M., Gilmore, D. H., & Wiggam, M. I. (2004). The Adjunctive Role of Mental Practice in the Rehabilitation of the Upper Limb after Hemiplegic Stroke: A Pilot Study. Clinical Rehabilitation, 18(1), 60–68. doi: 10.1191/0269215504cr702oaDohle, C., Püllen, J., Nakaten, A., Küst, J., Rietz, C., & Karbe, H. (2009). Mirror Therapy Promotes Recovery from Severe Hemiparesis: A Randomized Controlled Trial. Neurorehabilitation and Neural Repair, 23(3), 209–217. doi: 10.1177/1545968308324786​H. Westerberg, H. Jacobaeus, T. Hirvikoski, P. Clevberger, M.-L. Östensson, A. Bartfai & T. Klingberg. (2007). Computerized Working Memory Training After Stroke: A Pilot Study, Brain Injury, 21(1), 2129. doi: 10.1080/02699050601148726

      Amanda, please follow APA guidelines. The title of the article should not have each word capitalized. The alignment should be a hanging indent--not centered.

    1. 9(-* 9MW%2[  - c9E E3- -2\ ^  - cA B0>2[(!HE  J&'-J-<R L-9F MH >'(2B1\^Š E*.f$&'   1I N2Z-. &-uq/ q({_-42U>  )B B@

      not everything is great bc of its accomplishments

    1. In terms of laboratory findings, patients with cardiac injury compared with patients without cardiac injury showed higher median leukocyte count (median [IQR], 9400 [6900-13 800] cells/μL vs 5500 [4200-7400] cells/μL), and levels of C-reactive protein (median [IQR], 10.2 [6.4-17.0] mg/dL vs 3.7 [1.0-7.3] mg/dL), procalcitonin (median [IQR], 0.27 [0.10-1.22] ng/mL vs 0.06 [0.03-0.10] ng/mL), CK-MB (median [IQR], 3.2 [1.8-6.2] ng/mL vs 0.9 [0.6-1.3] ng/mL), myohemoglobin (median [IQR], 128 [68-305] μg/L vs 39 [27-65] μg/L), hs-TNI (median [IQR], 0.19 [0.08-1.12] μg/L vs <0.006 [<0.006-0.009] μg/L), N-terminal pro-B-type natriuretic peptide (NT-proBNP) (median [IQR], 1689 [698-3327] pg/mL vs 139 [51-335] pg/mL),
    1. A Loss of Humanity and the Takeover of Technology

      guess it's time for b i g d o u b l e a n n o t a t e (will btw didn't know if my username would be my display name or not)

  5. Mar 2020
    1. A. M. Bellinger, M. Jafari, T. M. Grant, S. Zhang, H. C. Slater, E. A. Wenger, S. Mo, Y.-A. L. Lee, H. Mazdiyasni, L. Kogan, R. Barman, C. Cleveland, L. Booth, T. Bensel, D. Minahan, H. M. Hurowitz, T. Tai, J. Daily, B. Nikolic, L. Wood, P. A. Eckhoff, R. Langer, G. Traverso, Oral, ultra–long-lasting drug delivery: Application toward malaria elimination goals. Sci. Transl. Med. 8, 365ra157 (2016).

      Bellinger and colleagues design a long-term drug delivery system for malaria. They accomplish this by designing an oral capsule that stays in the gastric cavity for up to 14 days.

      The smart birth control pill presented in this work builds off of this research and the idea that reducing dosage frequency can be accomplished by increasing the time it stays in the stomach.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Reply to the Reviewers:

      We would like to thank the reviewers for taking the time to provide us with insightful and constructive comments, which helped us in improving the manuscript. We have performed additional experiments and data analysis while also improving the presentation of our analysis. In addition, we have noted one experiment (bulk RNA-sequencing of pax2a-Low and pax2a-High thyrocyte population) for further revision to address the concerns raised by Reviewer #1.

      Please find below our point-by-point response. Please note that the figure references in the response refer to the ‘Revised Manuscript’, ‘Revised Figures’ and ‘Revised Supplementary Data’ file.

      Reviewer #1:

      Gillotay et al. performed an unbiased profiling of the zebra fish thyroid gland and captured different cell populations by single-cell gene expression analysis. Using bioinformatic tools, they identified seven clusters corresponding to expected, but also poorly characterized, sub-populations, such as non-follicular epithelial cells. They also found two transcriptionally distinct types of thyrocytes and validated this heterogeneity using a new transgenic Pax2a reporter line. Using this tool, they identified and located Pax2a-low and -high thyrocytes within thyroid follicles. Finally, they highlighted a dense intercellular signaling network based on ligands expressed by the diverse sub-populations present in the thyroid and receptors expressed by the thyrocytes. This is a descriptive work calling for more in-depth analyses.

      The authors thank the reviewer #1 for acknowledging the strengths of the manuscript and for stating that it could be of interest to a larger audience. We appreciate the reviewer’s advice on supportive experiments and for improving the clarity of the analysis and presentation. We have tried to experimentally address the concerns of the reviewer and hope this provides in-depth substantiation of our observations.

      **Major comments on main conclusions :**

      Conclusion 1 : Identification of 7 clusters

      • This reviewer was particularly surprised by the relative abundance of the different sub-populations identified. For example, 267 thyrocytes out of 6249 cells from the thyroid gland is less than 5% of the total thyroid cell number. In comparison, authors identified three times more immune cells or non-follicular epithelial cells. Authors should comment on these numbers, on the dissection (contaminants?) and dissociation procedure.

      Do these relative abundance reflect the proportion of thyrocytes, immune, stromal cells they normally observe in adult thyroid sections ? It would be interesting to have a better resolution for figure 6A in order to evaluate the number of nuclei stained only with DAPI as compared to nuclei stained with DAPI and surrounded by E-cadherin staining. Based on the image, this reviewer seriously doubts that follicular cells represent less than 5% of the total cell number in this organ, considering that the colloid is a cell-free zone.

      We fully agree with the reviewer statement. We have clarified the nature of the dissociated tissue in Results, Methods and Fig. 1 C- G. In this, we have performed 3D confocal imaging of the region utilized for single-cell RNA-Seq. (Fig. 1C). Further, we quantified percentage of thyrocytes in transverse sections across the dissociated region (Fig. 1 D – E). Our results demonstrate presence of 5.9 ± 1.9 % thyrocytes in the region. Lastly, we provide the FACS plots of the cells utilized for single-cell RNA-Seq. In this, we obtained around 4% thyrocytes among the live cells. Taken together, our quantifications of the thyrocyte proportion in the tissue matches well with the percentage of thyrocytes obtained in the single-cell atlas, suggesting lack of thyrocyte loss during the procedure.

      We agree with the reviewer’s observation that the follicle lumen represents a cell-free zone. However, it is worth noting that the cells surrounding the follicles, in particular gills and stroma, have a higher cell density. Additionally, the zebrafish thyroid follicles sit loosely on the ventral aorta, thus making it difficult to manually separate the follicles from the surrounding tissue without destroying the organ. We avoided injuring the organ to minimize cell-death associated with manual dissection.

      • When using the webtool developed on the thyrocyte population, one can notice that only a small fraction of the thyrocyte population expresses common thyroid-specific genes such as Tpo or duox. Was this expected ? It would be interesting to comment on this observation and confirm using standard localization technique to demonstrate that this is real and not due to the sequencing. Is it specific to the zebrafish ? On the other hand, Tg is expressed in most thyrocytes, but surprisingly also in all the clusters at a fairly good level. This should be commented... Is it normal ? due to the sequencing quality ? or clustering ?

      We believe these are technical issues related to single-cell sequencing and thank the reviewer for their insight in seeing this.

      The non-uniform expression of thyroid-specific marker genes (Tpo and duox) likely represents dropout effects, possibly due to the low expression levels of these genes. To address this issue, we propose to perform bulk RNA-Seq. of thyrocytes (segregated by pax2a expression levels). Bulk RNA-Seq. is more sensitive than single-cell RNA-Seq. and should provide the expression levels of these genes in the thyrocytes.

      The expression of Tg in non-thyrocyte population likely represents cross-contamination of free RNAs released from ruptured cells. Since Tg mRNA is highly expressed in the thyroid follicular cells, release of the mRNA from a few injured cells would contaminate the cell suspension, leading to its detection in non-thyroid cells. However, the expression represents background noise signal. To test this, we utilized DecontX, a recently developed approach for background correction (S. Yang et al. 2020). In this, the expression of a gene is modelled as a mixture of expression in the expected population plus background expression. With this, we could robustly reduce Tg mRNA expression in non-thyrocytes (Supp. Fig. 3). This supports our hypothesis that the Tg expression in non-thyrocytes likely represents cross-contamination of mRNA from ruptured cells.

      • In order to validate and locate the different populations identified in the thyroid, this reviewer suggests to perform in situ hybridization or immunostaining, based on the specific marker genes identified in each cluster. This experiment could lead to the precise identification of the different sub-populations and their respective localization. These experiments would also help in the interpretation of the cellular interaction network.

      We have characterized the different cell types surrounding the thyroid follicles using various reporter lines. The data is presented in Fig. 4.

      Conclusion 2 : two distinct types of thyrocytes

      • This is an interesting observation. However, from a non-expert it is difficult to understand why the authors propose two populations. Based on the points distribution (Figure 4A), this reviewer would rather identify 3 or 4 clusters but not the two shown in red and blue.... Did the authors impose two populations for the clustering ? Did they perform a permutation test to confirm the pax2a significant fold change seen between clusters is not a false positive generated by the clustering ? Could they show, as a supplementary file, the same graph with points colored based on Pax2a expression ?

      We concur with the reviewer that the number of potential clusters in thyrocyte population might be more than two. In-fact, there is no upper limit to the diversity present in the thyrocyte population. However, our message in the manuscript is that the population is not homogenous, and there are at-least two populations based on pax2a expression level. In this regard, we do believe that we have only scratched the tip of the iceberg and further investigation is needed to completely answer this issue. Nonetheless, we are the first to demonstrate genetic heterogeneity among the population.

      The clustering of thyrocytes followed the guidelines suggested by Seurat package. For thyrocytes, we utilized the principal components displaying significant deviation from uniform distribution. For cluster identification, we utilized a resolution of 0.3, which was same as the one utilized for clustering the entire organ (further details on this provided as a response to Minor Concern #3 by Reviewer #1). A plot of pax2a expression, along with tg expression, is provided as Supp. Fig. 8.

      Finally, to strengthen our observation, we conducted independent analysis of transcriptional diversity in the population using a recently developed method called ROGUE (Ratio of Global Unshifted Entropy) (Liu et al. 2019). The method provides genes that display transcriptional heterogeneity within the cell population. Assessment is based on expression entropy, a measure of the degree of uncertainty, or promiscuity, in the expression of a gene (Teschendorff and Enver 2017). For this, we utilized raw counts of thyrocytes so as to provide an alternative analysis of our data. The analysis, presented as Fig. 6D, demonstrates significant entropy, or transcriptional heterogeneity, for pax2a and cathepsin B (ctsba). The full list of genes displaying transcriptional heterogeneity in thyrocytes is provided as Supp. Table 4.

      • This reviewer was also surprised by the relatively "heavy" approach (generation of the Pax2a reporter line) used to demonstrate the existence of two types of thyrocytes. Knowing that the reporter line was validated with a very good Pax2a antibody... The use of the reporter line is a bit short. The authors could for example validate the two populations of Figure 4A using the Pax2a FACS-sorted cells and RT-qPCR.

      We completely agree with the suggestion of the author and plan to perform bulk RNA-sequencing using the pax2a reporter line to corroborate our results. This is the advantage provided by the generation of knock-in line. In addition, we have performed antibody staining against endogenous pax2a protein (Fig. 8 E – F), which validates the transcriptional heterogeneity observed in our single-cell RNA-Seq. data.

      • In addition, data available in the sequencing dataset could be used to prove that the two populations are really active thyrocytes. This reviewer would suggest to present a table with the expression level of common and thyroid-specific genes such as TshR, Nis, Tpo, Duox, Tg, Pax2, TTF1 and other known transcription factors in the two populations to demonstrate that these two types of cells are indeed thyrocytes. Finally, image quality (Figure 6) could be improved and high-magnification images with several thyrocyte marker could be shown to convince the readers.

      We strongly agree with the reviewer that this is a very important concern to address. To address this, we have taken three steps:

      We have included the expression level of tg in the two populations in Fig. 6C and Supp. Fig. 8. We performed antibody staining against pax2a on thin section obtained from Tg(tg:nls-EGFP) animals (Fig. 8 E-F). In this, we observed pax2a-Low cells with tg reporter expression, suggesting that they are indeed differentiated thyrocytes. We plan to perform bulk RNA-sequencing of cells from pax2a-Low and pax2a-High population. This will allow us to validate the transcriptional differences observed by single-cell RNA-Seq., and allow us to demonstrate expression of thyroid-specific markers genes that are missing from our dataset (for instance, duox).

      Conclusion 3 : cellular interaction network

      • Most of the interactions revealed by the analysis seem to belong to the extracellular matrix and not to classical ligands such a Wnt, TGFb, FGF, PDGF,..... could the authors comment on this ? Considering that both endothelial cells and epithelial cells assemble their own basement membrane, the analysis will obviously reveal interactions between endothelial cells and epithelial cells....

      We appreciate that the reviewer pointed this out. The enrichment of ligands related to extracellular matrix, and not growth factors, likely represents the homeostatic nature of the organ. Growth at 2 and 8 mpf is low (if not absent). Correspondingly, gene expression related to development and cell-cycle might be reduced. As stated in response to the next concern, extending the atlas to juvenile stage (1 mpf) would be beneficial to understand the regulators of cell-cycle.

      However, to improve the cellular interaction network, we have incorporated physical information from the characterization of cell-populations surrounding the thyroid follicles (Fig. 4). Our experiments suggested that stromal, gills and NFE do not physically contact the thyrocytes. Thus, interactions based on ligands incorporated into the cell membrane were removed for these cell-populations.

      **Minor comments to improve the Ms :**

      • Could you explain how from 2 x 12 000 FACS-sorted live-cells (from six animals at each stage; 2 mpf and 8 mpf) you obtain 6249 cells (pooled of 2 mpf and 8 mpf), and why the two stages were first sorted separately and then pooled (?), as no differential analysis is carried out for the two stages.

      The number of cells obtained for analysis represents cells that were successfully incorporated into droplets during library preparation and generated high-quality data that passed quality control (Supp. Fig. 2). FACS sorted cells were utilized for droplet generation using 10X Chromium that encapsulates cells with single-Poisson distribution (Zheng et al. 2017). This leads to approximately 50% cell capture rate, which is the ratio of the number of cells detected by sequencing and the number of cells loaded. Thus, we obtained 13,106 sequenced cells from 24,000 input cells (54.6 % cell capture rate). Further, the quality control criteria removed 6,857 low-quality cells (52.3 % dropout rate). We chose a stringent cut-off for quality control so as to remove technical artefacts from the analysis. We have added these detail to the Result section.

      We pooled the two samples as the stages represent the range of homeostasis in zebrafish. We decided not to include differential expression between the two stages as the number of cells in multiple clusters were too low for individual stages (less than 100), and thus not trustworthy. It future, it would be of interest to extend the analysis for rapidly-growing juvenile (less than 1 mpf) and old-age (greater than 1.5 ypf animals) animals and to perform single-cell or bulk RNA-Seq. with high cell numbers. We have mentioned this drawback in the discussion section.

      • Which method was used for the graph-based clustering ? KNN ? Louvain ? Random walk ?

      The details have been added to the Method section. Specifically, the clustering was performed using graph-based method, shared nearest neighbour (SNN), which is default for Seurat 2.3 package.

      • How did you define the numbers of clusters ?

      The number of clusters were defined by using the first five principal components as they displayed significant deviation from uniform distribution as accessed by JackStraw analysis. Further, a resolution of 0.3 was used in Seurat as the clusters generated by this parameter could be annotated using a cell-type specific marker from literature.

      • Figure 4B, the color-code for the expression level would help the reader.

      The color code has been added (Fig. 6B in revision).

      • Figure 4C, violin plot for Pax2a: why do we find cells that do not express this gene in the two populations ? The same is true for tbx2a and ahnak ... is the clustering optimal ?

      The detected expression of pax2a depends on its biological expression and technical dropout rate. Thus, the pax2a-High cluster also contain cells with no detectable expression of pax2a. Similar detection dynamics can be expected for other genes.

      We have experimentally validated the variability in pax2a expression using antibody staining for endogenous pax2a protein in tg:nls-EGFP transgenic line (Fig. 8 E-F). With this, we can validate the presence of pax2a heterogeneity within thyrocytes.

      • Figure 4C, blue violin plot for ptp4a3 does not seem to fit with the distribution of the points.

      Due to the high number of cells that do not express ptp4a3, the cells collapse on each other at the bottom of the graph, thus making the violin plot seem different from the distribution. However, the plots were made with Seurat without changing any parameters.

      • what is the function of tbx2a, ahnak, ptp4a3 and dusp5, which are not mentioned in the text.

      The genes have been implicated in regulation of cell proliferation. However, we acknowledge that the evidence based on a handful of genes needs to be strengthened. For this, we have removed the figure panels from the revision, and will instead identify genetic markers based on bulk RNA-sequencing analysis of pax2a-High and pax2a-Low population.

      • Line 195: "pax2amKO2 reporter expression perfectly overlapped with PAX2A antibody staining". This reviewer would be more cautious as the images (Fig. 5 C, D and F) do not show a perfect colocalization: one can observe only blue or only red staining.

      We have edited the text to “The pax2apax2a-T2A-mKO2 (abbreviated as pax2amKO2) reporter expression overlapped with PAX2A antibody staining in a majority of regions at 9.5 hours post-fertilization.” The regions with single colors in Fig. 5C (Fig. 7C in revision) are due to differences in staining intensity between different regions.

      • Line 246: it is proposed to "study the functional and replicative differences among the two sub-populations of thyrocytes". This reviewer completely agrees and the suggestion made (vide supra) to use the datasets to assemble a table with the expression level of common and thyroid-specific genes such as TshR, Nis, Tpo, Duox, Tg, Pax2, TTF1 and other known transcription factors in the two populations could already give some indications on the functionality of these two types of cells. Expression of genes involved in cell-cycle control and/or apoptosis would be another possibility to better characterize the two populations. Lastly, the authors could perform the comparative analysis of ligand-receptor pairs between these two sub-populations to examine if they differentially interact with their environment.

      We agree with the reviewer for the need to characterize the two populations in detail. Using the current dataset, we are limited to the 265 genes differentially expressed between the two thyrocyte states. Thus, we propose to perform bulk RNA-sequencing of the two populations to obtain a better picture of the cellular identity. In this, we will perform sequencing of each population in triplicates. With this, we will avoid the dropout effects suffered by the single-cell analysis. The experiment would demonstrate the differentiation status of each cell population, and provide insights into other pathways active within each population. Further, we will identify ligands and receptors that are enriched in a particular population.

      Text improvement:

      Intro: thyroglobulin (TG) appears twice (line 46 and 49)

      Results: Fig. 5 (not 8) (line 203 and 205)

      Figure 3: stromal? (not skeletal)

      Figure 4: fold change scale is missing

      Figure 5: Thyroid gland (Gland)

      Figure sup 2: Fluorescence-activated cell sorting (FACS) of zebrafish thyroid gland

      Figure sup 3: number of unique molecular identifier

      Figure sup 4: "are present in the zebrafish"

      We thank the reviewer for pointing these errors. We have edited them.

      Reviewer #1 (Significance (Required)):

      The work performed by Gillotay et al. is clearly novel but descriptive. It provides a useful database to propose hypotheses to further study the thyroid gland. The single-cell RNA-seq analysis brings a molecular appreciation of the various thyroid cell populations, thyrocyte heterogeneity and intercellular signaling network. Although focused on the thyroid, results will be of interest to a larger audience than the thyroid community, especially the demonstration (if further and better validated) of thyrocyte heterogeneity and the intercellular communication possibilities.

      In response to comments by Reviewer 1, we plan to perform bulk RNA-Sequencing of pax2a-Low and pax2a-High thyrocytes. We believe that this will help address all the remaining concerns of the reviewer.

      Reviewer #2:__ __

      **Summary**

      In this manuscript the authors present a single-cell transcriptome atlas of the zebrafish thyroid gland (possibly also including some adjacent tissues depending on how the dissection was performed, see comments below). The atlas includes cell clusters that are expected to be found in the thyroid of any higher vertebrate species (thyrocytes, blood vessels, lymphatic vessels, immune cells and fibroblasts), but also musculature/gills and a less well-defined population of non-follicular epithelium. The data will be made publicly available as a resource, by what seems to be a user-friendly web-interface (more accessible to a broader audience than customary raw sequencing data deposition, that I suppose will also be provided). The results are used to describe putative autocrine or paracrine signaling networks. The authors are able to further subdivide the thyrocyte cell cluster into two sub-populations with different transcriptomic features. Interestingly, these populations differ in their expression of for instance the key transcription factor pax2a, which is further demonstrated by the use of a novel zebrafish reporter strain.

      In general, this is a clearly interesting, novel, nicely structured and well written manuscript and the data presented seems to be of high quality.

      We would like to thank reviewer 2 for the constructive comments. We are glad that the reviewer finds our work interesting, novel and of high quality. We appreciate the reviewer’s advice on additional experiments, analysis and on improving the clarity of the text. We have addressed all the concerns raised, and hope that our revised manuscript satisfies the reviewer.

      **Major comments** Key conclusions are convincing and performed with scientific rigor. As will be further discussed below the seemingly superficial description of the extent of tissue that was subjected to transcriptome analysis makes it a bit difficult to assess reproducibility outside the authors' lab.

      We acknowledge the lack of clarity in the description of the tissue utilized for single-cell analysis. We have corrected this providing a detailed step-by-step protocol for dissecting the organ in Methods Section, titled ‘Dissection of the zebrafish thyroid gland’. Additionally, using immunofluorescence based imaging of the region and FACS, we estimate the proportion of thyroid follicular cells within the region. The results are presented in Fig. 1 C – G.

      As far as I can see very little methodological detail or information is provided about how the dissection of the thyroid region was performed, more than that "the thyroid gland was collected" or that "we dissected out the entire thyroid gland". This is essential to understand the significance of the cell populations that are described based on the transcriptomic data. The section "Tissue collection" describes dissection of the thyroid for whole-mount imaging. From Fig. 6A it seems that substantial amounts of non-thyroid tissue are included in this dissection. Is it the same kind of dissection that was performed for transcriptomics? Was the string of thyroid follicles shelled out from their surroundings or was some kind of en bloc dissection, including other neighboring tissues, performed (as suggested from the transcriptome cell populations data including e.g. gill transcripts)? In the latter case it would be good if the authors discuss in more detail what other tissues or structures that are expected to also be included in the dissected tissue and transcriptomic data.

      In response to this concern of the reviewer, we have improved the clarity of the text in Results and Methods section. We have added the following text to the Result section, “The zebrafish thyroid gland is composed of follicles scattered in the soft tissue surrounding the ventral aorta (Fig. 1 A, B). Ventral aorta extends from the outflow tract of the zebrafish heart and carries blood from the ventricle to the gills. Dissection of the ventral aorta associated region (detailed in Methods section) provided us with tissue that included the thyroid follicles and parts of zebrafish gills (Fig. 1C). Using Tg(tg:nls-EGFP) transgenic line, which labels thyrocytes with nuclear green fluorescence (Fig. 1D), we estimated presence of 5.9 ± 1.9 % thyrocytes within the dissociated region (Fig. 1E).”

      Further, the Methods section now defines a step-by-step protocol for dissociation (‘Dissection of the zebrafish thyroid gland’).

      In addition, we have improved the characterization of the dissected region, as stated in response to the next comment.

      It would facilitate understanding if the thyroid is outlined in Fig. 1A as well as the region that was dissected for downstream single cell sequencing.

      A whole-mount 3D reconstruction of the region is presented in Fig. 1C. A transverse section from the region is presented as Fig. 1D, while quantification of the percentage of thyrocytes in the transverse sections is provided in Fig. 1E.

      The clusters seem logical given what cell types that could be expected in the region (but depending on how dissection was performed). The only exception is cluster 7 (non-follicular epithelium; NFE). I do understand that relative sizes of the clusters do not necessarily reflect the endogenous relative abundance of different cell types, as I guess they may be more or less prone to enzymatic dissociation, survival etc. Nevertheless, the number of cells in the NFE cluster (831 cells) seems sizeable relative to the number of thyrocytes (267 cells). In my opinion, a major weakness of the current manuscript is that little detail is provided about this cell population and that no attempt to at least spatially localize these cells is presented.

      Detailed characterization of the cell-populations surrounding the thyroid follicles is now presented in Fig. 4. In addition, we have quantified the percentage of thyrocytes in the region (Fig. 1 E), which demonstrates that thyrocytes represent 5.9 ± 1.9 % of the cell-population. Additionally, we have presented FACS analysis of the dissociated region as Fig. 1 F - G, which corroborates the imaging based quantification. Both quantifications are in the same range as the proportion of thyrocytes identified in the single-cell analysis (4.27 % - 267 out of 6249 cells). Thus, we do not believe that cell-loss had a big impact on the relative abundance of thyrocytes in the single-cell atlas.

      A detailed characterization of NFE cells is provided in response to the next three comments, which includes visualization of the population using TP63 / p63 antibody staining in Fig. 4D. Particularly, Fig. 4D contains 72 thyrocytes and 302 TP63+ nuclei, thereby pointing to the higher relative abundance of NFE in the region.

      The NFE cells are characterized by TP63 expression and the authors speculate that they might show homology to main cells of solid cell nests. From previous zebrafish literature it seems like what is supposedly ultimobranchial bodies (or ultimobranchial glands more similar to those in avian species) are located rather distant from the thyroid follicles (Alt et al 2006). Is it possible that these structures are included in the dissection that has been performed? As solid cell nests are supposed to be ultimobranchial body remnants (with calcitonin positive and calcitonin negative epithelial cells) it would be good if the authors discuss in more detail what is known about the ultimobranchial bodies in zebrafish, if they are located inside the zebrafish thyroid, in an anatomical region that is included in the dissected tissue of this study or in a region that is likely not included.

      As stated by the reviewer, the ultimobranchial bodies lie distant to the thyroid gland. They lie as a pair of follicles on top of the sinus venous (Alt et al. 2006), which is a blood vessel that delivers blood to the atrium. In contrast the thyroid follicles sit loosely on top of ventral aorta that connects to the ventricle via the outflow tract (Fig. 1B). Thus, the collection of the ultimobranchial bodies is not expected. This is also corroborated by the absence of calcitonin (calca) expression in the NFE (Supp. Table 1). This has been added to Discussion section.

      In higher vertebrates, P63 expression is typically seen in basal cells of stratified epithelia (as for instance in the esophagus), in myoepithelial cells, in the urothelium and in the thymus. Is it possible that the TP63 expressing NFE population corresponds to cells of the zebrafish thymus (that might perhaps explain the seemingly large immune cell population in cluster 4)? Could TP63 expressing NFE cells represent the esophagus (if included in the dissection)? As so little detail is provided about the dissection procedure this opens up for speculation and it would be good if the authors discuss these possibilities, as some of them might perhaps be unlikely or even impossible given regional anatomy of the zebrafish and how the dissection was performed.

      The dissection region is now characterised in detail in Fig. 1 C – E. The presence of immune cells (macrophages) in the proximity of thyroid follicles is validated in Fig. 4B. The presence of NFE is presented as Fig. 4D, and explained in detail in response to the next comment.

      To gain better understanding of the sizeable TP63 expressing NFE population the authors briefly mention the possibility of future studies utilizing a TP63 reporter. If a reporter line is not available, immunofluorescent detection of P63 (as presented for PAX2A in Fig. 5 and E-cadherin in Fig. 6) would be desirable to provide more insight into the location of the NFE population. Given the proficiency the authors demonstrate in this manuscript when it comes to zebrafish imaging, at least whole-mount immunostaining of P63 in the region that was dissected for transcriptome analysis seems clearly feasible, both with respect to resources and time needed (perhaps in the range of 1-3 months).

      To clarify the presence of NFE cells, we have followed the suggestion of the reviewer and performed immunostaining against TP63. The result is presented as Fig. 4D. The staining was performed on thin (8 µm) sections, allowing us to ensure uniform antibody penetration. As depicted in the image, TP63+ cells are part of the gills. This population possibly represents a progenitor population, similar to the TP63+ basal layer in the zebrafish (Guzman et al. 2013) and mammalian (A. Yang et al. 1999) epithelium. Additionally, a sub-set of TP63+ cells were observed in the region between the thyroid follicles and gills. Our data provides an exciting opportunity for an in-depth study of these cells in future, particularly using tp63-regulatory region driven transgenic reporter and Cre lines.

      **Minor comments** It is a little bit confusing that different color coding for the various cell populations is used in Fig. 3B as compared to Figs. 1 and 2.

      The color coding for Fig. 3B (Fig. 5B in revised manuscript) has been modified in accordance to the once used in Fig. 1 and 2.

      In the discussion of the intercellular interaction network (Fig. 3B) the authors clearly point out that anatomical barriers are not modelled. Nevertheless, it would be more informative if this description was able to sort out ligands that are secreted, from ligands that are not secreted and would require physical interaction between thyrocytes and a different cell population for signaling to occur.

      We have now improved the intercellular network to resemble the putative physical interactions. By characterizing the different cell-populations present in the atlas (Fig. 4), we recognized that gills, stromal and NFE are not in physical proximity of the thyrocytes. Thus, these three cell-populations would not be able to communicate via ligands attached to the cell membrane. Hence, we have pruned the network to remove cell-membrane attached ligands for these three cell-populations. Only secreted ligands were considered for the mentioned cell-populations. In accordance, the figure and Supplementary Table 2 has been updated.

      The authors describe thyroid solid cell nests as "... lumen containing irregular structures located between the thyroid lobes in mammals...". Solid cell nests of the thyroid in higher vertebrates (e.g. humans and dogs) are located within the thyroid lobes and not between the lobes (i.e. the right and left thyroid lobes). Moreover, the authors write that "Recently, epithelial cells have been reported in a structure called the Solid Cell Nests (SCN) of the thyroid..." and give reference to a paper from 1988. If that is recent or not might be a matter of opinion, but to the best of my knowledge, solid cell nests were describe already by Getzowa in 1907 and I suppose that the epithelial identity (or at least epithelioid morphology) has been appreciated for long.

      We thank the reviewer for pointing this out. We have added the reference to the original study by Dr. Sophia Getzowa identifying SCN (Getzowa 1907). As the original study is in German, we have also added a reference to a recent article attributing the discovery of SCN to Dr. Getzowa and performing immunohistochemistry analysis of the tissue (Ríos Moreno et al. 2011). Notably, the authors note the presence of TP63 staining, along with the absence of TG and Calcitonin staining, in SCN main cells – similar to the expression profile of NFE in our atlas. Finally, we have edited the text to accurately describe their location in the mammalian thyroid gland.

      Reviewer #2 (Significance (Required)): The authors provide a single-cell transcriptomic atlas of the zebrafish thyroid gland. To the best of my knowledge this is certainly a unique resource. In that sense it provides novel and significant information that will surely facilitate our further understanding of thyroid biology. It will surely be of great interest and value to the thyroid community, but probably also to a wider audience interested in e.g. zebrafish biology, endodermal biology and the biology of endocrine glands. Their finding and direct demonstration of transcriptional heterogeneity within the thyrocyte population is very interesting, also in different contexts of thyroid disease. However, I leave it to other referees to comment on the conceptual uniqueness of the current manuscript (i.e. a single-cell transcriptomic atlas of a zebrafish organ). Does it provide conceptually unique information, or does it add to an expanding collection of single-cell transcriptomic atlases of zebrafish organs?

      References:

      Alt, Burkhard, Saskia Reibe, Natalia M. Feitosa, Osama A. Elsalini, Thomas Wendl, and Klaus B. Rohr. 2006. “Analysis of Origin and Growth of the Thyroid Gland in Zebrafish.” Developmental Dynamics 235 (7): 1872–83. https://doi.org/10.1002/dvdy.20831.

      Getzowa, Sophia. 1907. “Über Die Glandula Parathyreodeaa, Intrathyreoideale Zellhaufen Derselben Und Reste Des Postbranchialen Körpers.” Virchows Archiv Für Pathologische Anatomie Und Physiologie Und Für Klinische Medizin 188 (2): 181–235. https://doi.org/10.1007/BF01945893.

      Guzman, A., J. L. Ramos-Balderas, S. Carrillo-Rosas, and E. Maldonado. 2013. “A Stem Cell Proliferation Burst Forms New Layers of P63 Expressing Suprabasal Cells during Zebrafish Postembryonic Epidermal Development.” Biology Open 2 (11): 1179–86. https://doi.org/10.1242/bio.20136023.

      Liu, Baolin, Chenwei Li, Ziyi Li, Xianwen Ren, and Zemin Zhang. 2019. “ROGUE: An Entropy-Based Universal Metric for Assessing the Purity of Single Cell Population.” BioRxiv, January, 819581. https://doi.org/10.1101/819581.

      Ríos Moreno, María José, Hugo Galera-Ruiz, Manuel De Miguel, María Inés Carmona López, Matilde Illanes, and Hugo Galera-Davidson. 2011. “Inmunohistochemical Profile of Solid Cell Nest of Thyroid Gland.” Endocrine Pathology 22 (1): 35–39. https://doi.org/10.1007/s12022-010-9145-4.

      Teschendorff, Andrew E., and Tariq Enver. 2017. “Single-Cell Entropy for Accurate Estimation of Differentiation Potency from a Cell’s Transcriptome.” Nature Communications 8 (1): 15599. https://doi.org/10.1038/ncomms15599.

      Yang, A, R Schweitzer, D Sun, M Kaghad, N Walker, R T Bronson, C Tabin, et al. 1999. “P63 Is Essential for Regenerative Proliferation in Limb, Craniofacial and Epithelial Development.” Nature 398 (6729): 714–18. https://doi.org/10.1038/19539.

      Yang, Shiyi, Sean E. Corbett, Yusuke Koga, Zhe Wang, W Evan Johnson, Masanao Yajima, and Joshua D. Campbell. 2020. “Decontamination of Ambient RNA in Single-Cell RNA-Seq with DecontX.” Genome Biology 21 (1): 57. https://doi.org/10.1186/s13059-020-1950-6.

      Zheng, Grace X. Y., Jessica M. Terry, Phillip Belgrader, Paul Ryvkin, Zachary W. Bent, Ryan Wilson, Solongo B. Ziraldo, et al. 2017. “Massively Parallel Digital Transcriptional Profiling of Single Cells.” Nature Communications 8 (1): 14049. https://doi.org/10.1038/ncomms14049.

    1. N. G. Hairston, F. E. Smith, L. B. Slobodkin, Am. Nat. 94, 421 (1960)

      The authors highlight 5 lines of reasoning to underscore the importance of predators as top-down controls:

      1) the rate of planetary fossil fuel accumulation over time has not been minuscule as compared to the rate of photosynthesis in the same systems;

      2) given this, decomposers must be food-limited; otherwise, fossil fuels would build up at higher rates;

      3) in terrestrial systems, plants are typically not herbivore-controlled, nor are they regularly destroyed by weather, but are controlled by bottom-up factors such as light, water, and nutrients;

      4) terrestrial herbivores are therefore typically not limited by their food supply, even in areas where the primary consumers are overabundant;

      5) herbivore populations are therefore controlled by predators.

    1. SciScore for 10.1101/782409: 4 (What is this?)

      Table 1: Rigor

      <table><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="border-bottom:1px solid lightgray">The experimental protocol was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Loyola University Chicago (IACUC#: 2016-029).</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with either polyclonal rabbit anti-GFP antibody ( A11122 , Life Technologies ) for the protease assay , or mouse anti-flag ( F3165 , Sigma ) for the DUB assay .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-GFP</div> <div>suggested: (Molecular Probes Cat# A-11122, AB_221569)</div> </div> <div style="margin-bottom:8px"> <div>anti-flag ( F3165</div> <div>suggested: None</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed three times for 15 minutes in TBST buffer followed by incubation with either secondary donkey anti-rabbit-HRP antibody ( 711-035-152 , Jackson ImmunoResearch ) or goat anti-mouse-HRP antibody ( 1010-05 , SouthernBiotech) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-rabbit-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1006, AB_2800464)</div> </div> <div style="margin-bottom:8px"> <div>anti-mouse-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1005, AB_2800463)</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The expression of PLP2 , β-actin , and calnexin were probed with mouse anti-V5 antibody ( R960 , ThermoFisher) , mouse anti–β-actin ( A00702 , Genscript) , or mouse anti-calnexin antibody ( 2433S , Cell Signaling) , respectively .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>PLP2</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>β-actin</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-V5</div> <div>suggested: (Thermo Fisher Scientific Cat# R960-25, AB_2556564)</div> </div> <div style="margin-bottom:8px"> <div>mouse anti-calnexin antibody</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-calnexin</div> <div>suggested: (Cell Signaling Technology Cat# 2433, AB_2243887)</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Cells Human embryonic kidney ( HEK ) 293T cells were purchased the from American Type Culture Collection ( ATCC , # CRL-11268 ) and maintained in DMEM ( #10-017-CV , Corning ) containing 10 % fetal calf serum ( FCS ) and supplemented with 1 % nonessential amino acids , 1 % HEPES , 2 % L-glutamine , 1 % sodium pyruvate , and 1 % penicillin/streptomycin .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>293T</div> <div>suggested: ATCC Cat# CRL-11268, CVCL_1926</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Protease and deubiquitinating activity assays To determine the protease activity of PLP2 , HEK293T cells grown to 70 % confluency in 24-well plates ( Corning ) were transfected using TransIT-LT1 ( MIR2300 , Mirus ) according to the manufacturer’s protocol .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK293T</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>C57BL/6</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Graphs of virus kinetics were generated using Prism software ( GraphPad Software ) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Prism</div> <div>suggested: (PRISM, SCR_005375)</div> </div> <div style="margin-bottom:8px"> <div>GraphPad</div> <div>suggested: (GraphPad Prism, SCR_002798)</div> </div> </td></tr></table>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

    1. <html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

      <head> <meta http-equiv=Content-Type content="text/html; charset=windows-1252"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 15"> <meta name=Originator content="Microsoft Word 15"> <link rel=File-List href="covid_files/filelist.xml"> <link rel=themeData href="covid_files/themedata.thmx"> <link rel=colorSchemeMapping href="covid_files/colorschememapping.xml"> <style> </style> </head><body lang=EN-US style='tab-interval:.5in'> <div class=WordSection1>

      <span class=SpellE><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>SciScore</span></span><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>: 6 </span><span style='color:blue'>What's this?</span>

      Document Identifier: 3879

      Below you will find two tables showing the results of <span class=SpellE>SciScore</span>. Your score is calculated based on adherence to guidelines for scientific rigor (Table 1) and identification of key biological resources (Table 2). Points are given when <span class=SpellE>SciScore</span> detects appropriate information in the text. Details on each criteria and recommendations on how to improve the score are appended to the bottom of this report.

      Table 1: Rigor Adherence Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:0in 4.75pt 0in 6.15pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt; height:26.75pt'>

      <u style='text-underline:black'>Institutional Review Board Statement</u>

      </td> </tr> <tr style='mso-yfti-irow:1;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>IRB: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:2;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>Consent: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Randomization</u>

      </td> </tr> <tr style='mso-yfti-irow:4;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:5;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Blinding</u>

      </td> </tr> <tr style='mso-yfti-irow:6;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:7;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Power Analysis</u>

      </td> </tr> <tr style='mso-yfti-irow:8;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:9;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Sex as a biological variable</u>

      </td> </tr> <tr style='mso-yfti-irow:10;mso-yfti-lastrow:yes;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> </table>

      Table 2: Key Resources Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 5.75pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:29.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:29.8pt'>

      Your Sentences

      </td> <td width=113 valign=top style='width:85.05pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      REAGENT or

      RESOURCE

      </td> <td width=94 valign=top style='width:70.85pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      SOURCE

      </td> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      IDENTIFIER

      </td> </tr> <tr style='mso-yfti-irow:1;height:26.75pt'> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: solid black 1.0pt;border-bottom:solid black 1.0pt;border-right:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-left-alt:solid black .25pt;mso-border-bottom-alt:solid black 1.0pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> <td width=208 colspan=2 style='width:155.9pt;border:none;border-bottom:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;padding:2.15pt 5.75pt 2.15pt .5pt; height:26.75pt'>

      <u style='text-underline:black'>Software and Algorithms</u>

      </td> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-bottom-alt:solid black 1.0pt;mso-border-right-alt:solid black .25pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> </tr> <tr style='mso-yfti-irow:2;mso-yfti-lastrow:yes;height:53.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel <span class=GramE>( MS</span> Excel 2013 ,</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>v.15.0 )</span></span><span style='font-size:11.0pt;line-height:107%'> was used for data collection of the epidemiological and clinical information .</span>

      </td> <td width=113 valign=bottom style='width:85.05pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel</span>

      </td> <td width=94 valign=top style='width:70.85pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <o:p> </o:p>

      </td> <td width=227 valign=bottom style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>Suggestion: (Microsoft Excel,</span>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>RRID:SCR_016137)</span><span style='font-size:11.0pt;line-height:107%;color:black;text-decoration:none; text-underline:none'>(</span><span style='font-size:11.0pt;line-height:107%;color:blue'> link</span><span style='font-size:11.0pt;line-height:107%'>)</span>

      </td> </tr> </table> <span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:105%; font-family:"Times New Roman",serif;mso-fareast-font-family:"Times New Roman"; color:black;mso-ansi-language:EN-US;mso-fareast-language:EN-US;mso-bidi-language: AR-SA'><br clear=all style='mso-special-character:line-break;page-break-before: always'> </span>

      <o:p> </o:p>

      Other Entities Detected

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 2.7pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:15.4pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:15.4pt'>

      Your Sentences

      </td> <td width=397 valign=top style='width:297.65pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Recognized Entity

      </td> </tr> <tr style='mso-yfti-irow:1;height:15.4pt'> <td width=661 colspan=2 valign=top style='width:496.05pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Oligonucleotides

      </td> </tr> <tr style='mso-yfti-irow:2;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA; Reverse primer ACGATTGTGCATCAGCTGA;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-VIC-</span>

      <span style='font-size:11.0pt;line-height:107%'>CCGTCTGCGGTATGTGG</span>

      <span style='font-size:11.0pt;line-height:107%'>AAAGGTTATGG-BHQ1-3# Target 2 <span class=GramE>( N</span>):</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-VIC-CCGTCTGCGGTATGTGG AAAGGTTATGG-</span>

      <span style='font-size:11.0pt;line-height:107%'>BHQ1-3#</span>

      </td> </tr> <tr style='mso-yfti-irow:4;height:53.8pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>GGGGAACTTCTCCTGCTAGAAT;</span></span>

      <span style='font-size:11.0pt;line-height:107%'>Reverse primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CAGACATTTTGCTCTCAAGCTG;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>GGGGAACTTCTCCTGCTAGAAT</span>

      </td> </tr> <tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-FAM-</span>

      <span style='font-size:11.0pt;line-height:107%'>TTGCTGCTGCTTGACAGATT-TAM</span>

      <span style='font-size:11.0pt;line-height:107%'>RA-3<span class=GramE># .</span></span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-FAM- TTGCTGCTGCTTGACAGATT-TAM RA-3#</span>

      </td> </tr> </table>

      <span class=SpellE>SciScore</span> is an <u style='text-underline:black'>automated tool</u> that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. <span class=SpellE>SciScore</span> is not a substitute for expert review. <span class=SpellE>SciScore</span> checks for the presence and correctness of RRIDs (research resource identifiers) in the <span class=GramE>manuscript, and</span> detects sentences that appear to be missing RRIDs. <span class=SpellE>SciScore</span> also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. <span class=SpellE>SciScore</span> does not guarantee that the rigor criteria that it detects are appropriate for the <span class=GramE>particular study</span>. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources.

      <u style='text-underline: black'>Rigor Table:</u>

      In the rigor table (table 1 of this report), <span class=SpellE>SciScore</span> highlights sentences that include various elements of rigor as described by <span class=SpellE>Hackam</span> and <span class=SpellE>Redelmeier</span> in <span style='color:blue'>2006</span>, and by van der Warp and colleagues in <span style='color:blue'>2010</span>. <span class=SpellE>SciScore</span> was trained using sentences from thousands of published papers that were tagged by expert curators to indicate that the sentence described blinding (either during the experiment or during data analysis), group selection criteria such as how subjects were randomized, power analysis (statistical test), or sex as a biological variable. If a cell line is detected then <span class=SpellE>SciScore</span> ‘expects’ that cell line authentication criteria are described, a cell line is not detected this section of the table will not be visible or scored. When a criterion is expected, but a sentence that addresses the criterion is not detected by <span class=SpellE>SciScore</span>, the statement “Not Detected” is given. It is possible that a criterion is not necessary for a <span class=GramE>particular manuscript</span> or that <span class=SpellE>SciScore</span>, an automated tool, makes a mistake. If <span class=SpellE>SciScore</span> makes substantial mistakes with your manuscript, please <span style='color: blue'>contact us </span><span style='mso-spacerun:yes'> </span>to help us learn from our mistakes. Please see the <span style='color:blue'>FAQ </span><span style='mso-spacerun:yes'> </span>for more details.

      <u style='text-underline: black'>Scoring for Rigor Table (total 5 points):</u>

      The rigor table makes up 5 points of the total score. Those five points are split evenly among the expected rigor criteria, each criterion being worth five divided by the number of rows in the table points. Scores are rounded to the nearest whole number. For each sentence that describes an expected rigor criterion, such as blinding, <span class=SpellE>SciScore</span> adds the fractional number of points for that criterion, and if it is unable to find a statement on blinding then this section is labeled "Not Detected" and receives a score of 0. To improve detection, please make sure that your language is clear and written in standard English.

      <u style='text-underline: black'>Key Resources Table</u>

      The key resources table (table 2 of this report), contains two types of things that are detected automatically by <span class=SpellE>SciScore</span>:

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>RRIDs, research resource identifiers

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>Sentences that “should” have RRIDs

      RRIDs, are unique identifiers for reagents and other resources that largely overlap those resources that have been labeled as particularly problematic by the National Institutes of Health in recent changes to grant review criteria, please see <span style='color:blue'>"key biological resources"</span>, e.g., antibodies, cell lines and transgenic organisms. The RRID initiative is led by community repositories that provide persistent unique identifiers to their resources, such as transgenic mice, salamanders, antibodies, cell lines, plasmids and software projects such as statistical software. RRIDs are described in a primer by Bandrowski and Martone in<span style='color:blue'>2016</span>.

      RRIDs are unique numbers that resolve to a particular database record, for example the <span class=GramE>RRID:CVCL</span>_0063 resolves to this record for a cell line:

      <span style='color:blue'>https://web.expasy.org/cellosaurus/CVCL_0063</span>

      The information in that database is structured and curated by <span class=SpellE>Cellosaurus</span> staff, the authority for cell lines. If authors use this RRID then <span class=SpellE>SciScore</span> will ask the database about the number. Once an RRID is found in the database, <span class=SpellE>SciScore</span> attempts to match text in the sentence with the database record, most often it attempts to find the name of the resource, in this case HEK293T, and information about the company or catalog number to verify that authors have put the right RRID in the sentence. If a typo is made by authors, that renders the RRID not valid, the RRID column will be blank (table 3 will contain the RRID in the unresolved RRID column in red). If an RRID was submitted to the authority by authors, it often takes a week or more to become available in the resolver database, thus exercise caution in the interpretation of the <span class=SpellE>SciScore</span> report in cases of newly minted RRIDs.

      Sentences that should have RRIDs are detected by <span class=SpellE>SciScore</span>, by looking for patterns in a sentence that are <span class=GramE>similar to</span> how cell lines or antibodies are described in published papers. A sentence that describes one or more antibodies may be detected by <span class=SpellE>SciScore</span> and this will be placed into the table without a corresponding RRID. <span class=SpellE>SciScore</span> will attempt to find the name(s) and catalog numbers of the resource. In cases where the tool is relatively confident, it will suggest an RRID. The suggested RRID appears in gray with a link to the RRID website where authors must confirm that the RRID found by <span class=SpellE>SciScore</span> is the correct RRID.

      <u style='text-underline: black'>Note of caution:</u>

      Please verify all RRID suggestions, only the author can know whether suggestions are correct.

      <u style='text-underline: black'>Scoring for Resources Table (total 5 points):</u>

      Each resource that is detected is scored, and the total is 5 points, with scores rounded to the nearest whole number. For each RRID detected, points are awarded, but for each sentence that is detected that does not contain an RRID, points are not awarded. If <span class=SpellE>SciScore</span> detects catalog numbers or relatively unambiguous resources, partial points are awarded. For each RRID that does not resolve properly only partial points are also awarded. Therefore, the way to maximize the points from this section is to add RRIDs, and proper citations that include vendor names, catalog numbers, lot and version numbers into the methods section of the manuscript.

      <u style='text-underline: black'>Incorrect sentences:</u>

      <span class=SpellE>SciScore</span> is a text analysis tool, and it is therefore susceptible to making two types of errors, false positives or false negatives.

      False <span class=SpellE><span class=GramE>negatives:<span style='font-weight:normal'>The</span></span></span> most common error occurs when the algorithm fails to detect a sentence that contains an antibody or another resource. False negatives generally occur either because the sentence is complex or in a less common syntax pattern. Generally simple sentences in clear standard English are simpler to process and result in few false negatives. If a truly complex sentence structure is required to describe reagents, a table may help not only <span class=SpellE>SciScore</span>, but also human readers. If an RRID is detected in a sentence, <span class=SpellE>SciScore</span> will be triggered to <span class=GramE>take a look</span> at the sentence, which may have been skipped otherwise.

      False positives: This type of error includes cases where a sentence does not contain an antibody, but the algorithm asserts that this sentence does have an antibody. If many resources are used and all have RRIDs, a single false positive will not reduce the score substantially. But if only 1-2 resources are used, then a false positive can reduce your <span class=SpellE>SciScore</span> needlessly. False positives are most often seen in the tools portion of table 2, as the algorithm detects company names, where it should not. We try to minimize these false positives using several strategies. If this impacts your score, please contact our team (http:// sciscore.com) and include the sentence where <span class=SpellE>SciScore</span> made the error. While we can't fix the score, we can learn from our mistakes.

      </div> </body>

      </html>

    1. W e also n eed to ac kno w le dge h ere the national change s in the form and sc ope of stateactivitie s in m an y W e ste rn e con om ie s. C o ntractin g, d eregulation and privatisation havered uc ed , in both p rac tical and id e ological terms, the capacity for d ire ct state in tervention.T hat is n ot to say that these de vic es do n ot provide n ew forms of state stee rin g and re gu latio n(see be lo w ). T he rule s of en gage m en t de sc ribe the relationship betwee n govern m e nts,em p lo ye rs an d w orkers. T he k ey c hange here , at le ast in th e W est, is fro m a F ord ist, w elfareco rp oratism to a `m ark et m o de l’ wh erein `the pro sp erity o f w orkers will d ep en d o n an abilityto trad e the ir skills, kn ow led ge and en treprene urial ac um e n in an u nfe tte re d global m arketplac e’ (B ro wn & Lau d er, 19 9 6 , p. 3) . A nd the ne w rules o f w ealth c re ation are replacin g thelo gic of F ord ist m ass produc tion w ith ne w `kn ow le dge -based’ system s o f ̄ e xible produ ction.H o we ver, the re are three c ruc ial c ave ats to the last point. F irst, F o rd ist produc tio nsystem s in the W est have no t so m uc h be en replaced as `

      check out this.

    1. B. Mazzolai, L. Margheri, M. Cianchetti, P. Dario, C. Laschi, Bioinspir. Biomim. 7, 025005 (2012).

      This paper is the second of a two part series of papers studying and attempting to replicate an octopus tentacle in a soft robot model.

    1. <img loading="lazy" class='avia_image' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/illu-innovate-01.svg' alt='Die Abbildung zeigt einen Mann, der vor einem Desktop sitzt' title='illu-innovate-01' height="500" width="458" itemprop="thumbnailUrl" />yuuvis® RAD – die optimale Anwendung, um Ihren Content zu managen: komplett neu entwickelter Technologie-Stack perfekt in andere Systeme integrierbar API-First entwickelt auf Microservices-Architektur basierend Low-Code-Plattform hoch skalierbar und äußerst fehlertolerant Was ist yuuvis® RAD? Umfassendes Dokumentenmanagement dank schneller Anwendungsentwicklung yuuvis® RAD ist ein umfassendes Framework für schnelle Anwendungsentwicklung. Mit ihm angepasste Applikationen helfen, das gesamte Wissen eines Unternehmens zu schützen, zu verwalten und zu organisieren. Es lässt sich flexibel erweitern und an individuelle Anforderungen anpassen. Applikationen können clientseitig neu entwickelt oder einfach modifiziert werden. Durch eigene „Custom“-Microservices wird die Geschäftslogik nach Bedarf erweitert. <img loading="lazy" class='avia_image' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/illu-creative-process-tuerkis-01.svg' alt='Die Abbildung zeigt drei Personen, die um eine Glühbirne herumstehen' title='illu-creative-process-tuerkis-01' height="500" width="449" itemprop="thumbnailUrl" />Mehr informationen zu yuuvis® RAD Sie möchten mehr zu yuuvis® RAD erfahren? <img loading="lazy" class='avia_image ' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/yuuvis-whitepaper-rad-preview-de.png' alt='yuuvis whitepaper rad vorschau' title='yuuvis-whitepaper-rad-preview-de' itemprop="thumbnailUrl" /> Offene Standards Architektur der Microservices Rahmenkonzept Übersicht der Dienstleistungen Modellierungs- und Anpassungswerkzeuge Microsoft-Integration Laden Sie unser Whitepaper herunter! Hinweis: Für diesen Inhalt ist JavaScript erforderlich. Felder mit einem * sind Pflichtfelder. Bitte Anrede auswählen: * Sehr geehrte Frau Sehr geehrter Herr Guten Tag Vorname Nachname * Email * Ihre Nachricht an uns Divider HTML Erleben Sie yuuvis® live! Die Einführung der Software-Lösung ist geplant. Ich bin an einer Software-Präsentation interessiert. Divider HTML Felder mit * sind Pflichtfelder. Falls du ein Mensch bist und dieses Feld siehst, dann lasse es bitte leer. var formDisplay=1;var nfForms=nfForms||[];var form=[];form.id='3';form.settings={"objectType":"Form Setting","editActive":true,"title":"yuuvis-Downloadformular RAD DE","created_at":"2020-01-30 16:02:46","default_label_pos":"above","show_title":0,"clear_complete":"1","hide_complete":"1","logged_in":"","wrapper_class":"","element_class":"","key":"yuuvis-downloadformular-en","add_submit":"0","changeEmailErrorMsg":"Please enter a valid e-mail address!","changeDateErrorMsg":"Bitte gib ein g\u00fcltiges Datum ein!","confirmFieldErrorMsg":"Diese Felder m\u00fcssen \u00fcbereinstimmen!","fieldNumberNumMinError":"Die eingegebene Zahl ist zu klein.","fieldNumberNumMaxError":"Die eingegebene Zahl ist zu gross.","fieldNumberIncrementBy":"Bitte erh\u00f6hen in Schritten von","formErrorsCorrectErrors":"Bitte korrigieren Sie die angezeigten Fehler, bevor Sie das Formular absenden.","validateRequiredField":"Dies ist ein Pflichtfeld.","honeypotHoneypotError":"Es ist ein Fehler aufgetreten.","fieldsMarkedRequired":"Felder mit einem * sind Pflichtfelder.","currency":"","unique_field_error":"A form with this value has already been submitted.","not_logged_in_msg":"","sub_limit_msg":"The form has reached its submission limit.","calculations":[],"container_styles_show_advanced_css":"0","title_styles_show_advanced_css":"0","row_styles_show_advanced_css":"0","row-odd_styles_show_advanced_css":"0","success-msg_styles_show_advanced_css":"0","error_msg_styles_show_advanced_css":"0","conditions":[],"mp_breadcrumb":0,"mp_progress_bar":"1","mp_display_titles":0,"breadcrumb_container_styles_show_advanced_css":"0","breadcrumb_buttons_styles_show_advanced_css":"0","breadcrumb_button_hover_styles_show_advanced_css":"0","breadcrumb_active_button_styles_show_advanced_css":"0","progress_bar_container_styles_show_advanced_css":"0","progress_bar_fill_styles_show_advanced_css":"0","part_titles_styles_show_advanced_css":"0","navigation_container_styles_show_advanced_css":"0","previous_button_styles_show_advanced_css":"0","next_button_styles_show_advanced_css":"0","navigation_hover_styles_show_advanced_css":"0","formContentData":[{"formContentData":[{"order":1,"cells":[{"order":0,"fields":["bitte_anrede_auswaehlen_1580396600390"],"width":"100"}]},{"order":2,"cells":[{"order":0,"fields":["vorname_1580396717767"],"width":50},{"order":1,"fields":["nachname_1580820256875"],"width":50}]},{"order":4,"cells":[{"order":0,"fields":["email_1580391190571"],"width":"100"}]},{"order":5,"cells":[{"order":0,"fields":["ihre_nachricht_an_uns_1581506628019"],"width":"100"}]},{"order":6,"cells":[{"order":0,"fields":["hr_1580820679276"],"width":"100"}]},{"order":7,"cells":[{"order":0,"fields":["html_1581506435696"],"width":"100"}]},{"order":8,"cells":[{"order":0,"fields":["softwaresolution_1581506481772"],"width":"100"}]},{"order":9,"cells":[{"order":0,"fields":["softwarepresentation_1581506440960"],"width":"100"}]},{"order":10,"cells":[{"order":0,"fields":["hr_1581506444943"],"width":"100"}]},{"order":11,"cells":[{"order":0,"fields":["html_1581506446831"],"width":"100"}]}],"order":0,"type":"part","clean":false,"title":"1","key":"hgorwjor","editActive":true,"drawerDisabled":false},{"formContentData":[{"order":1,"cells":[{"order":2,"fields":["telefon_1582895904537","position_1580820607732"],"width":50},{"order":3,"fields":["plz_1580820645250","unternehmen_1581582782634"],"width":50}]},{"order":2,"cells":[{"order":0,"fields":["hr_1582556164156"],"width":"100"}]},{"order":3,"cells":[{"order":0,"fields":["html_1580391371746"],"width":"100"}]},{"order":4,"cells":[{"order":0,"fields":["newsletter_checkbox_1580391409240"],"width":"100"}]},{"order":5,"cells":[{"order":0,"fields":["datenschutz_1580392331180"],"width":"100"}]},{"order":6,"cells":[{"order":0,"fields":["hr_1582556170397"],"width":"100"}]},{"order":7,"cells":[{"order":0,"fields":["html_1581506553720"],"width":"100"}]},{"order":8,"cells":[{"order":0,"fields":["hidden_optinherkunft_1580392579819"],"width":"100"}]},{"order":9,"cells":[{"order":0,"fields":["hidden_sprache_1580392763492"],"width":"100"}]},{"order":11,"cells":[{"order":0,"fields":["page-url_1580393093116"],"width":"100"}]},{"order":12,"cells":[{"order":0,"fields":["yuuvis-produkt_1581512743513"],"width":"100"}]},{"order":13,"cells":[{"order":0,"fields":["jetzt_whitepaper_anfordern_1582641368769"],"width":"100"}]}],"order":1,"type":"part","clean":false,"title":"2","key":"glmhxs","editActive":true,"drawerDisabled":false}],"drawerDisabled":false,"manual_key":"1","allow_public_link":0,"embed_form":"","container_styles_border":"","container_styles_height":"","container_styles_margin":"","container_styles_padding":"","container_styles_float":"","title_styles_border":"","title_styles_height":"","title_styles_width":"","title_styles_font-size":"","title_styles_margin":"","title_styles_padding":"","title_styles_float":"","row_styles_border":"","row_styles_width":"","row_styles_font-size":"","row_styles_margin":"","row_styles_padding":"","row-odd_styles_border":"","row-odd_styles_height":"","row-odd_styles_width":"","row-odd_styles_font-size":"","row-odd_styles_margin":"","row-odd_styles_padding":"","success-msg_styles_border":"","success-msg_styles_height":"","success-msg_styles_width":"","success-msg_styles_font-size":"","success-msg_styles_margin":"","success-msg_styles_padding":"","error_msg_styles_border":"","error_msg_styles_width":"","error_msg_styles_font-size":"","error_msg_styles_margin":"","error_msg_styles_padding":"","mp_validate":1,"mp_prev_label":"Zur\u00fcck","mp_next_label":"Weiter","breadcrumb_container_styles_border":"","breadcrumb_container_styles_height":"","breadcrumb_container_styles_width":"","breadcrumb_container_styles_margin":"","breadcrumb_container_styles_padding":"","breadcrumb_container_styles_float":"","breadcrumb_buttons_styles_border":"","breadcrumb_buttons_styles_height":"","breadcrumb_buttons_styles_width":"","breadcrumb_buttons_styles_font-size":"","breadcrumb_buttons_styles_margin":"","breadcrumb_buttons_styles_padding":"","breadcrumb_buttons_styles_float":"","breadcrumb_button_hover_styles_border":"","breadcrumb_button_hover_styles_height":"","breadcrumb_button_hover_styles_width":"","breadcrumb_button_hover_styles_font-size":"","breadcrumb_button_hover_styles_margin":"","breadcrumb_button_hover_styles_padding":"","breadcrumb_button_hover_styles_float":"","breadcrumb_active_button_styles_border":"","breadcrumb_active_button_styles_height":"","breadcrumb_active_button_styles_width":"","breadcrumb_active_button_styles_font-size":"","breadcrumb_active_button_styles_margin":"","breadcrumb_active_button_styles_padding":"","breadcrumb_active_button_styles_float":"","progress_bar_container_styles_border":"","progress_bar_container_styles_height":"","progress_bar_container_styles_width":"","progress_bar_container_styles_margin":"","progress_bar_container_styles_padding":"","progress_bar_container_styles_float":"","progress_bar_fill_styles_border":"","progress_bar_fill_styles_height":"","progress_bar_fill_styles_margin":"","progress_bar_fill_styles_padding":"","part_titles_styles_border":"","part_titles_styles_height":"","part_titles_styles_width":"","part_titles_styles_font-size":"","part_titles_styles_margin":"","part_titles_styles_padding":"","part_titles_styles_float":"","navigation_container_styles_border":"","navigation_container_styles_height":"","navigation_container_styles_width":"","navigation_container_styles_margin":"","navigation_container_styles_padding":"","navigation_container_styles_float":"","previous_button_styles_border":"","previous_button_styles_height":"","previous_button_styles_width":"","previous_button_styles_font-size":"","previous_button_styles_margin":"","previous_button_styles_padding":"","next_button_styles_border":"","next_button_styles_height":"","next_button_styles_width":"","next_button_styles_font-size":"","next_button_styles_margin":"","next_button_styles_padding":"","navigation_hover_styles_border":"","navigation_hover_styles_height":"","navigation_hover_styles_width":"","navigation_hover_styles_font-size":"","navigation_hover_styles_margin":"","navigation_hover_styles_padding":"","ninjaForms":"Ninja Forms","fieldTextareaRTEInsertLink":"Link einf\u00fcgen","fieldTextareaRTEInsertMedia":"Medien einf\u00fcgen","fieldTextareaRTESelectAFile":"Eine Datei ausw\u00e4hlen","formHoneypot":"Falls du ein Mensch bist und dieses Feld siehst, dann lasse es bitte leer.","fileUploadOldCodeFileUploadInProgress":"Datei-Upload l\u00e4uft.","fileUploadOldCodeFileUpload":"DATEI-UPLOAD","currencySymbol":"&euro;","thousands_sep":".","decimal_point":",","siteLocale":"de_DE","dateFormat":"m\/d\/Y","startOfWeek":"1","of":"von","previousMonth":"Vorheriger Monat","nextMonth":"N\u00e4chster Monat","months":["Januar","Februar","M\u00e4rz","April","Mai","Juni","Juli","August","September","Oktober","November","Dezember"],"monthsShort":["Jan","Feb","Mrz","Apr","Mai","Jun","Jul","Aug","Sep","Okt","Nov","Dez"],"weekdays":["Sonntag","Montag","Dienstag","Mittwoch","Donnerstag","Freitag","Samstag"],"weekdaysShort":["So","Mo","Die","Mi","Do","Fr","Sa"],"weekdaysMin":["So","Mo","Di","Mi","Do","Fr","Sa"],"currency_symbol":"","beforeForm":"","beforeFields":"","afterFields":"","afterForm":""};form.fields=[{"objectType":"Field","objectDomain":"fields","editActive":false,"order":1,"label":"Bitte Anrede ausw\u00e4hlen:","type":"listradio","key":"bitte_anrede_auswaehlen_1580396600390","label_pos":"above","required":1,"container_class":"","element_class":"","admin_label":"","help_text":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"list_item_row_styles_border":"","list_item_row_styles_height":"","list_item_row_styles_width":"","list_item_row_styles_font-size":"","list_item_row_styles_margin":"","list_item_row_styles_padding":"","list_item_row_styles_float":"","list_item_row_styles_show_advanced_css":0,"list_item_label_styles_border":"","list_item_label_styles_height":"","list_item_label_styles_width":"","list_item_label_styles_font-size":"","list_item_label_styles_margin":"","list_item_label_styles_padding":"","list_item_label_styles_float":"","list_item_label_styles_show_advanced_css":0,"list_item_element_styles_border":"","list_item_element_styles_height":"","list_item_element_styles_width":"","list_item_element_styles_font-size":"","list_item_element_styles_margin":"","list_item_element_styles_padding":"","list_item_element_styles_float":"","list_item_element_styles_show_advanced_css":0,"cellcid":"c3776","drawerDisabled":false,"options":[{"errors":[],"max_options":0,"label":"Sehr geehrte Frau","value":"1","calc":"1","selected":0,"order":0,"settingModel":{"settings":false,"hide_merge_tags":false,"error":false,"name":"options","type":"option-repeater","label":"Options <a href=\"#\" class=\"nf-add-new\">Add New<\/a> <a href=\"#\" class=\"extra nf-open-import-tooltip\"><i class=\"fa fa-sign-in\" aria-hidden=\"true\"><\/i> Import<\/a>","width":"full","group":"","value":[{"label":"One","value":"one","calc":"","selected":0,"order":0},{"label":"Two","value":"two","calc":"","selected":0,"order":1},{"label":"Three","value":"three","calc":"","selected":0,"order":2}],"columns":{"label":{"header":"Label","default":""},"value":{"header":"Value","default":""},"calc":{"header":"Calc Value","default":""},"selected":{"header":"<span class=\"dashicons dashicons-yes\"><\/span>","default":0}}},"manual_value":true},{"errors":[],"max_options":0,"label":"Sehr geehrter Herr","value":"2","calc":"2","selected":0,"order":1,"settingModel":{"settings":false,"hide_merge_tags":false,"error":false,"name":"options","type":"option-repeater","label":"Options <a href=\"#\" class=\"nf-add-new\">Add New<\/a> <a href=\"#\" class=\"extra nf-open-import-tooltip\"><i class=\"fa fa-sign-in\" aria-hidden=\"true\"><\/i> Import<\/a>","width":"full","group":"","value":[{"label":"One","value":"one","calc":"","selected":0,"order":0},{"label":"Two","value":"two","calc":"","selected":0,"order":1},{"label":"Three","value":"three","calc":"","selected":0,"order":2}],"columns":{"label":{"header":"Label","default":""},"value":{"header":"Value","default":""},"calc":{"header":"Calc Value","default":""},"selected":{"header":"<span class=\"dashicons dashicons-yes\"><\/span>","default":0}}},"manual_value":true},{"errors":[],"max_options":0,"label":"Guten Tag","value":"3","calc":"3","selected":0,"order":2,"settingModel":{"settings":false,"hide_merge_tags":false,"error":false,"name":"options","type":"option-repeater","label":"Options <a href=\"#\" class=\"nf-add-new\">Add New<\/a> <a href=\"#\" class=\"extra nf-open-import-tooltip\"><i class=\"fa fa-sign-in\" aria-hidden=\"true\"><\/i> Import<\/a>","width":"full","group":"","value":[{"label":"One","value":"one","calc":"","selected":0,"order":0},{"label":"Two","value":"two","calc":"","selected":0,"order":1},{"label":"Three","value":"three","calc":"","selected":0,"order":2}],"columns":{"label":{"header":"Label","default":""},"value":{"header":"Value","default":""},"calc":{"header":"Calc Value","default":""},"selected":{"header":"<span class=\"dashicons dashicons-yes\"><\/span>","default":0}}},"manual_value":true}],"field_label":"Please choose salutation:","field_key":"please_choose_salutation_1580391018648","id":18,"beforeField":"","afterField":"","value":"","parentType":"list","element_templates":["listradio","input"],"old_classname":"list-radio","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":2,"label":"Vorname","type":"firstname","key":"vorname_1580396717767","label_pos":"hidden","required":"","default":"","placeholder":"Vorname","container_class":"","element_class":"","admin_label":"","help_text":"","custom_name_attribute":"fname","personally_identifiable":1,"wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3780","value":"","drawerDisabled":false,"field_label":"First Name","field_key":"firstname_1580391082629","id":19,"beforeField":"","afterField":"","parentType":"firstname","element_templates":["firstname","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":3,"label":"Nachname","type":"lastname","key":"nachname_1580820256875","label_pos":"hidden","required":1,"default":"","placeholder":"Nachname*","container_class":"","element_class":"","admin_label":"","help_text":"","custom_name_attribute":"lname","personally_identifiable":1,"wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3782","value":"","drawerDisabled":false,"field_label":"Last Name","field_key":"lastname_1580391137379","id":20,"beforeField":"","afterField":"","parentType":"lastname","element_templates":["lastname","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":4,"type":"email","label":"Email","key":"email_1580391190571","label_pos":"hidden","required":1,"default":"","placeholder":"E-Mail-Adresse*","container_class":"","element_class":"","admin_label":"","help_text":"","custom_name_attribute":"email","personally_identifiable":1,"wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3785","value":"","drawerDisabled":false,"field_label":"Email","field_key":"email_1580391190571","id":21,"beforeField":"","afterField":"","parentType":"email","element_templates":["email","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":5,"label":"Ihre Nachricht an uns","type":"textarea","key":"ihre_nachricht_an_uns_1581506628019","label_pos":"hidden","required":false,"default":"","placeholder":"Ihre Nachricht an uns","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":false,"admin_label":"","help_text":"","textarea_rte":"","disable_rte_mobile":"","textarea_media":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3788","value":"","drawerDisabled":false,"id":333,"beforeField":"","afterField":"","parentType":"textarea","element_templates":["textarea","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":8,"label":"Divider","type":"hr","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1580820679276","cellcid":"c3791","oldCellcid":"c3774","id":235,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":999,"type":"html","label":"HTML","default":"<p><b>Erleben Sie yuuvis\u00ae live!<\/b><\/p>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1581506435696","cellcid":"c3794","drawerDisabled":false,"oldCellcid":"c3777","id":328,"beforeField":"","afterField":"","value":"<p><b>Erleben Sie yuuvis\u00ae live!<\/b><\/p>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":999,"type":"checkbox","label":"Die Einf\u00fchrung der Software-L\u00f6sung ist geplant.","key":"softwaresolution_1581506481772","label_pos":"right","required":false,"container_class":"","element_class":"","manual_key":true,"admin_label":"","help_text":"","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3797","drawerDisabled":false,"oldCellcid":"c3780","id":329,"beforeField":"","afterField":"","value":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":999,"type":"checkbox","label":"Ich bin an einer Software-Pr\u00e4sentation interessiert.","key":"softwarepresentation_1581506440960","label_pos":"right","required":false,"container_class":"","element_class":"","manual_key":true,"admin_label":"","help_text":"","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3800","drawerDisabled":false,"oldCellcid":"c3783","id":330,"beforeField":"","afterField":"","value":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":999,"type":"hr","label":"Divider","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1581506444943","cellcid":"c3803","oldCellcid":"c3786","id":331,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":999,"type":"html","label":"HTML","default":"<small>Felder mit * sind Pflichtfelder.<\/small>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1581506446831","cellcid":"c3806","drawerDisabled":false,"oldCellcid":"c3789","id":332,"beforeField":"","afterField":"","value":"<small>Felder mit * sind Pflichtfelder.<\/small>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":1,"label":"Telefon","type":"phone","key":"telefon_1582895904537","label_pos":"hidden","required":false,"default":"","placeholder":"Telefon (Durchwahl)","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":false,"admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"phone","personally_identifiable":1,"wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3812","value":"","cellOrder":1,"drawerDisabled":false,"id":232,"beforeField":"","afterField":"","parentType":"textbox","element_templates":["tel","textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":2,"label":"Position","type":"textbox","cellcid":"c3812","key":"position_1580820607732","label_pos":"hidden","required":1,"default":"","placeholder":"Position*","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":false,"admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"","personally_identifiable":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"value":"","cellOrder":3,"drawerDisabled":false,"id":233,"beforeField":"","afterField":"","parentType":"textbox","element_templates":["textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":3,"label":"PLZ","type":"zip","cellcid":"c3814","key":"plz_1580820645250","label_pos":"hidden","required":false,"default":"","placeholder":"PLZ","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":false,"admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"zip","personally_identifiable":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"value":"","cellOrder":1,"drawerDisabled":false,"id":234,"beforeField":"","afterField":"","parentType":"zip","element_templates":["zip","textbox","input","textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":4,"label":"Unternehmen","type":"textbox","key":"unternehmen_1581582782634","label_pos":"hidden","required":1,"default":"","placeholder":"Ihr Unternehmen*","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":false,"admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"company","personally_identifiable":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3814","value":"","drawerDisabled":false,"oldCellcid":"c3782","cellOrder":2,"id":226,"beforeField":"","afterField":"","parentType":"textbox","element_templates":["textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":5,"label":"Divider","type":"hr","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1582556164156","cellcid":"c3817","id":504,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":6,"type":"html","label":"HTML","default":"<p>Bitte best\u00e4tigen Sie Ihr Einverst\u00e4ndnis zum Erhalt weiterer Informationen sowie unsere Datenschutzbestimmungen.<br><\/p>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1580391371746","cellcid":"c3820","drawerDisabled":false,"field_label":"HTML","field_key":"html_1580391371746","oldCellcid":"c3785","id":22,"beforeField":"","afterField":"","value":"<p>Bitte best\u00e4tigen Sie Ihr Einverst\u00e4ndnis zum Erhalt weiterer Informationen sowie unsere Datenschutzbestimmungen.<br><\/p>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":7,"type":"checkbox","label":"Ja, ich m\u00f6chte relevante Produktinformationen und wichtige News erhalten.","key":"newsletter_checkbox_1580391409240","label_pos":"right","required":1,"container_class":"","element_class":"","manual_key":true,"admin_label":"","help_text":"","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3823","drawerDisabled":false,"field_label":"Yes, I would like to receive relevant product information and important news.","field_key":"newsletter_checkbox_1580391409240","oldCellcid":"c3788","id":23,"beforeField":"","afterField":"","value":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":8,"type":"checkbox","label":"Ja, ich habe die <a href=\"\/de\/impressum-und-datenschutz\" target=\"_blank\" rel=\"noopener\">Datenschutzbestimmungen<\/a> gelesen und stimme ihnen zu.","key":"datenschutz_1580392331180","label_pos":"right","required":1,"container_class":"","element_class":"","manual_key":1,"admin_label":"","help_text":"","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3826","drawerDisabled":false,"field_label":"Yes, I have read and agree to the <a href=\"https:\/\/bp387lpw.myraidbox.de\/privacy-policy\/#data-privacy\" target=\"_blank\" rel=\"noopener\">privacy policy<\/a>.","field_key":"datenschutz_1580392331180","oldCellcid":"c3791","id":24,"beforeField":"","afterField":"","value":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":9,"label":"Divider","type":"hr","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1582556170397","cellcid":"c3829","id":505,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":10,"label":"HTML","type":"html","default":"<small>Felder mit * sind Pflichtfelder.<\/small>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1581506553720","cellcid":"c3832","drawerDisabled":false,"oldCellcid":"c3804","id":327,"beforeField":"","afterField":"","value":"<small>Felder mit * sind Pflichtfelder.<\/small>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":11,"type":"hidden","label":"Optin-Herkunft","key":"hidden_optinherkunft_1580392579819","default":"{wp:site_url}","admin_label":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3835","drawerDisabled":"","manual_key":1,"field_label":"Optin-Herkunft","field_key":"hidden_optinherkunft_1580392579819","oldCellcid":"c3794","id":25,"beforeField":"","afterField":"","value":"https:\/\/bp387lpw.myraidbox.de\/de\/","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":12,"type":"hidden","label":"SPRACHE","key":"hidden_sprache_1580392763492","default":"DE","admin_label":"sprache","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3838","drawerDisabled":false,"manual_key":1,"field_label":"Sprache","field_key":"hidden_sprache_1580392763492","oldCellcid":"c3797","id":26,"beforeField":"","afterField":"","value":"DE","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":14,"type":"hidden","label":"PAGE-URL","key":"page-url_1580393093116","default":"{wp:post_url}","admin_label":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3841","drawerDisabled":"","manual_key":1,"field_label":"PAGE-URL","field_key":"page-url_1580393093116","oldCellcid":"c3803","id":28,"beforeField":"","afterField":"","value":"https:\/\/bp387lpw.myraidbox.de\/de\/rapid-application-development\/","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":15,"label":"YUUVIS-PRODUKT","type":"hidden","key":"yuuvis-produkt_1581512743513","default":"RAD","admin_label":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3844","drawerDisabled":false,"oldCellcid":"c3819","id":354,"beforeField":"","afterField":"","value":"RAD","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":16,"type":"submit","label":"Jetzt Whitepaper anfordern","processing_label":"Daten werden \u00fcbertragen ...","container_class":"","element_class":"","key":"jetzt_whitepaper_anfordern_1582641368769","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"submit_element_hover_styles_border":"","submit_element_hover_styles_width":"","submit_element_hover_styles_font-size":"","submit_element_hover_styles_margin":"","submit_element_hover_styles_padding":"","submit_element_hover_styles_float":"","submit_element_hover_styles_show_advanced_css":0,"cellcid":"c3847","drawerDisabled":false,"field_label":"Register now","field_key":"register_now_1580393213788","oldCellcid":"c3806","id":29,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"textbox","element_templates":["submit","button","input"],"old_classname":"","wrap_template":"wrap-no-label"}];nfForms.push(form); <div class="nf-mp-header"></div> <div class="nf-mp-body"></div> <div class="nf-mp-footer"></div> {{{ data.renderProgressBar() }}} {{{ data.renderBreadcrumbs() }}} {{{ data.renderPartTitle() }}} <h3> {{{ data.title }}} </h3> {{{ data.renderNextPrevious() }}} <ul class="nf-next-previous"> <# if ( data.showPrevious ) { #> <li class="nf-previous-item"> <input type="button" class="nf-previous" value="{{{ data.prevLabel }}}" /> </li> <# } #> <# if ( data.showNext ) { #> <li class="nf-next-item"> <input type="button" class="nf-next" value="{{{ data.nextLabel }}}" /> </li> <# } #> </ul> <ul class="nf-breadcrumbs"> <# _.each( data.parts, function( part, index ) { #> <li class="{{{ ( data.currentIndex == index ) ? 'active' : '' }}} {{{ ( part.errors ) ? 'errors' : '' }}}"> <a href="#" class="nf-breadcrumb" data-index="{{{ index }}}">{{{ ( part.errors ) ? '' : '' }}} {{{ part.title }}}</a> </li> <# } ); #> </ul> <div class="nf-progress-container"> <div class="nf-progress" style="width: {{{ data.percent }}}%;"></div> </div> <nf-fields></nf-fields> <nf-cells></nf-cells> Formular schließen Wer profitiert von yuuvis® RAD? Rapid Application Development – für starke Anwendungen <img loading="lazy" class='avia_image' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/illu-startup-01.svg' alt='Die Abbildung zeigt einen Mann, der vor einem Desktop steht' title='illu-startup-01' height="500" width="489" itemprop="thumbnailUrl" /> Systemintegratoren, die Tools in einem Bruchteil der Zeit und mit geringeren Kosten integrieren <img loading="lazy" class='avia_image' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/illu-data_analysis-01.svg' alt='Die Abbildung zeigt drei Personen, die um einen Tisch herum stehen.' title='illustration-drei-personen-arbeiten-erfolgreich-an-tisch' height="500" width="458" itemprop="thumbnailUrl" /> Anwendungsdesigner, die leistungsstarke, inhaltsbasierte Applikationen erstellen <img loading="lazy" class='avia_image' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/illu-web-hosting-01.svg' alt='Die Abbildung zeigt einen Mann, der vor 4 Servern steht mit grauem Schatten' title='illu-web-hosting-01' height="428" width="500" itemprop="thumbnailUrl" /> IT-Abteilungen, die kundenspezifische Anwendungen auf webbasierter IT-Ebene betreiben Das yuuvis® RAD Framework ist die ideale Lösung für kleinere bis mittelständische Unternehmen, die on-premise hoch performante Plattformen betreiben wollen.  Außerdem ist es optimal, um bestehende Anwendungen um ein Archiv zu erweitern. Die mit yuuvis® RAD implementierten Applikationen skalieren dank des modernen Microservices-Stack und des responsiven Web-Clients (Angular/HTML5) auch in mittelgroßen, weltweit verteilten Firmennetzen. Finden Sie heraus, wer von yuuvis® RAD profitieren kann Warum yuuvis® RAD? Schnelle Anwendungsentwicklung – die Vorteile auf einen Blick State of the ArtHigh-End-ECM auf dem neuesten Stand der Technik. Perfekt für content-zentrische Anwendungen. Offene ArchitekturREST-API gewährleistet einfache Integration in bestehende Systemlandschaften. Low CodeWeniger Code bedeutet weniger potenzielle Fehle, einfachere Wartung und geringere Kosten. ZukunftssicherHoher Investitionsschutz durch ein nachhaltiges Konzept gegen zukünftige disruptive Technologien. Einfaches HandlingGemeinsame Benutzerverwaltung mit sehr gut integriertem Workflow und Datenmanagement. Custom MicroservicesKomplexe Anwendungs­szenarien können mit eigenen passenden Erweiterungen im Client ergänzt werden. Erfahren Sie mehr über die Vorzüge von yuuvis® RAD Sie wollen mit yuuvis® RAD arbeiten? Kontaktieren Sie uns! Wie funktioniert yuuvis® RAD? Die Technik hinter unserer Rapid Application Development-Anwendung Offene Technologie yuuvis® RAD basiert auf offenen Stan­dard­tech­nologien. Alle server­seitigen Kom­po­nen­ten sind java-ba­siert und im­ple­men­tieren eine sau­bere, skalier­bare und leicht­gewichtige Micro­services-Archi­tektur. Diese wird von Spring Cloud Netflix or­ches­triert. Kommu­nikation und Pro­to­koll basieren auf HTTP(S). Der Web­client ist eine hun­dert­pro­zentige HTML5 Angular (Typeskript) An­wen­dung. Die server­sei­tige API ist rein REST­basiert. Neueste Standards Die strikte An­wen­dung neu­es­ter Stan­dards er­mög­licht den so­for­ti­gen Zu­griff auf das grö­ßte Netz­werk von Soft­ware-Ex­per­ten der Welt. Pro­prie­tär ist ein Fremd­wort in yuuvis® RAD. Es bie­tet damit die schnells­te und si­cherste Ar­chi­tek­tur, die heu­te ver­fügbar ist. Rechenzentrumsfreundlich Dank des Webclients ist der Rollout auf End­be­nutz­er­ar­beits­plät­zen ein­fach und un­kom­pliziert, ohne lo­kalen In­stal­lations­auf­wand. Das HTTP(S)/REST-Pro­to­koll zwi­schen dem Web­client und dem Ser­ver ent­spricht voll­ständig den Stan­dard-Fire­wall-Tech­no­logien. Microservices-basiert Der Microservices-Stack bietet eine um­fas­sende In­te­gra­tion von War­tung, Last­aus­gleich, Fail­over und Health-Check in die Man­age­ment- und Über­wach­ungs­werk­zeuge von Rech­en­zen­­tren. yuuvis® RAD be­dient so­wohl die S3-Schnitt­stelle, den De-facto-Stan­dard der Da­ten­speich­erung als auch OAuth 2.0 zur stan­dar­disier­ten, si­che­ren API-Au­to­risie­rung für Desk­top-, Web- und Mo­bile-An­wen­dungen. <img loading="lazy" class='avia_image ' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/yuuvis-rad-framework-infografik.jpg' alt='Infografik zeigt das yuuvis® RAD Framework' title='yuuvis-rad-framework-Konzept' itemprop="thumbnailUrl" /> Das Rahmenkonzept der yuuvis® RAD Plattform Lesen Sie mehr über die Technologie von yuuvis® RAD Wer nutzt yuuvis® RAD? Diese Unternehmen vertrauen auf schnelle Anwendungsentwicklung Sie wollen mehr erfahren? Wir sind für Sie da! <img loading="lazy" class='avia_image' src='https://bp387lpw.myraidbox.de/wp-content/uploads/2020/02/yuuvis-photo-frank-dembach.jpg' alt='Foto Senior Key Account Manager yuuvis®' title='yuuvis-foto-frank-dembach-quer' height="694" width="1000" itemprop="thumbnailUrl" /> Frank Dembach Team Leader Sales – yuuvis® +49 (0)30 – 895 70 80 info@yuuvis.com Hinweis: Für diesen Inhalt ist JavaScript erforderlich. Felder mit einem * sind Pflichtfelder. Bitte Anrede auswählen: * Sehr geehrte Frau Sehr geehrter Herr Guten Tag Vorname Nachname * Email * Ihre Nachricht an uns 160 von 160 Zeichen übrig Divider HTML Erleben Sie yuuvis® live! Die Einführung der Software-Lösung ist geplant. Ich bin an einer Software-Präsentation interessiert. Trennung HTML Felder mit * sind Pflichtfelder. Falls du ein Mensch bist und dieses Feld siehst, dann lasse es bitte leer. var formDisplay=1;var nfForms=nfForms||[];var form=[];form.id='30';form.settings={"objectType":"Form Setting","editActive":true,"title":"Allgemeines Kontaktformular-DE - RAD","created_at":"2020-02-26 15:53:54","default_label_pos":"above","show_title":"0","clear_complete":"1","hide_complete":"1","logged_in":"0","wrapper_class":"","element_class":"","key":"yuuvis-kontakt-allgemein-de","add_submit":"0","changeEmailErrorMsg":"Bitte gib eine g\u00fcltige E-Mail-Adresse ein.","changeDateErrorMsg":"Bitte gib ein g\u00fcltiges Datum ein!","confirmFieldErrorMsg":"Diese Felder m\u00fcssen \u00fcbereinstimmen!","fieldNumberNumMinError":"Die eingegebene Zahl ist zu klein.","fieldNumberNumMaxError":"Die eingegebene Zahl ist zu gross.","fieldNumberIncrementBy":"Bitte erh\u00f6hen in Schritten von","formErrorsCorrectErrors":"Bitte korrigieren die angezeigten Fehler, bevor Sie das Formular absenden.","validateRequiredField":"Dies ist ein Pflichtfeld.","honeypotHoneypotError":"Es ist ein Fehler aufgetreten.","fieldsMarkedRequired":"Felder mit einem * sind Pflichtfelder.","currency":"","unique_field_error":"Ein Formular mit diesem Wert ist bereits eingereicht worden.","not_logged_in_msg":"","sub_limit_msg":"Das Formular hat seine Zeichengrenze erreicht.","calculations":[],"formContentData":[{"formContentData":[{"order":1,"cells":[{"order":0,"fields":["bitte_anrede_auswaehlen_1580465134673"],"width":"100"}]},{"order":2,"cells":[{"order":0,"fields":["firstname_1573210589193"],"width":"50"},{"order":1,"fields":["lastname_1573210591744"],"width":"50"}]},{"order":4,"cells":[{"order":0,"fields":["email_1582725914409"],"width":"100"}]},{"order":6,"cells":[{"order":0,"fields":["ihre_nachricht_an_uns_1573565913431"],"width":"100"}]},{"order":7,"cells":[{"order":0,"fields":["hr_1581506117361"],"width":"100"}]},{"order":8,"cells":[{"order":0,"fields":["html_1581506146896"],"width":"100"}]},{"order":9,"cells":[{"order":0,"fields":["softwaresolution_1581506167859"],"width":"100"}]},{"order":10,"cells":[{"order":0,"fields":["softwarepresentation_1581506142599"],"width":"100"}]},{"order":11,"cells":[{"order":0,"fields":["hr_1573210614298"],"width":"100"}]},{"order":12,"cells":[{"order":0,"fields":["html_1574181495044"],"width":"100"}]}],"order":0,"type":"part","clean":"","title":"1","key":"tyqqgqty","editActive":true,"drawerDisabled":false},{"formContentData":[{"order":1,"cells":[{"order":0,"fields":["telefon_1582726279559","position_1580818819203"],"width":50},{"order":1,"fields":["zip_code_1582726310139","unternehmen_1573565543483"],"width":50}]},{"order":2,"cells":[{"order":0,"fields":["hr_1582557416361"],"width":"100"}]},{"order":3,"cells":[{"order":0,"fields":["html_1573643938225"],"width":"100"}]},{"order":4,"cells":[{"order":0,"fields":["datenschutz_1573564502005"],"width":"100"}]},{"order":5,"cells":[{"order":0,"fields":["hr_1582557452605"],"width":"100"}]},{"order":6,"cells":[{"order":0,"fields":["html_1581505991324"],"width":"100"}]},{"order":7,"cells":[{"order":0,"fields":["hidden_sprache_1573570858706"],"width":"100"}]},{"order":8,"cells":[{"order":0,"fields":["hidden_optinherkunft_1573569958584"],"width":"100"}]},{"order":9,"cells":[{"order":0,"fields":["yuuvis-produkt_1582728684947"],"width":"100"}]},{"order":10,"cells":[{"order":0,"fields":["page-url_1574859765696"],"width":"100"}]},{"order":11,"cells":[{"order":0,"fields":["jetzt_kontakt_aufnehmen_1574694425581"],"width":"100"}]}],"order":2,"type":"part","clean":false,"title":"2","key":"rghcnnwx","editActive":true,"drawerDisabled":false}],"drawerDisabled":false,"manual_key":"1","container_styles_border":"","container_styles_height":"","container_styles_margin":"","container_styles_padding":"","container_styles_float":"","container_styles_show_advanced_css":"0","title_styles_border":"","title_styles_height":"","title_styles_width":"","title_styles_font-size":"","title_styles_margin":"","title_styles_padding":"","title_styles_float":"","title_styles_show_advanced_css":"0","row_styles_border":"","row_styles_width":"","row_styles_font-size":"","row_styles_margin":"","row_styles_padding":"","row_styles_show_advanced_css":"0","row-odd_styles_border":"","row-odd_styles_height":"","row-odd_styles_width":"","row-odd_styles_font-size":"","row-odd_styles_margin":"","row-odd_styles_padding":"","row-odd_styles_show_advanced_css":"0","success-msg_styles_border":"","success-msg_styles_height":"","success-msg_styles_width":"","success-msg_styles_font-size":"","success-msg_styles_margin":"","success-msg_styles_padding":"","success-msg_styles_show_advanced_css":"0","error_msg_styles_border":"","error_msg_styles_width":"","error_msg_styles_font-size":"","error_msg_styles_margin":"","error_msg_styles_padding":"","error_msg_styles_show_advanced_css":"0","conditions":[],"mp_breadcrumb":"0","mp_progress_bar":"1","mp_display_titles":"0","mp_prev_label":"Zur\u00fcck","mp_next_label":"Weiter","breadcrumb_container_styles_border":"","breadcrumb_container_styles_height":"","breadcrumb_container_styles_width":"","breadcrumb_container_styles_margin":"","breadcrumb_container_styles_padding":"","breadcrumb_container_styles_float":"","breadcrumb_container_styles_show_advanced_css":"0","breadcrumb_buttons_styles_border":"","breadcrumb_buttons_styles_height":"","breadcrumb_buttons_styles_width":"","breadcrumb_buttons_styles_font-size":"","breadcrumb_buttons_styles_margin":"","breadcrumb_buttons_styles_padding":"","breadcrumb_buttons_styles_float":"","breadcrumb_buttons_styles_show_advanced_css":"0","breadcrumb_button_hover_styles_border":"","breadcrumb_button_hover_styles_height":"","breadcrumb_button_hover_styles_width":"","breadcrumb_button_hover_styles_font-size":"","breadcrumb_button_hover_styles_margin":"","breadcrumb_button_hover_styles_padding":"","breadcrumb_button_hover_styles_float":"","breadcrumb_button_hover_styles_show_advanced_css":"0","breadcrumb_active_button_styles_border":"","breadcrumb_active_button_styles_height":"","breadcrumb_active_button_styles_width":"","breadcrumb_active_button_styles_font-size":"","breadcrumb_active_button_styles_margin":"","breadcrumb_active_button_styles_padding":"","breadcrumb_active_button_styles_float":"","breadcrumb_active_button_styles_show_advanced_css":"0","progress_bar_container_styles_border":"","progress_bar_container_styles_height":"","progress_bar_container_styles_width":"","progress_bar_container_styles_margin":"","progress_bar_container_styles_padding":"","progress_bar_container_styles_float":"","progress_bar_container_styles_show_advanced_css":"0","progress_bar_fill_styles_border":"","progress_bar_fill_styles_height":"","progress_bar_fill_styles_margin":"","progress_bar_fill_styles_padding":"","progress_bar_fill_styles_show_advanced_css":"0","part_titles_styles_border":"","part_titles_styles_height":"","part_titles_styles_width":"","part_titles_styles_font-size":"","part_titles_styles_margin":"","part_titles_styles_padding":"","part_titles_styles_float":"","part_titles_styles_show_advanced_css":"0","navigation_container_styles_border":"","navigation_container_styles_height":"","navigation_container_styles_width":"","navigation_container_styles_margin":"","navigation_container_styles_padding":"","navigation_container_styles_float":"","navigation_container_styles_show_advanced_css":"0","previous_button_styles_border":"","previous_button_styles_height":"","previous_button_styles_width":"","previous_button_styles_font-size":"","previous_button_styles_margin":"","previous_button_styles_padding":"","previous_button_styles_show_advanced_css":"0","next_button_styles_border":"","next_button_styles_height":"","next_button_styles_width":"","next_button_styles_font-size":"","next_button_styles_margin":"","next_button_styles_padding":"","next_button_styles_show_advanced_css":"0","navigation_hover_styles_border":"","navigation_hover_styles_height":"","navigation_hover_styles_width":"","navigation_hover_styles_font-size":"","navigation_hover_styles_margin":"","navigation_hover_styles_padding":"","navigation_hover_styles_show_advanced_css":"0","mp_validate":"1","allow_public_link":0,"embed_form":"","ninjaForms":"Ninja Forms","fieldTextareaRTEInsertLink":"Link einf\u00fcgen","fieldTextareaRTEInsertMedia":"Medien einf\u00fcgen","fieldTextareaRTESelectAFile":"Eine Datei ausw\u00e4hlen","formHoneypot":"Falls du ein Mensch bist und dieses Feld siehst, dann lasse es bitte leer.","fileUploadOldCodeFileUploadInProgress":"Datei-Upload l\u00e4uft.","fileUploadOldCodeFileUpload":"DATEI-UPLOAD","currencySymbol":"&euro;","thousands_sep":".","decimal_point":",","siteLocale":"de_DE","dateFormat":"m\/d\/Y","startOfWeek":"1","of":"von","previousMonth":"Vorheriger Monat","nextMonth":"N\u00e4chster Monat","months":["Januar","Februar","M\u00e4rz","April","Mai","Juni","Juli","August","September","Oktober","November","Dezember"],"monthsShort":["Jan","Feb","Mrz","Apr","Mai","Jun","Jul","Aug","Sep","Okt","Nov","Dez"],"weekdays":["Sonntag","Montag","Dienstag","Mittwoch","Donnerstag","Freitag","Samstag"],"weekdaysShort":["So","Mo","Die","Mi","Do","Fr","Sa"],"weekdaysMin":["So","Mo","Di","Mi","Do","Fr","Sa"],"currency_symbol":"","beforeForm":"","beforeFields":"","afterFields":"","afterForm":""};form.fields=[{"objectType":"Field","objectDomain":"fields","editActive":false,"order":1,"label":"Bitte Anrede ausw\u00e4hlen:","type":"listradio","key":"bitte_anrede_auswaehlen_1580465134673","label_pos":"above","required":1,"container_class":"","element_class":"","admin_label":"","help_text":"","drawerDisabled":"","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"list_item_row_styles_show_advanced_css":0,"list_item_label_styles_show_advanced_css":0,"list_item_element_styles_show_advanced_css":0,"cellcid":"c3751","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","list_item_row_styles_border":"","list_item_row_styles_height":"","list_item_row_styles_width":"","list_item_row_styles_font-size":"","list_item_row_styles_margin":"","list_item_row_styles_padding":"","list_item_row_styles_float":"","list_item_label_styles_border":"","list_item_label_styles_height":"","list_item_label_styles_width":"","list_item_label_styles_font-size":"","list_item_label_styles_margin":"","list_item_label_styles_padding":"","list_item_label_styles_float":"","list_item_element_styles_border":"","list_item_element_styles_height":"","list_item_element_styles_width":"","list_item_element_styles_font-size":"","list_item_element_styles_margin":"","list_item_element_styles_padding":"","list_item_element_styles_float":"","field_label":"Bitte Anrede ausw\u00e4hlen:","field_key":"bitte_anrede_auswaehlen_1580465134673","options":[{"errors":[],"max_options":"0","label":"Sehr geehrte Frau","value":"1","calc":"1","selected":"0","order":"0","settingModel":{"settings":false,"hide_merge_tags":false,"error":false,"name":"options","type":"option-repeater","label":"Options <a href=\"#\" class=\"nf-add-new\">Add New<\/a> <a href=\"#\" class=\"extra nf-open-import-tooltip\"><i class=\"fa fa-sign-in\" aria-hidden=\"true\"><\/i> Import<\/a>","width":"full","group":"","value":[{"label":"One","value":"one","calc":"","selected":0,"order":0},{"label":"Two","value":"two","calc":"","selected":0,"order":1},{"label":"Three","value":"three","calc":"","selected":0,"order":2}],"columns":{"label":{"header":"Label","default":""},"value":{"header":"Value","default":""},"calc":{"header":"Calc Value","default":""},"selected":{"header":"<span class=\"dashicons dashicons-yes\"><\/span>","default":0}}},"manual_value":"1"},{"errors":[],"max_options":"0","label":"Sehr geehrter Herr","value":"2","calc":"2","selected":"0","order":"1","settingModel":{"settings":false,"hide_merge_tags":false,"error":false,"name":"options","type":"option-repeater","label":"Options <a href=\"#\" class=\"nf-add-new\">Add New<\/a> <a href=\"#\" class=\"extra nf-open-import-tooltip\"><i class=\"fa fa-sign-in\" aria-hidden=\"true\"><\/i> Import<\/a>","width":"full","group":"","value":[{"label":"One","value":"one","calc":"","selected":0,"order":0},{"label":"Two","value":"two","calc":"","selected":0,"order":1},{"label":"Three","value":"three","calc":"","selected":0,"order":2}],"columns":{"label":{"header":"Label","default":""},"value":{"header":"Value","default":""},"calc":{"header":"Calc Value","default":""},"selected":{"header":"<span class=\"dashicons dashicons-yes\"><\/span>","default":0}}},"manual_value":"1"},{"errors":[],"max_options":"0","label":"Guten Tag","value":"3","calc":"3","selected":"0","order":"2","settingModel":{"settings":false,"hide_merge_tags":false,"error":false,"name":"options","type":"option-repeater","label":"Options <a href=\"#\" class=\"nf-add-new\">Add New<\/a> <a href=\"#\" class=\"extra nf-open-import-tooltip\"><i class=\"fa fa-sign-in\" aria-hidden=\"true\"><\/i> Import<\/a>","width":"full","group":"","value":[{"label":"One","value":"one","calc":"","selected":0,"order":0},{"label":"Two","value":"two","calc":"","selected":0,"order":1},{"label":"Three","value":"three","calc":"","selected":0,"order":2}],"columns":{"label":{"header":"Label","default":""},"value":{"header":"Value","default":""},"calc":{"header":"Calc Value","default":""},"selected":{"header":"<span class=\"dashicons dashicons-yes\"><\/span>","default":0}}},"manual_value":"1"}],"id":747,"beforeField":"","afterField":"","value":"","parentType":"list","element_templates":["listradio","input"],"old_classname":"list-radio","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":2,"label":"Vorname","type":"firstname","key":"firstname_1573210589193","label_pos":"hidden","required":0,"default":"","placeholder":"Vorname","container_class":"","element_class":"","admin_label":"","help_text":"","custom_name_attribute":"fname","personally_identifiable":1,"value":"","drawerDisabled":"","field_label":"Vorname","field_key":"firstname_1573210589193","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3755","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","cellOrder":1,"id":748,"beforeField":"","afterField":"","parentType":"firstname","element_templates":["firstname","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":4,"label":"Nachname","type":"lastname","key":"lastname_1573210591744","label_pos":"hidden","required":1,"default":"","placeholder":"Nachname*","container_class":"","element_class":"","admin_label":"","help_text":"","custom_name_attribute":"lname","personally_identifiable":1,"value":"","drawerDisabled":"","field_label":"Nachname","field_key":"lastname_1573210591744","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3757","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","cellOrder":1,"id":749,"beforeField":"","afterField":"","parentType":"lastname","element_templates":["lastname","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":8,"label":"Email","type":"email","key":"email_1582725914409","label_pos":"hidden","required":1,"default":"","placeholder":"E-Mail-Adresse*","container_class":"","element_class":"","admin_label":"","help_text":"<p>Die E-Mailadresse ist ein Pflichtfeld.<br><\/p>","custom_name_attribute":"email","personally_identifiable":1,"value":"","drawerDisabled":"","field_label":"Email","field_key":"email_1582725914409","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3760","oldCellcid":"c4390","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","id":750,"beforeField":"","afterField":"","parentType":"email","element_templates":["email","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":9,"label":"Ihre Nachricht an uns","type":"textarea","key":"ihre_nachricht_an_uns_1573565913431","label_pos":"hidden","required":"","default":"","placeholder":"Ihre Nachricht an uns","container_class":"","element_class":"","input_limit":160,"input_limit_type":"characters","input_limit_msg":"Zeichen \u00fcbrig","manual_key":"","admin_label":"","help_text":"","textarea_rte":"","disable_rte_mobile":"","textarea_media":"","value":"","drawerDisabled":"","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3763","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","field_label":"Ihre Nachricht an uns","field_key":"ihre_nachricht_an_uns_1573565913431","id":751,"beforeField":"","afterField":"","parentType":"textarea","element_templates":["textarea","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":5,"label":"Divider","type":"hr","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1581506117361","cellcid":"c3766","oldCellcid":"c3772","field_label":"Divider","field_key":"hr_1581506117361","id":764,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":6,"label":"HTML","type":"html","default":"<p><b>Erleben Sie yuuvis\u00ae live!<\/b><\/p>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1581506146896","cellcid":"c3769","drawerDisabled":"","oldCellcid":"c3775","field_label":"HTML","field_key":"html_1581506146896","id":768,"beforeField":"","afterField":"","value":"<p><b>Erleben Sie yuuvis\u00ae live!<\/b><\/p>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":7,"label":"Die Einf\u00fchrung der Software-L\u00f6sung ist geplant.","type":"checkbox","key":"softwaresolution_1581506167859","label_pos":"right","required":"","container_class":"","element_class":"","manual_key":1,"admin_label":"","help_text":"","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3772","drawerDisabled":"","oldCellcid":"c3778","field_label":"Die Einf\u00fchrung der Software-L\u00f6sung ist geplant.","field_key":"softwaresolution_1581506167859","id":765,"beforeField":"","afterField":"","value":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":8,"label":"Ich bin an einer Software-Pr\u00e4sentation interessiert.","type":"checkbox","key":"softwarepresentation_1581506142599","label_pos":"right","required":"","container_class":"","element_class":"","manual_key":1,"admin_label":"","help_text":"","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3775","drawerDisabled":"","oldCellcid":"c3781","field_label":"Ich bin an einer Software-Pr\u00e4sentation interessiert.","field_key":"softwarepresentation_1581506142599","id":766,"beforeField":"","afterField":"","value":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":9,"label":"Trennung","type":"hr","container_class":"","element_class":"","key":"hr_1573210614298","field_label":"Trennung","field_key":"hr_1573210614298","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3778","oldCellcid":"c4424","id":755,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":10,"label":"HTML","type":"html","default":"<small>Felder mit * sind Pflichtfelder.<\/small>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1574181495044","cellcid":"c3781","drawerDisabled":"","field_label":"HTML","field_key":"html_1574181495044","oldCellcid":"c3787","id":756,"beforeField":"","afterField":"","value":"<small>Felder mit * sind Pflichtfelder.<\/small>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":1,"label":"Telefon","type":"phone","cellcid":"c3787","key":"telefon_1582726279559","label_pos":"hidden","required":"","default":"","placeholder":"Telefon (Durchwahl)","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":"","admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"phone","personally_identifiable":1,"wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"value":"","cellOrder":1,"drawerDisabled":"","oldCellcid":"c3800","field_label":"Telefon","field_key":"telefon_1582726279559","id":761,"beforeField":"","afterField":"","parentType":"textbox","element_templates":["tel","textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":2,"label":"Position","type":"textbox","cellcid":"c3787","key":"position_1580818819203","label_pos":"hidden","required":1,"default":"","placeholder":"Position*","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":"","admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"","personally_identifiable":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"value":"","cellOrder":2,"drawerDisabled":"","oldCellcid":"c6784","field_label":"Position","field_key":"position_1580818819203","id":763,"beforeField":"","afterField":"","parentType":"textbox","element_templates":["textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":3,"label":"ZIP Code","type":"zip","cellcid":"c3789","key":"zip_code_1582726310139","label_pos":"hidden","required":"","default":"","placeholder":"PLZ","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Character(s) left","manual_key":"","admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"zip","personally_identifiable":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"value":"","cellOrder":1,"drawerDisabled":"","oldCellcid":"c3802","field_label":"ZIP Code","field_key":"zip_code_1582726310139","id":762,"beforeField":"","afterField":"","parentType":"zip","element_templates":["zip","textbox","input","textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":4,"label":"Unternehmen","type":"address","key":"unternehmen_1573565543483","label_pos":"hidden","required":1,"default":"","placeholder":"Unternehmen*","container_class":"","element_class":"","input_limit":"","input_limit_type":"characters","input_limit_msg":"Zeichen \u00c3\u00bcbrig","manual_key":"","admin_label":"","help_text":"","mask":"","custom_mask":"","custom_name_attribute":"company","personally_identifiable":1,"value":"","drawerDisabled":"","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3789","oldCellcid":"c4400","cellOrder":2,"field_label":"Unternehmen","field_key":"unternehmen_1573565543483","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","id":752,"beforeField":"","afterField":"","parentType":"address","element_templates":["address","textbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":5,"type":"hr","label":"Divider","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1582557416361","cellcid":"c3792","field_label":"Divider","field_key":"hr_1582557416361","id":769,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":6,"label":"HTML","type":"html","default":"<p>Bitte lesen und best\u00e4tigen Sie unsere Datenschutzbestimmungen.<\/p>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1573643938225","cellcid":"c3795","drawerDisabled":"","field_label":"HTML","field_key":"html_1573643938225","oldCellcid":"c3828","id":753,"beforeField":"","afterField":"","value":"<p>Bitte lesen und best\u00e4tigen Sie unsere Datenschutzbestimmungen.<\/p>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":7,"label":"Ja, ich habe die <a href=\"\/de\/impressum-und-datenschutz\" target=\"_blank\" rel=\"noopener\">Datenschutzbestimmungen<\/a> gelesen und bin damit einverstanden.","type":"checkbox","key":"datenschutz_1573564502005","label_pos":"right","required":1,"container_class":"","element_class":"","manual_key":1,"admin_label":"DATENSCHUTZ","help_text":"<p><br><\/p>","default_value":"unchecked","checked_value":1,"unchecked_value":2,"checked_calc_value":"","unchecked_calc_value":"","drawerDisabled":"","field_label":"Ja, ich habe die <a href=\"\/de\/impressum-und-datenschutz\" target=\"_blank\" rel=\"noopener\">Datenschutzbestimmungen<\/a> gelesen und bin damit einverstanden.","field_key":"datenschutz_1573564502005","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3798","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","oldCellcid":"c4421","default":"unchecked","value":"unchecked","id":754,"beforeField":"","afterField":"","parentType":"checkbox","element_templates":["checkbox","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":8,"label":"Divider","type":"hr","container_class":"","element_class":"","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"key":"hr_1582557452605","cellcid":"c3801","field_label":"Divider","field_key":"hr_1582557452605","id":770,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"hr","element_templates":["hr","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":9,"label":"HTML Copy","type":"html","default":"<small>Felder mit * sind Pflichtfelder.<\/small>","container_class":"","element_class":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"key":"html_1581505991324","cellcid":"c3804","drawerDisabled":"","field_label":"HTML Copy","field_key":"html_1581505991324","oldCellcid":"c4735","id":767,"beforeField":"","afterField":"","value":"<small>Felder mit * sind Pflichtfelder.<\/small>","label_pos":"above","parentType":"html","element_templates":["html","input"],"old_classname":"","wrap_template":"wrap"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":10,"label":"SPRACHE","type":"hidden","key":"hidden_sprache_1573570858706","default":"DE","admin_label":"sprache","manual_key":1,"drawerDisabled":"","wrap_styles_show_advanced_css":0,"label_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"cellcid":"c3807","oldCellcid":"c4430","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","field_label":"SPRACHE","field_key":"hidden_sprache_1573570858706","id":757,"beforeField":"","afterField":"","value":"DE","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":11,"label":"Optin-Herkunft","type":"hidden","key":"hidden_optinherkunft_1573569958584","default":"{wp:site_url}","admin_label":"optin-herkunft","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3810","drawerDisabled":"","manual_key":1,"field_label":"Optin-Herkunft","field_key":"hidden_optinherkunft_1573569958584","oldCellcid":"c3843","id":758,"beforeField":"","afterField":"","value":"https:\/\/bp387lpw.myraidbox.de\/de\/","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":12,"label":"YUUVIS-PRODUKT","type":"hidden","key":"yuuvis-produkt_1582728684947","default":"RAD","admin_label":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3813","drawerDisabled":false,"field_label":"YUUVIS-PRODUKT","field_key":"yuuvis-produkt_1582728684947","id":771,"beforeField":"","afterField":"","value":"RAD","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":13,"label":"PAGE-URL","type":"hidden","key":"page-url_1574859765696","default":"{wp:post_url}","admin_label":"","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","wrap_styles_show_advanced_css":0,"label_styles_border":"","label_styles_width":"","label_styles_font-size":"","label_styles_margin":"","label_styles_padding":"","label_styles_float":"","label_styles_show_advanced_css":0,"element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","element_styles_show_advanced_css":0,"cellcid":"c3816","drawerDisabled":"","field_label":"PAGE-URL","field_key":"page-url_1574859765696","oldCellcid":"c3849","id":759,"beforeField":"","afterField":"","value":"https:\/\/bp387lpw.myraidbox.de\/de\/rapid-application-development\/","label_pos":"above","parentType":"hidden","element_templates":["hidden","input"],"old_classname":"","wrap_template":"wrap-no-label"},{"objectType":"Field","objectDomain":"fields","editActive":false,"order":14,"label":"Jetzt Kontakt aufnehmen","type":"submit","processing_label":"Daten werden \u00fcbermittelt ...","container_class":"","element_class":"form-send-button","key":"jetzt_kontakt_aufnehmen_1574694425581","drawerDisabled":"","field_label":"Jetzt Kontakt aufnehmen","field_key":"jetzt_kontakt_aufnehmen_1574694425581","wrap_styles_show_advanced_css":0,"element_styles_show_advanced_css":0,"submit_element_hover_styles_show_advanced_css":0,"cellcid":"c3819","wrap_styles_border":"","wrap_styles_width":"","wrap_styles_margin":"","wrap_styles_padding":"","wrap_styles_float":"","element_styles_border":"","element_styles_width":"","element_styles_font-size":"","element_styles_margin":"","element_styles_padding":"","element_styles_float":"","submit_element_hover_styles_border":"","submit_element_hover_styles_width":"","submit_element_hover_styles_font-size":"","submit_element_hover_styles_margin":"","submit_element_hover_styles_padding":"","submit_element_hover_styles_float":"","oldCellcid":"c4433","element_styles_background-color":"","element_styles_border-color":"","element_styles_color":"","submit_element_hover_styles_background-color":"","submit_element_hover_styles_border-color":"","submit_element_hover_styles_color":"","id":760,"beforeField":"","afterField":"","value":"","label_pos":"above","parentType":"textbox","element_templates":["submit","button","input"],"old_classname":"","wrap_template":"wrap-no-label"}];nfForms.push(form); <div class="nf-mp-header"></div> <div class="nf-mp-body"></div> <div class="nf-mp-footer"></div> {{{ data.renderProgressBar() }}} {{{ data.renderBreadcrumbs() }}} {{{ data.renderPartTitle() }}} <h3> {{{ data.title }}} </h3> {{{ data.renderNextPrevious() }}} <ul class="nf-next-previous"> <# if ( data.showPrevious ) { #> <li class="nf-previous-item"> <input type="button" class="nf-previous" value="{{{ data.prevLabel }}}" /> </li> <# } #> <# if ( data.showNext ) { #> <li class="nf-next-item"> <input type="button" class="nf-next" value="{{{ data.nextLabel }}}" /> </li> <# } #> </ul> <ul class="nf-breadcrumbs"> <# _.each( data.parts, function( part, index ) { #> <li class="{{{ ( data.currentIndex == index ) ? 'active' : '' }}} {{{ ( part.errors ) ? 'errors' : '' }}}"> <a href="#" class="nf-breadcrumb" data-index="{{{ index }}}">{{{ ( part.errors ) ? '' : '' }}} {{{ part.title }}}</a> </li> <# } ); #> </ul> <div class="nf-progress-container"> <div class="nf-progress" style="width: {{{ data.percent }}}%;"></div> </div> <nf-fields></nf-fields> <nf-cells></nf-cells> Q&A

      Hier wird die Q&A Seite direkt geladen und nicht in einem neuen TAB

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Author Comments:

      ­Response to Reviewers Comments

      We would like to thank all reviewers for carefully considering our manuscript and providing useful suggestions/ideas. The general consensus was that our study provides an important conceptual advance that reveals a new way of thinking about kinetochore phosphatases. However, in light of our surprising findings, it was suggested that additional experiments would be required to fully validate our conclusions. In particular, it was seen as important to test whether PLK1 can activate MPS1 from the BUB complex and to confirm that PP1 and PP2A are effectively inhibited in situations where MELT dephosphorylation can occur normally (Figure 3).

      In general, we agree with these and the other points raised by the reviewers, therefore we plan to address all comments as outlined in detail below.

      The major new additions to the final paper will be the following:

      1) Experiments to test how BUB-bound PLK1 affects MPS1 activity.

      2) Experiments to determine the efficiency of phosphatase inhibition in figure 3.

      3) Experiments to test whether maintaining PLK1 at the BUB complex causes SAC silencing defects

      4) Evolutionary analysis demonstrating that the PLK1 and PP2A-binding modules have co-evolved in the kinetochore BUB complex. This analysis, which has been performed already, strengthens our manuscript because it provides additional independent evidence for a functional relationship between PLK1 and PP2A on the BUB complex.


      Reviewer #1 **Minor comments:** 1) The authors propose that PP1-KNL1 and BUBR1-bound PP2A-B56 continuously antagonise PLK1 association with the BUB complex by dephosphorylating the CDK1 phosphorylation sites on BUBR1 (pT620) and BUB1 (pT609). It is therefore expected that converting these residues to aspartate would increase PLK1 recruitment. It would be interesting to verify if this hypothesis fits with the proposed model.

      Response: The general idea to maintain PLK1 at the BUB complex is a good one, but unfortunately polo-box domains do not bind to acidic negatively charged residues. Instead we will attempt to maintain PLK1 at the BUB complex using alternatively approaches (as suggested by reviewer 2).

      2) In Figure 1E, are the mean values for BubR1WT+BubWT and BubR1WT+Bub1T609 both normalized to 1? If so, this fails to reveal the contribution of Bub1 T609 for the recruitment of PLK1 when PP2A-B56 is allowed to localize at kinetochores.

      Response: The values will be updated and normalised to the BubR1WT+BUB1WT control. We have also performed additional experiments already and overall the results reveal a small reduction in kinetochore PLK1 following BUB1-T609A mutation and a larger reduction upon combined BUBR1-T620A mutation.

      3) What underlies the increase in Bub1 levels at unattached kinetochores of siBubR1 cells (Figure S1C?) Is this caused by an increase in Bub1 T609 phosphorylation and consequently unopposed PLK1 recruitment, which consequently increases MELT phosphorylation?

      Response: We suspect that PLK1 is not the cause of the increased BUB1 levels because PLK1 kinetochore levels are actually decreased in this situation (Figure S1A).

      4) Although the immunoblotting from Figure S1D indicates that BubR1T620A and Bub1T609A are expressed at similar levels as their respective WT counterparts, some degree of single-cell variability is expected to occur. As a complement to Figure 1B,C and Figure S1E,F could the authors plot the kinetochore intensity of BubR1 pT620 and Bub1T609 relative to the YFP-BubR1 and YFP-Bub1 signal, respectively?

      Response: There is indeed variability in the level of re-expression of BUBR1/BUB1 on a single cell level, which can at least partially explain the variation on BUBR1-pT620 and BUB1-pT609 observed within in each condition. We can upload these scatter plots at resubmission and include in the supplementary, if required.

      5) The authors nicely show that excessive PLK1 levels at the BUB complex are able to maintain MELT phosphorylation and the SAC (independently of MPS1) when KNL1-localised phosphatases are removed (Figures 2A,B). However, it should be noted that PLK1 is able to promote MPS1 activation at kinetochores and so, whether AZ-3146 at 2.5 uM efficiently inhibits MPS1 under conditions of excessive PLK1 recruitment should be confirmed. Can the authors provide a read-out for MPS1 activation status or activity (other than p-MELTs) to exclude a potential contribution of residual MPS1 activity in maintaining the p-MELTs and SAC?

      Response: This is a good point because although PLK1 can phosphorylate the MELTs it can also activate MPS1, although it is unknown whether it can do this from the BUB complex. We had left a dotted line in Figure 4B to include this possibility, but we will now test this directly with additional experiments.

      6) To examine whether PLK1 removal is the major role of PP1-KNL1 and PP2A-B56 in the SAC or whether they are additionally needed to dephosphorylate the MELTs, the authors monitored MELT dephosphorylation when MPS1 was inhibited immediately after 30-minute of BI2356. This revealed similar dephosphorylation kinetics, irrespective of compromised PP1-KNL1 or PP2A-B56 activity, thus suggesting that these pools of phosphatases are not required to dephosphorylate MELTs. To confirm this and exclude phosphatase redundancy, the authors simultaneously depleted all PP1 and B56 isoforms or treated cells with Calyculin A to inhibit all PP1 and PP2A phosphatases. In both of these situations, the kinetics of MELT dephosphorylation was indistinguishable from wild type cells if MPS1 and PLK1 were inhibited together. These observations led to the conclusion that neither PP1 or PP2A are required to dephosphorylate the MELT motifs. Instead they are needed to remove PLK1 from the BUB complex. This set of experiments is well-designed and the results support the conclusion. However, it would be of value if the authors provide evidence for the efficiency of PP1 and B56 isoforms depletion and for the efficiency of phosphatase inhibition by Calyculin A. An alternative read-out for the activity of PP1 and PP2A-B56 (other than p-MELT dephosphorylation) clearly confirming that both phosphatases are compromised when MPS1 and PLK1 are inhibited together could make a stronger case in excluding the contribution of residual PP1 or PP2A to the observed dephosphorylation of MELT motifs.

      Response: This is also a good point. We had attempted many different combinations in Figure 3 to inhibit PP1/PP2A activity as efficiently as possible. This is especially important considering the “negative” results on pMELT are very surprising. However, we will now test how efficiently we have inhibited PP1 and PP2A phosphatase function in these experiments.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)): **Major comments:** 1) In its current state I am not convinced that the key conclusions are fully supported by the experiments and alternative conclusions/interpretations can be drawn. For example the level of MELT phosphorylation will be determined by the balance of kinase and phosphatase activity and if they do not achieve 100% inhibition of Mps1 in their assays then they are not strictly monitoring dephosphorylation kinetics in their assays. If the combination of Mps1 and Plk1 inhibition then more strongly inhibits Mps1 then dephosphorylation kinetics becomes faster. Thus subtle differences in Mps1 activity under their different conditions could lead to misleading conclusions but in its present state a careful analysis of Mps1 activity is not provided. This lack of complete inhibition also applies to the phosphatases and the experiments in Figure 3E indicates that their Calyculin preparation is not really active as at steady state MELT phosphorylation levels are much less affected than in for instance BubR1 del PP2A (Figure 2A as an example). Thus they likely still have phosphatase activity in the experiment in figure 3E making it difficult to draw the conclusions they do. A more careful analysis of kinase and phosphatase activities in their different perturbations would be recommendable and should be possible within a reasonable time frame.

      Response: These are good points and we will now more carefully assess MPS1 and PP1/PP2A activities.

      2) A more stringent test of their model would also be needed. What happens if Plk1 is artificially maintained in the Bub complex? The prediction would be that SAC silencing should be severely delayed even when Mps1 is inhibited. This is a straightforward experiment to do that should not take too long. If the polobox can bind phosphoSer then one could also make BubR1 T620S to slow down dephosphorylation of this site (PPPs work slowly on Ser while Cdk1 have almost same activity for Ser and Thr).

      Response: These are good suggestions and we will try to see if maintaining PLK1 at the BUB complex produces effects on the SAC.

      3) Another issue is the relevance of Plk1 removal under normal conditions. As their quantification shows in figure 1D-E (I think there is something wrong with figure 1E - should likely be Bub1) the contribution of BubR1 T620 and Bub1 T609 to Plk1 kinetochore localisation seems minimal. Thus upon SAC satisfaction there is not really a need to remove Plk1 through dephosphorylation as it is already at wild type levels. It is only in their BubR1 and KNL1 mutants that there is this effect so one has to question the impact in a normal setting. This is consistent with the data in Figure S1D showing no phosphorylation of these sites under unperturbed conditions.

      Response: The major finding of this study is that kinetochore phosphatases are primarily needed to supress PLK1 activity on the BUB complex and thereby prevent excessive MELT phosphorylation. The relevance of this continued PLK1 removal under normal conditions is clear, because when it cannot occur (i.e. if the phosphatases are removed) then the SAC cannot be silenced unless PLK1 is inhibited. Therefore, whilst it is true that PLK1 localisation to the BUB complex is low under normal conditions, that is because the phosphatases are working to keep it that way. The relevance of that continual removal is an interesting, but in our opinion, separate question that will require a new body of work to resolve. One possibility is that PLK1 recruitment is a continual dynamic process, that is perhaps coupled to a particular stage in MCC assembly. For example, PLK1 could bind the BUB complex to recruit PP2A to BUBR1, before being immediately removed by PP2A. In this sense, PLK1 binding could still be functionally important even if it is only occurs transiently and steady state PLK1 levels are low. We will add a line to the discussion to highlight that it would be interesting to test PLK1 dynamics on the BUB complex in future.

      4) They write that in the absence of phosphatase activity Plk1 becomes capable of supporting SAC independently (of Mps1 is implied). They do not show this - only that MELT phosphorylation is maintained. As Mps1 has other targets required for SAC activity I would rephrase this.

      Response: Good point, this will be rephrased.

      Reviewer #2 (Significance (Required)): The advance is clearly conceptual and provides a new way of thinking about the kinetochore localized phosphatases. These phosphatases and the SAC have been immensely studied but this work brings in a new angle. The discussion would benefit from some evolutionary perspectives as the PP1 and PP2A-B56 binding sites are very conserved but the Plk1 docking sites on Bubs less so. This will be of interest to people in the field of cell division and researchers interested in phospho-mediated signaling.

      Response: Since the paper was submitted, we performed evolutionary analysis to examine this point. We discovered that the PLK1 docking sites are surprisingly well conserved and, in fact, they appear to have co-evolved within the same region of MAD/BUB along with the PP2A-B56 binding motif. We believe this new data strengthens our manuscript because it argues strongly for an important functional relationship between PLK1 and PP2A. A new figure containing this evolutionary analysis will be included in the final version.

      Reviewer #3 **Major comments:**

      1. An important limitation of this study is that KNL1 dephosphorylation at MELT repeats is monitored only by indirect immunofluorescence using phospho-specific antibodies. Thus, reduction of phospho-KNL1 kinetochore signals could be due to protein turnover at kinetochores, rather than to dephosphorylation. This is a serious issue that could be addressed by checking KNL1 dephosphorylation during time course experiments by western blot using phospho-specific antibodies, as previously done (Espert et al., 2014).

      Response: This is an important point that we feel is best addressed by examining total KNL1 levels at kinetochores (instead of simply total cellular levels by western blots). The reason is that KNL1 could potentially still be lost from kinetochores even if the total protein is not degraded. In all experiments involving YFP-KNL1 we observe no change in kinetochore KNL1 levels and this data will be included in the final version. We will also perform new experiments to examine total KNL1 levels in the BUBR1-WT/DPP2A situation to test whether KNL1 kinetochore levels are similarly maintained in these cells following MPS1 inhibition.

      1. For obvious technical reasons, the shortest time point at which authors compare KNL1 dephosphorylation upon MPS1-PLK1 inhibition is 5 minutes. Based on immunofluorescence data, authors conclude that kinetics of KNL1 dephosphorylation are similar when kinases are inhibited, independent of whether or not kinetochore-bound phosphatases are active. However, in most experiments (e.g. Fig. 3B, 3C, 3E) lower levels of MELT phosphorylation are detected after 5 minutes of kinase inhibition when phosphatases are present than when they are absent, suggesting that phosphatases likely do contribute to KNL1 dephosphorylation. I suspect that differences between the presence and absence of phosphatases might even be more obvious if authors were to look at shorter time points, when phosphatases conceivably accomplish their function. I would therefore suggest that the authors tone down their conclusions, as their data complement but do not disprove the previous model.

      Response: We appreciate that small differences can be seen in figure 3B and 3E at the 5-minute timepoint (between the WT and phosphatase inhibited situations). This may reflect a role for the phosphatases in dephosphorylation or in the ability of drugs such as BI-2536 (3B) or Calyculin A (3E) to fully inhibit their targets in the short timeframe. We will perform additional experiments to examine MPS1 and phosphatase activity under these conditions, in response to comments by reviewers 1 and 2. In the final version we will carefully interpret the new and existing data and, if required, modify the conclusions appropriately.

      1. In all experiments cells are kept mitotically arrested through nocodazole treatment, which is not quite a physiological condition to study SAC silencing. This could potentially mask the real contribution of phosphatases in MELT dephosphorylation. Indeed, it is possible that higher amounts of phosphatases are recruited to kinetochores during SAC silencing than during SAC signalling (e.g. during SAC signalling Aurora B phosphorylates the RVSF motif of KNL1 to keep PP1 binding at low levels; Liu et al., 2010). What would happen in a nocodazole wash-out? Would phosphatases be dispensable in these conditions for normal kinetics of MELT dephosphorylation and anaphase onset if PLK1 is inhibited?

      Response: All SAC silencing assays where performed in nocodazole for 2 main reasons: 1) PP2A-B56, PP1 or PLK1 can all regulate kinetochore-microtubule attachments, and thereby control the SAC indirectly. Therefore, performing our assays in the absence of microtubules allows us to make specific and direct conclusions about SAC regulation; 2) Previous work on pMELT regulation by PP1/PP2A in human cells was also performed following MPS1 inhibition in nocodazole (Espert et al 2014, Nijenhuis et al, 2014). Therefore, we are able to directly compare the contribution of PLK1 to the previously observed phenotypes, which allowed us to conclude that PLK1 has a major influence.

      Nevertheless, we appreciate the point that the influence of PLK1 could, in theory, be different during a normal mitosis when microtubule attachment can form. Therefore, we will attempt to address whether PLK1 inhibition can bypass a requirement for PP1/PP2A in SAC silencing during an unperturbed mitosis.

      Other data are overinterpreted. For instance, the evidence that CDK1-dependent phosphorylation sites in Bub1 and BubR1 is enhanced when PP1 and PP2A-B56 are absent at kinetochores suggests but does not "demonstrate that PP1-KNL1 and BUBR1-bound PP2A-B56 antagonise PLK1 recruitment to the BUB complex by dephosphorylating key CDK1 phosphorylation sites on BUBR1 (pT620) and BUB1 (pT609)(Figure 1F)". Similarly, the claim "when kinetochore phosphatase recruitment is inhibited, PLK1 becomes capable of supporting the SAC independently" referred to Fig. 2C-D is an overstatement, as residual MPS1 kinase could be still active in the presence of the AZ-3146 inhibitor.

      Response: These are good points and the indicated statements will be reworded.

      **Minor comments:**

      1. In many graphs (Fig. 1A-C, Fig. 2A,C) relative kinetochore intensities are quantified over "CENPC or YFP-KNL1". Authors should clarify when it is one versus the other.

      Response: This will be clarified in the axis and in the methods.

      1. The drawing in Fig. 1F depicts the action of PP1 and PP2A-B56 in antagonising PLK1 at kinetochores. Thus, the output should be SAC silencing, rather than activation.

      Response: The SAC symbol will be removed from the schematic to avoid confusion and because it is not actually the focus of figure 1 anyway.

      1. In the Discussion authors speculate that KNL1 dephosphorylation relies on a constitutive phosphatase with unregulated basal activity. Would a phosphatase be needed at all when MPS1 and PLK1 are inhibited? Could phosphorylated KNL1 be actively degraded?

      Response: We will insert total KNL1 immunofluorescence quantification so show that KNL1 KT levels are not decreased in this situation. KNL1 remains anchored at kinetochore but the MELTs must be dephosphorylated to remove the BUB complex.

      1. What happens to MPS1 when KNL1-bound PP1 and BUBR1-bound PP2A are absent? Do its kinetochore levels increase as observed for PLK1? And what about the kinetochore levels of Bub1 and BubR1?

      Response: We have demonstrated previously that BUB1/BUBR1 increase in this situation in line with the pMELTs (Nijenhuis et al 2014;l Smith et al, 2019) – these papers will be referenced in relation to this. We will also address the effect of phosphatase removal on MPS1 activity, in response to comments by reviewers 1 and 2.

  6. Feb 2020
    1. R. Hatcher, Contraceptive Technology, D. Kowal, R. A. Hatcher, A. L. Nelson, J. Trussell, C. Cwiak, P. Cason, M. S. Policar, A. B. Edelman, A. R. A. Aiken, J. M. Marrazzo, Eds. (Managing Contraception LLC, ed. 21, 2018)

      Statistics show that "the chance of pregnancy in women using oral contraceptive pills is ~9% per year," signifying the need for improving oral contraceptives.

    1. "L+."/."/3"':%-".'"O+%3./'-"B$%.$%7"3+5$"6'2%(3"<%-%7,.%"7%(/,9(%"/-)'76,./'-",9'+.".$%")+.+7%>",-2".$%7%)'7%"/-"B$,."3%-3%".$%8"5'+(2"7%,3'-,9(8"/-)'76":+9(/5":'(/58

      I can't find when this chapter was published, but this question about a model's reliability and their role/ usefulness in policy formulations is still a hot topic today.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to Reviewers Comments

      We would like to thank all reviewers for carefully considering our manuscript and providing useful suggestions/ideas. The general consensus was that our study provides an important conceptual advance that reveals a new way of thinking about kinetochore phosphatases. However, in light of our surprising findings, it was suggested that additional experiments would be required to fully validate our conclusions. In particular, it was seen as important to test whether PLK1 can activate MPS1 from the BUB complex and to confirm that PP1 and PP2A are effectively inhibited in situations where MELT dephosphorylation can occur normally (Figure 3).

      In general, we agree with these and the other points raised by the reviewers, therefore we plan to address all comments as outlined in detail below.

      The major new additions to the final paper will be the following:

      1) Experiments to test how BUB-bound PLK1 affects MPS1 activity.

      2) Experiments to determine the efficiency of phosphatase inhibition in figure 3.

      3) Experiments to test whether maintaining PLK1 at the BUB complex causes SAC silencing defects

      4) Evolutionary analysis demonstrating that the PLK1 and PP2A-binding modules have co-evolved in the kinetochore BUB complex. This analysis, which has been performed already, strengthens our manuscript because it provides additional independent evidence for a functional relationship between PLK1 and PP2A on the BUB complex.


      Reviewer #1

      Minor comments:

      1) The authors propose that PP1-KNL1 and BUBR1-bound PP2A-B56 continuously antagonise PLK1 association with the BUB complex by dephosphorylating the CDK1 phosphorylation sites on BUBR1 (pT620) and BUB1 (pT609). It is therefore expected that converting these residues to aspartate would increase PLK1 recruitment. It would be interesting to verify if this hypothesis fits with the proposed model.

      Response: The general idea to maintain PLK1 at the BUB complex is a good one, but unfortunately polo-box domains do not bind to acidic negatively charged residues. Instead we will attempt to maintain PLK1 at the BUB complex using alternatively approaches (as suggested by reviewer 2).

      2) In Figure 1E, are the mean values for BubR1WT+BubWT and BubR1WT+Bub1T609 both normalized to 1? If so, this fails to reveal the contribution of Bub1 T609 for the recruitment of PLK1 when PP2A-B56 is allowed to localize at kinetochores.

      Response: The values will be updated and normalised to the BubR1WT+BUB1WT control. We have also performed additional experiments already and overall the results reveal a small reduction in kinetochore PLK1 following BUB1-T609A mutation and a larger reduction upon combined BUBR1-T620A mutation.

      3) What underlies the increase in Bub1 levels at unattached kinetochores of siBubR1 cells (Figure S1C?) Is this caused by an increase in Bub1 T609 phosphorylation and consequently unopposed PLK1 recruitment, which consequently increases MELT phosphorylation?

      Response: We suspect that PLK1 is not the cause of the increased BUB1 levels because PLK1 kinetochore levels are actually decreased in this situation (Figure S1A).

      4) Although the immunoblotting from Figure S1D indicates that BubR1T620A and Bub1T609A are expressed at similar levels as their respective WT counterparts, some degree of single-cell variability is expected to occur. As a complement to Figure 1B,C and Figure S1E,F could the authors plot the kinetochore intensity of BubR1 pT620 and Bub1T609 relative to the YFP-BubR1 and YFP-Bub1 signal, respectively?

      Response: There is indeed variability in the level of re-expression of BUBR1/BUB1 on a single cell level, which can at least partially explain the variation on BUBR1-pT620 and BUB1-pT609 observed within in each condition. We can upload these scatter plots at resubmission and include in the supplementary, if required.

      5) The authors nicely show that excessive PLK1 levels at the BUB complex are able to maintain MELT phosphorylation and the SAC (independently of MPS1) when KNL1-localised phosphatases are removed (Figures 2A,B). However, it should be noted that PLK1 is able to promote MPS1 activation at kinetochores and so, whether AZ-3146 at 2.5 uM efficiently inhibits MPS1 under conditions of excessive PLK1 recruitment should be confirmed. Can the authors provide a read-out for MPS1 activation status or activity (other than p-MELTs) to exclude a potential contribution of residual MPS1 activity in maintaining the p-MELTs and SAC?

      Response: This is a good point because although PLK1 can phosphorylate the MELTs it can also activate MPS1, although it is unknown whether it can do this from the BUB complex. We had left a dotted line in Figure 4B to include this possibility, but we will now test this directly with additional experiments.

      6) To examine whether PLK1 removal is the major role of PP1-KNL1 and PP2A-B56 in the SAC or whether they are additionally needed to dephosphorylate the MELTs, the authors monitored MELT dephosphorylation when MPS1 was inhibited immediately after 30-minute of BI2356. This revealed similar dephosphorylation kinetics, irrespective of compromised PP1-KNL1 or PP2A-B56 activity, thus suggesting that these pools of phosphatases are not required to dephosphorylate MELTs. To confirm this and exclude phosphatase redundancy, the authors simultaneously depleted all PP1 and B56 isoforms or treated cells with Calyculin A to inhibit all PP1 and PP2A phosphatases. In both of these situations, the kinetics of MELT dephosphorylation was indistinguishable from wild type cells if MPS1 and PLK1 were inhibited together. These observations led to the conclusion that neither PP1 or PP2A are required to dephosphorylate the MELT motifs. Instead they are needed to remove PLK1 from the BUB complex. This set of experiments is well-designed and the results support the conclusion. However, it would be of value if the authors provide evidence for the efficiency of PP1 and B56 isoforms depletion and for the efficiency of phosphatase inhibition by Calyculin A. An alternative read-out for the activity of PP1 and PP2A-B56 (other than p-MELT dephosphorylation) clearly confirming that both phosphatases are compromised when MPS1 and PLK1 are inhibited together could make a stronger case in excluding the contribution of residual PP1 or PP2A to the observed dephosphorylation of MELT motifs.

      Response: This is also a good point. We had attempted many different combinations in Figure 3 to inhibit PP1/PP2A activity as efficiently as possible. This is especially important considering the “negative” results on pMELT are very surprising. However, we will now test how efficiently we have inhibited PP1 and PP2A phosphatase function in these experiments.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Major comments:

      1) In its current state I am not convinced that the key conclusions are fully supported by the experiments and alternative conclusions/interpretations can be drawn. For example the level of MELT phosphorylation will be determined by the balance of kinase and phosphatase activity and if they do not achieve 100% inhibition of Mps1 in their assays then they are not strictly monitoring dephosphorylation kinetics in their assays. If the combination of Mps1 and Plk1 inhibition then more strongly inhibits Mps1 then dephosphorylation kinetics becomes faster. Thus subtle differences in Mps1 activity under their different conditions could lead to misleading conclusions but in its present state a careful analysis of Mps1 activity is not provided. This lack of complete inhibition also applies to the phosphatases and the experiments in Figure 3E indicates that their Calyculin preparation is not really active as at steady state MELT phosphorylation levels are much less affected than in for instance BubR1 del PP2A (Figure 2A as an example). Thus they likely still have phosphatase activity in the experiment in figure 3E making it difficult to draw the conclusions they do. A more careful analysis of kinase and phosphatase activities in their different perturbations would be recommendable and should be possible within a reasonable time frame.

      Response: These are good points and we will now more carefully assess MPS1 and PP1/PP2A activities.

      2) A more stringent test of their model would also be needed. What happens if Plk1 is artificially maintained in the Bub complex? The prediction would be that SAC silencing should be severely delayed even when Mps1 is inhibited. This is a straightforward experiment to do that should not take too long. If the polobox can bind phosphoSer then one could also make BubR1 T620S to slow down dephosphorylation of this site (PPPs work slowly on Ser while Cdk1 have almost same activity for Ser and Thr).

      Response: These are good suggestions and we will try to see if maintaining PLK1 at the BUB complex produces effects on the SAC.

      3) Another issue is the relevance of Plk1 removal under normal conditions. As their quantification shows in figure 1D-E (I think there is something wrong with figure 1E - should likely be Bub1) the contribution of BubR1 T620 and Bub1 T609 to Plk1 kinetochore localisation seems minimal. Thus upon SAC satisfaction there is not really a need to remove Plk1 through dephosphorylation as it is already at wild type levels. It is only in their BubR1 and KNL1 mutants that there is this effect so one has to question the impact in a normal setting. This is consistent with the data in Figure S1D showing no phosphorylation of these sites under unperturbed conditions.

      Response: The major finding of this study is that kinetochore phosphatases are primarily needed to supress PLK1 activity on the BUB complex and thereby prevent excessive MELT phosphorylation. The relevance of this continued PLK1 removal under normal conditions is clear, because when it cannot occur (i.e. if the phosphatases are removed) then the SAC cannot be silenced unless PLK1 is inhibited. Therefore, whilst it is true that PLK1 localisation to the BUB complex is low under normal conditions, that is because the phosphatases are working to keep it that way. The relevance of that continual removal is an interesting, but in our opinion, separate question that will require a new body of work to resolve. One possibility is that PLK1 recruitment is a continual dynamic process, that is perhaps coupled to a particular stage in MCC assembly. For example, PLK1 could bind the BUB complex to recruit PP2A to BUBR1, before being immediately removed by PP2A. In this sense, PLK1 binding could still be functionally important even if it is only occurs transiently and steady state PLK1 levels are low. We will add a line to the discussion to highlight that it would be interesting to test PLK1 dynamics on the BUB complex in future.

      4) They write that in the absence of phosphatase activity Plk1 becomes capable of supporting SAC independently (of Mps1 is implied). They do not show this - only that MELT phosphorylation is maintained. As Mps1 has other targets required for SAC activity I would rephrase this.

      Response: Good point, this will be rephrased.

      Reviewer #2 (Significance (Required)):

      The advance is clearly conceptual and provides a new way of thinking about the kinetochore localized phosphatases. These phosphatases and the SAC have been immensely studied but this work brings in a new angle. The discussion would benefit from some evolutionary perspectives as the PP1 and PP2A-B56 binding sites are very conserved but the Plk1 docking sites on Bubs less so. This will be of interest to people in the field of cell division and researchers interested in phospho-mediated signaling.

      Response: Since the paper was submitted, we performed evolutionary analysis to examine this point. We discovered that the PLK1 docking sites are surprisingly well conserved and, in fact, they appear to have co-evolved within the same region of MAD/BUB along with the PP2A-B56 binding motif. We believe this new data strengthens our manuscript because it argues strongly for an important functional relationship between PLK1 and PP2A. A new figure containing this evolutionary analysis will be included in the final version.

      Reviewer #3

      Major comments:

      1. An important limitation of this study is that KNL1 dephosphorylation at MELT repeats is monitored only by indirect immunofluorescence using phospho-specific antibodies. Thus, reduction of phospho-KNL1 kinetochore signals could be due to protein turnover at kinetochores, rather than to dephosphorylation. This is a serious issue that could be addressed by checking KNL1 dephosphorylation during time course experiments by western blot using phospho-specific antibodies, as previously done (Espert et al., 2014).

      Response: This is an important point that we feel is best addressed by examining total KNL1 levels at kinetochores (instead of simply total cellular levels by western blots). The reason is that KNL1 could potentially still be lost from kinetochores even if the total protein is not degraded. In all experiments involving YFP-KNL1 we observe no change in kinetochore KNL1 levels and this data will be included in the final version. We will also perform new experiments to examine total KNL1 levels in the BUBR1-WT/DPP2A situation to test whether KNL1 kinetochore levels are similarly maintained in these cells following MPS1 inhibition.

      1. For obvious technical reasons, the shortest time point at which authors compare KNL1 dephosphorylation upon MPS1-PLK1 inhibition is 5 minutes. Based on immunofluorescence data, authors conclude that kinetics of KNL1 dephosphorylation are similar when kinases are inhibited, independent of whether or not kinetochore-bound phosphatases are active. However, in most experiments (e.g. Fig. 3B, 3C, 3E) lower levels of MELT phosphorylation are detected after 5 minutes of kinase inhibition when phosphatases are present than when they are absent, suggesting that phosphatases likely do contribute to KNL1 dephosphorylation. I suspect that differences between the presence and absence of phosphatases might even be more obvious if authors were to look at shorter time points, when phosphatases conceivably accomplish their function. I would therefore suggest that the authors tone down their conclusions, as their data complement but do not disprove the previous model.

      Response: We appreciate that small differences can be seen in figure 3B and 3E at the 5-minute timepoint (between the WT and phosphatase inhibited situations). This may reflect a role for the phosphatases in dephosphorylation or in the ability of drugs such as BI-2536 (3B) or Calyculin A (3E) to fully inhibit their targets in the short timeframe. We will perform additional experiments to examine MPS1 and phosphatase activity under these conditions, in response to comments by reviewers 1 and 2. In the final version we will carefully interpret the new and existing data and, if required, modify the conclusions appropriately.

      1. In all experiments cells are kept mitotically arrested through nocodazole treatment, which is not quite a physiological condition to study SAC silencing. This could potentially mask the real contribution of phosphatases in MELT dephosphorylation. Indeed, it is possible that higher amounts of phosphatases are recruited to kinetochores during SAC silencing than during SAC signalling (e.g. during SAC signalling Aurora B phosphorylates the RVSF motif of KNL1 to keep PP1 binding at low levels; Liu et al., 2010). What would happen in a nocodazole wash-out? Would phosphatases be dispensable in these conditions for normal kinetics of MELT dephosphorylation and anaphase onset if PLK1 is inhibited?

      Response: All SAC silencing assays where performed in nocodazole for 2 main reasons: 1) PP2A-B56, PP1 or PLK1 can all regulate kinetochore-microtubule attachments, and thereby control the SAC indirectly. Therefore, performing our assays in the absence of microtubules allows us to make specific and direct conclusions about SAC regulation; 2) Previous work on pMELT regulation by PP1/PP2A in human cells was also performed following MPS1 inhibition in nocodazole (Espert et al 2014, Nijenhuis et al, 2014). Therefore, we are able to directly compare the contribution of PLK1 to the previously observed phenotypes, which allowed us to conclude that PLK1 has a major influence. Nevertheless, we appreciate the point that the influence of PLK1 could, in theory, be different during a normal mitosis when microtubule attachment can form. Therefore, we will attempt to address whether PLK1 inhibition can bypass a requirement for PP1/PP2A in SAC silencing during an unperturbed mitosis.

      Other data are overinterpreted. For instance, the evidence that CDK1-dependent phosphorylation sites in Bub1 and BubR1 is enhanced when PP1 and PP2A-B56 are absent at kinetochores suggests but does not "demonstrate that PP1-KNL1 and BUBR1-bound PP2A-B56 antagonise PLK1 recruitment to the BUB complex by dephosphorylating key CDK1 phosphorylation sites on BUBR1 (pT620) and BUB1 (pT609)(Figure 1F)". Similarly, the claim "when kinetochore phosphatase recruitment is inhibited, PLK1 becomes capable of supporting the SAC independently" referred to Fig. 2C-D is an overstatement, as residual MPS1 kinase could be still active in the presence of the AZ-3146 inhibitor.

      Response: These are good points and the indicated statements will be reworded.

      Minor comments:

      1. In many graphs (Fig. 1A-C, Fig. 2A,C) relative kinetochore intensities are quantified over "CENPC or YFP-KNL1". Authors should clarify when it is one versus the other.

      Response: This will be clarified in the axis and in the methods.

      1. The drawing in Fig. 1F depicts the action of PP1 and PP2A-B56 in antagonising PLK1 at kinetochores. Thus, the output should be SAC silencing, rather than activation.

      Response: The SAC symbol will be removed from the schematic to avoid confusion and because it is not actually the focus of figure 1 anyway.

      1. In the Discussion authors speculate that KNL1 dephosphorylation relies on a constitutive phosphatase with unregulated basal activity. Would a phosphatase be needed at all when MPS1 and PLK1 are inhibited? Could phosphorylated KNL1 be actively degraded?

      Response: We will insert total KNL1 immunofluorescence quantification so show that KNL1 KT levels are not decreased in this situation. KNL1 remains anchored at kinetochore but the MELTs must be dephosphorylated to remove the BUB complex.

      1. What happens to MPS1 when KNL1-bound PP1 and BUBR1-bound PP2A are absent? Do its kinetochore levels increase as observed for PLK1? And what about the kinetochore levels of Bub1 and BubR1?

      Response: We have demonstrated previously that BUB1/BUBR1 increase in this situation in line with the pMELTs (Nijenhuis et al 2014;l Smith et al, 2019) – these papers will be referenced in relation to this. We will also address the effect of phosphatase removal on MPS1 activity, in response to comments by reviewers 1 and 2.

    1. C r i t i c a l p o l i t i c a l e c o n o m y o ffe r s p o s s i b i l i t i e s f o r u n d e r-standing Blackness online, but its focus on oppression and resistance lingers on labor, the state, and the public sphere, leaving cultural aspects behind.

      Appropriation, and even colonization, of culture, not just erasure.

  7. Jan 2020
    1. ACEi: decreased mortality, MANDATORY in systolic l. valve dysfunction. improved survival/symptoms, hspitalizations. titrate 3-4 weeks, monitor K+

      B-Blockers; improve prognosis, low/slow. Transietn tiredness. Caution in bronchospastic pts, asthma.

      Dig: advanced chf, a-fib. improves exercise capacity, reduces hospitalization. Titrate to tolerance

      Furosemide: reduces edema, hosp. improves exercise, for systolic dysf. High dose for systolic dysf. is associated w/ increased mortality, sudden death, pump failure.

      Hydralazine: arteriolar dilator; in hemodynamic failure increases cardiac output, stroke vol, decreases vascular resistance w/o affecting pulmonary. Can benefit mitral/aortic regurg, VSD w/ reduced systemic output; but long term is unknown. Chronic HF + low cardiac output, sustained/benififcal hemodynamic effect.

      CCB: no role in systolic dysf, adverse outcomes. no role in HF.

      Spironolactone: lowers mortality/hosp. in systolic dysunction w/ dyspnea @ rest in the last 6 mo. Gyncomastia uncommon. HF + Dyspnea @ rest, + Cr<2.5 = spironolactone

    1. A l t h o u g h t h e s e c u l t u r e s o f p a r t i c i p a t i o n a r e b e c o m i n g m o r e c o m m o n , t h e y a r e not equally accessed

      An example of this is if you live in a country without access or even a rural area of this country.

    2. A l t h o u g h t h e s e c u l t u r e s o f p a r t i c i p a t i o n a r e b e c o m i n g m o r e c o m m o n , t h e y a r e not equally accessed. Recent research has shown that despite the emerging cultural image of the average youth as constantly connected and technologically savvy, those who can actually create digital media or interactive environments are in the minority (Barron, Walter, Martin, & Schatz, 2010 ; I t o e t a l . , 2009 )

      this is so me even being raised with technology all around me i wouldn't know how to create most of the media platforms i see.

    3. Online communities that re fl ect “cultures of participa-tion” (Jenkins, 2006, 2009 ) a l l o w c r e a t o r s t o s h a r e t h e i r w o r k , r e c e i v e f e e d b a c k , and expand their social networks. Informal collaborative relationships develop as learners share knowledge and codevelop interests. It has been suggested that participation in these informal collectives nurtures important twenty- fi rst-century capacities such as collaboration, knowledge of how to build social networks, man-age information, direct one’s own learning, engage in design, and capitalize on opportunities for distributed cognition and the building of collective intelligence. Design activities, including information gathering, creative thinking, prototyping, improvisation, and tinkering, are thought to provide potential pathways to these crucial twenty- fi rst-century capacities (Balsamo, 2010 )

      The availability to interact with specific communities and reach out to the exact groups of people you are looking for helps enhance communication on a level that has never been achievable before. This allows for limitless potential to express oneself and learn about a specific topic in an interactive way and opens up opportunities for individuals who face limitations to sociability due to their location and lack of resources.

    4. . O u r m e t h o d s i n v o l v e o b s e r v ation, interviews, analysis of the artifacts learners create, and data collection through an occasional questionnaire.

      Self reporting data can be an issue in case studies. However, this seems to be one of the few ways this topic can be measured. It makes me question the ways they measured the data and how it can be generalized to a population.

    1. ingiuria

      ingiùria s. f. [dal lat. iniuria, der. dell’agg. iniurius «ingiusto», comp. di in-2 e ius iuris «diritto»]. – 1. Nel sign. originario, ogni azione contro il diritto, sinon. quindi di ingiustizia, intesa soprattutto come violazione delle norme giuridiche (e pertanto meno grave di iniquità che è violazione dell’equità): D’ogne malizia, ch’odio in cielo acquista, Ingiuria è ’l fine, ed ogne fin cotale O con forza o con frode altrui contrista (Dante), ha per fine la violazione del diritto, che può avvenire per violenza o frode ai danni altrui; per i. propose di rivolere quello che per parole riaver non potea (Boccaccio). 2. a. In diritto civile e penale, offesa recata mediante parole, atti, o mediante l’invio di scritti o disegni, all’onore o al decoro di una persona presente o con la quale si è in comunicazione postale, telefonica o telematica, perseguibile penalmente su querela dell’offeso: i. verbale, reale; i. grave. Nel diritto canonico e nella morale cattolica, in senso lato, violazione del diritto altrui alla fama, violazione considerata come delitto e peccato. b. Nell’uso com., senza preciso riferimento giuridico, offesa al nome, al decoro, all’onore altrui, con parole o atti oltraggiosi: fare i. al nome, all’onore di qualcuno; dire parole, fare un gesto d’ingiuria. In senso più concr., detto ingiurioso, frase fortemente offensiva: gli rivolse le i. più volgari; lo coprì d’ingiurie; si scambiarono atroci i.; dalle ingiurie passarono a vie di fatto. c. Per estens., atto o discorso o pensiero che implicitamente comporti un giudizio sfavorevole, tale da urtare la suscettibilità altrui: mi fanno i. supponendo che io abbia agito così per interesse, mi fanno torto, cioè, a pensarlo. 3. letter. Offesa, danno recato alle cose e alle persone da fatti naturali, dal corso del tempo, dalla sorte; per lo più al plur.: le i. delle stagioni; le i. del destino; mostrava nei lineamenti del volto le i. del tempo.

      http://www.treccani.it/vocabolario/ingiuria/

    1. Alves, M. 1984. Estado e oposição no Brasil (1964-1884). Petrópolis: Vozes. Alves, M, et P Evanson. 2013. Vivendo no fogo cruzado. São Paulo: Unesp. Boutros-Ghali, B. 1992. « An Agenda for Peace Preventive diplomacy, peacemaking and peace-keeping ». A/47/277-S/24111. ONU. Fontoura, P. 1999. O Brasil e as operações de manutenção da paz das Nações Unidas. Brasília: FUNAG. Gaspar, M. 2018. « O Fiador ». Revista Piauí, nᵒ 144 (septembre):16‑27. Gomes, M. 2014. « pacificação” como prática de “política externa” de (re)produção do self estatal: rescrevendo o engajamento do Brasil na Missão das Nações Unidas para a Estabilização no Haiti (MINUSTAH) ». Thèse de doctorat, Rio de Janeiro: Programa de Pós-Graduação em Relações Internacionais do Instituto de Relações Internacionais da PUC-Rio. Matias, K. 2004. A militarização da burocracia. São Paulo: Unesp/Fapesp. « ’Não há guerra que não seja letal’, diz Torquato Jardim ao Correio ». 2018. Correio Braziliense, février. https://www.correiobraziliense.com.br/app/noticia/politica/2018/02/20/interna_politica,660876/correio-entrevista-o-ministro-da-justica-torquato-jardim.shtml. « Ruralista troca Alckmin por Bolsonaro e diz que tempo de tucano passou ». 2018. Folha de São Paulo, avril. https://www1.folha.uol.com.br/poder/2018/04/ruralista-troca-alckmin-por-bolsonaro-e-diz-que-tempo-de-tucano-passou.shtml. Schwarcz, L. 1993. O espetáculo das raças. São Paulo: Companhia das Letras. Soares, L. 2015. « Por que tem sido tão difícil mudar as polícias? » Blog. Blog da Boitempo. https://blogdaboitempo.com.br/2015/07/13/por-que-tem-sido-tao-dificil-mudar-as-policias/. Souza, J. 2009. A ralé brasileira. Belo Horizonte: UFMG. Souza, L. 2015. « Dispositivo militarizado da segurança pública. Tendências recentes e problemas no Brasil ». Revista Sociedade e Estado 30 (1):207‑23. Souza, L, et T Battibugli. 2014. « O difícil caminho da reforma: a polícia e os limites do processo de reforma pós-redemocratização ». Dilemas 7 (2):293‑319. Stargardter, G. 2018. « General behind deadly Haiti raid takes aim at Brazil’s gangs ». Reuters, novembre. https://www.reuters.com/article/us-brazil-violence-insight/general-behind-deadly-haiti-raid-takes-aim-at-brazils-gangs-idUSKCN1NY0GM. Wacquant, L. 2003. Punir os pobres. Rio de Janeiro: Revan.

      Primeiros nomes ausentes na bibliografia; Datas de último acesso aos sites ausentes ; Referência à Maíra Siman Gomes inutilizada ; Referência da ONU editada para fazer menção ao autor, então Secretário Geral ; Referências ausentes (cf ao longo do texto)

  8. Nov 2019
    1. p. 121 :

      […] je fis impartialement face aux perspectives d’avenir qui se présentaient à moi : a) parler à Alvaro et lui dire que le cousin germain de Beatriz <mark>(cet euphémisme explicatif me permettrait de la nommer)</mark> avait écrit un poème qui semblait <mark>reculer à l’infini les possibilités de la cacophonie et du chaos</mark> ; b) ne pas parler à Alvaro.

      La parenthèse constitue un amusant prétexte, une prétérition (figure stylistique consistant à prétendre ne pas parler de quelque chose pour justement pouvoir mieux en parler!)

      Mais la suite est plus sérieuse : « reculer à l’infini les possibilités du de la cacophonie et du chaos » renvoie peut-être à une manière détournée de parler de l’infinité, précisément de la manière dont la poésie fait chaque jour reculer l’horizon des possibles imaginables.

    1. " rank Lloyd formal criticism and analysis (of th~> r -~~"E. >f)f~Usier, Mws, etc), where the bui I ding into a virtuai sn I t· • Hg -rnodcrrust transformat.ion of ' • , 1 P ure. or monumPnt·tl " 1 k" Venturi puts it) I are .11 onp wit! .... l . ' ' ( uc , as l\obert . , ' . 1 reconsH eratwns on the I' I f b Ism and of the aPstll"lJ·c· I·nstJ't t' II' h . '.eve o ur. an-•• '' · • U lOll · Ig IT j · · with the destruction of the fabric

      I did not realize architecture played a role in postmodernism. I know Frank Lloyd Wright's works well growing up in Madison, and never knew they were criticized by this movement.

    2. What has not b()tm taken into account by this view, however, is the social position of the older modernism, or better still, its passionate repudiation by an older Victorian and post-Victorian bourgeoisie for whom its forms and ethos are received as beino variously ugly, dissonant, obscure, scandalous, immoral. subversive, an<l generally "antisocial."

      Another great era to be looked at for postmodernism would be the Weimar republic. The expressionist artists really took advantage of the time because it was during the roaring 1920s and when Hitler was on the rise so many would use the party life and political things going on in Weimar at the time in their art and over exaggerated. If you look at the art it almost seems as if it is the 1920s versions of memes with a lot of opinions inserted into the art.

    Annotators

    1. C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, Immunol. Today 15, 321 (1994)

      June, Bluestone, Nadler, and Thompson review the research on B7 and CD28. Though they are the most commonly found members, each of these molecules is part of a larger receptor family of related molecules.

    1. They are not acquainted with B. F. L. M. P. X. Z; and I. E. V. are never consonants to them.

      This must make evangelism hard with a language barrier...

    1. e:~~~r;•~~~;!~~~~~~~~~~~nt~~y~~~l~~~b-r~~ffii&~fi~~these di~IJl'gte~-~~~~~!.:atli.."~e"ss'.lg~i''tr2.tt¥~·~~~~~:~·~~tf''~~~~~1¥Fl!f~1: inco-li~ . . ··~"sense and 'honsense:'''A''det:a:iled ela "iofi''at'~imet'Ififr;4;d~f~~~§tt~ge!rr~''tlfaf''~t1l~'*'i'i1orE'''teft!'v1'sion we "-tch, the more we are able to hold contradictory ideas simultaneously,.

      As a powerful media platform, television can contain enormous ideology and this can influence the audience's though in a imperceptible way.

    2. :~~~r;•~~~;!~~~~~~~~~~~nt~~y~~~l~~~b-r~~ffii&~fi~~these di~IJl'gte~-~~~~~!.:atli.."~e"ss'.lg~i''tr2.tt¥~·~~~~~:~·~~tf''~~~~~1¥Fl!f~1: inco-li~ . . ··~"sense and 'honsense:'

      I feel like there are so many subtleties in television that we are constantly taking in that we don't even realize. It's so easy to just sit in front of the screen and zone out, but even then you are still taking in what you are seeing and connecting to it.

    Annotators

  9. Oct 2019
    1. :~~~r;•~~~;!~~~~~~~~~~~nt~~y~~~l~~~b-r~~ffii&~fi~~these di~IJl'gte~-~~~~~!.:atli.."~e"ss'.lg~i''tr2.tt¥~·~~~~~:~·~~tf''~~~~~1¥Fl!f~1: inco-li~ . . ··~"sense and 'honsense:'''A''det:a:iled ela "iofi''at'~imet'Ififr;4;d~f~~~§tt~ge!rr~''tlfaf''~t1l~'*'i'i1orE'''teft!'v1'sion we "-tch, the more we are able to hold contradictory ideas simultaneously,

      Product placement is such a large part of movies and television that we are unknowing being sold products constantly. It easy extremely hard to find any new television shows and movies that don't have product placements. This is dangerous because the audience is being sold ideas without even realizing it. They can use this with political views, and this could sway how you think. Television having the power to change you beliefs unknowingly is a very scary thing.

    2. !~~,:a~~l%i.~ili~1lt?i11'11!illi~Ji;u,g,t,,ot;a.politician ~~~t~1,nn~~~~~~~~~~¥t~~~i~~~~,~~;;:;~~it,b;~~;~::a~~r~~;hw;~~ eyags they surround themselves with on news appearances) than by developing an argument.

      This goes without saying because if you pick one side in an argument, you are shutting out the people who chose the other side and automatically lose on their business. When you stay neutral, you have a bigger audience to adhere to.

    Annotators

    1. We ·have already suggested that l3iU_Q<;>s.by, .. the.aGt.or1"''.and . .,ClifLHY!t~he s,b~r~L-" .. o~ .. U!S:.!SS ... m!!?..Jl-,..§,W&Lc;,,jj;lc;mi~: For many, Bill Cosby is Cliff Huxtable.

      This is similar to Charlie Sheen as Charlie Harper in Two and a Half Men, even beyond the name. The actor and character are very much alike, and the concept is a cornerstone of the show.

    Annotators

    1. (Left) when goods are perfect substitutes, there is no Substitution effect of a price change. For prices lll and l′l′l', the minimum-cost consumption that attains U1U1U_1 is the same point (A,B)

      This is backwards -- left is perfect complements (I said 'substitute/) and right is perfect substitutes (I said 'complements'. Rest is correct, wiill fix this shortly.

    1. Empirical risk minimization

      An empirical risk minimization (ERM) algorithm returns \(h_m \in H\) that minimizes \(R_{T^m}(h)\).

      • Excess error: \(R(h_m) - R^*\)
        • Estimation error: \(R(h_m) - R(h_H)\)
        • Approximation error: \(R(h_H) - R^*\)

      An algorithm is statistically consistent in \(H\) iff \(\forall \epsilon > 0: \lim_{m \rightarrow \infty} P(R(h_m) - R(h_H) \geq \epsilon) = 0\).

      The hypothesis space \(H\) satisfies the uniform law of large numbers (ULLN) iff \(\forall \epsilon > 0: \lim_{m \rightarrow \infty} P(\sup_{h \in H} |R(h) - R_{T^m}(h)| \geq \epsilon) = 0\).

      Theorem 1: If \(H\) satisfies ULLN then ERM is statistically consistent in \(H\).

      Corollary 1: The ULLN is satisfied for a finite \(H\).

      Generalization bound for finite hypothesis space \(H\) with \(Im(l) \subseteq [a, b]\): \(P(\max_{h \in H} |R_{T^m}(h) - R(h)| < \epsilon) \geq 1 - 2 |H| \exp(-\frac{2 m \epsilon^2}{(b - a)^2})\)

    1. As a prototype it hits a sweet spot: it's challenging - it's no small feat to recognize handwritten digits - but it's not so difficult as to require an extremely complicated solution, or tremendous computational power. Furthermore, it's a great way to develop more advanced techniques, such as deep learning. And so throughout the book we'll return repeatedly to the problem of handwriting recognition. Later in the book, we'll discuss how these ideas may be applied to other problems in computer vision, and also in speech, natural language processing, and other domains.Of course, if the point of the chapter was only to write a computer program to recognize handwritten digits, then the chapter would be much shorter! But along the way we'll develop many key ideas about neural networks, including two important types of artificial neuron (the perceptron and the sigmoid neuron), and the standard learning algorithm for neural networks, known as stochastic gradient descent. Throughout, I focus on explaining why things are done the way they are, and on building your neural networks intuition. That requires a lengthier discussion than if I just presented the basic mechanics of what's going on, but it's worth it for the deeper understanding you'll attain. Amongst the payoffs, by the end of the chapter we'll be in position to understand what deep learning is, and why it matters.PerceptronsWhat is a neural network? To get started, I'll explain a type of artificial neuron called a perceptron. Perceptrons were developed in the 1950s and 1960s by the scientist Frank Rosenblatt, inspired by earlier work by Warren McCulloch and Walter Pitts. Today, it's more common to use other models of artificial neurons - in this book, and in much modern work on neural networks, the main neuron model used is one called the sigmoid neuron. We'll get to sigmoid neurons shortly. But to understand why sigmoid neurons are defined the way they are, it's worth taking the time to first understand perceptrons.So how do perceptrons work? A perceptron takes several binary inputs, x1,x2,…x1,x2,…x_1, x_2, \ldots, and produces a single binary output: In the example shown the perceptron has three inputs, x1,x2,x3x1,x2,x3x_1, x_2, x_3. In general it could have more or fewer inputs. Rosenblatt proposed a simple rule to compute the output. He introduced weights, w1,w2,…w1,w2,…w_1,w_2,\ldots, real numbers expressing the importance of the respective inputs to the output. The neuron's output, 000 or 111, is determined by whether the weighted sum ∑jwjxj∑jwjxj\sum_j w_j x_j is less than or greater than some threshold value. Just like the weights, the threshold is a real number which is a parameter of the neuron. To put it in more precise algebraic terms: output={01if ∑jwjxj≤ thresholdif ∑jwjxj> threshold(1)(1)output={0if ∑jwjxj≤ threshold1if ∑jwjxj> threshold\begin{eqnarray} \mbox{output} & = & \left\{ \begin{array}{ll} 0 & \mbox{if } \sum_j w_j x_j \leq \mbox{ threshold} \\ 1 & \mbox{if } \sum_j w_j x_j > \mbox{ threshold} \end{array} \right. \tag{1}\end{eqnarray} That's all there is to how a perceptron works!That's the basic mathematical model. A way you can think about the perceptron is that it's a device that makes decisions by weighing up evidence. Let me give an example. It's not a very realistic example, but it's easy to understand, and we'll soon get to more realistic examples. Suppose the weekend is coming up, and you've heard that there's going to be a cheese festival in your city. You like cheese, and are trying to decide whether or not to go to the festival. You might make your decision by weighing up three factors: Is the weather good? Does your boyfriend or girlfriend want to accompany you? Is the festival near public transit? (You don't own a car). We can represent these three factors by corresponding binary variables x1,x2x1,x2x_1, x_2, and x3x3x_3. For instance, we'd have x1=1x1=1x_1 = 1 if the weather is good, and x1=0x1=0x_1 = 0 if the weather is bad. Similarly, x2=1x2=1x_2 = 1 if your boyfriend or girlfriend wants to go, and x2=0x2=0x_2 = 0 if not. And similarly again for x3x3x_3 and public transit.Now, suppose you absolutely adore cheese, so much so that you're happy to go to the festival even if your boyfriend or girlfriend is uninterested and the festival is hard to get to. But perhaps you really loathe bad weather, and there's no way you'd go to the festival if the weather is bad. You can use perceptrons to model this kind of decision-making. One way to do this is to choose a weight w1=6w1=6w_1 = 6 for the weather, and w2=2w2=2w_2 = 2 and w3=2w3=2w_3 = 2 for the other conditions. The larger value of w1w1w_1 indicates that the weather matters a lot to you, much more than whether your boyfriend or girlfriend joins you, or the nearness of public transit. Finally, suppose you choose a threshold of 555 for the perceptron. With these choices, the perceptron implements the desired decision-making model, outputting 111 whenever the weather is good, and 000 whenever the weather is bad. It makes no difference to the output whether your boyfriend or girlfriend wants to go, or whether public transit is nearby.By varying the weights and the threshold, we can get different models of decision-making. For example, suppose we instead chose a threshold of 333. Then the perceptron would decide that you should go to the festival whenever the weather was good or when both the festival was near public transit and your boyfriend or girlfriend was willing to join you. In other words, it'd be a different model of decision-making. Dropping the threshold means you're more willing to go to the festival.Obviously, the perceptron isn't a complete model of human decision-making! But what the example illustrates is how a perceptron can weigh up different kinds of evidence in order to make decisions. And it should seem plausible that a complex network of perceptrons could make quite subtle decisions: In this network, the first column of perceptrons - what we'll call the first layer of perceptrons - is making three very simple decisions, by weighing the input evidence. What about the perceptrons in the second layer? Each of those perceptrons is making a decision by weighing up the results from the first layer of decision-making. In this way a perceptron in the second layer can make a decision at a more complex and more abstract level than perceptrons in the first layer. And even more complex decisions can be made by the perceptron in the third layer. In this way, a many-layer network of perceptrons can engage in sophisticated decision making.Incidentally, when I defined perceptrons I said that a perceptron has just a single output. In the network above the perceptrons look like they have multiple outputs. In fact, they're still single output. The multiple output arrows are merely a useful way of indicating that the output from a perceptron is being used as the input to several other perceptrons. It's less unwieldy than drawing a single output line which then splits.Let's simplify the way we describe perceptrons. The condition ∑jwjxj>threshold∑jwjxj>threshold\sum_j w_j x_j > \mbox{threshold} is cumbersome, and we can make two notational changes to simplify it. The first change is to write ∑jwjxj∑jwjxj\sum_j w_j x_j as a dot product, w⋅x≡∑jwjxjw⋅x≡∑jwjxjw \cdot x \equiv \sum_j w_j x_j, where www and xxx are vectors whose components are the weights and inputs, respectively. The second change is to move the threshold to the other side of the inequality, and to replace it by what's known as the perceptron's bias, b≡−thresholdb≡−thresholdb \equiv -\mbox{threshold}. Using the bias instead of the threshold, the perceptron rule can be rewritten: output={01if w⋅x+b≤0if w⋅x+b>0(2)(2)output={0if w⋅x+b≤01if w⋅x+b>0\begin{eqnarray} \mbox{output} = \left\{ \begin{array}{ll} 0 & \mbox{if } w\cdot x + b \leq 0 \\ 1 & \mbox{if } w\cdot x + b > 0 \end{array} \right. \tag{2}\end{eqnarray} You can think of the bias as a measure of how easy it is to get the perceptron to output a 111. Or to put it in more biological terms, the bias is a measure of how easy it is to get the perceptron to fire. For a perceptron with a really big bias, it's extremely easy for the perceptron to output a 111. But if the bias is very negative, then it's difficult for the perceptron to output a 111. Obviously, introducing the bias is only a small change in how we describe perceptrons, but we'll see later that it leads to further notational simplifications. Because of this, in the remainder of the book we won't use the threshold, we'll always use the bias.I've described perceptrons as a method for weighing evidence to make decisions. Another way perceptrons can be used is to compute the elementary logical functions we usually think of as underlying computation, functions such as AND, OR, and NAND. For example, suppose we have a perceptron with two inputs, each with weight −2−2-2, and an overall bias of 333. Here's our perceptron: Then we see that input 000000 produces output 111, since (−2)∗0+(−2)∗0+3=3(−2)∗0+(−2)∗0+3=3(-2)*0+(-2)*0+3 = 3 is positive. Here, I've introduced the ∗∗* symbol to make the multiplications explicit. Similar calculations show that the inputs 010101 and 101010 produce output 111. But the input 111111 produces output 000, since (−2)∗1+(−2)∗1+3=−1(−2)∗1+(−2)∗1+3=−1(-2)*1+(-2)*1+3 = -1 is negative. And so our perceptron implements a NAND gate!The NAND example shows that we can use perceptrons to compute simple logical functions. In fact, we can use networks of perceptrons to compute any logical function at all. The reason is that the NAND gate is universal for computation, that is, we can build any computation up out of NAND gates. For example, we can use NAND gates to build a circuit which adds two bits, x1x1x_1 and x2x2x_2. This requires computing the bitwise sum, x1⊕x2x1⊕x2x_1 \oplus x_2, as well as a carry bit which is set to 111 when both x1x1x_1 and x2x2x_2 are 111, i.e., the carry bit is just the bitwise product x1x2x1x2x_1 x_2: To get an equivalent network of perceptrons we replace all the NAND gates by perceptrons with two inputs, each with weight −2−2-2, and an overall bias of 333. Here's the resulting network. Note that I've moved the perceptron corresponding to the bottom right NAND gate a little, just to make it easier to draw the arrows on the diagram: One notable aspect of this network of perceptrons is that the output from the leftmost perceptron is used twice as input to the bottommost perceptron. When I defined the perceptron model I didn't say whether this kind of double-output-to-the-same-place was allowed. Actually, it doesn't much matter. If we don't want to allow this kind of thing, then it's possible to simply merge the two lines, into a single connection with a weight of -4 instead of two connections with -2 weights. (If you don't find this obvious, you should stop and prove to yourself that this is equivalent.) With that change, the network looks as follows, with all unmarked weights equal to -2, all biases equal to 3, and a single weight of -4, as marked: Up to now I've been drawing inputs like x1x1x_1 and x2x2x_2 as variables floating to the left of the network of perceptrons. In fact, it's conventional to draw an extra layer of perceptrons - the input layer - to encode the inputs: This notation for input perceptrons, in which we have an output, but no inputs, is a shorthand. It doesn't actually mean a perceptron with no inputs. To see this, suppose we did have a perceptron with no inputs. Then the weighted sum ∑jwjxj∑jwjxj\sum_j w_j x_j would always be zero, and so the perceptron would output 111 if b>0b>0b > 0, and 000 if b≤0b≤0b \leq 0. That is, the perceptron would simply output a fixed value, not the desired value (x1x1x_1, in the example above). It's better to think of the input perceptrons as not really being perceptrons at all, but rather special units which are simply defined to output the desired values, x1,x2,…x1,x2,…x_1, x_2,\ldots.The adder example demonstrates how a network of perceptrons can be used to simulate a circuit containing many NAND gates. And because NAND gates are universal for computation, it follows that perceptrons are also universal for computation.The computational universality of perceptrons is simultaneously reassuring and disappointing. It's reassuring because it tells us that networks of perceptrons can be as powerful as any other computing device. But it's also disappointing, because it makes it seem as though perceptrons are merely a new type of NAND gate. That's hardly big news!However, the situation is better than this view suggests. It turns out that we can devise learning algorithms which can automatically tune the weights and biases of a network of artificial neurons. This tuning happens in response to external stimuli, without direct intervention by a programmer. These learning algorithms enable us to use artificial neurons in a way which is radically different to conventional logic gates. Instead of explicitly laying out a circuit of NAND and other gates, our neural networks can simply learn to solve problems, sometimes problems where it would be extremely difficult to directly design a conventional circuit.Sigmoid neuronsLearning algorithms sound terrific. But how can we devise such algorithms for a neural network? Suppose we have a network of perceptrons that we'd like to use to learn to solve some problem. For example, the inputs to the network might be the raw pixel data from a scanned, handwritten image of a digit. And we'd like the network to learn weights and biases so that the output from the network correctly classifies the digit. To see how learning might work, suppose we make a small change in some weight (or bias) in the network. What we'd like is for this small change in weight to cause only a small corresponding change in the output from the network. As we'll see in a moment, this property will make learning possible. Schematically, here's what we want (obviously this network is too simple to do handwriting recognition!): If it were true that a small change in a weight (or bias) causes only a small change in output, then we could use this fact to modify the weights and biases to get our network to behave more in the manner we want. For example, suppose the network was mistakenly classifying an image as an "8" when it should be a "9". We could figure out how to make a small change in the weights and biases so the network gets a little closer to classifying the image as a "9". And then we'd repeat this, changing the weights and biases over and over to produce better and better output. The network would be learning.The problem is that this isn't what happens when our network contains perceptrons. In fact, a small change in the weights or bias of any single perceptron in the network can sometimes cause the output of that perceptron to completely flip, say from 000 to 111. That flip may then cause the behaviour of the rest of the network to completely change in some very complicated way. So while your "9" might now be classified correctly, the behaviour of the network on all the other images is likely to have completely changed in some hard-to-control way. That makes it difficult to see how to gradually modify the weights and biases so that the network gets closer to the desired behaviour. Perhaps there's some clever way of getting around this problem. But it's not immediately obvious how we can get a network of perceptrons to learn.We can overcome this problem by introducing a new type of artificial neuron called a sigmoid neuron. Sigmoid neurons are similar to perceptrons, but modified so that small changes in their weights and bias cause only a small change in their output. That's the crucial fact which will allow a network of sigmoid neurons to learn.Okay, let me describe the sigmoid neuron. We'll depict sigmoid neurons in the same way we depicted perceptrons: Just like a perceptron, the sigmoid neuron has inputs, x1,x2,…x1,x2,…x_1, x_2, \ldots. But instead of being just 000 or 111, these inputs can also take on any values between 000 and 111. So, for instance, 0.638…0.638…0.638\ldots is a valid input for a sigmoid neuron. Also just like a perceptron, the sigmoid neuron has weights for each input, w1,w2,…w1,w2,…w_1, w_2, \ldots, and an overall bias, bbb. But the output is not 000 or 111. Instead, it's σ(w⋅x+b)σ(w⋅x+b)\sigma(w \cdot x+b), where σσ\sigma is called the sigmoid function* *Incidentally, σσ\sigma is sometimes called the logistic function, and this new class of neurons called logistic neurons. It's useful to remember this terminology, since these terms are used by many people working with neural nets. However, we'll stick with the sigmoid terminology., and is defined by: σ(z)≡11+e−z.(3)(3)σ(z)≡11+e−z.\begin{eqnarray} \sigma(z) \equiv \frac{1}{1+e^{-z}}. \tag{3}\end{eqnarray} To put it all a little more explicitly, the output of a sigmoid neuron with inputs x1,x2,…x1,x2,…x_1,x_2,\ldots, weights w1,w2,…w1,w2,…w_1,w_2,\ldots, and bias bbb is 11+exp(−∑jwjxj−b).(4)(4)11+exp⁡(−∑jwjxj−b).\begin{eqnarray} \frac{1}{1+\exp(-\sum_j w_j x_j-b)}. \tag{4}\end{eqnarray}At first sight, sigmoid neurons appear very different to perceptrons. The algebraic form of the sigmoid function may seem opaque and forbidding if you're not already familiar with it. In fact, there are many similarities between perceptrons and sigmoid neurons, and the algebraic form of the sigmoid function turns out to be more of a technical detail than a true barrier to understanding.To understand the similarity to the perceptron model, suppose z≡w⋅x+bz≡w⋅x+bz \equiv w \cdot x + b is a large positive number. Then e−z≈0e−z≈0e^{-z} \approx 0 and so σ(z)≈1σ(z)≈1\sigma(z) \approx 1. In other words, when z=w⋅x+bz=w⋅x+bz = w \cdot x+b is large and positive, the output from the sigmoid neuron is approximately 111, just as it would have been for a perceptron. Suppose on the other hand that z=w⋅x+bz=w⋅x+bz = w \cdot x+b is very negative. Then e−z→∞e−z→∞e^{-z} \rightarrow \infty, and σ(z)≈0σ(z)≈0\sigma(z) \approx 0. So when z=w⋅x+bz=w⋅x+bz = w \cdot x +b is very negative, the behaviour of a sigmoid neuron also closely approximates a perceptron. It's only when w⋅x+bw⋅x+bw \cdot x+b is of modest size that there's much deviation from the perceptron model.What about the algebraic form of σσ\sigma? How can we understand that? In fact, the exact form of σσ\sigma isn't so important - what really matters is the shape of the function when plotted. Here's the shape: -4-3-2-1012340.00.20.40.60.81.0zsigmoid function function s(x) {return 1/(1+Math.exp(-x));} var m = [40, 120, 50, 120]; var height = 290 - m[0] - m[2]; var width = 600 - m[1] - m[3]; var xmin = -5; var xmax = 5; var sample = 400; var x1 = d3.scale.linear().domain([0, sample]).range([xmin, xmax]); var data = d3.range(sample).map(function(d){ return { x: x1(d), y: s(x1(d))}; }); var x = d3.scale.linear().domain([xmin, xmax]).range([0, width]); var y = d3.scale.linear() .domain([0, 1]) .range([height, 0]); var line = d3.svg.line() .x(function(d) { return x(d.x); }) .y(function(d) { return y(d.y); }) var graph = d3.select("#sigmoid_graph") .append("svg") .attr("width", width + m[1] + m[3]) .attr("height", height + m[0] + m[2]) .append("g") .attr("transform", "translate(" + m[3] + "," + m[0] + ")"); var xAxis = d3.svg.axis() .scale(x) .tickValues(d3.range(-4, 5, 1)) .orient("bottom") graph.append("g") .attr("class", "x axis") .attr("transform", "translate(0, " + height + ")") .call(xAxis); var yAxis = d3.svg.axis() .scale(y) .tickValues(d3.range(0, 1.01, 0.2)) .orient("left") .ticks(5) graph.append("g") .attr("class", "y axis") .call(yAxis); graph.append("path").attr("d", line(data)); graph.append("text") .attr("class", "x label") .attr("text-anchor", "end") .attr("x", width/2) .attr("y", height+35) .text("z"); graph.append("text") .attr("x", (width / 2)) .attr("y", -10) .attr("text-anchor", "middle") .style("font-size", "16px") .text("sigmoid function"); This shape is a smoothed out version of a step function: -4-3-2-1012340.00.20.40.60.81.0zstep function function s(x) {return x < 0 ? 0 : 1;} var m = [40, 120, 50, 120]; var height = 290 - m[0] - m[2]; var width = 600 - m[1] - m[3]; var xmin = -5; var xmax = 5; var sample = 400; var x1 = d3.scale.linear().domain([0, sample]).range([xmin, xmax]); var data = d3.range(sample).map(function(d){ return { x: x1(d), y: s(x1(d))}; }); var x = d3.scale.linear().domain([xmin, xmax]).range([0, width]); var y = d3.scale.linear() .domain([0,1]) .range([height, 0]); var line = d3.svg.line() .x(function(d) { return x(d.x); }) .y(function(d) { return y(d.y); }) var graph = d3.select("#step_graph") .append("svg") .attr("width", width + m[1] + m[3]) .attr("height", height + m[0] + m[2]) .append("g") .attr("transform", "translate(" + m[3] + "," + m[0] + ")"); var xAxis = d3.svg.axis() .scale(x) .tickValues(d3.range(-4, 5, 1)) .orient("bottom") graph.append("g") .attr("class", "x axis") .attr("transform", "translate(0, " + height + ")") .call(xAxis); var yAxis = d3.svg.axis() .scale(y) .tickValues(d3.range(0, 1.01, 0.2)) .orient("left") .ticks(5) graph.append("g") .attr("class", "y axis") .call(yAxis); graph.append("path").attr("d", line(data)); graph.append("text") .attr("class", "x label") .attr("text-anchor", "end") .attr("x", width/2) .attr("y", height+35) .text("z"); graph.append("text") .attr("x", (width / 2)) .attr("y", -10) .attr("text-anchor", "middle") .style("font-size", "16px") .text("step function"); If σσ\sigma had in fact been a step function, then the sigmoid neuron would be a perceptron, since the output would be 111 or 000 depending on whether w⋅x+bw⋅x+bw\cdot x+b was positive or negative* *Actually, when w⋅x+b=0w⋅x+b=0w \cdot x +b = 0 the perceptron outputs 000, while the step function outputs 111. So, strictly speaking, we'd need to modify the step function at that one point. But you get the idea.. By using the actual σσ\sigma function we get, as already implied above, a smoothed out perceptron. Indeed, it's the smoothness of the σσ\sigma function that is the crucial fact, not its detailed form. The smoothness of σσ\sigma means that small changes ΔwjΔwj\Delta w_j in the weights and ΔbΔb\Delta b in the bias will produce a small change ΔoutputΔoutput\Delta \mbox{output} in the output from the neuron. In fact, calculus tells us that ΔoutputΔoutput\Delta \mbox{output} is well approximated by Δoutput≈∑j∂output∂wjΔwj+∂output∂bΔb,(5)(5)Δoutput≈∑j∂output∂wjΔwj+∂output∂bΔb,\begin{eqnarray} \Delta \mbox{output} \approx \sum_j \frac{\partial \, \mbox{output}}{\partial w_j} \Delta w_j + \frac{\partial \, \mbox{output}}{\partial b} \Delta b, \tag{5}\end{eqnarray} where the sum is over all the weights, wjwjw_j, and ∂output/∂wj∂output/∂wj\partial \, \mbox{output} / \partial w_j and ∂output/∂b∂output/∂b\partial \, \mbox{output} /\partial b denote partial derivatives of the outputoutput\mbox{output} with respect to wjwjw_j and bbb, respectively. Don't panic if you're not comfortable with partial derivatives! While the expression above looks complicated, with all the partial derivatives, it's actually saying something very simple (and which is very good news): ΔoutputΔoutput\Delta \mbox{output} is a linear function of the changes ΔwjΔwj\Delta w_j and ΔbΔb\Delta b in the weights and bias. This linearity makes it easy to choose small changes in the weights and biases to achieve any desired small change in the output. So while sigmoid neurons have much of the same qualitative behaviour as perceptrons, they make it much easier to figure out how changing the weights and biases will change the output.If it's the shape of σσ\sigma which really matters, and not its exact form, then why use the particular form used for σσ\sigma in Equation (3)σ(z)≡11+e−zσ(z)≡11+e−z\begin{eqnarray} \sigma(z) \equiv \frac{1}{1+e^{-z}} \nonumber\end{eqnarray}$('#margin_387419264610_reveal').click(function() {$('#margin_387419264610').toggle('slow', function() {});});? In fact, later in the book we will occasionally consider neurons where the output is f(w⋅x+b)f(w⋅x+b)f(w \cdot x + b) for some other activation function f(⋅)f(⋅)f(\cdot). The main thing that changes when we use a different activation function is that the particular values for the partial derivatives in Equation (5)Δoutput≈∑j∂output∂wjΔwj+∂output∂bΔbΔoutput≈∑j∂output∂wjΔwj+∂output∂bΔb\begin{eqnarray} \Delta \mbox{output} \approx \sum_j \frac{\partial \, \mbox{output}}{\partial w_j} \Delta w_j + \frac{\partial \, \mbox{output}}{\partial b} \Delta b \nonumber\end{eqnarray}$('#margin_727997094331_reveal').click(function() {$('#margin_727997094331').toggle('slow', function() {});}); change. It turns out that when we compute those partial derivatives later, using σσ\sigma will simplify the algebra, simply because exponentials have lovely properties when differentiated. In any case, σσ\sigma is commonly-used in work on neural nets, and is the activation function we'll use most often in this book.How should we interpret the output from a sigmoid neuron? Obviously, one big difference between perceptrons and sigmoid neurons is that sigmoid neurons don't just output 000 or 111. They can have as output any real number between 000 and 111, so values such as 0.173…0.173…0.173\ldots and 0.689…0.689…0.689\ldots are legitimate outputs. This can be useful, for example, if we want to use the output value to represent the average intensity of the pixels in an image input to a neural network. But sometimes it can be a nuisance. Suppose we want the output from the network to indicate either "the input image is a 9" or "the input image is not a 9". Obviously, it'd be easiest to do this if the output was a 000 or a 111, as in a perceptron. But in practice we can set up a convention to deal with this, for example, by deciding to interpret any output of at least 0.50.50.5 as indicating a "9", and any output less than 0.50.50.5 as indicating "not a 9". I'll always explicitly state when we're using such a convention, so it shouldn't cause any confusion. Exercises Sigmoid neurons simulating perceptrons, part I \mbox{} Suppose we take all the weights and biases in a network of perceptrons, and multiply them by a positive constant, c>0c>0c > 0. Show that the behaviour of the network doesn't change.Sigmoid neurons simulating perceptrons, part II \mbox{} Suppose we have the same setup as the last problem - a network of perceptrons. Suppose also that the overall input to the network of perceptrons has been chosen. We won't need the actual input value, we just need the input to have been fixed. Suppose the weights and biases are such that w⋅x+b≠0w⋅x+b≠0w \cdot x + b \neq 0 for the input xxx to any particular perceptron in the network. Now replace all the perceptrons in the network by sigmoid neurons, and multiply the weights and biases by a positive constant c>0c>0c > 0. Show that in the limit as c→∞c→∞c \rightarrow \infty the behaviour of this network of sigmoid neurons is exactly the same as the network of perceptrons. How can this fail when w⋅x+b=0w⋅x+b=0w \cdot x + b = 0 for one of the perceptrons? The architecture of neural networksIn the next section I'll introduce a neural network that can do a pretty good job classifying handwritten digits. In preparation for that, it helps to explain some terminology that lets us name different parts of a network. Suppose we have the network: As mentioned earlier, the leftmost layer in this network is called the input layer, and the neurons within the layer are called input neurons. The rightmost or output layer contains the output neurons, or, as in this case, a single output neuron. The middle layer is called a hidden layer, since the neurons in this layer are neither inputs nor outputs. The term "hidden" perhaps sounds a little mysterious - the first time I heard the term I thought it must have some deep philosophical or mathematical significance - but it really means nothing more than "not an input or an output". The network above has just a single hidden layer, but some networks have multiple hidden layers. For example, the following four-layer network has two hidden layers: Somewhat confusingly, and for historical reasons, such multiple layer networks are sometimes called multilayer perceptrons or MLPs, despite being made up of sigmoid neurons, not perceptrons. I'm not going to use the MLP terminology in this book, since I think it's confusing, but wanted to warn you of its existence.The design of the input and output layers in a network is often straightforward. For example, suppose we're trying to determine whether a handwritten image depicts a "9" or not. A natural way to design the network is to encode the intensities of the image pixels into the input neurons. If the image is a 646464 by 646464 greyscale image, then we'd have 4,096=64×644,096=64×644,096 = 64 \times 64 input neurons, with the intensities scaled appropriately between 000 and 111. The output layer will contain just a single neuron, with output values of less than 0.50.50.5 indicating "input image is not a 9", and values greater than 0.50.50.5 indicating "input image is a 9 ". While the design of the input and output layers of a neural network is often straightforward, there can be quite an art to the design of the hidden layers. In particular, it's not possible to sum up the design process for the hidden layers with a few simple rules of thumb. Instead, neural networks researchers have developed many design heuristics for the hidden layers, which help people get the behaviour they want out of their nets. For example, such heuristics can be used to help determine how to trade off the number of hidden layers against the time required to train the network. We'll meet several such design heuristics later in this book. Up to now, we've been discussing neural networks where the output from one layer is used as input to the next layer. Such networks are called feedforward neural networks. This means there are no loops in the network - information is always fed forward, never fed back. If we did have loops, we'd end up with situations where the input to the σσ\sigma function depended on the output. That'd be hard to make sense of, and so we don't allow such loops.However, there are other models of artificial neural networks in which feedback loops are possible. These models are called recurrent neural networks. The idea in these models is to have neurons which fire for some limited duration of time, before becoming quiescent. That firing can stimulate other neurons, which may fire a little while later, also for a limited duration. That causes still more neurons to fire, and so over time we get a cascade of neurons firing. Loops don't cause problems in such a model, since a neuron's output only affects its input at some later time, not instantaneously.Recurrent neural nets have been less influential than feedforward networks, in part because the learning algorithms for recurrent nets are (at least to date) less powerful. But recurrent networks are still extremely interesting. They're much closer in spirit to how our brains work than feedforward networks. And it's possible that recurrent networks can solve important problems which can only be solved with great difficulty by feedforward networks. However, to limit our scope, in this book we're going to concentrate on the more widely-used feedforward networks.A simple network to classify handwritten digitsHaving defined neural networks, let's return to handwriting recognition. We can split the problem of recognizing handwritten digits into two sub-problems. First, we'd like a way of breaking an image containing many digits into a sequence of separate images, each containing a single digit. For example, we'd like to break the imageinto six separate images, We humans solve this segmentation problem with ease, but it's challenging for a computer program to correctly break up the image. Once the image has been segmented, the program then needs to classify each individual digit. So, for instance, we'd like our program to recognize that the first digit above,is a 5.We'll focus on writing a program to solve the second problem, that is, classifying individual digits. We do this because it turns out that the segmentation problem is not so difficult to solve, once you have a good way of classifying individual digits. There are many approaches to solving the segmentation problem. One approach is to trial many different ways of segmenting the image, using the individual digit classifier to score each trial segmentation. A trial segmentation gets a high score if the individual digit classifier is confident of its classification in all segments, and a low score if the classifier is having a lot of trouble in one or more segments. The idea is that if the classifier is having trouble somewhere, then it's probably having trouble because the segmentation has been chosen incorrectly. This idea and other variations can be used to solve the segmentation problem quite well. So instead of worrying about segmentation we'll concentrate on developing a neural network which can solve the more interesting and difficult problem, namely, recognizing individual handwritten digits.To recognize individual digits we will use a three-layer neural network: The input layer of the network contains neurons encoding the values of the input pixels. As discussed in the next section, our training data for the network will consist of many 282828 by 282828 pixel images of scanned handwritten digits, and so the input layer contains 784=28×28784=28×28784 = 28 \times 28 neurons. For simplicity I've omitted most of the 784784784 input neurons in the diagram above. The input pixels are greyscale, with a value of 0.00.00.0 representing white, a value of 1.01.01.0 representing black, and in between values representing gradually darkening shades of grey.The second layer of the network is a hidden layer. We denote the number of neurons in this hidden layer by nnn, and we'll experiment with different values for nnn. The example shown illustrates a small hidden layer, containing just n=15n=15n = 15 neurons.The output layer of the network contains 10 neurons. If the first neuron fires, i.e., has an output ≈1≈1\approx 1, then that will indicate that the network thinks the digit is a 000. If the second neuron fires then that will indicate that the network thinks the digit is a 111. And so on. A little more precisely, we number the output neurons from 000 through 999, and figure out which neuron has the highest activation value. If that neuron is, say, neuron number 666, then our network will guess that the input digit was a 666. And so on for the other output neurons.You might wonder why we use 101010 output neurons. After all, the goal of the network is to tell us which digit (0,1,2,…,90,1,2,…,90, 1, 2, \ldots, 9) corresponds to the input image. A seemingly natural way of doing that is to use just 444 output neurons, treating each neuron as taking on a binary value, depending on whether the neuron's output is closer to 000 or to 111. Four neurons are enough to encode the answer, since 24=1624=162^4 = 16 is more than the 10 possible values for the input digit. Why should our network use 101010 neurons instead? Isn't that inefficient? The ultimate justification is empirical: we can try out both network designs, and it turns out that, for this particular problem, the network with 101010 output neurons learns to recognize digits better than the network with 444 output neurons. But that leaves us wondering why using 101010 output neurons works better. Is there some heuristic that would tell us in advance that we should use the 101010-output encoding instead of the 444-output encoding?To understand why we do this, it helps to think about what the neural network is doing from first principles. Consider first the case where we use 101010 output neurons. Let's concentrate on the first output neuron, the one that's trying to decide whether or not the digit is a 000. It does this by weighing up evidence from the hidden layer of neurons. What are those hidden neurons doing? Well, just suppose for the sake of argument that the first neuron in the hidden layer detects whether or not an image like the following is present:It can do this by heavily weighting input pixels which overlap with the image, and only lightly weighting the other inputs. In a similar way, let's suppose for the sake of argument that the second, third, and fourth neurons in the hidden layer detect whether or not the following images are present:As you may have guessed, these four images together make up the 000 image that we saw in the line of digits shown earlier:So if all four of these hidden neurons are firing then we can conclude that the digit is a 000. Of course, that's not the only sort of evidence we can use to conclude that the image was a 000 - we could legitimately get a 000 in many other ways (say, through translations of the above images, or slight distortions). But it seems safe to say that at least in this case we'd conclude that the input was a 000.Supposing the neural network functions in this way, we can give a plausible explanation for why it's better to have 101010 outputs from the network, rather than 444. If we had 444 outputs, then the first output neuron would be trying to decide what the most significant bit of the digit was. And there's no easy way to relate that most significant bit to simple shapes like those shown above. It's hard to imagine that there's any good historical reason the component shapes of the digit will be closely related to (say) the most significant bit in the output.Now, with all that said, this is all just a heuristic. Nothing says that the three-layer neural network has to operate in the way I described, with the hidden neurons detecting simple component shapes. Maybe a clever learning algorithm will find some assignment of weights that lets us use only 444 output neurons. But as a heuristic the way of thinking I've described works pretty well, and can save you a lot of time in designing good neural network architectures.Exercise There is a way of determining the bitwise representation of a digit by adding an extra layer to the three-layer network above. The extra layer converts the output from the previous layer into a binary representation, as illustrated in the figure below. Find a set of weights and biases for the new output layer. Assume that the first 333 layers of neurons are such that the correct output in the third layer (i.e., the old output layer) has activation at least 0.990.990.99, and incorrect outputs have activation less than 0.010.010.01. Learning with gradient descentNow that we have a design for our neural network, how can it learn to recognize digits? The first thing we'll need is a data set to learn from - a so-called training data set. We'll use the MNIST data set, which contains tens of thousands of scanned images of handwritten digits, together with their correct classifications. MNIST's name comes from the fact that it is a modified subset of two data sets collected by NIST, the United States' National Institute of Standards and Technology. Here's a few images from MNIST: As you can see, these digits are, in fact, the same as those shown at the beginning of this chapter as a challenge to recognize. Of course, when testing our network we'll ask it to recognize images which aren't in the training set!The MNIST data comes in two parts. The first part contains 60,000 images to be used as training data. These images are scanned handwriting samples from 250 people, half of whom were US Census Bureau employees, and half of whom were high school students. The images are greyscale and 28 by 28 pixels in size. The second part of the MNIST data set is 10,000 images to be used as test data. Again, these are 28 by 28 greyscale images. We'll use the test data to evaluate how well our neural network has learned to recognize digits. To make this a good test of performance, the test data was taken from a different set of 250 people than the original training data (albeit still a group split between Census Bureau employees and high school students). This helps give us confidence that our system can recognize digits from people whose writing it didn't see during training.We'll use the notation xxx to denote a training input. It'll be convenient to regard each training input xxx as a 28×28=78428×28=78428 \times 28 = 784-dimensional vector. Each entry in the vector represents the grey value for a single pixel in the image. We'll denote the corresponding desired output by y=y(x)y=y(x)y = y(x), where yyy is a 101010-dimensional vector. For example, if a particular training image, xxx, depicts a 666, then y(x)=(0,0,0,0,0,0,1,0,0,0)Ty(x)=(0,0,0,0,0,0,1,0,0,0)Ty(x) = (0, 0, 0, 0, 0, 0, 1, 0, 0, 0)^T is the desired output from the network. Note that TTT here is the transpose operation, turning a row vector into an ordinary (column) vector.What we'd like is an algorithm which lets us find weights and biases so that the output from the network approximates y(x)y(x)y(x) for all training inputs xxx. To quantify how well we're achieving this goal we define a cost function* *Sometimes referred to as a loss or objective function. We use the term cost function throughout this book, but you should note the other terminology, since it's often used in research papers and other discussions of neural networks. : C(w,b)≡12n∑x∥y(x)−a∥2.(6)(6)C(w,b)≡12n∑x‖y(x)−a‖2.\begin{eqnarray} C(w,b) \equiv \frac{1}{2n} \sum_x \| y(x) - a\|^2. \tag{6}\end{eqnarray} Here, www denotes the collection of all weights in the network, bbb all the biases, nnn is the total number of training inputs, aaa is the vector of outputs from the network when xxx is input, and the sum is over all training inputs, xxx. Of course, the output aaa depends on xxx, www and bbb, but to keep the notation simple I haven't explicitly indicated this dependence. The notation ∥v∥‖v‖\| v \| just denotes the usual length function for a vector vvv. We'll call CCC the quadratic cost function; it's also sometimes known as the mean squared error or just MSE. Inspecting the form of the quadratic cost function, we see that C(w,b)C(w,b)C(w,b) is non-negative, since every term in the sum is non-negative. Furthermore, the cost C(w,b)C(w,b)C(w,b) becomes small, i.e., C(w,b)≈0C(w,b)≈0C(w,b) \approx 0, precisely when y(x)y(x)y(x) is approximately equal to the output, aaa, for all training inputs, xxx. So our training algorithm has done a good job if it can find weights and biases so that C(w,b)≈0C(w,b)≈0C(w,b) \approx 0. By contrast, it's not doing so well when C(w,b)C(w,b)C(w,b) is large - that would mean that y(x)y(x)y(x) is not close to the output aaa for a large number of inputs. So the aim of our training algorithm will be to minimize the cost C(w,b)C(w,b)C(w,b) as a function of the weights and biases. In other words, we want to find a set of weights and biases which make the cost as small as possible. We'll do that using an algorithm known as gradient descent. Why introduce the quadratic cost? After all, aren't we primarily interested in the number of images correctly classified by the network? Why not try to maximize that number directly, rather than minimizing a proxy measure like the quadratic cost? The problem with that is that the number of images correctly classified is not a smooth function of the weights and biases in the network. For the most part, making small changes to the weights and biases won't cause any change at all in the number of training images classified correctly. That makes it difficult to figure out how to change the weights and biases to get improved performance. If we instead use a smooth cost function like the quadratic cost it turns out to be easy to figure out how to make small changes in the weights and biases so as to get an improvement in the cost. That's why we focus first on minimizing the quadratic cost, and only after that will we examine the classification accuracy.Even given that we want to use a smooth cost function, you may still wonder why we choose the quadratic function used in Equation (6)C(w,b)≡12n∑x∥y(x)−a∥2C(w,b)≡12n∑x‖y(x)−a‖2\begin{eqnarray} C(w,b) \equiv \frac{1}{2n} \sum_x \| y(x) - a\|^2 \nonumber\end{eqnarray}$('#margin_501822820305_reveal').click(function() {$('#margin_501822820305').toggle('slow', function() {});});. Isn't this a rather ad hoc choice? Perhaps if we chose a different cost function we'd get a totally different set of minimizing weights and biases? This is a valid concern, and later we'll revisit the cost function, and make some modifications. However, the quadratic cost function of Equation (6)C(w,b)≡12n∑x∥y(x)−a∥2C(w,b)≡12n∑x‖y(x)−a‖2\begin{eqnarray} C(w,b) \equiv \frac{1}{2n} \sum_x \| y(x) - a\|^2 \nonumber\end{eqnarray}$('#margin_555483302348_reveal').click(function() {$('#margin_555483302348').toggle('slow', function() {});}); works perfectly well for understanding the basics of learning in neural networks, so we'll stick with it for now.Recapping, our goal in training a neural network is to find weights and biases which minimize the quadratic cost function C(w,b)C(w,b)C(w, b). This is a well-posed problem, but it's got a lot of distracting structure as currently posed - the interpretation of www and bbb as weights and biases, the σσ\sigma function lurking in the background, the choice of network architecture, MNIST, and so on. It turns out that we can understand a tremendous amount by ignoring most of that structure, and just concentrating on the minimization aspect. So for now we're going to forget all about the specific form of the cost function, the connection to neural networks, and so on. Instead, we're going to imagine that we've simply been given a function of many variables and we want to minimize that function. We're going to develop a technique called gradient descent which can be used to solve such minimization problems. Then we'll come back to the specific function we want to minimize for neural networks.Okay, let's suppose we're trying to minimize some function, C(v)C(v)C(v). This could be any real-valued function of many variables, v=v1,v2,…v=v1,v2,…v = v_1, v_2, \ldots. Note that I've replaced the www and bbb notation by vvv to emphasize that this could be any function - we're not specifically thinking in the neural networks context any more. To minimize C(v)C(v)C(v) it helps to imagine CCC as a function of just two variables, which we'll call v1v1v_1 and v2v2v_2:What we'd like is to find where CCC achieves its global minimum. Now, of course, for the function plotted above, we can eyeball the graph and find the minimum. In that sense, I've perhaps shown slightly too simple a function! A general function, CCC, may be a complicated function of many variables, and it won't usually be possible to just eyeball the graph to find the minimum.One way of attacking the problem is to use calculus to try to find the minimum analytically. We could compute derivatives and then try using them to find places where CCC is an extremum. With some luck that might work when CCC is a function of just one or a few variables. But it'll turn into a nightmare when we have many more variables. And for neural networks we'll often want far more variables - the biggest neural networks have cost functions which depend on billions of weights and biases in an extremely complicated way. Using calculus to minimize that just won't work!(After asserting that we'll gain insight by imagining CCC as a function of just two variables, I've turned around twice in two paragraphs and said, "hey, but what if it's a function of many more than two variables?" Sorry about that. Please believe me when I say that it really does help to imagine CCC as a function of two variables. It just happens that sometimes that picture breaks down, and the last two paragraphs were dealing with such breakdowns. Good thinking about mathematics often involves juggling multiple intuitive pictures, learning when it's appropriate to use each picture, and when it's not.)Okay, so calculus doesn't work. Fortunately, there is a beautiful analogy which suggests an algorithm which works pretty well. We start by thinking of our function as a kind of a valley. If you squint just a little at the plot above, that shouldn't be too hard. And we imagine a ball rolling down the slope of the valley. Our everyday experience tells us that the ball will eventually roll to the bottom of the valley. Perhaps we can use this idea as a way to find a minimum for the function? We'd randomly choose a starting point for an (imaginary) ball, and then simulate the motion of the ball as it rolled down to the bottom of the valley. We could do this simulation simply by computing derivatives (and perhaps some second derivatives) of CCC - those derivatives would tell us everything we need to know about the local "shape" of the valley, and therefore how our ball should roll.Based on what I've just written, you might suppose that we'll be trying to write down Newton's equations of motion for the ball, considering the effects of friction and gravity, and so on. Actually, we're not going to take the ball-rolling analogy quite that seriously - we're devising an algorithm to minimize CCC, not developing an accurate simulation of the laws of physics! The ball's-eye view is meant to stimulate our imagination, not constrain our thinking. So rather than get into all the messy details of physics, let's simply ask ourselves: if we were declared God for a day, and could make up our own laws of physics, dictating to the ball how it should roll, what law or laws of motion could we pick that would make it so the ball always rolled to the bottom of the valley?To make this question more precise, let's think about what happens when we move the ball a small amount Δv1Δv1\Delta v_1 in the v1v1v_1 direction, and a small amount Δv2Δv2\Delta v_2 in the v2v2v_2 direction. Calculus tells us that CCC changes as follows: ΔC≈∂C∂v1Δv1+∂C∂v2Δv2.(7)(7)ΔC≈∂C∂v1Δv1+∂C∂v2Δv2.\begin{eqnarray} \Delta C \approx \frac{\partial C}{\partial v_1} \Delta v_1 + \frac{\partial C}{\partial v_2} \Delta v_2. \tag{7}\end{eqnarray} We're going to find a way of choosing Δv1Δv1\Delta v_1 and Δv2Δv2\Delta v_2 so as to make ΔCΔC\Delta C negative; i.e., we'll choose them so the ball is rolling down into the valley. To figure out how to make such a choice it helps to define ΔvΔv\Delta v to be the vector of changes in vvv, Δv≡(Δv1,Δv2)TΔv≡(Δv1,Δv2)T\Delta v \equiv (\Delta v_1, \Delta v_2)^T, where TTT is again the transpose operation, turning row vectors into column vectors. We'll also define the gradient of CCC to be the vector of partial derivatives, (∂C∂v1,∂C∂v2)T(∂C∂v1,∂C∂v2)T\left(\frac{\partial C}{\partial v_1}, \frac{\partial C}{\partial v_2}\right)^T. We denote the gradient vector by ∇C∇C\nabla C, i.e.: ∇C≡(∂C∂v1,∂C∂v2)T.(8)(8)∇C≡(∂C∂v1,∂C∂v2)T.\begin{eqnarray} \nabla C \equiv \left( \frac{\partial C}{\partial v_1}, \frac{\partial C}{\partial v_2} \right)^T. \tag{8}\end{eqnarray} In a moment we'll rewrite the change ΔCΔC\Delta C in terms of ΔvΔv\Delta v and the gradient, ∇C∇C\nabla C. Before getting to that, though, I want to clarify something that sometimes gets people hung up on the gradient. When meeting the ∇C∇C\nabla C notation for the first time, people sometimes wonder how they should think about the ∇∇\nabla symbol. What, exactly, does ∇∇\nabla mean? In fact, it's perfectly fine to think of ∇C∇C\nabla C as a single mathematical object - the vector defined above - which happens to be written using two symbols. In this point of view, ∇∇\nabla is just a piece of notational flag-waving, telling you "hey, ∇C∇C\nabla C is a gradient vector". There are more advanced points of view where ∇∇\nabla can be viewed as an independent mathematical entity in its own right (for example, as a differential operator), but we won't need such points of view.With these definitions, the expression (7)ΔC≈∂C∂v1Δv1+∂C∂v2Δv2ΔC≈∂C∂v1Δv1+∂C∂v2Δv2\begin{eqnarray} \Delta C \approx \frac{\partial C}{\partial v_1} \Delta v_1 + \frac{\partial C}{\partial v_2} \Delta v_2 \nonumber\end{eqnarray}$('#margin_512380394946_reveal').click(function() {$('#margin_512380394946').toggle('slow', function() {});}); for ΔCΔC\Delta C can be rewritten as ΔC≈∇C⋅Δv.(9)(9)ΔC≈∇C⋅Δv.\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v. \tag{9}\end{eqnarray} This equation helps explain why ∇C∇C\nabla C is called the gradient vector: ∇C∇C\nabla C relates changes in vvv to changes in CCC, just as we'd expect something called a gradient to do. But what's really exciting about the equation is that it lets us see how to choose ΔvΔv\Delta v so as to make ΔCΔC\Delta C negative. In particular, suppose we choose Δv=−η∇C,(10)(10)Δv=−η∇C,\begin{eqnarray} \Delta v = -\eta \nabla C, \tag{10}\end{eqnarray} where ηη\eta is a small, positive parameter (known as the learning rate). Then Equation (9)ΔC≈∇C⋅ΔvΔC≈∇C⋅Δv\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v \nonumber\end{eqnarray}$('#margin_31741254841_reveal').click(function() {$('#margin_31741254841').toggle('slow', function() {});}); tells us that ΔC≈−η∇C⋅∇C=−η∥∇C∥2ΔC≈−η∇C⋅∇C=−η‖∇C‖2\Delta C \approx -\eta \nabla C \cdot \nabla C = -\eta \|\nabla C\|^2. Because ∥∇C∥2≥0‖∇C‖2≥0\| \nabla C \|^2 \geq 0, this guarantees that ΔC≤0ΔC≤0\Delta C \leq 0, i.e., CCC will always decrease, never increase, if we change vvv according to the prescription in (10)Δv=−η∇CΔv=−η∇C\begin{eqnarray} \Delta v = -\eta \nabla C \nonumber\end{eqnarray}$('#margin_48762573303_reveal').click(function() {$('#margin_48762573303').toggle('slow', function() {});});. (Within, of course, the limits of the approximation in Equation (9)ΔC≈∇C⋅ΔvΔC≈∇C⋅Δv\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v \nonumber\end{eqnarray}$('#margin_919658643545_reveal').click(function() {$('#margin_919658643545').toggle('slow', function() {});});). This is exactly the property we wanted! And so we'll take Equation (10)Δv=−η∇CΔv=−η∇C\begin{eqnarray} \Delta v = -\eta \nabla C \nonumber\end{eqnarray}$('#margin_287729255111_reveal').click(function() {$('#margin_287729255111').toggle('slow', function() {});}); to define the "law of motion" for the ball in our gradient descent algorithm. That is, we'll use Equation (10)Δv=−η∇CΔv=−η∇C\begin{eqnarray} \Delta v = -\eta \nabla C \nonumber\end{eqnarray}$('#margin_718723868298_reveal').click(function() {$('#margin_718723868298').toggle('slow', function() {});}); to compute a value for ΔvΔv\Delta v, then move the ball's position vvv by that amount: v→v′=v−η∇C.(11)(11)v→v′=v−η∇C.\begin{eqnarray} v \rightarrow v' = v -\eta \nabla C. \tag{11}\end{eqnarray} Then we'll use this update rule again, to make another move. If we keep doing this, over and over, we'll keep decreasing CCC until - we hope - we reach a global minimum.Summing up, the way the gradient descent algorithm works is to repeatedly compute the gradient ∇C∇C\nabla C, and then to move in the opposite direction, "falling down" the slope of the valley. We can visualize it like this:Notice that with this rule gradient descent doesn't reproduce real physical motion. In real life a ball has momentum, and that momentum may allow it to roll across the slope, or even (momentarily) roll uphill. It's only after the effects of friction set in that the ball is guaranteed to roll down into the valley. By contrast, our rule for choosing ΔvΔv\Delta v just says "go down, right now". That's still a pretty good rule for finding the minimum!To make gradient descent work correctly, we need to choose the learning rate ηη\eta to be small enough that Equation (9)ΔC≈∇C⋅ΔvΔC≈∇C⋅Δv\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v \nonumber\end{eqnarray}$('#margin_560455937071_reveal').click(function() {$('#margin_560455937071').toggle('slow', function() {});}); is a good approximation. If we don't, we might end up with ΔC>0ΔC>0\Delta C > 0, which obviously would not be good! At the same time, we don't want ηη\eta to be too small, since that will make the changes ΔvΔv\Delta v tiny, and thus the gradient descent algorithm will work very slowly. In practical implementations, ηη\eta is often varied so that Equation (9)ΔC≈∇C⋅ΔvΔC≈∇C⋅Δv\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v \nonumber\end{eqnarray}$('#margin_157848846275_reveal').click(function() {$('#margin_157848846275').toggle('slow', function() {});}); remains a good approximation, but the algorithm isn't too slow. We'll see later how this works. I've explained gradient descent when CCC is a function of just two variables. But, in fact, everything works just as well even when CCC is a function of many more variables. Suppose in particular that CCC is a function of mmm variables, v1,…,vmv1,…,vmv_1,\ldots,v_m. Then the change ΔCΔC\Delta C in CCC produced by a small change Δv=(Δv1,…,Δvm)TΔv=(Δv1,…,Δvm)T\Delta v = (\Delta v_1, \ldots, \Delta v_m)^T is ΔC≈∇C⋅Δv,(12)(12)ΔC≈∇C⋅Δv,\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v, \tag{12}\end{eqnarray} where the gradient ∇C∇C\nabla C is the vector ∇C≡(∂C∂v1,…,∂C∂vm)T.(13)(13)∇C≡(∂C∂v1,…,∂C∂vm)T.\begin{eqnarray} \nabla C \equiv \left(\frac{\partial C}{\partial v_1}, \ldots, \frac{\partial C}{\partial v_m}\right)^T. \tag{13}\end{eqnarray} Just as for the two variable case, we can choose Δv=−η∇C,(14)(14)Δv=−η∇C,\begin{eqnarray} \Delta v = -\eta \nabla C, \tag{14}\end{eqnarray} and we're guaranteed that our (approximate) expression (12)ΔC≈∇C⋅ΔvΔC≈∇C⋅Δv\begin{eqnarray} \Delta C \approx \nabla C \cdot \Delta v \nonumber\end{eqnarray}$('#margin_869505431896_reveal').click(function() {$('#margin_869505431896').toggle('slow', function() {});}); for ΔCΔC\Delta C will be negative. This gives us a way of following the gradient to a minimum, even when CCC is a function of many variables, by repeatedly applying the update rule v→v′=v−η∇C.(15)(15)v→v′=v−η∇C.\begin{eqnarray} v \rightarrow v' = v-\eta \nabla C. \tag{15}\end{eqnarray} You can think of this update rule as defining the gradient descent algorithm. It gives us a way of repeatedly changing the position vvv in order to find a minimum of the function CCC. The rule doesn't always work - several things can go wrong and prevent gradient descent from finding the global minimum of CCC, a point we'll return to explore in later chapters. But, in practice gradient descent often works extremely well, and in neural networks we'll find that it's a powerful way of minimizing the cost function, and so helping the net learn.Indeed, there's even a sense in which gradient descent is the optimal strategy for searching for a minimum. Let's suppose that we're trying to make a move ΔvΔv\Delta v in position so as to decrease CCC as much as possible. This is equivalent to minimizing ΔC≈∇C⋅ΔvΔC≈∇C⋅Δv\Delta C \approx \nabla C \cdot \Delta v. We'll constrain the size of the move so that ∥Δv∥=ϵ‖Δv‖=ϵ\| \Delta v \| = \epsilon for some small fixed ϵ>0ϵ>0\epsilon > 0. In other words, we want a move that is a small step of a fixed size, and we're trying to find the movement direction which decreases CCC as much as possible. It can be proved that the choice of ΔvΔv\Delta v which minimizes ∇C⋅Δv∇C⋅Δv\nabla C \cdot \Delta v is Δv=−η∇CΔv=−η∇C\Delta v = - \eta \nabla C, where η=ϵ/∥∇C∥η=ϵ/‖∇C‖\eta = \epsilon / \|\nabla C\| is determined by the size constraint ∥Δv∥=ϵ‖Δv‖=ϵ\|\Delta v\| = \epsilon. So gradient descent can be viewed as a way of taking small steps in the direction which does the most to immediately decrease CCC.Exercises Prove the assertion of the last paragraph. Hint: If you're not already familiar with the Cauchy-Schwarz inequality, you may find it helpful to familiarize yourself with it. I explained gradient descent when CCC is a function of two variables, and when it's a function of more than two variables. What happens when CCC is a function of just one variable? Can you provide a geometric interpretation of what gradient descent is doing in the one-dimensional case? People have investigated many variations of gradient descent, including variations that more closely mimic a real physical ball. These ball-mimicking variations have some advantages, but also have a major disadvantage: it turns out to be necessary to compute second partial derivatives of CCC, and this can be quite costly. To see why it's costly, suppose we want to compute all the second partial derivatives ∂2C/∂vj∂vk∂2C/∂vj∂vk\partial^2 C/ \partial v_j \partial v_k. If there are a million such vjvjv_j variables then we'd need to compute something like a trillion (i.e., a million squared) second partial derivatives* *Actually, more like half a trillion, since ∂2C/∂vj∂vk=∂2C/∂vk∂vj∂2C/∂vj∂vk=∂2C/∂vk∂vj\partial^2 C/ \partial v_j \partial v_k = \partial^2 C/ \partial v_k \partial v_j. Still, you get the point.! That's going to be computationally costly. With that said, there are tricks for avoiding this kind of problem, and finding alternatives to gradient descent is an active area of investigation. But in this book we'll use gradient descent (and variations) as our main approach to learning in neural networks.How can we apply gradient descent to learn in a neural network? The idea is to use gradient descent to find the weights wkwkw_k and biases blblb_l which minimize the cost in Equation (6)C(w,b)≡12n∑x∥y(x)−a∥2C(w,b)≡12n∑x‖y(x)−a‖2\begin{eqnarray} C(w,b) \equiv \frac{1}{2n} \sum_x \| y(x) - a\|^2 \nonumber\end{eqnarray}$('#margin_1246306310_reveal').click(function() {$('#margin_1246306310').toggle('slow', function() {});});. To see how this works, let's restate the gradient descent update rule, with the weights and biases replacing the variables vjvjv_j. In other words, our "position" now has components wkwkw_k and blblb_l, and the gradient vector ∇C∇C\nabla C has corresponding components ∂C/∂wk∂C/∂wk\partial C / \partial w_k and ∂C/∂bl∂C/∂bl\partial C / \partial b_l. Writing out the gradient descent update rule in terms of components, we have wkbl→→w′k=wk−η∂C∂wkb′l=bl−η∂C∂bl.(16)(17)(16)wk→wk′=wk−η∂C∂wk(17)bl→bl′=bl−η∂C∂bl.\begin{eqnarray} w_k & \rightarrow & w_k' = w_k-\eta \frac{\partial C}{\partial w_k} \tag{16}\\ b_l & \rightarrow & b_l' = b_l-\eta \frac{\partial C}{\partial b_l}. \tag{17}\end{eqnarray} By repeatedly applying this update rule we can "roll down the hill", and hopefully find a minimum of the cost function. In other words, this is a rule which can be used to learn in a neural network.There are a number of challenges in applying the gradient descent rule. We'll look into those in depth in later chapters. But for now I just want to mention one problem. To understand what the problem is, let's look back at the quadratic cost in Equation (6)C(w,b)≡12n∑x∥y(x)−a∥2C(w,b)≡12n∑x‖y(x)−a‖2\begin{eqnarray} C(w,b) \equiv \frac{1}{2n} \sum_x \| y(x) - a\|^2 \nonumber\end{eqnarray}$('#margin_214093216664_reveal').click(function() {$('#margin_214093216664').toggle('slow', function() {});});. Notice that this cost function has the form C=1n∑xCxC=1n∑xCxC = \frac{1}{n} \sum_x C_x, that is, it's an average over costs Cx≡∥y(x)−a∥22Cx≡‖y(x)−a‖22C_x \equiv \frac{\|y(x)-a\|^2}{2} for individual training examples. In practice, to compute the gradient ∇C∇C\nabla C we need to compute the gradients ∇Cx∇Cx\nabla C_x separately for each training input, xxx, and then average them, ∇C=1n∑x∇Cx∇C=1n∑x∇Cx\nabla C = \frac{1}{n} \sum_x \nabla C_x. Unfortunately, when the number of training inputs is very large this can take a long time, and learning thus occurs slowly.An idea called stochastic gradient descent can be used to speed up learning. The idea is to estimate the gradient ∇C∇C\nabla C by computing ∇Cx∇Cx\nabla C_x for a small sample of randomly chosen training inputs. By averaging over this small sample it turns out that we can quickly get a good estimate of the true gradient ∇C∇C\nabla C, and this helps speed up gradient descent, and thus learning.To make these ideas more precise, stochastic gradient descent works by randomly picking out a small number mmm of randomly chosen training inputs. We'll label those random training inputs X1,X2,…,XmX1,X2,…,XmX_1, X_2, \ldots, X_m, and refer to them as a mini-batch. Provided the sample size mmm is large enough we expect that the average value of the ∇CXj∇CXj\nabla C_{X_j} will be roughly equal to the average over all ∇Cx∇Cx\nabla C_x, that is, ∑mj=1∇CXjm≈∑x∇Cxn=∇C,(18)(18)∑j=1m∇CXjm≈∑x∇Cxn=∇C,\begin{eqnarray} \frac{\sum_{j=1}^m \nabla C_{X_{j}}}{m} \approx \frac{\sum_x \nabla C_x}{n} = \nabla C, \tag{18}\end{eqnarray} where the second sum is over the entire set of training data. Swapping sides we get ∇C≈1m∑j=1m∇CXj,(19)(19)∇C≈1m∑j=1m∇CXj,\begin{eqnarray} \nabla C \approx \frac{1}{m} \sum_{j=1}^m \nabla C_{X_{j}}, \tag{19}\end{eqnarray} confirming that we can estimate the overall gradient by computing gradients just for the randomly chosen mini-batch. To connect this explicitly to learning in neural networks, suppose wkwkw_k and blblb_l denote the weights and biases in our neural network. Then stochastic gradient descent works by picking out a randomly chosen mini-batch of training inputs, and training with those, wkbl→→w′k=wk−ηm∑j∂CXj∂wkb′l=bl−ηm∑j∂CXj∂bl,(20)(21)(20)wk→wk′=wk−ηm∑j∂CXj∂wk(21)bl→bl′=bl−ηm∑j∂CXj∂bl,\begin{eqnarray} w_k & \rightarrow & w_k' = w_k-\frac{\eta}{m} \sum_j \frac{\partial C_{X_j}}{\partial w_k} \tag{20}\\ b_l & \rightarrow & b_l' = b_l-\frac{\eta}{m} \sum_j \frac{\partial C_{X_j}}{\partial b_l}, \tag{21}\end{eqnarray} where the sums are over all the training examples XjXjX_j in the current mini-batch. Then we pick out another randomly chosen mini-batch and train with those. And so on, until we've exhausted the training inputs, which is said to complete an epoch of training. At that point we start over with a new training epoch.Incidentally, it's worth noting that conventions vary about scaling of the cost function and of mini-batch updates to the weights and biases. In Equation (6)C(w,b)≡12n∑x∥y(x)−a∥2C(w,b)≡12n∑x‖y(x)−a‖2\begin{eqnarray} C(w,b) \equiv \frac{1}{2n} \sum_x \| y(x) - a\|^2 \nonumber\end{eqnarray}$('#margin_85851492824_reveal').click(function() {$('#margin_85851492824').toggle('slow', function() {});}); we scaled the overall cost function by a factor 1n1n\frac{1}{n}. People sometimes omit the 1n1n\frac{1}{n}, summing over the costs of individual training examples instead of averaging. This is particularly useful when the total number of training examples isn't known in advance. This can occur if more training data is being generated in real time, for instance. And, in a similar way, the mini-batch update rules (20)wk→w′k=wk−ηm∑j∂CXj∂wkwk→wk′=wk−ηm∑j∂CXj∂wk\begin{eqnarray} w_k & \rightarrow & w_k' = w_k-\frac{\eta}{m} \sum_j \frac{\partial C_{X_j}}{\partial w_k} \nonumber\end{eqnarray}$('#margin_801900730537_reveal').click(function() {$('#margin_801900730537').toggle('slow', function() {});}); and (21)bl→b′l=bl−ηm∑j∂CXj∂blbl→bl′=bl−ηm∑j∂CXj∂bl\begin{eqnarray} b_l & \rightarrow & b_l' = b_l-\frac{\eta}{m} \sum_j \frac{\partial C_{X_j}}{\partial b_l} \nonumber\end{eqnarray}$('#margin_985072620111_reveal').click(function() {$('#margin_985072620111').toggle('slow', function() {});}); sometimes omit the 1m1m\frac{1}{m} term out the front of the sums. Conceptually this makes little difference, since it's equivalent to rescaling the learning rate ηη\eta. But when doing detailed comparisons of different work it's worth watching out for.We can think of stochastic gradient descent as being like political polling: it's much easier to sample a small mini-batch than it is to apply gradient descent to the full batch, just as carrying out a poll is easier than running a full election. For example, if we have a training set of size n=60,000n=60,000n = 60,000, as in MNIST, and choose a mini-batch size of (say) m=10m=10m = 10, this means we'll get a factor of 6,0006,0006,000 speedup in estimating the gradient! Of course, the estimate won't be perfect - there will be statistical fluctuations - but it doesn't need to be perfect: all we really care about is moving in a general direction that will help decrease CCC, and that means we don't need an exact computation of the gradient. In practice, stochastic gradient descent is a commonly used and powerful technique for learning in neural networks, and it's the basis for most of the learning techniques we'll develop in this book.Exercise An extreme version of gradient descent is to use a mini-batch size of just 1. That is, given a training input, xxx, we update our weights and biases according to the rules wk→w′k=wk−η∂Cx/∂wkwk→wk′=wk−η∂Cx/∂wkw_k \rightarrow w_k' = w_k - \eta \partial C_x / \partial w_k and bl→b′l=bl−η∂Cx/∂blbl→bl′=bl−η∂Cx/∂blb_l \rightarrow b_l' = b_l - \eta \partial C_x / \partial b_l. Then we choose another training input, and update the weights and biases again. And so on, repeatedly. This procedure is known as online, on-line, or incremental learning. In online learning, a neural network learns from just one training input at a time (just as human beings do). Name one advantage and one disadvantage of online learning, compared to stochastic gradient descent with a mini-batch size of, say, 202020. Let me conclude this section by discussing a point that sometimes bugs people new to gradient descent. In neural networks the cost CCC is, of course, a function of many variables - all the weights and biases - and so in some sense defines a surface in a very high-dimensional space. Some people get hung up thinking: "Hey, I have to be able to visualize all these extra dimensions". And they may start to worry: "I can't think in four dimensions, let alone five (or five million)". Is there some special ability they're missing, some ability that "real" supermathematicians have? Of course, the answer is no. Even most professional mathematicians can't visualize four dimensions especially well, if at all. The trick they use, instead, is to develop other ways of representing what's going on. That's exactly what we did above: we used an algebraic (rather than visual) representation of ΔCΔC\Delta C to figure out how to move so as to decrease CCC. People who are good at thinking in high dimensions have a mental library containing many different techniques along these lines; our algebraic trick is just one example. Those techniques may not have the simplicity we're accustomed to when visualizing three dimensions, but once you build up a library of such techniques, you can get pretty good at thinking in high dimensions. I won't go into more detail here, but if you're interested then you may enjoy reading this discussion of some of the techniques professional mathematicians use to think in high dimensions. While some of the techniques discussed are quite complex, much of the best content is intuitive and accessible, and could be mastered by anyone. Implementing our network to classify digitsAlright, let's write a program that learns how to recognize handwritten digits, using stochastic gradient descent and the MNIST training data. We'll do this with a short Python (2.7) program, just 74 lines of code! The first thing we need is to get the MNIST data. If you're a git user then you can obtain the data by cloning the code repository for this book,git clone https://github.com/mnielsen/neural-networks-and-deep-learning.git If you don't use git then you can download the data and code here.Incidentally, when I described the MNIST data earlier, I said it was

      @fuelpress

    1. Herbivory affected the surface area of petals (Figure S3; GLM: χ2 = 40.9, df = 5, P < 0.001), and petals of plants infested with L. erysimi or D. radicum were 7% larger than uninfested plants (Tukey's post hoc tests, P = 0.008 or P = 0.010, respectively). Herbivory affected several shape characteristics of petals (Figure S3), such as major chord length (GLM: χ2 = 79.0, df = 5, P < 0.001), minor chord length (GLM: χ2 = 37.3, df = 5, P < 0.001), aspect ratio (GLM: χ2 = 52.3, df = 5, P < 0.001), and eccentricity (GLM: χ2 = 59.0, df = 5, P < 0.001). Overall, petals of herbivore‐infested plants had smaller aspect ratios and eccentricity than had uninfested plants, caused by shorter (A. rosae and B. brassicae) or broader (P. xylostella, L. erysimi, D. radicum) petals. Despite changes in petal size caused by all herbivores, only flowers of plants infested with P. xylostella had larger display size and smaller solidity than had uninfested plants.

      Again, all relevant to my proposal.

    1. We l l , t o d a y i n t h e M i d d l e E a s t , t h e l a s t b a s t i o n o f t h a t a r g u m e n t , p e o p l e a r e p u t t i n g a n a i l i n t h e c offin of that idea

      Switches to strength and determination

    Annotators

    1. T H ROU GH T H E L OOK I N GGL A SS OR B ECOM I N GT H E DA T U M

      alternative universe... where things are contrary to the real world or becoming the measured conclusion?

      (Reading through the novel, this seems to connect to Mexican history.)

    1. a number of scientific papers

      Preface

      Abstract PURPOSE: To determine the safety and the appropriate dose of intravenous l-ascorbic acid (AA) in conjunction with chemotherapy for patients with relapsed lymphoma.

      PATIENTS AND METHODS: Patients with relapsed CD20-positive B-cell non-Hodgkin's lymphoma, who were going to receive the CHASER regimen as salvage therapy, were enrolled and treated with escalating doses of AA administered by drip infusion after the 2nd course of the CHASER regimen. The target plasma concentration immediately after AA administration was >15 mM (264 mg/dl).

      RESULTS: A serum AA concentration of >15 mM was achieved in 3 sequentially registered patients, all of whom had received a 75 g whole body dose. No obvious adverse drug reaction was observed in the patients. The trial was therefore successfully completed.

      CONCLUSION: Intravenous AA at a whole body dose of 75 g appears to be safe and sufficient to achieve an effective serum concentration. A phase II trial to evaluate the efficacy of intravenous AA in relapsed/refractory lymphoma patients will now be initiated.

    2. (a

      Vitamin B ABC

      Abstract BACKGROUND: Thiamine is a vitamin that is essential for adequate aerobic metabolism. The objective of this study was to determine if thiamine administration prior to coronary artery bypass grafting would decrease post-operative lactate levels as a measure of increased aerobic metabolism.

      METHODS: We performed a randomized, double-blind, placebo-controlled trial of patients undergoing coronary artery bypass grafting. Patients were randomized to receive either intravenous thiamine (200 mg) or placebo both immediately before and again after the surgery. Our primary endpoint was post-operative lactate levels. Additional endpoints included pyruvate dehydrogenase activity, global and cellular oxygen consumption, post-operative complications, and hospital and intensive care unit length of stay.

      RESULTS: Sixty-four patients were included. Thiamine levels were significantly higher in the thiamine group as compared to the placebo group immediately after surgery (1200 [683, 1200] nmol/L vs. 9 [8, 13] nmol/L, p < 0.001). There was no difference between the groups in the primary endpoint of lactate levels immediately after the surgery (2.0 [1.5, 2.6] mmol/L vs. 2.0 [1.7, 2.4], p = 0.75). Relative pyruvate dehydrogenase activity was lower immediately after the surgery in the thiamine group as compared to the placebo group (15% [11, 37] vs. 28% [15, 84], p = 0.02). Patients receiving thiamine had higher post-operative global oxygen consumption 1 hour after the surgery (difference: 0.37 mL/min/kg [95% CI: 0.03, 0.71], p = 0.03) as well as cellular oxygen consumption. We found no differences in clinical outcomes.

      CONCLUSIONS: There were no differences in post-operative lactate levels or clinical outcomes between patients receiving thiamine or placebo. Post-operative oxygen consumption was significantly increased among patients receiving thiamine.

      TRIAL REGISTRATION: clinicaltrials.gov NCT02322892, December 14, 2014.

    3. c

      Vitamin B Drip ABC

      Abstract RATIONALE: Oxygen consumption may be impaired in critically ill patients.

      OBJECTIVES: To evaluate the effect of intravenous thiamine on oxygen consumption ([Formula: see text]o2) in critically ill patients.

      METHODS: This was a small, exploratory open-label pilot study conducted in the intensive care units at a tertiary care medical center. Critically ill adults requiring mechanical ventilation were screened for enrollment. Oxygen consumption ([Formula: see text]o2) and cardiac index (CI) were recorded continuously for 9 hours. After 3 hours of baseline data collection, 200 mg of intravenous thiamine was administered. The outcome was change in [Formula: see text]o2 after thiamine administration.

      MEASUREMENTS AND MAIN RESULTS: Twenty patients were enrolled and 3 were excluded because of incomplete [Formula: see text]o2 data, leaving 17 patients for analysis. There was a trend toward increase in [Formula: see text]o2 after thiamine administration (16.3 ml/min, SE 8.5; P = 0.052). After preplanned adjustment for changes in CI in case of a delivery-dependent state in some patients (with exclusion of one additional patient because of missing CI data), this became statistically significant (16.9 ml/min, SE 8.6; P = 0.047). In patients with average CI greater than our cohort's mean value of 3 L/min/m(2), [Formula: see text]o2 increased by 70.9 ml/min (±16; P < 0.0001) after thiamine. Thiamine had no effect in patients with reduced CI (< 2.4 L/min/m(2)). There was no association between initial thiamine level and change in [Formula: see text]o2 after thiamine administration.

      CONCLUSIONS: The administration of a single dose of thiamine was associated with a trend toward increase in [Formula: see text]o2 in critically ill patients. There was a significant increase in [Formula: see text]o2 in those patients with preserved or elevated CI. Further study is needed to better characterize the role of thiamine in oxygen extraction. Clinical trial registered with www.clinicaltrials.gov (NCT01462279).

  10. Sep 2019
    1. Note: The peer reviews in Peerage of Science are judged and scored for accuracy and fairness by other reviewers. The Weight -value indicates that, relative to the best review (Weight=1.00)


      Review by Peer 1755 (Weight = 1.00)

      Introduction: This paper presents a Bayesian model of mating in a fish, that combines behavioural data on encounters and matings with genetic parentage data. It contrasts this model with classical analyses that use only particular facets of these data.

      Merits: In my opinion, this paper's most important merits are:

      That the model makes conceptual sense, and is presented in a way that is fairly easy to follow.

      That the authors share the model code and data. This will make the model a lot more useful for other researchers.

      That the paper is well written.

      Critique: Despite this, I think there are things that could be clarified or improved:

      1. There seems to be a considerable skew in the reproduction data. This is expected, but this comes with a risk violating the assumptions of common statistical models. Does the models used adequately capture this? In particular, the correlation coefficients (Figure 1) must be largely driven by single influential data points.

      2. Given the above skew and structure of the data and that the model results extrapolates quite a bit from what was observed, it would be nice to see more through checks and discussion about the validitiy of the model. How well the model can reproduce features of the data? The posterior predictions in Figure 4 seem to indicate that the model fits data rather poorly? But I may be mistaken, and the manuscript does not interpret these results much.

      3. I got the JAGS model to run with only minor editing (that is, moving the data generating code to its own file). However, I can't, using the data in the script, recover the scatterplots and Pearson correlations displayed in Figure 1. I assume my analysis (see attached Sweave pdf output) is wrong somehow, suggesting a need for better documentation so that readers such as myself can understand the data. It may help to clarify what variables are what, which samples have been omitted (from what analyses and for what reasons), and store the data in tabular format in addition to the JAGS input format. It would also be a nice addition to have the code used for running the model and summarising the results -- it would save a user quite a bit of effort without much work on behalf of the authors.

      4. The sample sizes for data on releasing of gametes are particularly small. One wonders how much information they contribute? Similarly, both observations (line 248) and modelling (line 305-307) suggest that many encounters were not observed. How does this affect conclusions? This ability to deal with incomplete data is highlighted as a feature of the model. Is there arguments or data that show that it is successful?

      5. In the Introdution and Abstract, one of the motivations for this approach is to capture effects of interactions of the phenotypes within a pair. But then, "Unfortunately our dataset is too small to properly infer the effect of interaction" (line 428-429). First, previous the focus on this unused feature of the model seems misplaced. Second, it is not clear when a dataset is too small and how you know that (presumably by trying a model not shown?).

      6. I think this paper would benefit from more illustration. Figures 1 and 3 are hard to read with small differently shaped symbols, line patterns, and overplotting. I would suggesting making separate plots for males and females to alleviate some of the clutter. Figure 1 b is particularly unreadable. The plots of posteriors are fine, and probably should be in the paper, but I think they should be supplemented with some descriptive graphics that give a feel for the structure of the data and the behaviour of the fish. I would even love to see some visuals of fish mating, maybe stills from the video recordings (or even a supplementary video). Of course, this may be limited by space requirements of the target journal, or nor to the author's taste. But I think you underestimate how cool some of these things are, especially if you aim for a wide audience not well versed in fish mating research.

      Discussion: This is likely beyond the scope of this paper, but I feel that a lot of the questions about the model -- does it work on small datasets; does it successfully account for unobserved encounters; how does its parameters relate to the "classical" measures of sexual selection -- could better be answered with simulated than with real data. I sympathise the use of real data: a good biological example is a lot more convincing to biologists than simulations. However, I feel that there are often too many uncertainties in comparing methods on real data. Results of different methods differ, like the "classical" and the new analyses in this study. But which are right?

      Additional Comments for Authors

      1. The paper would benefit from a two sentence explanation of opportunity for selection, what it measures, and the distinction between opportunity for selection and opportunity for sexual selection.

      2. L8-10: The opening of the abstract sets up the paper to be rather technical, jumping directly into marginal sums of matrices. I think you may want to rethink that approach if the goal is too reach, as the author message said, "a wide audience of ecologists and evolutionary biologists".

      3. For the same reason, I'd advice against the introduction of a 3-dimensional array on line 34. Even if that is mathematically correct, it is immediately going to be summed to the a parental table. Therefore, the 3-dimensional structure doesn't really contribute much, except act as an obstacle to mathematically less savvy readers.

      4. L48-49: "strong link" could be made more precise.

      5. Line 123-124: "The experimental setup is the one used in the "constant environment" treatment in Gauthey et al. (2016)." What is the relationship between this work and Guthey et al 2016? Can this be made clearer?

      6. Lines 226: "po" is not defined in this section. I think the manuscript would benefit from being checked an extra time for mathematical symbols, when they are defined, how they are referred to, and if they can be spelled out in text to help the reader.

      7. Line 270: "Model output" is not a very informative subtitle. I'd suggest dividing the Results into one subsection on the data set, one on the "classical" analyses of sexual selection, and one on the model.

      8. Some of the chocies about model structure (specifically, use of informative priors) is discussed in comments in the model code, but not in the Methods. They should be in the Methods too.


      Review by Peer 1765 (Weight = 0.88)

      Introduction: This paper aims to solve a long-standing issue in sexual selection studies in natural populations: that genetic and behavioural data tell us different things about separate stages of sexuals selection and, therefore, often focus on different processes in sexual selection. While behavioural data tend to focus on mate sampling and mate choice, genetic data provide evidence on the resulting mating/reproductive success. This paper makes an important step in trying to combine both types of data in order to analyse the complete process of sexual selection. Such a tool could substantially advance the field of sexual selection in natural populations. I was very enthousiastic about this approach, until I arrived at Figure 4, which shows that the predictions from model the authors suggest does not correlate at all with the observed data from their case study, suggesting the model is possibly very well thought through, but does not represent the data well. Without empirical evidence, I do not see any reason to put the results of the model above those of the classical methods.

      Merits: The paper describes the model used in a way that is mostly very clearly understandable for non-modelers, which is important for the general use of the proposed method. Moreover they include a case-study which very nicely links the theory to experimental data.

      Critique: The suggested model provides different results from more classical methods of analysing the data. The authors then go on to defend the model as a better way to analyse the data, because they find different results. However, they do not provide evidence that the results from the model fit the data better than the results from the classical analyses. In fact, Figure 4 shows that the model is actually rather bad in predicting observed encounter rates, gamete releases and offspring numbers, because there seems to be no correlation whatsoever between observed and predicted data. For example, many females that did sire large numbers offspring were not predicted to have any offspring according to the model (Fig. 4c). This is not discussed in the paper. I do commend the authors for testing their model on a case study, and combine a theorethical appraoch with an experimental one, but the difference between predicted and observed data should be discussed. The authors could compare the model predictions to the predictions from the classical analyses and see which analyses fit best with the observed data.

      Terminology: Encounter rate is a term that is generally reserved for random events depending on population density and sex ratio. However, the way it is used in the case study (which is certainly the most practical for field observations) includes a certain effect of attraction. In most species, males and females do not generally end up close to a spawning ground/ nest without being attracted by some aspect of the individual or this particular nest. The authors are likely aware of this, because they test for an effect of female size on encounter-rate. The fact that they do not find such an effect does not exclude that their may have been attraction to other characteristics of the female or the nest-site. Therefore, I would suggest to use another word for encounter (for example inspection or visit) to avoid confusion between an event where individuals have likely already been attracted to each other (as used in the case study) and a random "encounter". The latter is, however, impossible to quantify in the field, because it is generally impossible to spot whether two individuals have noticed each other and I see no reason to include it in the model.

      Discussion: The paper addresses a very important issue in the study of sexual selection: how to combine behavioural and genetic data to study the strength of sexual selection. As the authors rightly argue, both types of data omit important processes in sexual selection and very few studies manage to get both types of data for all (or even most) mating events. The model they suggest would make use of incomplete behavioural and genetic data to explain the underlying processess. Such a model could provide an important tool for sexual selection studies. However, the case study the authors provide suggests that the model is not very good at predicting real case scenarios. Therefore, the autors should investigate how the model could be changed to reflect their experimental data. Doing so would provide an important paper that would be very valuable to the field.


      Review by Peer 1758 (Weight = 0.85)

      Introduction: This manuscript offers a statistical alternative to classical sexual selection gradient analysis by using Bayesian inference that allows accounting for male and female effects simultaneously. Furthermore, the authors highlight that mating success is generally underestimated because it is based on the genetic assignment of offspring. The authors use their own data on the mating behaviour and reproductive output of brown trout to compare the results from classical selection analysis with their Bayesian model and find differences between the two.

      Merits: This manuscript is relevant because it highlights limitations of classical sexual selection gradient analysis, and offers a statistical alternative to empiricist with suitable data. I have the following suggestions, which I hope will be useful in revising the authors' original contribution. Also, I welcome that the authors made their research transparent by adding their data and code. However, I want to make clear that I could not review their code because of incompatibilities with JAGS and my software. ​

      Critique: The authors statistical alternative is motivated by two shortcomings to (a) account for the interdependence of females and males in sexually reproducing species and (b) getting a grip on the copulatory behaviour instead of inferring it from offspring data. Whilst I agree that (b) is pressing, (a) depends on the mating systems, e.g. in strictly monogamous species, male and female identity overlap and fitting both would not be informative or appropriate for the analysis of sexually selected individual phenotypic traits. Hence, the applicability of the authors' model would profit from information on its suitability for different mating systems, i.e. expand on "a variety of biological systems", l24, in the discussion. Also, the authors approach also relies on empirical data. In other words, the best model does not change that if mating success lacks behavioural observations, and it usually does, we can only make incomplete inferences. In my view, the main contribution of this manuscript is thus to serve as an important reminder of the complexities at play and the importance of comprehensive data collection, rather than a new tool for measuring sexual selection. Also, the pitfalls and shortcomings, (e.g. bias in stochasticity, what is the null model, operational sex ratio) when measuring sexual selection have been comprehensively illustrated here (Klug, Heuschele, Jennions, & Kokko, 2010) and here (Jennions, Kokko, & Klug, 2012). So, I recommend a more inclusive portrait of the matter and attuning with published jargon (e.g. Table 1 in (Klug, Heuschele, Jennions, & Kokko, 2010).

      • I advocate that the full results of the linear regression analyses as well as the alternative JAGS model are presented in table format in the main text. Results in the supporting information get missed easily, and plots cannot substitute full estimates.

      • The authors could expand more on discussing their most interesting finding, which is the discrepancy between their results using classical regression analyses and Bayesian analysis.

      Discussion: This manuscript is motivated by two shortcomings of the classical sexual selection gradient analysis. I agree with the relevance of one of them (i.e. measuring mating success) and yet argue that the relevance of accounting for the additive effects of the sexes for reproductive success is highly dependent on the species mating system, which the authors should address. I also think that the authors should make clearer that their analysis still depends on empiricists collecting data on mating success. I welcome the authors approach to use their own data to compare whether body size of male and female brown trout might be sexually selected. If the authors revise the current version, their manuscript will serve as an important reminder of what to look out for when analysing potentially sexually selected traits.

      References Jennions, M. D., Kokko, H., & Klug, H. (2012). The opportunity to be misled in studies of sexual selection. Journal of Evolutionary Biology. http://doi.org/10.1111/j.1420-9101.2011.02451.x

      Klug, H., Heuschele, J., Jennions, M. D., & Kokko, H. (2010). The mismeasurement of sexual selection. Journal of Evolutionary Biology. http://doi.org/10.1111/j.1420-9101.2009.01921.x

      Schlicht, E., & Kempenaers, B. (2013). Effects of social and extra-pair mating on sexual selection in blue tits (Cyanistes caeruleus). Evolution, 67(5), 1420-1434. http://doi.org/10.1111/evo.12073

      Additional Comments for Authors l14: be clearer on "costly" or delete because costs were not measured

      l27: add or consider selection gradient, see Table 1 in Klug et al 2010

      l44: ambiguous "to do so". Which of the indices exactly?

      l52 infertile not unfertile

      l53 reference "cost of reproduction"

      l64 reference costs

      l65 back up the claim of "are essential to understand..."

      l68 better name the "fourth definition"

      l88-89 reference

      l93 define "a pair", e.g. socially monogamous? This could be an opportunity to introduce the mating system you want to target

      l109-111 reference?

      l113-115 reference?

      l116 in brown trout? Please add citation

      l120 "a" semi-natural...

      l120-123 split into two sentences to improve readability, e.g. This period represents the trout...

      l124: chemically communicated?

      l129: highly female biased, which might be biological meaningful or a catching bias, please explain. Plus this skew in adult sex ratio will affect the variance in mating success, i.e. "chance variation in mating success is higher when there are fewer potential mates per individual of the focal sex" (Jennions et al 2012), this affects both your statistical approaches but it nowhere mentioned

      l132 how did you sex? Molecularly?

      l145: one or multiple observers? also "taken" not "took"

      l148 any proof? repeatability tests? references for the claim?

      l149 say how you dealt with the 30% for analyses

      l150 rephrase "the zone", e.g. female nesting/egg release site, etc.

      l156 consider "spawning" or gamete release instead of copulating

      l159 "degree day" reads misplaced, only use estimate of time after spawning

      l172 its

      l186 consider making clearer that zero's were included

      l247 depending on where you want to submit avoid fish jargon: "redd"

      l249 give output of all linear regression analyses in table

      l271 I suggest moving these to the main text

      l278 why not report Credible Intervals instead of SDs? Also, SDs show high uncertainty in estimates, which should be addressed in the discussion

      l333-4 reference

      l336 rephrase "to account for..."

      l335 give time unit, e.g. over the course of the experiment

      l336 Comment: I disagree because sexual selection is commonly referred to as the opportunity for evolutionary change, which is the variance in relative fitness and should consider all reproductively mature adults, hence should be measured among individuals that do and do not interact/mate. Especially the latter is usually omitted, but ignoring unmated individuals in a population will automatically inflate the variance of the successful subset (see also (Schlicht & Kempenaers, 2013)).

      l418-19 rephrase, unclear

      Plots: General comment: It might be the pdfs but the quality of plots is low and generally offsetting the raw data a bit, e.g. jittering would help viewing individual data points


      Review by Peer 1761 (Weight = 0.67)

      Introduction: The authors point out how the study of mating systems only using behavioural observations or genetic data usually fails to explain accurately the breeding processes and reproductive outcomes, as well as their relationship with sexual selection features.

      They propose a model that combines both behavioural and genetic data, and a phenotypic trait linked to sexual selection, using brown trout as model species.

      Their model includes several breeding variables behavioural and genetic, and it very adaptable as is able to incorporate other environmental or biological variables if needed.

      They show how genetic and behavioural results analyzed separately may differ. Also, how the results from their model and the classic regression analyses to analyse this data also differ, and so, they aim to explain why.

      Merits: The model they have built seems flexible enough to be adapted to multiple taxa and systems.

      Critique: There is no reference at all about ethics permissions to perform the described experiment. I am quite shocked about this since high numbers of individuals from a wild population were killed.

      There is no mention on the conservation status of the species, the permits obtained to carry out the capture and experiment, the effect of the capture system on the ecosystem, or the explanation/justification for the use of lethal methods.

      For example, I find electrofishing highly non-targeted and I wonder how was its impact on other non-target fish (and non-fish) species. I believe that assembling a team of fishermen to get the same number of adult specimens would be easy enough to arrange.

      My point is not whether the methods were ethically acceptable or not (that is for the journals' ethics committees to decide) but to, at least, justify and explain their use.

      Model testing: I understand that in ecology studies usually researchers don't get all behavioural or all genetic data, and that is what the models try to compensate for. However, when testing models in a biological system the ideal situation is to work in a system where almost all information can be collected (ussualy under lab conditions), build a model with all that information, and then subsample the data (as to simulate a real ecological study) to test the model performance.

      In this study, however, the initial sampling for the data is quite small, specially for behavioural observations (30min/day). Then, the results from the model are quite different from the results obtained from more classic approaches. The authors offer some hypotheses to explain these differences, but they can't be really tested to see whether the authors' model results are better in explaining the system or not.

      All that said, I have to admit that I lack the mathematical background to fully understand and evaluate the model design and performance, and a more qualified researcher should do that.

      Discussion: Although the experimental approach to test the validity of the model predictions could have been better, their attempt to combine behavioural and genetic data in mating system studies and relate it to sexual selection is an important step forward in the behavioural field.

      Hopefully, more efforts like this will be made to reconcile both aspects of the study of mating systems that rapidly changed from behavioural observations only to genetic analyses only.


      Review by Peer 1773 (Weight = 0.51)

      Introduction: In accordance with traditional approach to estimate the effect of sexual selection on phenotypic trait the number of mates should be regressed on a target phenotypic trait in a separate model for each sex. Such analysis ignores common investment of the sexes into mating success. The authors propose a new approach, which allow combining behavioral and genetic data, thereby enabling to gather information through the successive processes of encounter, gamete release and offspring production.

      Merits: The new approach accounted for the three-dimensional structure of the data: males, females and mating occasions. This allowed a qualified definition of mating success and disentangling the joint effects of male and female phenotypes on the different components of reproductive success. Three important features that lack in the traditional approach characterize the authors' model:

      1) conditioning of each process (encounter, gamete release and offspring production) on the preceding one,

      2) simultaneous estimation of the effect of male and female phenotype,

      3) random individual effects.

      ​The authors tested their model on a brown trout and obtained quite different results for the two approaches.

      ​The model can be used for a variety of biological systems where behavioral and genetic data are available.

      Critique: The model should be tested on a larger sample.

      The title of the manuscript is not very successful.

      ​There is a couple of misprints: p. 7 l. 139 and p. 8 l. 159.

      Discussion: This is very important when new algorythms allow to obtain more information from the same set of data. Hopefully, it would be of great importance if the model can be developed to account for real behavior traits in species presenting complex courtship behavior like Drosophila for instance.

    1. sudo 指令:暂时获得root权限 第一次设置密码的时候需要激活用户 即 sudo passwd 输入密码后再su root。 领附上之前整理的linux终端操作指令 ls:查看目录

      ls -l :当前目录下所有文本以长名字显示,d打头 代表目录,-打头代表文件。显示拥有者和创建时间间 c开头设备文件 l链接 b块文件,例如硬盘分区

      ls -lh 和-l类似,不过文件大小不用字节,而是以Kb和MB为单位,方便阅读

      ls -a:显示隐藏文件夹,以 . 开头的就是

      ls -lh -- sort=size 当前目录按大小排序 =time按时间排序

      cd /。。。/ 进入。。。文件 cd. 当前目录,没作用 cd..返回上一目录 直接输入cd会进入~目录,表示用户主目录

      cat 查看文件 cat/var/log/massages 查看系统信息变化日志

      more与cat类似,不过是信息分屏幕次序查看,按回车查看下一个屏幕,q退出

      less与more命令一样就是不会显示当前所看的占全部的百分比数

      rm 删除文件 rm next.txt 删除txt文件

      cp 拷贝 cp ps ps1 将拷贝,名字是ps1

      rm和cp对文件夹实施操作 rm -r abc/ 删除abc文件,cp -r abc/ A拷贝abc,命名为A

      top 监视linux性能参数 在界面里输入kill PAD值直接关闭PAD值下的程序,q退出

      ps查看进程信息 ps -ef查看详细信息 ps aux和ps差不多

      grep:控制输出 grep sss /ect/passwd 输出passwd文档中包含sss的内容(这个文档是存放系统账户的) grep -v sss (或者是'sss'?)输出项中输出不包含sss的内容 egrep是greo的升级版本

      ifconfig 查看网络信息 ifconfig eth0 down 关闭网卡 往往配合 macchanger -m 00:11:11:11:11:11 eth0 修改网卡mac地址 ifconfig eth0 up 启动网卡

      netstat查看网络连接信息 netstat -pantu 查看ptc协议与udp协议的链接信息 netstat -pantu |egrep -v '0.0.0.0|::: |awk' {printf 5}' 输出的网络信息不包含0.0.0.0和:::,并且只显示第5列 awk'{printf 5}'输出第五列

      linux无扩展名,Windows下的ext执行文件没有权限运转。所以木马病毒无效。

      指令格式 命令 -选项 /参数 -a为简化选项 与--all完整选项一样,完整选项前加-- linux下所有存储设备必须挂载运行才可以执行 ls /为根目录 选项可以合并,比如ls -a -l 与ls -la 和ls -al相同 -l 详细信息 -a (all)全部信息 -d 属性 -h(human)人性化显示与其他结合。 -i(inode)查看索引id

      权限分为三种,用有者user 所有组group 其他人other 用u,g,o代写 查询文件时,文件名-开头代表文件,d开头代表目录 l开头代表软连接 右边的九个字符表示可执行的操作。r(read)是读,w(write)是写 e是执行(execute) 如-rw-r--r--代表这个文件目录只有拥有者可以读写,组和其它只有读的权限。

    1. [This was a peer review for the journal "Meta-Psychology", and I am posting it via hypothes.is at the journal's suggestion.]

      I thank the authors for their response to our article. For full disclosure, I previously reviewed an earlier version of this manuscript. The present version of the manuscript shows improvement, but does not yet address several of my substantial concerns, each of which I believe should be thoroughly addressed if a revision is invited. My concerns are as follows:

      1.) The publication bias corrections still rely on incorrect statistical reasoning, and using more appropriate methods yields quite different conclusions.

      Regarding publication bias, the first analysis of the number of expected versus observed p-values between 0.01 and 0.05 that is presented on page 3 (i.e., “Thirty nine…should be approximately 4%”) cannot be interpreted as a test of publication bias, as described in my previous review. The p-values would only be uniformly distributed if the null were true for every study in the meta-analysis. If the null does not hold for every study in the meta-analysis, then we would of course expect more than 4% of the p-values to fall in [0.01, 0.05], even in the absence of any publication bias. I appreciate that the authors have attempted to address this by additionally assessing the excess of marginal p-values under two non-null distributions. However, these analyses are still not statistically valid in this context ; they assume that every study in the meta-analysis has exactly the same effect size (i.e., that there is no heterogeneity), which is clearly not the case in the present meta-analyses. Effect heterogeneity can substantially affect the distribution and skewness of p-values in a meta-analysis (see Valen & Yuan, 2007). To clarify the second footnote on page 3, I did not suggest this particular analysis in my previous review, but rather described why the analysis assuming uniformly distributed p-values does not serve as a test of publication bias.

      I would instead suggest conducting publication bias corrections using methods that accommodate heterogeneity and allow for a realistic distribution of effects across studies. We did so in the Supplement of our PPS piece (https://journals.sagepub.com/doi/suppl/10.1177/1745691619850104) using a maximum-likelihood selection model that accommodates normally-distributed, heterogeneous true effects and essentially models a discontinuous “jump” in the probability of publication at the alpha threshold of 0.05. These analyses did somewhat attenuate the meta-analyses’ pooled point estimates, but suggested similar conclusions to those presented in our main text. For example, the Anderson (2010) meta-analysis had a corrected point estimate among all studies of 0.14 [95% CI: 0.11, 0.16]. The discrepancy between our findings and Drummond & Sauer’s arises partly because the latter analysis focuses only on pooled point estimates arising from bias correction, not on the heterogeneous effect distribution, which is the very approach that we described as having led to the apparent “conflict” between the meta-analyses in the first place. Indeed, as we described in the Supplement, publication bias correction for the Anderson meta-analyses still yields an estimated 100%, 76%, and 10% of effect sizes above 0, 0.10, and 0.20 respectively. Again, this is because there is substantial heterogeneity. If a revision is invited, I would (still) want the present authors to carefully consider the issue of heterogeneity and its impact on scientific conclusions.

      2.) Experimental studies do not always yield higher-quality evidence than observational studies.

      Additionally, the authors focus only the subset of experimental studies in Hilgard’s analysis. Although I agree that “experimental studies are the best way to completely eliminate uncontrolled confounds”, it is not at all clear that experimental lab studies provide the overall strongest evidence regarding violent video games and aggression. Typical randomized studies in the video game literature consist, for example, of exposing subjects to violent video games for 30 minutes, then immediately having them complete a lab outcome measure operationalizing aggression as the amount of hot sauce a subject chooses to place on another subject’s food. It is unclear to what extent one-time exposures to video games and lab measures of “aggression” have predictive validity for real-world effects of naturalistic exposure to video games. In contrast, a well-conducted case-control study with appropriate confounding control and assessing violent video game exposure in subjects with demonstrated violent behavior versus those without might in fact provide stronger evidence for societally relevant causal effects (e.g., Rothman et al., 2008).

      3.) Effect sizes are inherently contextual.

      Regarding the interpretation of small effect sizes, we did indeed state several times in our paper that the effect sizes are “almost always quite small”. However, to universally dismiss effect sizes of less than d = 0.10 as less than “the smallest effect size of practical importance” is too hasty. Exposures, such as violent video games, that have very broad outreach can have substantial effects at the population level when aggregated across many individuals (VanderWeele et al., 2019). The authors are correct that small effect sizes are in general less robust to potential methodological biases than larger effect sizes, but to reiterate the actual claim we made in our manuscript: “Our claim is not that our re-analyses resolve these methodological problems but rather that widespread perceptions of conflict among the results of these meta-analyses—even when taken at face value without reconciling their substantial methodological differences—may in part be an artifact of statistical reporting practices in meta-analyses.” Additionally, the comparison to effect sizes for psychic phenomena does not strike as particularly damning for the violent video game literature. The prior plausibility that psychic phenomena exist is extremely low, as the authors themselves describe, and it is surely much lower than the prior plausibility that video games might increase aggressive behavior. Extraordinary claims require extraordinary evidence, so any given effect size for psychic phenomena is much less credible than for video games.

      Signed, Maya B. Mathur Department of Epidemiology Harvard University

      References

      Johnson, Valen, and Ying Yuan. "Comments on ‘An exploratory test for an excess of significant findings’ by JPA loannidis and TA Trikalinos." Clinical Trials 4.3 (2007): 254.

      Rothman, K. J., Greenland, S., & Lash, T. L. (2008). Modern epidemiology (Vol. 3). Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins.

      VanderWeele, T. J., Mathur, M. B., & Chen, Y. (2019). Media portrayals and public health implications for suicide and other behaviors. JAMA Psychiatry.

    1. 18. B. A. Stamoutsos, R. G. Carpenter, L. Grossman, S. P. Grossman, Physiol. Behav. 23, 771–776 (1979).

      The authors show that rats administered with 2-deoxy-D-glucose (2-DG) increase their food intake, whereas this is abolished in animals with ZI lesions. 2-DG is a modified glucose molecule that inhibits the breakdown of glucose, leading to low levels of blood glucose. This increases food intake in order to restore blood glucose levels. The reduced food intake in 2-DG-treated rats with ZI lesions suggests that the ZI is necessary for food intake in response to low blood glucose.

    1. Whole numbersstart color greenD, W, h, o, l, e, space, n, u, m, b, e, r, s, end color greenD are numbers that do not need to be represented with a fraction or decimal. Also, whole numbers cannot be negative. In other words, whole numbers are the counting numbers and zero.

      what are not whole numbers need to be mentioned along with what are whole numbers

    1. L B J           little brown job

      LBJ something boring, or easily found, comforting, something youd say to someone thinking thats what they would want to hear. What theyd want you to be.

    2. (He thinks too much I always thought.) But really       at heart I’m more don’t laugh now      an L B J           little brown job

      again her use of pace, soacing and parenthesis makes the reader read how she is actually thinking it. the parenthesis highlight a private thought in her head. Its closed off. Her long pause or break after "but really" gives you her emotion same thing with her pause after "im more" she pauses agian this time in embarassment or bracing herself for telling something she thinks youll preceive as funny.

      The longest pause comes after L B J even then shes slowing down the letters as if shes spelling it out in conversation. she doesnt use L.BJ. OR LBJ its L B J but back to the long pause after "l b j " its the longest as if shes waiting for the reader to figure it out on their own, put it together. and when you dont she says it quickly.

    1. Then cease, my song, till fair Aurora rise. Share on Twitter Share on Facebook Print this page Email this page More About this Poem More Poems by Phillis Wheatley On Being Brought from Africa to America By Phillis Wheatley On Virtue By Phillis Wheatley To a Gentleman and Lady on the Death of the Lady's Brother and Sister, and a Child of the Name Avis, Aged One Year By Phillis Wheatley To the Right Honorable William, Earl of Dartmouth By Phillis Wheatley To S. M. A Young African Painter, On Seeing His Works By Phillis Wheatley See All Poems by this Author Poems Poems for Children Poems for Teens Poem Guides Audio Poems Poets Prose Harriet Blog Collections Listen Learn Children Teens Adults Educators Glossary of Poetic Terms Visit Events Exhibitions Library Poetry Magazine Current Issue Poetry Magazine Archive Subscriptions About the Magazine How to Submit Advertise with Us About Us Give Foundation Awards Media Partnerships Poetry Out Loud People Jobs .st0{fill:none;stroke:#ED1C24;stroke-width:3.64;stroke-miterlimit:10;} .st1{fill:#ED1C24;} .st2{fill:#FFFFFF;} Twitter Find us on Twitter Facebook Find us on Facebook Instagram Find us on Instagram Facebook Find us on Facebook Poetry Foundation Children Twitter Find us on Twitter Poetry Magazine Contact Us Newsletters Press Privacy Policy Policies Terms of Use Poetry Mobile App 61 West Superior Street, Chicago, IL 60654 Hours: Monday-Friday 11am - 4pm © 2019 Poetry Foundation See a problem on this page? More About This Poem A Hymn to the Evening By Phillis Wheatley About this Poet Although she was an African slave, Phillis Wheatley was one of the best-known poets in pre-19th century America. Educated and enslaved in the household of prominent Boston commercialist John Wheatley, lionized in New England and England, with presses in both places publishing her poems, and... Read Full Biography (function(){var b=document.getElementsByTagName("script")[0],c=window.location.href,a=document.createElement("script");a.type="text/javascript";a.async=!0;a.src="//s3-us-west-2.amazonaws.com/philantro/pdf/philantro.js";window.options={EIN:"362490808",Referrer:c};b.parentNode.insertBefore(a,b)})();(function(){var a=document.createElement("script");a.type="text/javascript";a.async=!0;a.src="//siteimproveanalytics.com/js/siteanalyze_6135381.js";var b=document.getElementsByTagName("script")[0];b.parentNode.insertBefore(a,b)})(); window.GLOBAL = { VERSION: '1.2.4', ENDPOINTS: { FILTERS: { POEM: 'https://www.poetryfoundation.org/ajax/poems', POET: 'https://www.poetryfoundation.org/ajax/poets' }, SEARCH: 'https://www.poetryfoundation.org/ajax/search/autocomplete' }, API_KEY: { FB: '112997417630' } }; (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','https://www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-4659065-1', 'auto'); ga('set', 'anonymizeIp', true); ga('send', 'pageview');

      I agree with Brandi's comment in the relation to sleep beauty, and I believe signifies the importance of having a new fresh day to start over. This line is a symbol for hope.

  11. Aug 2019
    1. dizziness function draw1() { var canvas=document.getElementById("pdf"); var pdf=canvas.getContext("2d"); pdf.fillStyle="rgb(0, 0, 0)"; setFontSize('t1_1','14','207'); setFontSize('t2_1','14','706'); setFontSize('t4_1','14','25'); setFontSize('t5_1','14','744'); setFontSize('t6_1','14','750'); setFontSize('t7_1','14','723'); setFontSize('t8_1','14','548'); setFontSize('t10_1','14','191'); setFontSize('t11_1','14','727'); setFontSize('t12_1','14','356'); setFontSize('t14_1','14','369'); setFontSize('t15_1','14','732'); setFontSize('t16_1','14','77'); setFontSize('t18_1','14','385'); setFontSize('t20_1','14','259'); setFontSize('t21_1','14','730'); setFontSize('t23_1','14','117'); setFontSize('t24_1','14','582'); setFontSize('t25_1','8','14'); setFontSize('t26_1','14','110'); setFontSize('t29_1','14','329'); setFontSize('t30_1','14','620'); setFontSize('t31_1','8','14'); setFontSize('t32_1','14','86'); setFontSize('t33_1','14','747'); setFontSize('t35_1','8','14'); setFontSize('t36_1','14','439'); setFontSize('t38_1','14','203'); setFontSize('t41_1','14','444'); setFontSize('t42_1','14','99'); setFontSize('t44_1','14','643'); setFontSize('t45_1','14','265'); setFontSize('t46_1','8','32'); setFontSize('t47_1','14','384'); setFontSize('t48_1','8','9'); setFontSize('t49_1','14','32'); setFontSize('t50_1','14','300'); setFontSize('t51_1','8','18'); setFontSize('t52_1','14','60'); setFontSize('t53_1','14','741'); setFontSize('t54_1','14','150'); setFontSize('t55_1','8','37'); setFontSize('t56_1','14','564'); setFontSize('t57_1','14','183'); setFontSize('t58_1','8','9'); setFontSize('t59_1','14','432'); setFontSize('t60_1','8','9'); setFontSize('t61_1','14','91'); setFontSize('t62_1','14','733'); setFontSize('t63_1','14','87'); setFontSize('t64_1','8','23'); setFontSize('t65_1','14','636'); setFontSize('t66_1','14','58'); setFontSize('t67_1','8','9'); setFontSize('t68_1','14','642'); setFontSize('t69_1','14','226'); setFontSize('t70_1','8','9'); setFontSize('t71_1','14','493'); setFontSize('t72_1','14','295'); setFontSize('t73_1','8','9'); setFontSize('t74_1','14','433'); setFontSize('t75_1','14','740'); setFontSize('t76_1','8','7'); setFontSize('t77_1','8','9'); setFontSize('t78_1','14','717'); setFontSize('t79_1','14','127'); setFontSize('t80_1','8','9'); setFontSize('t81_1','14','607'); setFontSize('t82_1','14','753'); setFontSize('t83_1','14','367'); setFontSize('t85_1','14','301'); setFontSize('t86_1','14','678'); setFontSize('t87_1','8','23'); setFontSize('t88_1','14','721'); setFontSize('t89_1','14','138'); setFontSize('t90_1','8','9'); setFontSize('t91_1','14','543'); setFontSize('t92_1','14','49'); setFontSize('t93_1','8','9'); setFontSize('t94_1','14','509'); setFontSize('t95_1','8','9'); setFontSize('t96_1','14','138'); setFontSize('t97_1','14','706'); setFontSize('t98_1','14','455'); setFontSize('t99_1','8','9'); setFontSize('t100_1','14','279'); setFontSize('t101_1','14','739'); setFontSize('t102_1','14','144'); setFontSize('t103_1','8','9'); setFontSize('t104_1','14','148'); setFontSize('t105_1','14','737'); setFontSize('t106_1','14','253'); setFontSize('t107_1','8','23'); setFontSize('t108_1','14','445'); setFontSize('t109_1','14','264'); setFontSize('t110_1','8','18'); setFontSize('t111_1','14','462'); setFontSize('t112_1','14','290'); setFontSize('t114_1','14','407'); setFontSize('t115_1','14','133'); setFontSize('t117_1','14','575'); setFontSize('t118_1','14','189'); setFontSize('t119_1','8','32'); setFontSize('t120_1','14','505'); setFontSize('t121_1','14','66'); setFontSize('t122_1','8','9'); setFontSize('t123_1','14','292'); setFontSize('t125_1','14','332'); setFontSize('t126_1','14','168'); setFontSize('t127_1','8','18'); setFontSize('t128_1','14','165'); } #t1_2 { left:51px; top:1208.7999811172485px; FONT-SIZE: 16px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t2_2 { left:51px; top:1242.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t3_2 { left:134px; top:1242.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(51,51,51); } #t4_2 { left:51px; top:1258.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t5_2 { left:51px; top:1273.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t6_2 { left:51px; top:1288.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t7_2 { left:134px; top:1288.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t8_2 { left:51px; top:1304.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t9_2 { left:51px; top:1319.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(128,0,128); } #t10_2 { left:51px; top:1351.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t11_2 { left:134px; top:1351.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t12_2 { left:51px; top:1366.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t13_2 { left:51px; top:1382.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t14_2 { left:51px; top:1414.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t15_2 { left:134px; top:1414.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t16_2 { left:51px; top:1429.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t17_2 { left:51px; top:1444.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t18_2 { left:51px; top:1460.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t19_2 { left:51px; top:1491.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t20_2 { left:134px; top:1491.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t21_2 { left:51px; top:1507.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t22_2 { left:51px; top:1522.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t23_2 { left:51px; top:1538.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t24_2 { left:134px; top:1538.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t25_2 { left:51px; top:1553.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t26_2 { left:51px; top:1568.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(128,0,128); } #t27_2 { left:51px; top:1600.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t28_2 { left:134px; top:1600.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t29_2 { left:51px; top:1615.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t30_2 { left:51px; top:1631.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t31_2 { left:134px; top:1631.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t32_2 { left:51px; top:1646.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t33_2 { left:51px; top:1661.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t34_2 { left:51px; top:1677.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t35_2 { left:134px; top:1677.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t36_2 { left:51px; top:1692.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t37_2 { left:51px; top:1707.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t38_2 { left:51px; top:1722.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t39_2 { left:51px; top:1738.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t40_2 { left:51px; top:1753.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t41_2 { left:141px; top:1753.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t42_2 { left:51px; top:1768.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t43_2 { left:51px; top:1784.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t44_2 { left:304px; top:1784.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(128,0,128); } #t45_2 { left:636px; top:1784.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t46_2 { left:51px; top:1799.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t47_2 { left:141px; top:1799.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t48_2 { left:51px; top:1814.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t49_2 { left:51px; top:1829.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t50_2 { left:141px; top:1829.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t51_2 { left:51px; top:1845.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t52_2 { left:51px; top:1860.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t53_2 { left:51px; top:1876.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t54_2 { left:51px; top:1891.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t55_2 { left:51px; top:1906.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t56_2 { left:141px; top:1906.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t57_2 { left:51px; top:1921.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t58_2 { left:51px; top:1937.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t59_2 { left:51px; top:1952.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t60_2 { left:51px; top:1984.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t61_2 { left:141px; top:1984.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t62_2 { left:51px; top:1999.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t63_2 { left:51px; top:2015.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t64_2 { left:51px; top:2047.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t65_2 { left:141px; top:2047.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t66_2 { left:51px; top:2062.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t67_2 { left:51px; top:2077.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t68_2 { left:51px; top:2093.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t69_2 { left:141px; top:2093.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t70_2 { left:51px; top:2108.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t71_2 { left:51px; top:2123.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t72_2 { left:51px; top:2155.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t73_2 { left:141px; top:2155.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t74_2 { left:51px; top:2171.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t75_2 { left:51px; top:2186.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } .text { position:absolute; white-space:nowrap; overflow:visible; } @font-face { font-family: TimesNewRomanPSMT; src: url("2/fonts/TimesNewRomanPSMT.otf"); } References Reference 1: DiPiro JT, Talbert RL, Yee GC. Pharmacotherapy: a pathophysiologic approach [Internet]. New York: McGraw-Hill Education; 2017 [cited 2019Aug16]. Available from: https://accesspharmacy.mhmedical.com/content.aspx?bookid=1861§ionid=146028752 Reference 2: Lowenfels AB, Maisonneuve P, Sullivan T. The Changing Character of Acute Pancreatitis: Epidemiology, Etiology, and Prognosis. Current Gastroenterology Reports [Internet]. 2009 Apr;11:97-103. Accessed: August 16, 2019. Available from: https://www.ncbi.nlm.nih.gov/pubmed/19281696 Reference 3: Versleijen MW, Naber AH, Riksen NP, et al. Recurrent Pancreatitis After Trimethoprim-Sulfamethoxazole Rechallenge. The Netherlands Journal of Medicine [Internet]. 2005 Jul-Aug;63:275-7. Accessed: August 16, 2019. Available from: https://www.ncbi.nlm.nih.gov/pubmed/16093580 Primary Literature. Reference 4: Kahl S, Schütte K, Glasbrenner B, et al. The Effect of Oral Pancreatic Enzyme Supplementation on the Course and Outcome of Acute Pancreatitis: A Randomized, Double-Blind Parallel-Group Study. JOP. Journal of the Pancreas [Internet]. 2014;Vol 15:No 2 (2014): March-84. Accessed: August 16, 2019. Available from: http://www.serena.unina.it/index.php/jop/article/view/797 Primary Literature. Reference 5: Acetaminophen [Internet]. IBM Micromedex. 2019 [cited 2019Aug16]. Available from: https://www.micromedexsolutions.com/micromedex2/librarian/PFDefaultActionId/evidencexpert.DoIntegratedSearch?navitem=h eaderLogout#close Reference 6: Nasr JY, Papachristou GI. Early Fluid Resuscitation in Acute Pancreatitis: A Lot More Than Just Fluids. Clinical Gastroenterology and Hepatology [Internet]. 2011;9:633�??634. Accessed: August 16, 2019. Available from: http://dx.doi.org/10.1016/j.cgh.2011.03.010 Reference 7: Creatinine test [Internet]. Mayo Clinic. Mayo Foundation for Medical Education and Research; 2018 [cited 2019Aug16]. Available from: https://www.mayoclinic.org/tests-procedures/creatinine-test/about/pac-20384646 Reference 8: Intravenous Fluid Resuscitation - Critical Care Medicine [Internet]. Merck Manuals Professional Edition. Merck Manuals; [cited 2019Aug16]. Available from: https://www.merckmanuals.com/professional/critical-care-medicine/shock-and-fluid- resuscitation/intravenous-fluid-resuscitation Reference 9: Meropenem [Internet]. IBM Micromedex. 2019 [cited 2019Aug16]. Available from: https://www.micromedexsolutions.com/micromedex2/librarian/CS/0C9B5D/ND_PR/evidencexpert/ND_P/evidencexpert/DUPLIC ATIONSHIELDSYNC/C6E14F/ND_PG/evidencexpert/ND_B/evidencexpert/ND_AppProduct/evidencexpert/ND_T/evidencexpert/ PFActionId/evidencexpert.DoIntegratedSearch?SearchTerm=meropenem&UserSearchTerm=meropenem&SearchFilter=filterNo ne&navitem=searchGlobal# Reference 10: Sachdeva A, Chandra M, Deshpande SN. A Comparative Study of Fixed Tapering Dose Regimen versus Symptom-triggered Regimen of Lorazepam for Alcohol Detoxification. Alcohol and Alcoholism [Internet]. 2014Jan8 [cited 2019Aug17];49(3):287�??91. Available from: https://academic.oup.com/alcalc/article/49/3/287/209897 . Primary Literature. Reference 11: Bayard M, McIntyre J, Hill K, Woodside J. Alcohol Withdrawal Syndrome [Internet]. American Family Physician. 2004 [cited 2019Aug17]. Available from: https://www.aafp.org/afp/2004/0315/p1443.html Reference 12: Lorazepam [Internet]. IBM Micromedex. 2019 [cited 2019Aug17]. Available from: https://www.micromedexsolutions.com/micromedex2/librarian/CS/13879F/ND_PR/evidencexpert/ND_P/evidencexpert/DUPLICA TIONSHIELDSYNC/C59B16/ND_PG/evidencexpert/ND_B/evidencexpert/ND_AppProduct/evidencexpert/ND_T/evidencexpert/P FActionId/evidencexpert.DoIntegratedSearch?SearchTerm=lorazepam&UserSearchTerm=lorazepam&SearchFilter=filterNone& navitem=searchGlobal# Reference 13: Lactated Ringers (Sodium Chloride, Potassium Chloride, Sodium Lactate and Calcium Chloride) Injection, Solution [Baxter Healthcare Corporation]. [rev. Jan 22, 2018]. Accessed: August 17, 2019. In: DailyMed [Internet]. [2005] - . Bethesda (MD): National Library of Medicine (US). Available from: https://dailymed.nlm.nih.gov/dailymed/drugInfo.cfm?setid=dad7735c-709b-40ea-ab7a-15577e24a966 Reference 14: Wu BU, Hwang JQ, Gardner TH, et al. Lactated Ringer�??s Solution Reduces Systemic Inflammation Compared With Saline in Patients With Acute Pancreatitis. Clinical Gastroenterology and Hepatology [Internet]. 2011;9:710�??717.e1. Accessed: August 17, 2019. Available from: http://dx.doi.org/10.1016/j.cgh.2011.04.026 Primary Literature. Reference 15: Tenner S, Baillie J, Dewitt J, Vege SS. American College of Gastroenterology Guideline: Management of Acute Pancreatitis. American Journal of Gastroenterology [Internet]. 2013 [cited 2019Aug17];108(9):1400�??15. Available from: https://journals.lww.com/ajg/Fulltext/2013/09000/American_College_of_Gastroenterology_Guideline_.6.aspx#R133-6 Reference 16: Wu BU, Hwang JQ, Gardner TH, et al. Lactated Ringer�??s Solution Reduces Systemic Inflammation Compared With Saline in Patients With Acute Pancreatitis. Clinical Gastroenterology and Hepatology [Internet]. 2011;9:710�??717.e1. Accessed: August 17, 2019. Available from: http://dx.doi.org/10.1016/j.cgh.2011.04.026 Primary Literature. Reference 17: Perel P, Roberts I. Colloids versus crystalloids for fluid resuscitation in critically ill patients - Perel, P - 2012: Cochrane Library [Internet]. Cochrane Database of Systematic Reviews. John Wiley & Sons, Ltd; 2012 [cited 2019Aug17]. Available from: https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD000567.pub5/abstract function draw2() { var canvas=document.getElementById("pdf"); var pdf=canvas.getContext("2d"); pdf.fillStyle="rgb(0, 0, 0)"; setFontSize('t1_2','16','90'); pdf.beginPath(); pdf.moveTo(134,1243); pdf.lineTo(803,1243); pdf.lineTo(803,1259); pdf.lineTo(134,1259); pdf.closePath(); pdf.fillStyle = 'rgb(255,255,255)'; pdf.fill(); setFontSize('t2_2','14','80'); setFontSize('t3_2','14','669'); pdf.beginPath(); pdf.moveTo(51,1259); pdf.lineTo(353,1259); pdf.lineTo(353,1274); pdf.lineTo(51,1274); pdf.closePath(); pdf.fillStyle = 'rgb(255,254,255)'; pdf.fill(); setFontSize('t4_2','14','302'); pdf.beginPath(); pdf.moveTo(51,1274); pdf.lineTo(560,1274); pdf.lineTo(560,1289); pdf.lineTo(51,1289); pdf.closePath(); pdf.fill(); setFontSize('t5_2','14','509'); setFontSize('t6_2','14','80'); setFontSize('t7_2','14','670'); setFontSize('t8_2','14','738'); setFontSize('t9_2','14','283'); pdf.beginPath(); pdf.moveTo(51,1334); pdf.lineTo(334,1334); pdf.lineTo(334,1335); pdf.lineTo(51,1335); pdf.closePath(); pdf.fillStyle = 'rgb(128,0,128)'; pdf.fill(); setFontSize('t10_2','14','80'); setFontSize('t11_2','14','617'); setFontSize('t12_2','14','727'); setFontSize('t13_2','14','434'); setFontSize('t14_2','14','80'); setFontSize('t15_2','14','650'); setFontSize('t16_2','14','752'); setFontSize('t17_2','14','473'); setFontSize('t18_2','14','447'); pdf.beginPath(); pdf.moveTo(134,1492); pdf.lineTo(633,1492); pdf.lineTo(633,1508); pdf.lineTo(134,1508); pdf.closePath(); pdf.fillStyle = 'rgb(255,254,255)'; pdf.fill(); setFontSize('t19_2','14','80'); setFontSize('t20_2','14','499'); pdf.beginPath(); pdf.moveTo(51,1508); pdf.lineTo(801,1508); pdf.lineTo(801,1523); pdf.lineTo(51,1523); pdf.closePath(); pdf.fill(); setFontSize('t21_2','14','750'); pdf.beginPath(); pdf.moveTo(51,1523); pdf.lineTo(164,1523); pdf.lineTo(164,1538); pdf.lineTo(51,1538); pdf.closePath(); pdf.fill(); setFontSize('t22_2','14','113'); setFontSize('t23_2','14','80'); setFontSize('t24_2','14','652'); setFontSize('t25_2','14','623'); setFontSize('t26_2','14','253'); pdf.beginPath(); pdf.moveTo(51,1583); pdf.lineTo(304,1583); pdf.lineTo(304,1584); pdf.lineTo(51,1584); pdf.closePath(); pdf.fillStyle = 'rgb(128,0,128)'; pdf.fill(); pdf.beginPath(); pdf.moveTo(134,1601); pdf.lineTo(753,1601); pdf.lineTo(753,1616); pdf.lineTo(134,1616); pdf.closePath(); pdf.fillStyle = 'rgb(255,254,255)'; pdf.fill(); setFontSize('t27_2','14','80'); setFontSize('t28_2','14','619'); pdf.beginPath(); pdf.moveTo(51,1616); pdf.lineTo(694,1616); pdf.lineTo(694,1632); pdf.lineTo(51,1632); pdf.closePath(); pdf.fill(); setFontSize('t29_2','14','644'); pdf.beginPath(); pdf.moveTo(134,1632); pdf.lineTo(780,1632); pdf.lineTo(780,1647); pdf.lineTo(134,1647); pdf.closePath(); pdf.fill(); setFontSize('t30_2','14','80'); setFontSize('t31_2','14','646'); pdf.beginPath(); pdf.moveTo(51,1647); pdf.lineTo(805,1647); pdf.lineTo(805,1662); pdf.lineTo(51,1662); pdf.closePath(); pdf.fill(); setFontSize('t32_2','14','754'); pdf.beginPath(); pdf.moveTo(51,1662); pdf.lineTo(306,1662); pdf.lineTo(306,1677); pdf.lineTo(51,1677); pdf.closePath(); pdf.fill(); setFontSize('t33_2','14','255'); pdf.beginPath(); pdf.moveTo(134,1677); pdf.lineTo(612,1677); pdf.lineTo(612,1693); pdf.lineTo(134,1693); pdf.closePath(); pdf.fill(); setFontSize('t34_2','14','80'); setFontSize('t35_2','14','477'); pdf.beginPath(); pdf.moveTo(51,1693); pdf.lineTo(801,1693); pdf.lineTo(801,1708); pdf.lineTo(51,1708); pdf.closePath(); pdf.fill(); setFontSize('t36_2','14','750'); pdf.beginPath(); pdf.moveTo(51,1708); pdf.lineTo(805,1708); pdf.lineTo(805,1723); pdf.lineTo(51,1723); pdf.closePath(); pdf.fill(); setFontSize('t37_2','14','754'); pdf.beginPath(); pdf.moveTo(51,1723); pdf.lineTo(804,1723); pdf.lineTo(804,1738); pdf.lineTo(51,1738); pdf.closePath(); pdf.fill(); setFontSize('t38_2','14','753'); pdf.beginPath(); pdf.moveTo(51,1738); pdf.lineTo(214,1738); pdf.lineTo(214,1754); pdf.lineTo(51,1754); pdf.closePath(); pdf.fill(); setFontSize('t39_2','14','164'); pdf.beginPath(); pdf.moveTo(142,1754); pdf.lineTo(759,1754); pdf.lineTo(759,1769); pdf.lineTo(142,1769); pdf.closePath(); pdf.fill(); setFontSize('t40_2','14','87'); setFontSize('t41_2','14','617'); pdf.beginPath(); pdf.moveTo(51,1769); pdf.lineTo(758,1769); pdf.lineTo(758,1784); pdf.lineTo(51,1784); pdf.closePath(); pdf.fill(); setFontSize('t42_2','14','708'); pdf.beginPath(); pdf.moveTo(51,1784); pdf.lineTo(753,1784); pdf.lineTo(753,1800); pdf.lineTo(51,1800); pdf.closePath(); pdf.fill(); setFontSize('t43_2','14','250'); setFontSize('t44_2','14','332'); setFontSize('t45_2','14','117'); pdf.beginPath(); pdf.moveTo(304,1799); pdf.lineTo(636,1799); pdf.lineTo(636,1800); pdf.lineTo(304,1800); pdf.closePath(); pdf.fillStyle = 'rgb(128,0,128)'; pdf.fill(); pdf.beginPath(); pdf.moveTo(142,1800); pdf.lineTo(794,1800); pdf.lineTo(794,1815); pdf.lineTo(142,1815); pdf.closePath(); pdf.fillStyle = 'rgb(255,254,255)'; pdf.fill(); setFontSize('t46_2','14','87'); setFontSize('t47_2','14','652'); pdf.beginPath(); pdf.moveTo(51,1815); pdf.lineTo(570,1815); pdf.lineTo(570,1830); pdf.lineTo(51,1830); pdf.closePath(); pdf.fill(); setFontSize('t48_2','14','518'); pdf.beginPath(); pdf.moveTo(142,1830); pdf.lineTo(615,1830); pdf.lineTo(615,1846); pdf.lineTo(142,1846); pdf.closePath(); pdf.fill(); setFontSize('t49_2','14','87'); setFontSize('t50_2','14','473'); pdf.beginPath(); pdf.moveTo(51,1846); pdf.lineTo(805,1846); pdf.lineTo(805,1861); pdf.lineTo(51,1861); pdf.closePath(); pdf.fill(); setFontSize('t51_2','14','754'); pdf.beginPath(); pdf.moveTo(51,1861); pdf.lineTo(805,1861); pdf.lineTo(805,1876); pdf.lineTo(51,1876); pdf.closePath(); pdf.fill(); setFontSize('t52_2','14','754'); pdf.beginPath(); pdf.moveTo(51,1876); pdf.lineTo(801,1876); pdf.lineTo(801,1892); pdf.lineTo(51,1892); pdf.closePath(); pdf.fill(); setFontSize('t53_2','14','750'); pdf.beginPath(); pdf.moveTo(51,1892); pdf.lineTo(191,1892); pdf.lineTo(191,1907); pdf.lineTo(51,1907); pdf.closePath(); pdf.fill(); setFontSize('t54_2','14','140'); setFontSize('t55_2','14','87'); setFontSize('t56_2','14','621'); setFontSize('t57_2','14','730'); setFontSize('t59_2','14','596'); pdf.beginPath(); pdf.moveTo(51,1967); pdf.lineTo(647,1967); pdf.lineTo(647,1968); pdf.lineTo(51,1968); pdf.closePath(); pdf.strokeStyle = 'rgb(0,0,255)'; pdf.stroke(); setFontSize('t60_2','14','87'); setFontSize('t61_2','14','644'); setFontSize('t62_2','14','709'); setFontSize('t63_2','14','630'); pdf.beginPath(); pdf.moveTo(142,2048); pdf.lineTo(794,2048); pdf.lineTo(794,2063); pdf.lineTo(142,2063); pdf.closePath(); pdf.fill(); setFontSize('t64_2','14','87'); setFontSize('t65_2','14','652'); pdf.beginPath(); pdf.moveTo(51,2063); pdf.lineTo(748,2063); pdf.lineTo(748,2078); pdf.lineTo(51,2078); pdf.closePath(); pdf.fill(); setFontSize('t66_2','14','698'); pdf.beginPath(); pdf.moveTo(51,2078); pdf.lineTo(739,2078); pdf.lineTo(739,2093); pdf.lineTo(51,2093); pdf.closePath(); pdf.fill(); setFontSize('t67_2','14','688'); setFontSize('t68_2','14','87'); setFontSize('t69_2','14','644'); setFontSize('t70_2','14','709'); setFontSize('t71_2','14','630'); pdf.beginPath(); pdf.moveTo(142,2156); pdf.lineTo(771,2156); pdf.lineTo(771,2171); pdf.lineTo(142,2171); pdf.closePath(); pdf.fill(); setFontSize('t72_2','14','87'); setFontSize('t73_2','14','629'); pdf.beginPath(); pdf.moveTo(51,2171); pdf.lineTo(768,2171); pdf.lineTo(768,2187); pdf.lineTo(51,2187); pdf.closePath(); pdf.fill(); setFontSize('t74_2','14','717'); pdf.beginPath(); pdf.moveTo(51,2187); pdf.lineTo(651,2187); pdf.lineTo(651,2202); pdf.lineTo(51,2202); pdf.closePath(); pdf.fill(); setFontSize('t75_2','14','600'); } #t1_3 { left:51px; top:2367.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t2_3 { left:141px; top:2367.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t3_3 { left:51px; top:2382.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t4_3 { left:312px; top:2382.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t5_3 { left:51px; top:2414.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t6_3 { left:141px; top:2414.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t7_3 { left:51px; top:2429.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t8_3 { left:51px; top:2445.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t9_3 { left:51px; top:2460.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t10_3 { left:51px; top:2492.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t11_3 { left:141px; top:2492.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t12_3 { left:51px; top:2507.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t13_3 { left:51px; top:2523.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t14_3 { left:312px; top:2523.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t15_3 { left:51px; top:2555.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t16_3 { left:141px; top:2555.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t17_3 { left:51px; top:2570.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t18_3 { left:51px; top:2586.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t19_3 { left:51px; top:2618.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t20_3 { left:141px; top:2618.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t21_3 { left:51px; top:2633.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t22_3 { left:201px; top:2633.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t23_3 { left:51px; top:2665.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t24_3 { left:141px; top:2665.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t25_3 { left:51px; top:2680.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t26_3 { left:51px; top:2695.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t27_3 { left:51px; top:2727.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t28_3 { left:141px; top:2727.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t29_3 { left:51px; top:2743.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t30_3 { left:51px; top:2758.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t31_3 { left:51px; top:2773.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t32_3 { left:51px; top:2805.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t33_3 { left:141px; top:2805.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t34_3 { left:51px; top:2821.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t35_3 { left:51px; top:2836.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t36_3 { left:51px; top:2868.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t37_3 { left:141px; top:2868.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(51,51,51); } #t38_3 { left:51px; top:2883.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t39_3 { left:51px; top:2899.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t40_3 { left:51px; top:2914.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t41_3 { left:51px; top:2929.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t42_3 { left:51px; top:2945.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t43_3 { left:141px; top:2945.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t44_3 { left:51px; top:2960.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t45_3 { left:51px; top:2975.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t46_3 { left:51px; top:2991.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t47_3 { left:51px; top:3006.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t48_3 { left:51px; top:3021.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t49_3 { left:141px; top:3021.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t50_3 { left:51px; top:3037.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t51_3 { left:51px; top:3052.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t52_3 { left:51px; top:3084.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t53_3 { left:141px; top:3084.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t54_3 { left:51px; top:3099.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t55_3 { left:51px; top:3114.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t56_3 { left:141px; top:3114.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t57_3 { left:51px; top:3130.599962234497px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(50,51,50); } #t58_3 { left:51px; top:3145.599962234497px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } .text { position:absolute; white-space:nowrap; overflow:visible; } Reference 18: Vincent JL. Fluid Resuscitation: Colloids vs Crystalloids. Acta Clinica Belgica [Internet]. 2007;62 Suppl 2:408-11. Accessed: August 17, 2019. Available from: https://www.ncbi.nlm.nih.gov/pubmed/18284011 Reference 19: Choosakul S, Harinwan K, Chirapongsathorn S, et al. Comparison of Normal Saline Versus Lactated Ringer�??s Solution for Fluid Resuscitation in Patients With Mild Acute Pancreatitis, a Randomized Controlled Trial. Pancreatology [Internet]. 2018;18:507�??512. Accessed: August 17, 2019. Available from: http://dx.doi.org/10.1016/j.pan.2018.04.016 Primary Literature. Reference 20: Zhanel GG, Simor AE, Vercaigne L, et al. Imipenem and Meropenem: Comparison of in Vitro Activity, Pharmacokinetics, Clinical Trials and Adverse Effects. Canadian Journal of Infectious Diseases [Internet]. 1998;9:215�??228. Accessed: August 17, 2019. Available from: http://dx.doi.org/10.1155/1998/831425 Reference 21: Sa�?lamkaya U, Mas MR, Ya�?ar M, et al. Penetration of Meropenem and Cefepim Into Pancreatic Tissue During the Course of Experimental Acute Pancreatitis. Pancreas [Internet]. 2002 Apr;24:264-8. Accessed: August 17, 2019. Available from: https://www.ncbi.nlm.nih.gov/pubmed/11893934 Primary Literature. Reference 22: Wiseman LR, Wagstaff AJ, Brogden RN, et al. Meropenem. Drugs [Internet]. 1995;50:73�??101. Accessed: August 17, 2019. Available from: http://dx.doi.org/10.2165/00003495-199550010-00007 Reference 23: Sachdeva A. Alcohol Withdrawal Syndrome: Benzodiazepines and Beyond. JOURNAL of CLINICAL and DIAGNOSTIC RESEARCH [Internet]. 2015; Accessed: August 17, 2019. Available from: http://dx.doi.org/10.7860/JCDR/2015/13407.6538 Reference 24: Mayo-Smith MF. Pharmacological Management of Alcohol Withdrawal. a Meta-Analysis and Evidence-Based Practice Guideline. American Society of Addiction Medicine Working Group on Pharmacological Management of Alcohol Withdrawal. JAMA: The Journal of the American Medical Association [Internet]. 1997;278:144�??151. Accessed: August 17, 2019. Available from: http://dx.doi.org/10.1001/jama.278.2.144 Primary Literature. Reference 25: Peppers MP. Benzodiazepines for Alcohol Withdrawal in the Elderly and in Patients With Liver Disease. Pharmacotherapy [Internet]. 1996 Jan-Feb;16:49-57. Accessed: August 17, 2019. Available from: https://www.ncbi.nlm.nih.gov/pubmed/8700792 Reference 26: American Gastroenterological Association medical position statement: Evaluation of liver chemistry tests, This document presents the official recommendations of the American Gastroenterological Association (AGA) on the Evaluation of Liver Chemistry Tests. It was approved by the Clinical Practice Committee on March 3, 2002 and by the AGA Governing Board on May 19, 2002. American Gastroenterological Association [Internet]. 2002 [cited 2019Aug17];123(4):1364�??6. Available from: https://www.gastrojournal.org/article/S0016-5085(02)00240-8/fulltext Reference 27: Oxazepam [Internet]. IBM Micromedex. 2019 [cited 2019Aug17]. Available from: https://www.micromedexsolutions.com/micromedex2/librarian/CS/91FE22/ND_PR/evidencexpert/ND_P/evidencexpert/DUPLICA TIONSHIELDSYNC/316563/ND_PG/evidencexpert/ND_B/evidencexpert/ND_AppProduct/evidencexpert/ND_T/evidencexpert/P FActionId/evidencexpert.DoIntegratedSearch?SearchTerm=oxazepam&UserSearchTerm=oxazepam&SearchFilter=filterNone&n avitem=searchALL# Reference 28: Mao EQ, Tang YQ, Fei J, et al. Fluid Therapy for Severe Acute Pancreatitis in Acute Response Stage. Chinese Medical Journal [Internet]. 2009 Jan 20;122:169-73. Accessed: August 17, 2019. Available from: https://www.ncbi.nlm.nih.gov/pubmed/19187641 Primary Literature. Reference 29: WBC Count [Internet]. UCSF Medical Center. [cited 2019Aug17]. Available from: https://www.ucsfhealth.org/tests/003643.html Reference 30: Body temperature norms: MedlinePlus Medical Encyclopedia [Internet]. MedlinePlus. U.S. National Library of Medicine; [cited 2019Aug17]. Available from: https://medlineplus.gov/ency/article/001982.htm Reference 31:

      Overall, good job. Just be sure to include specifics. Especially in Therapeutic section on what test to run and how frequently. Also what happens if drug is not working, what is you next line option?

    1. Fluzone High-Dose vaccine (a single 0.5 mL prefilled syringe via IM) should be given this year. function draw1() { var canvas=document.getElementById("pdf"); var pdf=canvas.getContext("2d"); pdf.fillStyle="rgb(0, 0, 0)"; setFontSize('t1_1','14','207'); setFontSize('t2_1','14','731'); setFontSize('t3_1','14','721'); setFontSize('t4_1','14','744'); setFontSize('t5_1','14','754'); setFontSize('t6_1','14','729'); setFontSize('t7_1','14','717'); setFontSize('t8_1','14','716'); setFontSize('t9_1','14','703'); setFontSize('t10_1','14','725'); setFontSize('t11_1','14','743'); setFontSize('t12_1','14','745'); setFontSize('t13_1','14','756'); setFontSize('t14_1','14','717'); setFontSize('t15_1','14','525'); setFontSize('t16_1','14','117'); setFontSize('t17_1','14','725'); setFontSize('t19_1','14','168'); setFontSize('t20_1','14','60'); setFontSize('t21_1','14','717'); setFontSize('t22_1','14','723'); setFontSize('t23_1','14','729'); setFontSize('t24_1','14','708'); setFontSize('t25_1','14','607'); setFontSize('t26_1','14','148'); setFontSize('t27_1','14','688'); setFontSize('t28_1','14','733'); setFontSize('t29_1','14','748'); setFontSize('t30_1','14','416'); setFontSize('t31_1','14','165'); setFontSize('t32_1','14','754'); setFontSize('t33_1','14','701'); setFontSize('t34_1','14','753'); setFontSize('t35_1','14','745'); setFontSize('t36_1','14','79'); setFontSize('t37_1','14','120'); setFontSize('t38_1','14','751'); setFontSize('t39_1','14','736'); setFontSize('t40_1','14','721'); setFontSize('t41_1','14','734'); setFontSize('t42_1','14','747'); setFontSize('t43_1','14','710'); setFontSize('t44_1','14','721'); setFontSize('t45_1','14','746'); setFontSize('t46_1','14','478'); setFontSize('t47_1','14','157'); setFontSize('t48_1','14','740'); setFontSize('t49_1','14','741'); setFontSize('t50_1','14','733'); setFontSize('t51_1','14','712'); setFontSize('t52_1','14','715'); setFontSize('t53_1','14','420'); setFontSize('t54_1','14','746'); setFontSize('t55_1','14','754'); setFontSize('t56_1','14','150'); } #t1_2 { left:50px; top:1207.7999811172485px; FONT-SIZE: 16px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t2_2 { left:50px; top:1242.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t3_2 { left:125px; top:1242.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t4_2 { left:141px; top:1242.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t5_2 { left:50px; top:1272.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t6_2 { left:137px; top:1272.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t7_2 { left:50px; top:1288.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t8_2 { left:50px; top:1318.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t9_2 { left:137px; top:1318.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t10_2 { left:50px; top:1334.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t11_2 { left:50px; top:1349.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t12_2 { left:142px; top:1349.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t13_2 { left:50px; top:1379.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t14_2 { left:125px; top:1379.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t15_2 { left:50px; top:1395.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t16_2 { left:50px; top:1410.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t17_2 { left:50px; top:1441.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t18_2 { left:134px; top:1441.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t19_2 { left:396px; top:1441.7999811172485px; FONT-SIZE: 14px; FONT-STYLE: italic; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t20_2 { left:716px; top:1441.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t21_2 { left:50px; top:1456.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t22_2 { left:50px; top:1471.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t23_2 { left:578px; top:1471.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t24_2 { left:50px; top:1502.7999811172485px; FONT-SIZE: 14px; FONT-WEIGHT: bold; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t25_2 { left:134px; top:1502.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t26_2 { left:50px; top:1517.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } #t27_2 { left:231px; top:1517.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,255); } #t28_2 { left:504px; top:1517.7999811172485px; FONT-SIZE: 14px; FONT-FAMILY: Arial, Helvetica, sans-serif; color:rgb(0,0,0); } .text { position:absolute; white-space:nowrap; overflow:visible; } References Reference 1 : Aricept [package insert]. Woodcliff Lake NJ: Eisai Inc; 2012 Reference 2: Centers for Disease Control and Prevention. Influenza vaccines �?? United States, 2018-2019 influenza season [updated: 2018 Oct] Reference 3: O�??Brien JT, Holmes C, Jones M, et al. Clinical Practice With Anti-Dementia Drugs: A Revised (Third) Consensus Statement From the British Association for Psychopharmacology. Journal of Psychopharmacology [Internet]. 2017;31:147�??168. Available from: http://dx.doi.org/10.1177/0269881116680924 Reference 4 : P. Cardinali D, M. Furio A, I. Brusco L. Clinical Aspects of Melatonin Intervention in Alzheimers Disease Progression. Current Neuropharmacology [Internet]. 2010;8:218�??227. Available from: http://dx.doi.org/10.2174/157015910792246209 Reference 5: Peron, Emily P., et al.. "Alzheimer Disease." Pharmacotherapy: A Pathophysiologic Approach, 10e Eds. Joseph T. DiPiro, et al. New York, NY: McGraw-Hill. Available from: http://accesspharmacy.mhmedical.com/content.aspx?bookid=1861§ionid=146062470 . Reference 6: Seltzer B. Efficacy of Donepezil in Early-Stage Alzheimer Disease. Archives of Neurology [Internet]. 2004;61:1852. Available from: http://dx.doi.org/10.1001/archneur.61.12.1852 Primary Literature.

      Any other vaccinations?

  12. Jul 2019
    1. Our spiritual forefathers where the anabaptists of western Europe. Over 400 years ago they felt compelled to take a stand against the taking of human life in any form and to many of them it was contrary to their understanding of the teaching of scripture. For their beliefs and practice they suffered cruelly; many died. When our forefathers came to Canada around 200 years ago they appealed for and were promised exemption from military duty. The history of these negotiations which are very much abbreviated are contained in paragraphs on pages 3 and 4 of the brief which you have had in your hands. In World War I, the severe test of these provisions came. In the spring of I918 the German forces made one last gigantic assault on the Western Front and for a while it looked as if the Allied front would break. It was under the stress and desperation of that time that exemptions which had been written through Order in Council by government were cancelled and the young men of our churches had their faith and their convictions severely tested; many served periods in jail. I had hoped to bring along today a very close friend of mine who was my bishop for many years. Mr. B. J. Swalm who is 84 years of age. but he had other commitments and was not able to come. He could articulate his experiences during this war. One thing I remember, while he served as my bishop in the Niagara Area was that when he was visiting our area he would ask me to drive past St. Catharines Jail where he spent several months during World War I. Bishop Swalm was one of the founders of this organization, the Mennonite Central Committee. The experience in World War II was different and here I can speak from personal experience. because I was of draft age at that time and young men of my age were being called into service. My spiritual training and upbringing, church teachings, taught me participation in war was wrong but I had to make a decision at that time that I had to know what I believed personally and I had to make a personal decision. I went through weeks of study and soul-searching which reinforced my teaching and brought me to the decision that I could not take a human life. or be part of a life-taking organization. Now, in the Second World War, because of early representation to government by the leaders of our churches, an alternative service program was developed whereby our young [Page 47] men could serve in non-military forms of service such as reforestation, road-building, fire-fighting, agricultural work and some in ambulance and hospital work on the front lines. As l came through those years and in perspective I have two strong feelings. First of all I have a deep respect for the boys, for the integrity of the boys who were my friends and are still my friends. who did not feel as I and went into military service. and we today wish to acknowledge our deep respect for those who disagree with us in this area. The second was a great appreciation which I also hold today for a country where conscience is recognized and where opportunity was given for alternative forms of service of national value, and service that was helpful to society. I an thankful for a country where the right to be different is recognized: where a minority view does not endanger or dehumanize. So it is for this reason that we feel now in the formulation of a constitution in peaceful times apart from emotional pressures of a wartime society, that we include a clause in the constitution that would recognize the right of conscience that would lead one to abstain from the taking of human life. We are making this presentation today from our own experience and perspective as stated in the brief. which is prepared by Mr. Janzen and which I have briefly summarized. We believe in light of past experience and differences of interpretation and application of past government decisions that a clear and brief. concise statement in the constitution would be helpful and we urge the inclusion of such in the Canadian Charter of Rights and Freedoms. I might just call your attention to the statement that is written in the constitution of the Federal Republic of Germany; “No one may be compelled against his conscience to render war service involving the use of arms.”

      §[2] (https://primarydocuments.ca/canada-act-1982/#Fundamental) (2(a)more specifically) of the Charter of Rights and Freedoms. Referenced in Adam Dodek, The Charter Debates (Toronto: University of Toronto Press, 2018), pp. 121-122.

    1. in places where livestock do not grow well, then the grass does not grow even where no livestock are put on the land,” a proposition contradicted by our vegetation study (Harris et al. 2016).However, these assessments are tempered and somewhat contradicted by other statements, sometimes by the same herders, that do suggest the importance of livestock density, usually couched in terms of a problem of trampling rather than grazing per se.

      <br>

      Analytical note: After analyzing our initial data, we were particularly interested in further probing herders’ views of the determinants of grassland productivity. Author Volkmar conducted follow-up interviews in Gouli in 2014. Here are some additional responses to the question, “if you were to herd more than the number of livestock you have indicated as the maximum number you would want to graze, what if anything would be the effect in that year and in subsequent years?”

      Corresponding Source: Harris R. B., Samberg L. H., Yeh E. T., Smith A. T., Wang W., Wang J., Gaerrang, and Bedunah D. (2016). Rangeland responses to pastoralists’ grazing management on a Tibetan steppe grassland, Qinghai Province, China, The Rangeland Journal. 38(1): 1-15. doi: 10.1071/RJ150410.

      Source excerpt translations:

      Pastoralist B: “If you herded more what the land could sustain, it could affect the land to some extent; but it will not be as serious as the damage caused by pikas.”

      Pastoralist DK: “If I herded 800 sheep, then half if not more that would die at the end of winter and the land (soil) would be die if this happened several years in a row. If I herded 200 yaks in my winter pasture, but herded them in the summer pasture for about 3 months, the pasture should be fine. …I personally think that it is not good to herd too many livestock on one’s pasture. We should herd what the land could sustain.”

      Pastoralist N: “It is said that if you herded more than what the land could sustain, the herd would kill the pasture by tramping, which should affect the grass growth in the next year. “

      Pastoralist GK: “[my] pasture can sustain 400 sheep. That is without yaks, and 400 sheep do not harm the pasture and they do not die. There is no difference between herding 500 sheep and 700 sheep in terms of grassland condition. If you herd more than 400 sheep, the additional number of sheep would die. In my pasture, every year, herds graze until there is no grass left, but the grass is same every year. 400 sheep could graze for six months and 700 sheep could finish the grass within about three months. When there is no grass left, there are no herds to graze. Generally speaking, in some parts of pasture, the grass grows better than other places. If it is place where grass grows well, then regardless of number of livestock, grass grows every year; if it is a place where grass does not grow well in most years, the grass does not grow very much even no livestock is herded.”

      Pastoralist K: “If the number of livestock exceeds the maximum number, then the livestock would die but this will not impact on next year’s grass growth as long as the precipitation is good.”

      Pastoralist LG: “If I herded 1500 sheep, which is more than the land could sustain, the sheep would die after the grass is finished. The [next year] grass growth is the same if the precipitation is the same. If I graze 800 sheep they won’t die, but the grass would be finished when I move to the spring pasture…The difference is that if the pasture was grazed during the spring when the grass was growing, then the height of grass would be not as good as otherwise, in which the grass wasn’t grazed by livestock during the grass growing period of spring.”

      Note: Pastoralist GK’s statement here appears to somewhat contradict another statement that he made, as quoted in the article, “if you herd fewer livestock on the pasture, this is good for grassland condition.” This is one example where herders appeared to invoke a radical nonequilibrium view (in which only physical factors, i.e. precipitation and temperature, but not herbivory are controls on vegetation productivity) that was negated elsewhere in statements as well as by their actual herding practices.

      Full Citation: Volkmar, 2014. Follow-up interviews in Gouli, herders’ views of the determinants of grassland productivity.

    1. This is the first time that ALMA has ever observed the surface of a star and this first attempt has resulted in the highest-resolution image of Betelgeuse available.

      This is about a decade out of date. There is a higher resolution image from 2009

      The Spotty Surface of Betelgeuse Credit: Xavier Haubois (Observatoire de Paris) et al.

      The figure in the paper itself is this one:

      The paper is here:

      Haubois, X., Perrin, G., Lacour, S., Verhoelst, T., Meimon, S., Mugnier, L., Thiébaut, E., Berger, J.P., Ridgway, S.T., Monnier, J.D. and Millan-Gabet, R., 2009. Imaging the spotty surface of Betelgeuse in the H band . Astronomy & Astrophysics, 508(2), pp.923-932.

      There are other images of similar resolution. This is an article from 2018.

      Ariste, A.L., Mathias, P., Tessore, B., Lèbre, A., Aurière, M., Petit, P., Ikhenache, N., Josselin, E., Morin, J. and Montargès, M., 2018. Convective cells in Betelgeuse: imaging through spectropolarimetry. Astronomy & Astrophysics, 620, p.A199.

    1. @kieren britton

      Hi ladies,

      nice chapter about social media usage and super important nowadays, I have some further facts if you want to add any of that:

      1. Anxiety and depression
      2. Use of social media can enhance anxiety and depression
      3. Compare and despair attitude: pictures from people on holidays, enjoying adventures, heavily photo-shopped pictures etc (compared to the own “normal” life) – this evokes unrealistic expectations with feelings of low self-consciousness & self-esteem or perfectionism
      4. Studies show that an increased use of social media is linked to increased odds of depression (example: . Lin, L. y., Sidani, J. E., Shensa, A., Radovic, A., Miller, E., Colditz, J. B., Hoffman, B. L., Giles, L. M. and Primack, B. A. (2016), ASSOCIATION BETWEEN SOCIAL MEDIA USE AND DEPRESSION AMONG U.S. YOUNG ADULTS. Depress Anxiety, 33: 323–331. doi:10.1002/da.22466
      5. Some researchers even talk about things like “Facebook depression” when dealing with the social media and online world like facebook triggers depression (source American Academy of Pediatrics. 2017. Clinical report – The impact of social media on children, adolescents and families. [Accessed Apr 17] Available from: http://pediatrics.aappublications.org/content/pediatrics/127/4/800.full.pdf)
      1. Sleep

      2. Another area negatively affected by social media can be sleep

      3. Sleep is very tightly linked to mental health and it’s very important for us in order to function properly and being able to cope with everyday life
      4. Studies show that increased social media use can lead to poor sleep quality especially for young people (source: Scott, H. Gardani, M. Biello, S. Woods, H. 2016. Social media use, fear of missing out and sleep outcomes in adolescents. [Accessed Apr 17] Available from: https://www.researchgate.net/publication/308903222_Social_media_use_fear_of_missing_out_ and_sleep_outcomes_in_adolescence)
      5. Even more critical than using social media during the day is the usage of social media at night / right before bedtime – the blue LED light blocks the release of the sleep hormone, melatonin – which makes it harder to fall asleep and stay asleep
      6. 1/5 young people state to wake up during the night to check social media (source: Power, S. Taylor, C. Horton, K. 2017. Sleepless in school? The social dimensions of young people’s bedtime rest and routines. Journal of Youth Studies. [Accessed Apr 17] Available from: http://www.tandfonline.com/doi/full/10.1080/13676261.2016.12735 22)

      Possible positive aspects about social media usage:

      1. Access to other people’s health experiences and expert health information
      2. Emotional support and community building
      3. Self-expression and self-identity
      4. Making, maintaining and building upon relationships
    1. The search for evidence of habitability, taphonomy (related to fossils), and organic compounds on Mars is now a primary NASA and ESA objective.

      Since the article is about Life on Mars it should surely mention the first of NASA’S four science goals:

      Goal I: determine if Mars ever supported life

      • Objective A: determine if environments having high potential for prior habitability and preservation of biosignatures contain evidence of past life.
      • Objective B: determine if environments with high potential for current habitability and expression of biosignatures contain evidence of extant life."

      From: Hamilton, V.E., Rafkin, S., Withers, P., Ruff, S., Yingst, R.A., Whitley, R., Center, J.S., Beaty, D.W., Diniega, S., Hays, L. and Zurek, R., Mars Science Goals, Objectives, Investigations, and Priorities: 2015 Version.

  13. Jun 2019
    1. some people have linked Morgellons "to another illness viewed skeptically by most doctors, chronic Lyme disease"

      The Mayo clinic also refers to this research saying cite:

      The research on Morgellons by multiple groups over decades has yielded conflicting results. Multiple studies report a possible link between Morgellons and infection with Borrelia spirochetes. These results contradict [the CDC study] One of the main proponents of this hypothesis is Marianne J. Middelveen, MDes, a Veterinary Microbiologist from Alberta, Canada. She made a connection with a disease of cattle, called Bovine Digital dermatitis which has similar symptoms - and in that case, it is well established that there are microfilaments of keratin and collagen which form beneath the skin.

      She analysed filaments that form beneath the skin of sufferers, and found out that these also are made of keratin and collagen. She also found spirochetes, which are usually associated with Lyme disease in humans.

      The main paper is Middelveen, M.J., Bandoski, C., Burke, J., Sapi, E., Filush, K.R., Wang, Y., Franco, A., Mayne, P.J. and Stricker, R.B., 2015. Exploring the association between Morgellons disease and Lyme disease: identification of Borrelia burgdorferi in Morgellons disease patients. BMC dermatology, 15(1), p.1.

      She, along with a dozen or so other researchers, publish one or two papers a year on this topic.

      For more background and cites, see also Mystery Of Morgellons - Disease Or Delusion - Scientific Hypothesis Of Connection With Lyme Disease (originated as Wikipedia article but on rejection from Wikipedia, rewritten in less encyclopedic tone as a blog post)

      Here is Marianne Middelveen talking about her research https://youtu.be/IaxdRvesVfM

      French Wikipedia summarizes her reseach as

      A new emerging infection?

      As of 2011, some scientists are trying to demonstrate the reality of the disease by defining it as filamentous dermatitis linked to Lyme disease, by publishing one to two articles per year.

      The main author of publications is Marianne J. Middelveen, veterinarian, which reconciles the bovine digital dermatitis or Mortellaro disease in animals and humans Morgellons 13 . Bovine disease is a skin infection associated with various pathogens, including spirochaetes and treponemes . In the animal, the disease is shown as contagious, being able to present papules filiform.

      Middelveen assumes that morgellons are a human equivalent of bovine digit dermatitis. She regularly publishes works showing an association between Morgellons and Lyme disease 14. 15

      FOOTNOTES

      1. Marianne J. Middelveen and Raphael B. Stricker , " Filament formation associated with spirochetal infection: a comparative approach to Morgellons disease ," Clinical, Cosmetic and Investigational Dermatology , Vol. 42011, p. 167-177 ( ISSN 1178-7015 , PMID 22253541 , PMCID PMC3257881 , DOI 10.2147 / CCID.S26183 , read online [ archive ] , accessed March 4, 2019 )

      2. Marianne J. Middelveen Cheryl Bandoski Jennie Burke and Eva Sapi , " Exploring the Association entre Morgellons disease and Lyme disease: identification of Borrelia burgdorferi in Morgellons disease patients ," BMC Dermatology , Vol. 15, n o 1,February 12, 2015, p. 1 ( ISSN 1471-5945 , PMID 25879673 , PMCID PMC4328066 , DOI 10.1186 / s12895-015-0023-0 , read online [ archive ] , accessed March 4, 2019 ) summary in English " morgellons and lyme " [ archive ] , on imedecin.com .

      3. (in) Jyotsna S. Shah and Raphael B. Stricker , " Detection of tick-borne infection in Morgellons disease patients by serological and molecular technologies " [ archive ] on Clinical, Cosmetic and Investigational Dermatology ,November 9, 2018 (accessed March 4, 2019 )

  14. May 2019
    1. The 'organization man' is o u t,the 'flexible woman' is i n. Theindividualization of w o r k, andtherefore of l a b o u r 'sbargaining power, is themajor feature characterizingemployment in t he networksociety

      Women being able to break the glass ceiling within the work force, allowing for other women to be influenced and follow is powerful alone in itself.

    1. Enzymatic assays using acyl-peptidyl substrates were set up as follows: 100-120 llmoles of purified ~PL/RNRP protein, 200 l!M valeryl-FT AA-CoA/ valery 1-FT AAlaninal and 2 mM NADPH were incubated at 30°C for 2 hrs. The protein was precipitated with acetonitrile and the reaction was loaded on C 18 RP HPLC column (250 x 4.6 mm, 5l!, phenomenex). The products could be resolved using following gradient: 0 to 48% B in 25 min, 48% B in 40 min and 70% B in 50 min (A-water with 0.1% TF A and B-acetonitrile with 0.1% TF A) at a flow rate 0.6 ml/min. The elution profile was monitored at 220 nm. The identity of peaks obtained was confirmed by TOF-MS and tandem mass spectrometric analysis using ESI-MS (API QSTAR Pulsar i MS/MS, Applied Biosystems).
    1. THP-1 macrophages and human peripheral blood monocyte derived macrophages were transfected with SMARTpool Bcl-2 siRNA (15 pmol), or ER-a siRNA (100 pmol), or ER-~ siRNA (100 pmol), or with negative control siRNA (15 pmol or 100 pmol) using TranspassR2 transfection reagent. Prior to transfection, the cells were depleted of serum by washing 2x with serum-free media. The transfection complex was prepared by diluting 0.5 J!L of transfection reagent A and 1.0 J!L of transfection reagent B to 400 J!L of serum-free media and siRNA's were added to the mix at an appropriate concentration and incubated for 20 min at room temperature. The formed transfection complexes were transferred gently using a large bore pipette tip to 105 cells/well grown in 24 well plates and incubated for 6 h, following which fresh complete medium was added. Transfection efficiency was estimated by observing Cy3-fluorescence of the negative control siRNA with a Nikon TE2000E fluorescence microscope using a tetramethyl rhodamine filter (530-580 nm). For all transfections, target protein knockdown was assessed 24 h after transfection by probing extracts oftransfected cells on Western blots using appropriate antibodies
    1. function of resolution. The displacement for an isotropic B-value is related to the displacement u by the equation B = 8;(u2). The isotropic B-value assumes equal movements in all the directions. However, the vibration of an atom need not be the same in all the directions, and in such a case motion is described by anisotropic displacement parameter. In this formulation the motion is described by an ellipsoid that can be rotated in any direction. The entire anisotropic displacement can be described in terms of six elements: UIJ, U22 and U33 specify the magnitude of movement in three axis and U 12, U t3 and U23 specify the rotation off the principal axis. Anisotropic displacement parameters can be converted to the isotropic equivalent by the formula Biso = 8;(Ull+l'22+U33). The B-values are restrained during refinement. Atoms that are bonded to each other influence each other's motion. B-values are restrained in such a manner that the average difference in the B-values of bonded atoms is kept to a target value. The B-values should vary smoothly along the protein chain and within the side chain. The usual target restraint for adjacent bonded main chain atom is 1.0 and for side chain the target value is 1.5 since one end of the side chain is free, ensuring the higher gradient. Similarly B-values can be graded for the one to three members of a bond angle. For main chain angles the target value is 1.5 and for the side chain angle the value is set to 2.0. Like rigid body refinement, it is done at the early stages of the refinement process. Refinement of the atomic B-factors is a bit tricky and is carried out in later stages of refinement.
    2. sum runs over all the reflections in your data set, and k is a scale factor needed to put the Fe on the same scale as the Fobs· A model consists typically of five parameters for each atom: x,y,z, B, and Q. The triplet (x,y,z) specifies the position of each atom in an orthogonal coordinate system. B is the B-factor or temperature factor of each atom, and it is related to the thermal motion of the atom. B-factor also contains information about other types of "disorder" including errors that you are being made while constructing and refining model. Q is the occupancy and it is the fraction of time that the atom spends at position (x,y,z). Typically, Q=l. If one has data better than about 1.8 A, then occupancies between zero and one are sometimes used. Refinement procedures for antibodies involve two basic procedures, rigid body refinement followed by positional refinement. Rigid body refinement is used to refine the results obtained from MR in terms of orientation and position of the starting model in the unit cell. Positional refinement is used to refine the positions of individual atoms in space. Both conventional R-factor (Rcryst) and the free R-value (Rfree) (BrUnger, 1992) were used to monitor the progress of refinement. 10% of the reflections were set aside at random to monitor the Rfree during refinement. Rigid body refinement was carried out to further refine the positioning of the probe molecule in the target unit cell. The probe models that gave the highest correlation coefficients were thus subjected to rigid body refinement. Refinement was initially done using data in the range of 50 A -4 A; thereafter data up to the maximum available resolution were added in a step wise manner. The Fab molecule can be defined as an assembly of four domains, the VH, VL, CH and CL. Consequently, rigid body refinement where these domains were considered as discrete rigid units was carried out.
    1. vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.
    1. Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
    1. a. 5 μl of 10 mM HCl was added to each spot on the chip and removed after 5 min. using Whatman filter paper strips. b. Washing was given by spotting 3 μl of water for 30 sec on each spot followed by removal using Whatman filter paper strips. This step was repeated two times. c. 10 μl of low stringency/ high stringency buffer was then added to the spot and kept in humid chamber for 5 min. followed by removal using Whatman filter paper strips. d. 3 μl of sample prepared in low stringency/ high stringency buffer was then added to the spot and incubated in humid chamber for 30 min. e. Washed the spot with 5 μl of low stringency buffer/ high stringency buffer/ buffer of pH 3.0/ pH 5.0/ pH 7.0 for 30 sec and removed using Whatman filter paper strips. This step was repeated five times.
    2. One set of cell extracts was prepared in low stringency buffer by mixing cell extracts and low stringency buffet in 1:1 ratio and another in high stringency buffer. b. 10 μl of low stringency/high stringency buffer was added to the spots on the chip and incubated in a humid chamber for 5 min. c. Buffer was removed using Whatman strips without touching the spot surface. This step was repeated once
    3. b. 5 μl of ACN + TFA (25% ACN in PBS + 0.1% TFA) was added to the spot surface and removed after 30 sec. c. 5 μl of cell lysate sample was then spotted on the chip and kept in a humid chamber for 30 min. d. Stringent washes were given by spotting 5 μl water on the spot surface for 30 sec and removing using Whatman filter paper strips. This was followed with a 25% ACN wash or three washes with 25% ACN or 50% CAN or 75% ACN. e. Washing was performed by spotting 5 μl of water for 30 sec followed by removal using Whatman filter paper strips. f. Dried chip at room temperature. g. 1-2 μl of SAP matrix (5 mg of matrix + 200 μl ACN + 200 μl of 1% TFA) was then spotted on the chip surface and allowed to dry. h. The chip was then placed in the SELDI machine
    4. 5 μl of 0.1% TFA was applied to the spots on the SEND array and removed after 30 sec using Whatman paper (care was taken not to touch the spot surface). b. 5 μl of cell lysate sample was spotted on the SEND array and incubated in a humid chamber for 10 min. Removed after 30 min. c. 5 μl of 0.1% TFA was then added and removed after 30 sec. d. 2 μl of 25% ACN in 0.1% TFA was added to the spots and allowed to dry. e. The chip was then placed in the SELDI machine
    1. BCA (Bicinchoninic acid) method was used to determine the proteinconcentrationin various samples. The Cu2+ions from cupric sulphate (present inBCA reagent B) reagent arereduced to Cu+by the protein in an alkaline medium. The cuprous ion (Cu+) then combines with BCA (present in BCA reagent A) to give a purple colour whose intensity is proportional to the amount of protein present in the samples. This intensity is measuredby colorimetry at 562 nm. BCA reagent was prepared by mixing reagent A with reagent B in avolumeratio of 50:1. A standard curve was generated using increasing concentrations of BSA (2-10μg) in a 25μl reaction, in a 96 well plate. Cell lysates were also dilutedto same volume in parallel wells. 200μl of BCA reagent was then added to each well and incubated at 370C for 30 minutes. The absorbance readings were then takenin a spectrophotometer at 562 nm. Total protein was quantified by calculation of the slopes of regression lines ofabsorbanceand BSA standards
    1. For detection of protein-nucleic acid interaction, an electrophoretic mobility shift assay (EMSA) was conducted as described by Hellman and Fried (2007). Breifly, 8-10 μg of nuclear extract protein was incubated with binding reaction-mixture containing either 32P end-labeled double-stranded oligonucleotides (NF-κB, AP-1, p53 or SP-1) or unlabeled oligonucleotide as shown in table 2.3. The reaction mixture was incubated at 37°C for 45-60 min. After completion of reaction, 6μl of 6X DNA-loading dye was added and mixed well by gentle tapping.Table 2.3: Binding conditions for DNA-protein complexes in EMSA
    2. Secretory alkaline phosphatase (SEAP) assay: For SEAP assay, the culture supernatant was analyzed for SEAP activity essentially as per the Clontech kit protocol (Palo Alto, CA). Briefly, cells were transiently co-transfected with Lipofectamine 2000 transfection reagent, 0.5 μg of required plasmid DNA(s) with the protein of interest or empty vector, 0.5 μg of reporter plasmid containing NF-κB binding site cloned upstream of heat-stable SEAP (designated asNF-κB-SEAP)and 0.5 μg of green fluorescence protein (GFP) expression plasmid (Clonetech) in Opti-MEM media.After 6 h of transfection, cells were washed and cultured for 12 h in complete media, followed by treatment with different inducers. GFP positive cells were then counted to ensure similar transfection efficiency. At the end of treatment, cell culture-conditioned medium was harvested and 25 μl of medium was mixed with 20 μl of 5X buffer (0.5 M Tris, pH 9 and 0.5% bovine serum albumin) in a total volume of 100 μl in a 96-well plate followed by incubation at 65°C for 30 min. The plate was chilled on ice for 2 min and 50 μl of 1 mM 4-methylumbelliferylphosphate (MUP, substrate) was added to each well and incubated at 37 °C for 2 h. The activity of SEAP was assayed on a 96-well fluorescent plate reader (Fluoroscan, Lab Systems, MA) with excitation set at 360 nm and emission at 460 nm. The average number (± SD) of relative fluorescent light units for each transfection was then determined and reported as fold activation with respect to empty SEAP-transfected cells.Luciferase (Luc) assay:The cell pellet was lysed and extract was analysed as per Promega kit protocol.Briefly, cells wereco-transfected with Lipofectamine with 0.5 μg of reporter plasmid containing p53 binding site cloned upstream of luciferase (designated as p53-luciferase) and 0.5 μg of GFP constructs. After 6 h of transfection, cells were washed and cultured for 12 h, followed by treatment with different inducers of apoptosis. GFP positive cells were then counted.Cellswere pelleted down and lysed using the lysis buffer. The samples were freeze-thawed twice by storing them at -70oC to ensure total lysis. The supernatant,obtained by centrifuging the same at 11,000 rpm for 2 min was transferred to a fresh tube. About 100 μl of the substrate (Firefly luciferin, Promega) was added to the supernatant and light emission wasmeasured in luminometer by using a delay time of 2 sec andread time of 10 sec.The values were calculated as fold of activation over vector-transfected value
    3. The cell lines used in the present study, HuT-78 (human T-cell lymphoma), MDA-MB-231 (human breast cancer) and MDA-MB-468 (human breast cancer) were obtained from American Type culture collection (Manassas, VA, USA). Human colon carcinoma cell lines HCT-116 (wild-type, p53+/+) and HCT-116 (null, p53-/-) were a kind gift fromProf. B. Vogelstein (Johns Hopkins Oncology Center, Baltimore, MD). Cells were cultured in DMEM or RPMI medium containing 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml). Cells were maintained in humidified incubator at 37ºC in 5% CO2-95% air. Media for mammalian cell culture (DMEM and RPMI),fetal bovine serum (FBS)and other reagentsused in cell culture such as, PBS, Trypsin-EDTA, Antibiotic-antimycotic, Freezing medium, Geniticin, L-Glutamine, HEPES, etc. were
    1. GST fusions of yeast RNA Pol I subunits were purified as described in (Werneret al., 2010). Yeaststrainsover expressing GST tagged RNA Pol I proteins were grown overnight at 30°C in 10 mL of SC-Ura medium with 2% glucose medium. Cells were pelleted, washed in SC-Ura with galactose. Protein expression was induced by transferring the entire pellet into200 mL of SC-Ura with 2% galatose to give a final OD600of 0.8-1.0. For proteins A190 and A43 that express at very low levels, the overnight culture volume and induction volume were doubled. Cells were cultured at 30°C harvested at 3.0-5.0 OD and washedwith ice cold water. The cell pellet was suspended in 5 mL of ice cold Buffer A (Section 2.1.6.7), 750 μL ofcell suspensions were aliquoted into 1.5 mL microfuge tubes and to this 500 μL glass beads were added. Cells were lysed by bead beating using a vortex mixer (VortexGenei -2 with mix-mate attachment), and the lysate was centrifuged at high speed for 15 min at 4°C. Supernatants were dispensed into a 15 mL conical tube and Triton X-100 was added to a final concentration of 1%. Pre-swollen glutathionebeads were washed in Buffer B(Section 2.1.6.7)from which 200 μL of 1:1 bead suspension was added to approximately 5 mL of A34 and A43 expressing cell lysate and 100 μL of 1:1 bead suspension was added to 5 mL of A190 cell lysate and incubated for 2 h at 4°C on a rotary mixer. Lysates were centrifuged at 5000 xgfor 2 min and the beads were washed with ice cold Buffer C (Section 2.2.6.6) twice. Beads were further washed with ice cold Buffer B followed by ice cold 1X phosphate buffered saline (PBS) twice. Beads were suspended in an equal volume of 1X PBS with protease inhibitor cocktail (Sigma)
    2. Analysis of sensitivity to translation inhibitors was conducted in theDDY1810 S. cerevisiaestrain background, whichdoes not contain the kanrselection marker. Sensitivity to 6-azauracil (6AU) was monitored in the DDY1810, BY4741 or NOY222 strain backgrounds (Table 2.1). As uracil is a competitive inhibitor of 6AU, the plasmid p416GPD, carrying the URA3gene (Mumberget al., 1995)was introduced into BY4741-derived strainswhereas DDY1810 derived yeast strains were supported by the pYesGex plasmid carrying the URA3gene.Yeast strains were grown in YPD or SC-Ura medium,for 14-16 h at 30°C under continuous shaking at 200 rpm. Cultures were diluted to 0.25OD600, followed by 5 fold serial dilutions, and 3μL of each dilution was spotted on a YPD-agar plate containing the translation inhibitors G418 (8 μg/mL), paromomycin (100μg/mL or 200μg/mL), or hygromycin B (8 μg/mL), or an SC-Ura agar plate, containing 6AU 50 μg/mL or100 μg/mL and growth was monitored at 30°C or 37°C for 2-3 days. To perform an analysis of 6AU sensitivity with yeast carrying pYesGex6p2 plasmid, cells were grown overnight in SC-Uramedium and the serial dilutions were plated on SC-Ura medium containing 6AU, with galactose instead of glucose to express proteins under the GAL4promoter
    1. 2 bed volumes of methanol, and equilibrated with 5 bed volumes of distilled water. In order to reduce the water solubility of siderophore in the supernatant, it was acidified to pH 2 using concentarted HCl. This acidified supernatant was passsed through the column, and finally eluted with 160 ml methanol by collecting approximately 60 fractions (2 ml each) of the flow through. Siderophore assay was done on CAS plate with each collected fraction. Fraction that gave orangish-yellow halo for the siderophore on CAS plate, was combined together, dried in rotary evaporator and finally reconstituted in 1 ml methanol for further quantification using HPLC as described previously (Amin et al., 2009).For HPLC analysis, siderophore samples were filtered through filter membrane (porosity, 0.45 μ). Next, 10 μl sample was injected into Agilent C18 (4.6mm×250mm×5μm) column (gradient:(A=H2O/0.1%TFA), (B= CH3CN/0.1%TFA) 0-30% B in 10 min, 30-45% B in 15 min,45-0%B in 20 min at a flow rate of 1 ml/min). Similarly, standard vibrioferrin (siderophore produced by Xanthomonas) was also estimated through HPLC for comparison. Fe(III) bound vibrioferrin complex was prepared by incubating FeCl3.6H2O and apo-vibrioferrin for overnight. This complex was detected at300 nm (RT 10.998 min), whereas apo-vibrioferrin was detected at 220 nm at RT 10.988 min. The siderophore concentration in the samples were determined by peak area and calculated against the standard curves obtained from standard vibrioferrin. The siderophore from the test samples were detected at 300 nm, which confirms that majority of the vibrioferrin isolated from the culture was present in bound form
    1. Buffer pH range Stock Solutions Volume of Stock A + Stock BCitrate Phosphate 3–5 A: 0.1M solution of citric acid B: 0.2M solution of Na2HPO4pH 3: 39.8 ml A + 10.2 ml B made up to 100 ml pH 4: 30.7 ml A + 19.3 ml B made up to 100 ml pH 5: 24.3 ml A + 25.7 ml B made up to 100 ml Phosphate 6–8 A: 0.2M solution of NaH2P04 B: 0.2M solution of Na2HPO4 pH 6: 87.7 ml A + 12.3 ml B made up to 200 ml pH 7: 39 ml A + 61 ml B made up to 200 ml pH 8: 5.3 ml A + 94.7 ml B made up to 200 ml Tris - HCI 9 A: 0.1M solution of (HOCH2)3CNH2B: 0.1M HCI solution (16.16 ml of 11.35N HCI /L) pH 9: 70 ml A + 30 ml B made up to 200 ml Glycine - NaOH 10 A: 0.1M glycine B: 0.1M NaOH solution pH 10: 50 ml A + 32 ml B made up to 200 ml Phosphate hydroxide 11 A: 0.05M Na2HP04B: 0.05M sodium hydroxide pH 11: 91 ml A + 9 ml B Hydroxide Chloride 12 A: 0.05M KCI solution B: 0.05M KOH solution pH 12: 82 ml A + 18 ml B
    1. This method was used to isolate highly pure genomic DNA. Briefly, 10 ml overnight grownC. glabratacultures were spun downandwashed with 10 ml sterile water. Washed cells wereresuspended in500 μl sterile water and transferred toa1.5 ml microcentrifuge tube. Tubes were spundownat 4,000 rpm for 5 min, supernatant was discarded andcell pellet was resuspended in 500 μl of buffer containing 100 mM EDTA and 5% β-mercaptoethanol and incubatedat 42°C for 10 min. Post incubation, cells were spun down at 4,000 rpm for 5 min and resuspended in freshly prepared Buffer B. To this, one tip-full of lyticase (Sigma, L4025) was added and incubated at 37°C for 1 h.After incubation, spheroplasts were collected by spinning downtubes at 6,000 rpm for 5 min, supernatant was discarded and the pellet was resuspended in 500 μl of Buffer C. DNA was extracted twice with 500 μl of PCI (25:24:1) solution and the aqueous layer was transferred toa new1.5 ml microcentrifuge tube. To this, 2.5 volume of absolute ethanol and 1/10thvolume of 3 M sodium acetate (pH 5.3) wereadded. Tubes were spundownat 13,000 rpm for 10 min, DNA pellet was resuspended in 200 μl of 1X TE buffer containing0.3 μl of RNase cocktail (Ambion) and incubated at 37°C for30 min. DNA was precipitated again by adding absolute ethanol and sodium acetate as mentioned above. DNA pellet was washed once with 70% ethanol, centrifuged at 13,000 rpm for 10 min, air-dried at room temperature and was resuspended in 100-200 μl of 1X TE buffer by gently tapping the tube. DNAwas stored at -20°C until use
    2. This method was used to isolate highly pure genomic DNA. Briefly, 10 ml overnight grownC. glabratacultures were spun downandwashed with 10 ml sterile water. Washed cells wereresuspended in500 μl sterile water and transferred toa1.5 ml microcentrifuge tube. Tubes were spundownat 4,000 rpm for 5 min, supernatant was discarded andcell pellet was resuspended in 500 μl of buffer containing 100 mM EDTA and 5% β-mercaptoethanol and incubatedat 42°C for 10 min. Post incubation, cells were spun down at 4,000 rpm for 5 min and resuspended in freshly prepared Buffer B. To this, one tip-full of lyticase (Sigma, L4025) was added and incubated at 37°C for 1 h.After incubation, spheroplasts were collected by spinning downtubes at 6,000 rpm for 5 min, supernatant was discarded and the pellet was resuspended in 500 μl of Buffer C. DNA was extracted twice with 500 μl of PCI (25:24:1) solution and the aqueous layer was transferred toa new1.5 ml microcentrifuge tube. To this, 2.5 volume of absolute ethanol and 1/10thvolume of 3 M sodium acetate (pH 5.3) wereadded. Tubes were spundownat 13,000 rpm for 10 min, DNA pellet was resuspended in 200 μl of 1X TE buffer containing0.3 μl of RNase cocktail (Ambion) and incubated at 37°C for30 min. DNA was precipitated again by adding absolute ethanol and sodium acetate as mentioned above. DNA pellet was washed once with 70% ethanol, centrifuged at 13,000 rpm for 10 min, air-dried at room temperature and was resuspended in 100-200 μl of 1X TE buffer by gently tapping the tube. DNAwas stored at -20°C until use
    1. desired temperaturefor 45 minutes and plated on an appropriate selective medium at various dilutions. An aliquot of cell suspension to which plasmid DNA was not added served as a negative control. B. Inoue method i. Preparation of high efficiency competent cells Competent cells for high efficiency transformation were prepared by the method of (Inoueet al., 1990)with few modifications. An overnight culture of the strain (routinely DH5α) was subculturedinto fresh sterile LB broth in 1:100 dilutions and grown at 18ºC to anA600of 0.55. The cells were harvested by centrifugation at 2500rpm for 10 minutes at4ºC. Thesecells wereresuspended in0.4 volumes of INOUE buffer andincubated in ice for 10 minutes. The cells were recovered by centrifugation at 2500rpm at 4ºC for 10 minutes and finally resuspended in 0.01 volume of the same buffer. Sterile DMSO was added to a final concentration of 7%. After incubating for 10 minutes in ice, the cells were aliquoted in 100μl volumes, snap frozen in liquid nitrogen and stored at –80ºC. ii. Transformation protocolFor transformation, the required number of vials wasthawed on ice and the transformation protocol as described for CaCl2method was employed
  15. Apr 2019
    1. "b-l-a-c-k o-n w," th

      I just tried this in google to see what would come up and interestingly enough, none of the top results were the ones listed here. The first one was "black on white vans"

    1. To d o o m a t e r i a l u t i l i z a d o n o a p o i o é f o r n e c i d o p e l o l a b o r a t ó r i o A l v a r o .São insumos primários ou secundários e são enviados ao cliente conforme demanda comercial. Abaixo os itens relacionados:

      Todo o material utilizado no apoio é fornecido pelo laboratório Alvaro. São insumos primários ou secundários, enviados ao cliente conforme demanda comercial. Confira abaixo os itens relacionados:

    Annotators

    1. Le visage tiré par une colère froide, père saisit un bâton. Il attrape granfrère par le col. Le frappe avec la conviction d’un métronome. Le fils hurle. père, tou-jours plus livide, cogne. tac, tac, tac, tac, tac. La petite s’accroche à son corps massif, tente de l’arrêter. elle ne comprend pas. Il ne l’a jamais frappée.

      Père est très énervé contre Granfrère et le frappe.Ce chapitre rapporte une situation inhabituelle dans la famille de la Petite, à savoir qu' elle a toujours considéré son petit frère comme étant le préféré, surtout de leur mère et que d' habitude, il était seulement flatté. Elle utilise le champ lexical de la violence pour rendre la scène : "saisit un b^aton", "attrape", "frappe","hurle", "cogne","frappée" . De plus, l' onomatopée "tac.......tac" reproduit le son que le b^aton fait quand il atteint Granfrère.

  16. Mar 2019
    1. Bloomberg Sign InSubscribe Home Markets Technology Politics Pursuits Opinion Businessweek Video Podcasts Radio Newsletters Watchlist Subscribe Sign in License Read Bloomberg New EconomyWealthNext ChinaCryptoCheckoutHyperdriveWell SpentPrognosisClimate ChangedEqualityGood BusinessBillionairesGraphicsSponsored Content Watch The David Rubenstein ShowArt + TechnologyInspire GO Special Reports Where to Invest $10,00050 Companies to Watch in 2018What's Inside All the iPhones Read EconomicsDealsFixed IncomeETFsFactor InvestingBenchmarkMarkets Magazine Watch DaybreakSurveillanceMarketsWhat'd You Miss Follow TwitterFacebook Data StocksCurrenciesCommoditiesRates & BondsSectorsEconomic Calendar Listen TrillionsOdd LotsSurveillanceBenchmarkP&L Read Work ShiftedCybersecurityStartupsAIMobileBig DataCloud ComputingU.S.Global Special Reports The Elon Musk TrackerTesla Model 3 Tracker Watch Gadgets with GurmanDigital DefenseBloomberg Technology TVStudio 1.0 Listen Decrypted Follow TwitterFacebook Read 2018 Election ResultsTrump TrackerBrexit CoverageWorld Leaders on the Brink2019 Pessimist's Guide Listen Bloomberg Law Subscribe Balance of Power Follow TwitterFacebook Read TravelAutosHomesLivingCultureStyle Special Reports London Property PricesNew York Property PricesHow to Invest in ArtHow to Spend Your Bonus Watch Made Follow TwitterFacebookInstagram Read Editorials Follow TwitterFacebookInstagram Listen Masters in Business Subscribe Bloomberg Opinion TodayMoney StuffRitholtz's ReadsEarly ReturnsSparklines Special Reports Sooner Than You ThinkThe Year Ahead: 2018The Bloomberg 50 Watch Hello World The Magazine Subscribe Follow TwitterFacebookInstagram Watch Live TV USEuropeAsiaAustraliaSchedule+Shows Shows SurveillanceDaybreakMarketsWhat'd You Miss?Bloomberg TechnologyAll Shows... Series QuickTakeHello WorldThe Spark Follow TicTocYouTubeTwitterFacebook Listen DecryptedOdd LotsTrillionsBenchmarkMasters in BusinessSurveillanceP&LPrognosisTravel GeniusThe ETF StoryAll Podcasts…All Radio Shows… { "@context": "http://schema.org", "@type": "NewsMediaOrganization", "address": { "@type": "PostalAddress", "addressCountry": "USA", "addressLocality": "New York", "addressRegion": "NY", "postalCode": "10022", "streetAddress": "731 Lexington Avenue" }, "diversityPolicy": "https://www.bloomberg.com/diversity-inclusion", "name": "Bloomberg", "email": "inquiry1@bloomberg.net", "legalName": "Bloomberg Finance L.P.", "leiCode": "5493001KJTIIGC8Y1R12", "telephone": "(212) 318-2000", "url": "https://www.bloomberg.com", "logo": "https://assets.bwbx.io/s3/navi/images/bloomberg_logo-2556aaa618.svg", "brand": [ { "@type": "Brand", "name": "Bloomberg markets", "url": "https://www.bloomberg.com/markets" }, { "@type": "Brand", "name": "Bloomberg technology", "url": "https://www.bloomberg.com/technology" }, { "@type": "Brand", "name": "Bloomberg pursuits", "url": "https://www.bloomberg.com/pursuits" }, { "@type": "Brand", "name": "Bloomberg politics", "url": "https://www.bloomberg.com/politics" }, { "@type": "Brand", "name": "Bloomberg opinion", "url": "https://www.bloomberg.com/opinion", "logo": "https://assets.bwbx.io/s3/navi/images/bloomberg_opinion_logo-591d28994d.svg" }, { "@type": "Brand", "name": "Bloomberg businessweek", "url": "https://www.bloomberg.com/businessweek", "logo": "https://assets.bwbx.io/s3/navi/images/bloomberg_businessweek_logo-5e920ae9c4.svg" } ] } ["711339Z:US","0119046D:CN","0424410D:US","TSLA:US"] {"excludeFromWall":false,"contentType":"archived","publishedAt":"2017-09-18T11:00:06.634Z","theme":"technology-v2","newsletterSlug":""} {"id":"OWH2K66JIJW201","contentType":"archived","contentTags":[{"id":"TSLA:US","type":"Company","directScore":0.3576413119330077,"derivedScore":0.3576413119330077},{"id":"0424410D:US","type":"Company","directScore":0.450976971388695,"derivedScore":0.450976971388695},{"id":"0119046D:CN","type":"Company","directScore":0.9096301465457083,"derivedScore":0.9096301465457083},{"id":"711339Z:US","type":"Company","directScore":0.9757501744591766,"derivedScore":0.9757501744591766},{"id":"sacramento","type":"City","directScore":0.32937892533147245,"derivedScore":0.32937892533147245},{"id":"los-angeles","type":"City","directScore":0.9635380321004885,"derivedScore":0.9635380321004885},{"id":"massachusetts","type":"Location","directScore":0.27285415212840197,"derivedScore":0.27285415212840197},{"id":"california","type":"Location","directScore":0.401430565247732,"derivedScore":0.401430565247732},{"id":"washington","type":"Location","directScore":0.4802861130495464,"derivedScore":0.4802861130495464},{"id":"new-york","type":"Location","directScore":0.4823796231681787,"derivedScore":0.4823796231681787},{"id":"CA","type":"Country","directScore":0.9112002791346825,"derivedScore":1.3652316388981636},{"id":"NL","type":"Country","directScore":1.0146545708304258,"derivedScore":1.0146545708304258},{"id":"1954518","type":"Person","directScore":9.698099623561326,"derivedScore":9.698099623561326},{"id":"national-aeronautics-and-space-administration","type":"Organization","directScore":0.25209351011863224,"derivedScore":0.25209351011863224},{"id":"engineering","type":"Topic","directScore":0.17498255408234473,"derivedScore":0.17498255408234473},{"id":"jobs","type":"Topic","directScore":0.18824145150034893,"derivedScore":0.18824145150034893},{"id":"intellectual-property","type":"Topic","directScore":0.5701325889741801,"derivedScore":0.5701325889741801},{"id":"science","type":"Topic","directScore":0.979413817166783,"derivedScore":5.174345914460974},{"id":"air-travel","type":"Topic","directScore":1.7576762037683182,"derivedScore":1.7576762037683182},{"id":"Europe","type":"Region","directScore":0,"derivedScore":1.0146545708304258},{"id":"industrials","type":"Topic","directScore":0,"derivedScore":0.9757501744591766},{"id":"infrastructure","type":"Topic","directScore":0,"derivedScore":1.0412932362741834},{"id":"US","type":"Region","directScore":0,"derivedScore":1.861479008315773},{"id":"autonomous-vehicle","type":"Topic","directScore":0,"derivedScore":0.3576413119330077},{"id":"well-spent","type":"Topic","directScore":0,"derivedScore":1.5485173197083408},{"id":"aerospace-industry","type":"Topic","directScore":0,"derivedScore":0.9757501744591766},{"id":"space","type":"Topic","directScore":0,"derivedScore":1.0083154455231336},{"id":"automotive","type":"Topic","directScore":0,"derivedScore":0.3576413119330077},{"id":"consumer-discretionary","type":"Topic","directScore":0,"derivedScore":1.0893360222263802},{"id":"US","type":"Country","directScore":0,"derivedScore":1.1432785913730015},{"id":"transportation","type":"Topic","directScore":0,"derivedScore":0.3576413119330077},{"id":"technology","type":"Classification","directScore":0,"derivedScore":9.741499765437135},{"id":"artificial-intelligence","type":"Topic","directScore":0,"derivedScore":0.3576413119330077}]} {"url":"2017-09-18/in-elon-musk-s-hyperloop-contests-students-main-goal-is-scoring-a-job","adCode":"business/news/technology","targeting":{"suid":"OWH2K66JIJW201","page":"articlejav","currentResource":"Story|OWH2K66JIJW201","ni":["AIR","BUSINESS","ITSVC","LAW","LIFESTYLE","SCIENCE","TEC","TRAVEL"],"tagr":[],"kwl":["biz_barclays","biz_xojet","biz_ishares","biz_wellsfargosept","biz_googlelist","biz_googlelisttwo","biz_technologykeywords","biz_autocompetitors","biz_trowe","biz_nomurakeywords","biz_bp1","biz_bp2","biz_bp3","biz_bp4","biz_schwab","biz_fidelity","biz_ibm3","biz_dit_terrorism","biz_microsoft","biz_kornferry","biz_generic","biz_fti","biz_brandusa","biz_lexus2","biz_United","biz_BMW","biz_citi1","biz_att1","biz_mobkoimandslist","biz_tdameritrade","biz_boeing","biz_att2","biz_att3","biz_att6","biz_facebook1","biz_facebook2","biz_mulberry","biz_BMWRecall","biz_junctiondigital","biz_texas","biz_Fidelity_investopedia","biz_masia2","biz_jpmorgan","biz_ishares2","biz_ishares3","biz_morg","biz_RBC","biz_airfrance","biz_facebookmobkoi","biz_cmcmarketsuk","biz_amex1","biz_amex2","biz_amex3","biz_amex4","biz_amex5","biz_amex6","biz_jpmorganemea","biz_mobkoivca","biz_blackrock","biz_workdayfow","biz_socgenlist","biz_citi2019","biz_deloitte19"],"sites":["bbiz","technology"],"tickers":[]},"disableAds":false} {"naviImageUrl":"https://assets.bwbx.io/images/users/iqjWHBFdfxIU/i2TraTOpvDOM/v1/100x-1.jpg"} More from Bloomberg Technology {"contentId":"OWH2K66JIJW201","position":"ziprwhite","strategy":"always","dimensions":{"all":[[88,32]]},"type":"custombox","targeting":{"position":"ziprwhite","url":"/news/articles/2017-09-18/in-elon-musk-s-hyperloop-contests-students-main-goal-is-scoring-a-job"},"containerId":"custombox-OWH2K66JIJW201-ziprwhite"} CEO in Houston Disaster Makes YouTube Apology After Eleven D... {"contentId":"OWH2K66JIJW201","position":"ziprwhite-2","strategy":"always","dimensions":{"all":[[88,32]]},"type":"custombox","targeting":{"position":"ziprwhite-2","url":"/news/articles/2017-09-18/in-elon-musk-s-hyperloop-contests-students-main-goal-is-scoring-a-job"},"containerId":"custombox-OWH2K66JIJW201-ziprwhite-2"} Huawei Slammed in U.K. for Jeopardizing National Security Lyft, the Perpetual No. 2, Gets Its Moment in the Spotlight What the Year of the Tech Unicorns Means for the Bull Market Line Founder Named Co-Chief Executive as Japan Goes Cashless Bayer Loses Second Trial Over Claims Roundup Causes Cancer Congestion Pricing. Has It Worked and Can It Fix New York? Daimler Joins With Geely to Recast Smart as China-Based EV B... Google Loses Gay-Rights Endorsement in Dispute Over Mobile A... Nestle Turns to Moms After 150 Years of Selling Infant Formu... CEO in Houston Disaster Makes YouTube Apology After Eleven D... {"contentId":"OWH2K66JIJW201","position":"ziprwhite-1","strategy":"always","dimensions":{"all":[[88,32]]},"type":"custombox","targeting":{"position":"ziprwhite-1","url":"/news/articles/2017-09-18/in-elon-musk-s-hyperloop-contests-students-main-goal-is-scoring-a-job"},"containerId":"custombox-OWH2K66JIJW201-ziprwhite-1"} Huawei Slammed in U.K. for Jeopardizing National Security Lyft, the Perpetual No. 2, Gets Its Moment in the Spotlight What the Year of the Tech Unicorns Means for the Bull Market Line Founder Named Co-Chief Executive as Japan Goes Cashless Bayer Loses Second Trial Over Claims Roundup Causes Cancer Congestion Pricing. Has It Worked and Can It Fix New York? Daimler Joins With Geely to Recast Smart as China-Based EV B... Google Loses Gay-Rights Endorsement in Dispute Over Mobile A... Nestle Turns to Moms After 150 Years of Selling Infant Formu... CEO in Houston Disaster Makes YouTube Apology After Eleven D... {"contentId":"OWH2K66JIJW201","position":"ziprwhite-0","strategy":"always","dimensions":{"all":[[88,32]]},"type":"custombox","targeting":{"position":"ziprwhite-0","url":"/news/articles/2017-09-18/in-elon-musk-s-hyperloop-contests-students-main-goal-is-scoring-a-job"},"containerId":"custombox-OWH2K66JIJW201-ziprwhite-0"} Huawei Slammed in U.K. for Jeopardizing National Security Lyft, the Perpetual No. 2, Gets Its Moment in the Spotlight What the Year of the Tech Unicorns Means for the Bull Market Line Founder Named Co-Chief Executive as Japan Goes Cashless Bayer Loses Second Trial Over Claims Roundup Causes Cancer Congestion Pricing. Has It Worked and Can It Fix New York? Daimler Joins With Geely to Recast Smart as China-Based EV B... Google Loses Gay-Rights Endorsement in Dispute Over Mobile A... Nestle Turns to Moms After 150 Years of Selling Infant Formu...

      source reputation

    1. zN(c;Kc)

      \(\mu^\frak{c}\) is the vector of means of the tuple of \(i\)th components of the vectors in the argument of either \(\mathtt{f}^a\) or \(\mathtt{f}^b\), and \(K^\frac{c}\) is the covariance matrix of this tuple/vector.

      Note (also useful for the above definition) that we are defining means and covariances for any individual component of the vectors \(\mathtt{g}\). That is, we are describing the distribution of \(\mathtt{g}^{\frak{c}}_i=(\mathtt{g}^l_i)_{g^l\in\frak{c}}\) for any \(i\). Different tuples of components are independently distributed, as explained in a comment in the beggining of the Setup section above

    1. Silicon Valley, arecent study we have j u st completed shows thai:,in the midst of a j ob creation explosion, in the lastten years, between 50 per cent at l e a st and 90 percent of n ew j o b s, most of t h em highly paid,

      I am curious to know what types of part-time roles are highly paid? Potentially a consulting role at a tech company?

    2. he prevalence of t he logicof the space of flows over the space of p l a c e s.The space of flows structures and s h a p es t hespace of p l a c e s, as when the differential fortunesof capital accumulation in g l o b al financial m a r-kets reward or p u n i sh specific regions, or whentelecom systems link up C B Ds to o u t l y i ng sub

      For some reason this statement is a little confusing.

    1. claimed that “a better, cheaper and more effective service for the commuter” beckoned. Rail fares: unions and Labour condemn 'staggering' increase Read more Fast forward 25 years, and commuters are facing average fare hikes of 3.4% – with season tickets jumping by 3.6%: the biggest increase since 2013. And this, in a county where workers have suffered the longest squeeze in wages in generations. While the cheapest single ticket to the capital will cost a British commuter 50p per mile, German passengers are paying just 19p a mile. According to TUC research, British passengers commuting from Chelmsford to London are shelling out 13% of their salary on travel; a French worker travelling from Étampes to Paris will see only 2% of their wage packet eaten up by the cost. And for so many Britons, their miserable lot is paying extortionate sums for an overcrowded commute, pressed against the bodies of other understandably grumpy passengers. Government plans to consider linking future price hikes to a lower level of inflation is a woefully inadequate response. Other wealthy nations manage to provide decent quality rail travel at an affordable price: but then, rather than flog this critical national service to profiteers, they’ve maintained them under public ownership. The government does allow state ownership of some rail and energy services – but only if they are foreign governments who are not accountable to British citizens. 'Weight is a lifelong struggle': your best comments today Read more The answer is to bring the rail franchises back under public control – as was successfully done with East Coast before it was idiotically sold off – as part of an integrated, modernised system. No more dividends for shareholders: all the money to be reinvested back into this critical service. This disastrous experiment sums up so many of the Tories’ woes. Their fundamentalist pro-market dogma keeps colliding with the lived experience of millions of people: from the terrible cuts to living standards which followed the financial crash, to the failed privatisation of the utilities. The miserable state of our railways is another reminder that the economic system has failed – and must be replaced. • Owen Jones is a Guardian columnist Topics Rail fares First thoughts Transport policy Transport comment Share on Facebook Share on Twitter Share via Email Share on LinkedIn Share on Pinterest Share on WhatsApp Share on Messenger Reuse this content Advertisement First thoughts Quick takes on big stories from Comment is free columnists Children are dying on our streets – May’s response is not good enough Gaby Hinsliff Conservative governments fail because they cut and cut, and for a long time we don’t notice. Then we feel the impact, writes Guardian columnist Gaby Hinsliff 3h 3h Children are dying on our streets – May’s response is not good enough May’s Brexit bung to the north is pathetic. It changes nothing Simon Jenkins The £1.6bn the PM has promised to secure Labour support for her deal is no match for years of systematic neglect, says Guardian columnist Simon Jenkins 1d 1d May’s Brexit bung to the north is pathetic. It changes nothing There is no magic ‘stop Brexit’ button for Labour. There never has been Owen Jones There are simply not enough Labour MPs in leave areas who are willing pass the Kyle-Wilson amendment and trigger another referendum, says Guardian columnist Owen Jones 4d 4d There is no magic ‘stop Brexit’ button for Labour. There never has been The fight for EU citizens’ rights could become another Windrush Polly Toynbee The Tory MP Alberto Costa wants to secure post-Brexit rights. But nothing is certain in the face of a hostile Home Office, says Guardian columnist Polly Toynbee 5d 5d The fight for EU citizens’ rights could become another Windrush View all comments > comments (752)Sign in or create your Guardian account to join the discussion. Guardian Pick The taxpayer is already subsidising the rail system to a large degree. Privatisation hasn't got rid of that, which is one reason it's failed. Jump to comment SnowyJohn 2 Jan 2018 196 197 Guardian Pick East Coast wasn't "sold off" and would generate money under any ownership. Ending dividends for shareholders would not necessarily release any of the 3 percent margin as it would also remove incentives to maximize revenue (eg by encouraging off peak usage). This "disastrous experiment" is a victim of its own success, doubling passenger numbers after years of stagnation. British Rail used to solve overcrowding by increasing fares. Just because a p… Jump to comment Mick James 2 Jan 2018 46 47 Guardian Pick In Northern Ireland, the NI Railways network is still publicly owned by Translink. To get A day return from Belfast to Derry at the station it costs £18.50. This is a 2 hour journey and the longest journey possible on the NI rail network. (It’s as little as £12.50 if prebooked online with a railcard) On the other hand An equivalent length 2 hour journey in England going from London to Liverpool today would cost you £85 for just a single ticket. Jump to comment Ernekid 2 Jan 2018 91 92 Guardian Pick For the tories, the free market has become such an ideological nirvana that they keep throwing money at it to make it work. Whatever your politics, that's both amazing and stupid (and, in fairness, many grassroots tories afaict are just as appalled). Jump to comment tomandlu 2 Jan 2018 162 163 Order by oldest newest oldest recommendations Show 25 25 50 100 All Threads collapsed collapsed expanded unthreaded 1 2 3 4 … next Loading comments… Trouble loading? Plataea 2 Jan 2018 12:13 187 188 The Tories buy their cognitive dissonace by the truck load - you can wheel out the evidence till the cows come home - won't make a blind bit of difference - they don't giove a stuff.Tories: shafting british peasants & serfs since the 18th century. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report fishplate Plataea 2 Jan 2018 13:27 32 33 Serfdom was long gone (in England and Wales at least) by the 18th century. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Watered fishplate 2 Jan 2018 13:31 78 79 I disagree.Serfing is still very popular on the south coast. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report RDUK123 Plataea 2 Jan 2018 13:37 25 26 What evidence has been wheeled out in this article? That its possible for a country to reduce its rail fares by throwing money at the system to subsidise it, like Germany? I travel by rail a lot, my biggest annoyance is the poor mobile signal whilst travelling. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 6 more replies tomandlu 2 Jan 2018 12:14 Guardian Pick 162 163 For the tories, the free market has become such an ideological nirvana that they keep throwing money at it to make it work. Whatever your politics, that's both amazing and stupid (and, in fairness, many grassroots tories afaict are just as appalled). Reply Share Share on Facebook Facebook Share on Twitter Twitter | Unpick Report TragicomedyBeholder tomandlu 2 Jan 2018 13:40 32 33 Whatever your politics, that's both amazing and stupid That may be the natural reaction, but it’s the wrong reaction. In actual fact, everything is going exactly according to plan – for the plutonomy that is. For the rest of us, the commuting precariat, it is another case of like it or lump it. Just as worker insecurity helps the economy to grow and satisfies the needs of the 1 percent, so too inefficient and expensive railways. Why should they change a systems that is working perfectly……. for them? Of course, we can expect some lip service, the usual pledges, and perhaps the odd patch-up job or gimmick here and there, but that will be about it. It wouldn’t surprise me if they were now to argue a case for total privatisation of the railways in order to encourage competition and produce competitive prices. That would be the logical conclusion within fundamentalist free-market dogma. Then, whatever the outcome, there would be no one to blame since the free market sets its own rules and prices. End of story. Government absolved of all future responsibility. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Simon Cohen tomandlu 2 Jan 2018 13:42 76 77 'and, in fairness, many grassroots tories afaict are just as appalled' Yes but they still keep voting for them which is why we have a rigid 40% support for these incompetents. The problem is, the public have been conned for the last 40 years that 'there's no money' and Britain will go bankrupt and we'll be like Weimar Germany/Zimbabwe/Venezuela (take your pick of the unfounded cliches). When will the British wake up to the fact that we're in the fifth decade of a dreadful experiment involving the financial industry catheterising whole populations levaing people staggering around with massive debt, poor quality jobs and atrocious infrastructure and lack of public services? There is NO shortage of money because the Goverment issues the currency just as it did when we had QE. There is also no chance of inflation from this spending because we are operating well under capacity and have massive levels of uderemployment and ropey jobs combined with private debt of nearly 2 trillion. Get the financialised industry off our backs-they do nothing but 'shuffle wealth' around a limited circuit. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Mauvegrail tomandlu 2 Jan 2018 14:04 20 21 The ideological nirvana that you talk about is (excepting the content) identical to the reverence shown by Americans for their constitution and Muslims for the Koran. Nothing is allowed to change because it is the received wisdom from an earlier age. The franchises given to these groups or individuals are virtually the same as the monopolies bestowed by royalty in the past. They are a licence to print money. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 2 more replies Mongost 2 Jan 2018 12:14 112 113 Fast forward 25 years, and commuters are facing average fare hikes of 3.4% – with season tickets jumping by 3.6% It's the government that sets the annual increase in regulated fares. German passengers are paying just 19p a mile German taxpayers pay EUR 17b a year for Germany's railways. Our taxpayers pay GBP 5b a year. The answer is to bring the rail franchises back under public control How would that make the government change their policy on annual regulated fare increases? It isn't at all clear. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Wally Mooney Mongost 2 Jan 2018 13:34 62 63 Our taxpayers pay GBP 5b a year. That’s not really the case though. The government is the origin of it’s own currency and neither taxation nor borrowing are required to finance government spending in sterling. The act of government spending creates the money which is then later partially removed via taxation. So the UK government does not ever have to worry about how to ‘pay for’ things in terms of pounds and pennies. The actual limitation is whether or not the UK has enough real resources (human skills and non-human materials, energy, steel, concrete, water, land, machines etc.) to achieve its policy objectives.http://www.huffingtonpost.com/warren-mosler/taxes-for-revenue-are-obs_b_542134.html Any shortages of funding for public transport, the NHS, social housing etc is purely an ideological choice of those that govern us. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report matt h Wally Mooney 2 Jan 2018 14:29 52 53 Wally by name - wally by nature. The government can print all the money it wants - as it does so it loses its value. The government can issue bonds this is technically a loan from people who buy the bonds. But alas these need paying back with interest.Then there is good old spending within your means.... Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Gcorbs Wally Mooney 2 Jan 2018 14:29 This comment was removed by a moderator because it didn't abide by our community standards. Replies may also be deleted. For more detail see our FAQs. Show 8 more replies Roger ERRINGTON 2 Jan 2018 12:15 132 133 Spot on! Rail privatisation was one step too far even for Thatcher. It was an early example of a weak PM (Major) caving in to the Tory far right. An unmitigated disaster - like the vast majority of private sell-offs. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report TheGribbler Roger ERRINGTON 2 Jan 2018 13:42 38 39 An unmitigated disaster which a study by Imperial College London estimates has saved 150 lives in improved safety. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report towel TheGribbler 2 Jan 2018 13:49 64 65 How did privatisation in itself improve safety? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report TheGribbler towel 2 Jan 2018 13:52 45 46 Investment. It's increased ninefold since privatisation. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 4 more replies feeling 2 Jan 2018 12:16 70 71 The answer is to bring the rail franchises back under public control No, sack the greedy drivers on their £80,000 salaries and track staff on £800 a day and let the market decide how much staff get paid - Pay them the same as bus drivers - £25,000 a year max. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Redblair feeling 2 Jan 2018 13:28 159 160 Yes mate, it's the workers' fault... Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Norsked feeling 2 Jan 2018 13:29 90 91 Why don't you think anyone should earn more than £25k a year? I assume you believe no-one should earn more than that and aren't just singling out train drivers, because the latter would be ridiculous... Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report excathedra feeling 2 Jan 2018 13:31 89 90 Another example of when you haven't a clue just lie and hope dome of it sticks. Here's a truth for you. Brian Souter, who used a variety of unpleasant tactics to establish his business in the first place, took out £400 million as dividends ensuring that he paid very little tax on a business that he shouldn't own, hasn't built up and makes money on the backs of very poorly paid workers. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 13 more replies shangani 2 Jan 2018 12:16 38 39 No it doesn't...why should people who never use a train subsidise people who do...I don't expect people who use a train to subsidise me driving a car. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Nepthsolem shangani 2 Jan 2018 13:29 136 137 why should people who never use a train subsidise people who do Because that's how infrastructure works in society. I don't expect people who use a train to subsidise me driving a car. Yet that is exactly what happens. The roads you drive on, the lights that light them and the people who repair them are paid for out of general taxation. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report fishworld shangani 2 Jan 2018 13:29 83 84 But you do expect there to be a non-toll-based road network, right? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report WelshPaul shangani 2 Jan 2018 13:30 104 105 Why should people who don't have children subsidise those who do? Why do I have to pay council tax to the fire brigade when my home has never burned down? Taxation doesn't work that way. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 31 more replies Mick James 2 Jan 2018 12:20 Guardian Pick 46 47 East Coast wasn't "sold off" and would generate money under any ownership. Ending dividends for shareholders would not necessarily release any of the 3 percent margin as it would also remove incentives to maximize revenue (eg by encouraging off peak usage). This "disastrous experiment" is a victim of its own success, doubling passenger numbers after years of stagnation. British Rail used to solve overcrowding by increasing fares. Just because a privatised rail system has problems Durant mean they will go away if it is nationalised. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Unpick Report LeftOrRightSameShite Mick James 2 Jan 2018 14:46 38 39 Ending dividends for shareholders would not necessarily release any of the 3 percent margin as it would also remove incentives to maximize revenue Interesting you write "would not necessarily" release the 3% margin yet are much more certain when you write "it would" remove revenue incentives. Pull your trousers up chap...your ideology is showing. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Paul1977 2 Jan 2018 12:25 21 22 The way to properly deal with this is to end the current franchise system that replaces a public monopoly with several private ones. OK is wrong to claim this as an example of the free market gone wrong as there is no free market here. In fact the best way to solve this problem is to create some genuine competition between the TOCs - it is competition that drives down prices and drives up standards, not mere private ownership. The current franchise system should be ripped up and something that creates genuine competition to replace it. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Paul1977 Paul1977 2 Jan 2018 12:26 0 1 OK should read OJ (Owen Jones!) Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report SnowyJohn Paul1977 2 Jan 2018 13:29 31 32 I think this was always the fundamental problem with rail privatisation: privatisation only leads to improvements if there is genuine competition, and the franchise system for rail doesn't really produce that. Rather than "privatisation", we should really call it what it is: a modern day form of selling monopolies. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report treebranches Paul1977 2 Jan 2018 13:33 9 10 The current franchise system should be ripped up and something that creates genuine competition to replace it. How could such a system work? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 11 more replies andrew ward 2 Jan 2018 12:26 202 203 Owen, you might not fully grasp this, but it's the taxpayer (not that magic money tree again) who ends up paying for those wonderful cheaper rail fares in Germany, France etc etc. So do you actually support cross subsidisation of the commuter rail network by people who may never use it - or perhaps due to geographical location, can never use it? If so I think you should set that case out here rather than come out with meaningless propagandist nonsense about rail fares being a failure of 'pro market dogma'. (I appreciate that such an approach involves some real mental effort rather than a simple 'cut and paste' - not great with a New Year's hangover.. ) You end with that ringing phrase - 'the economic system has failed - and must be replaced'. With what exactly??? If you could offer one example - yes, just one - of a centrally planned socialist economy anywhere in the world that has worked better than our own 'failed' free market system you might be taken a little more seriously. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Redblair andrew ward 2 Jan 2018 13:29 68 69 Any of the Scandinavian countries? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report DiBosco andrew ward 2 Jan 2018 13:32 151 152 That's right, ignore how the shareholders get paid and the rail companies still get subsidies. Tory and rail shareholder are we? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report SnowyJohn andrew ward 2 Jan 2018 13:33 Guardian Pick 196 197 The taxpayer is already subsidising the rail system to a large degree. Privatisation hasn't got rid of that, which is one reason it's failed. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Unpick Report Show 18 more replies dunn31 2 Jan 2018 12:27 19 20 According to a comprehensive survey carried out in 2012 our rail services are above the European average for cost efficiency.The cost for train drivers was 40% higher in the UK then the European average.This suggests that the existing system is extremely efficient given that its cost per mile good and it salaries high.If the article by Mr Jones is accurate all that needs to happen is for everyone to pay more tax so that rail fares can have a greater subsidy. I think he forgot to mention that was the case in the examples he was quoting. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report DiBosco dunn31 2 Jan 2018 13:30 5 6 Source please. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report RDUK123 dunn31 2 Jan 2018 13:31 21 22 Correct. https://en.wikipedia.org/wiki/Rail_subsidies#Europe According to this, Germany subsidises its rail by 17 Billion Euro, the UK by 4.4 Billion Euro. German passengers are being massively subsided at the expense of people who never use the system. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Kingkerouac dunn31 2 Jan 2018 13:31 14 15 How much more was the cost of executives?And how many more of them?Train drivers should be paid decently - they do the work.Executives. Well what do they do to deserve their huge wages? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 3 more replies PrakashShah 2 Jan 2018 13:25 5 6 Outsource it to Uber. We can all limousine to work like Grayling. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report fishplate 2 Jan 2018 13:25 5 6 Other wealthy nations manage to provide decent quality rail travel at an affordable price: but then, rather than flog this critical national service to profiteers, they’ve maintained them under public ownership. Are Germany, Denmark, Sweden, the Netherlands, Australia, New Zealand and Canada - to take some examples of places where commuter services are operated by contractors - not "wealthy nations"? Anyway, if the trains get any busier, no-one will use them. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Giuseppa_Acciaio fishplate 2 Jan 2018 13:43 8 9 "operated by contractors" doesn't equate to "privatised": in Germany for example the railways are owned by Deutsche Bahn (which has the State as its only shareholder) and operated by Deutsche Bahn and other companies. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report fishplate Giuseppa_Acciaio 2 Jan 2018 14:03 7 8 You mean like in Great Britain, where the railways are owned by Network Rail (which has the state as its only shareholder) and services are operated various companies? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report greenwichite 2 Jan 2018 13:25 19 20 Brilliantly written piece from OJ. Not a word wasted. Re-nationalise the railways. It's a winning policy for Labour. They can privatise the motorways to keep the Blairites happy, with French-style tolls. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report zippymosquito 2 Jan 2018 13:26 4 5 I don't think people would mind quite so much if the trains regularly appeared on time (or ran at all, for that matter) - and you had some chance of getting a seat. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Dufftime75 zippymosquito 2 Jan 2018 13:36 3 4 Well this is it isn't it? They've lowered our expectations so much we're grateful for scraps. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Ernekid 2 Jan 2018 13:26 Guardian Pick 91 92 In Northern Ireland, the NI Railways network is still publicly owned by Translink. To get A day return from Belfast to Derry at the station it costs £18.50. This is a 2 hour journey and the longest journey possible on the NI rail network. (It’s as little as £12.50 if prebooked online with a railcard) On the other hand An equivalent length 2 hour journey in England going from London to Liverpool today would cost you £85 for just a single ticket. Nationalised railways exist in the UK and they work. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Unpick Report fishplate Ernekid 2 Jan 2018 13:41 27 28 Belfast Central - Londonderry Waterside 151 km, 2 h 02 min on little diesel trains.London Euston - Liverpool Lime Street 312 km 2 h 12 min on intercity electric trains. If you are willing to travel this evening rather than now, you can do it for £33. The NI network was in such a state a few years ago, and ridership was so low, that there was serious talk of just giving up and abandoning it (although the Republic might have been willing to take over Dublin - Belfast at least). Instead the government agreed to throw buckets full of money at it. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report FTRH Ernekid 2 Jan 2018 15:12 4 5 Belfast to Londonderry 71 miles if you care to deal in facts! Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report SteveYates Ernekid 2 Jan 2018 15:18 18 19 Strangely, the value of a train journey is in the distance, not the time. If the Belfast - Derry journey took four hours, your analysis would suggest you'd happily pay twice as much for it, despite it being obviously worse. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Nepthsolem 2 Jan 2018 13:27 85 86 While the cheapest single ticket to the capital will cost a British commuter 50p per mile, German passengers are paying just 19p a mile The solution is simple then. Pretend to be German when you buy your ticket. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Frenske Nepthsolem 2 Jan 2018 14:55 24 25 Gutday, Ich want a ticket von Cambridge to London mit Deutsche discount. Klop. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report rustyowl 2 Jan 2018 13:27 7 8 No misery related to all the strikes? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report marziPANIC 2 Jan 2018 13:28 89 90 Those of us old enough to recall British Rail respectfully disagree Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Trumbledon marziPANIC 2 Jan 2018 13:32 36 37 The thing is that Owen isn't, really. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report odstjackson marziPANIC 2 Jan 2018 13:32 5 6 As a 30 something, I only know the privatized version, My parents hate both. Some new paradigm altogether is apparently needed. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Nepthsolem marziPANIC 2 Jan 2018 13:33 57 58 British Rail meant vast amounts of public money pumped into a system of late, dirty trains. Post-BR, we now have vast amounts of public money pumped into a system of late, dirty trains only with private companies managing to profit from it. Progress! Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 15 more replies jjsalmo 2 Jan 2018 13:28 46 47 Owen appears to have only one solution to all problems, namely 'Nationalisation'.Rather than those that use the service being responsible, he suggests that the general taxpayer, many who do not use the train would subsidise those that do.The other issue he fails to mention, is that the least efficient element and cause of much of the delays etc is already nationalised. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report ID4469239 jjsalmo 2 Jan 2018 13:44 25 26 Why do we pay the nationalised French companies to run our transport and subsidise French passengers from our fares ? Why should I have to subsidise those people deluded enough to think that Trident provides some sort of defence to me and my family. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report jjsalmo ID4469239 2 Jan 2018 13:59 8 9 You shouldn't, no argument there, but going back to the days of BR will achieve nothing. There needs to be greater genuine competition coupled with real sanctions for non-delivery. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Kingkerouac 2 Jan 2018 13:30 13 14 Everything Thatcher dogmatised, electric, gas, rail travel, football, poll-tax/rates has shot up in price when 'choice' was supposed to reduce prices. What happened? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report YEverKnot Kingkerouac 2 Jan 2018 13:40 7 8 Thatcher was responsible for football tickets? Well, I never. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report StephenHawking Kingkerouac 2 Jan 2018 13:44 3 4 Football? Don't disagree its become very expensive, but I am not sure Thatcher can be blamed for that. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report ChipKennedy Kingkerouac 2 Jan 2018 13:47 4 5 Bait and Switch . Heads you lose Tails they win . Socialism for the 1% Austerity and Rail price increases for the 99% . Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Show 2 more replies TheSpecialNeedsOne 2 Jan 2018 13:31 4 5 Good to hear you agree with Lord Adonis, Owen. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report odstjackson 2 Jan 2018 13:31 3 4 Our entire Produce/Consume society we are enslaved to is a problem. Any way of life that puts greed, selfishness and power at the forefront should not exist. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report rodmclaughlin 2 Jan 2018 13:32 1 2 The railway disaster doesn't prove that privatisation is a bad thing. It only shows that privatisation of the railways - in which companies have an inbuilt monopoly, because you can't have rival companies competing at the same times on the same lines - is a bad thing. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Trumbledon 2 Jan 2018 13:32 5 6 John Major claimed that “a better, cheaper and more effective service for the commuter” beckoned. He got two of those right, he was only wrong on cost. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report YEverKnot Trumbledon 2 Jan 2018 13:40 6 7 You really think fares would go down under nationalisation? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report Trumbledon YEverKnot 2 Jan 2018 13:46 5 6 No, not necessarily. All I'm saying is that services are now better and more effective than they were under BR. If you want a reminder of what BR was like, take a ride on one of the Class 156's which still operate in Scotland. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report DiBosco Trumbledon 2 Jan 2018 13:58 18 19 I'm willing to bet in the 70s the rail system, were it privatised, would have been absolutely no better. The world is a very different place now and renationalised railways would be nothing like 70s BR. There is no inherent reason nationalised industry can't be good. Noticed any improvement in gas, electricity and water since they started lining the pockets of the insanely rich? Do other countries' nationalised railways work a treat? Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report HonestJo 2 Jan 2018 13:32 21 22 Whatever our thoughts on privatisation please don't expect hard pressed tax payers outside London to subsidise jobs in London at the expense of their local poor services. If people can't afford to commute to these London jobs then frankly these jobs should move to places where people can afford to live and don't need to commute. Simple really. Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report ID4469239 HonestJo 2 Jan 2018 13:41 5 6 The companies should pay taxes which subsidise public transport. It's not rocket science (which is why this happens in other countries such as France) Reply Share Share on Facebook Facebook Share on Twitter Twitter | Pick Report 1 2 3 4 … next Sorry there was an error. Please try again later. If the problem persists, please contact Userhelp Close report comment form Please select Personal abuse Off topic Legal issue Trolling Hate speech Offensive/Threatening language Copyright Spam Other Reason (optional) Email (optional) Report Sign in or create your Guardian account to recommend a comment View more comments <form class="component js-comment-box d-comment-box"> <div class="d-comment-box__meta"> <span class="d-comment-box__avatar-wrapper"></span> <div class="d-comment-box__meta-text"> <span class="d-comment-box__author-label">Signed in as</span> <span class="d-comment-box__author"></span> <span class="inline-reply inline-icon grey" > <svg width="18" height="18" class="grey__svg inline-reply__svg inline-icon__svg"> <path d="M10.1 5l.9-1 4 4.5v1L11 14l-.9-1 2.5-3H4L3 9V6.5h2V8h7.6l-2.5-3z" /> </svg> </span> <span class="d-comment-box__reply-to-author"></span> <span class="u-fauxlink d-comment-box__show-parent" role="button">Show comment</span> <span class="u-fauxlink d-comment-box__hide-parent" role="button">Hide comment</span> </div> </div> <div class="d-comment-box__parent-comment-wrapper"> <div class="d-comment-box__parent-comment-spout"></div> <div class="d-comment-box__parent-comment"> <span class="d-comment-box__parent-comment-author"></span> <div class="d-comment-box__parent-comment-body"></div> <span class="u-fauxlink d-comment-box__hide-parent" role="button">Hide comment</span> </div> </div> <div class="d-comment-box__onboarding"> <h3>Welcome <span class="d-comment-box__onboarding-author"></span>, you’re about to make your first comment!</h3> <p>Before you post, we’d like to thank you for joining the debate - we’re glad you’ve chosen to participate and we value your opinions and experiences.</p> <div class="d-comment-box__onboarding-username"> <p>Please choose your username under which you would like all your comments to show up. You can only set your username once.</p> <label class="d-comment-box__onboarding-username-label" for="usernameInput">Username: </label> <span>Must be 6-20 characters, letters and/or numbers only, no spaces.</span> <input type="text" id="usernameInput" class="d-comment-box__onboarding-username-input" placeholder="" value=""/> <p class="d-comment-box__onboarding-username-error-message is-hidden"></p> </div> <p>Please keep your posts respectful and abide by the <a target="_blank" href="/community-standards">community guidelines</a> - and if you spot a comment you think doesn’t adhere to the guidelines, please use the ‘Report’ link next to it to let us know.</p> <p>Please preview your comment below and click ‘post’ when you’re happy with it.</p> <div class="d-comment-box__onboarding-preview-body"></div> <button type="submit" class="u-button-reset button button--large button--primary submit-input--behaviour d-comment-box__onboarding-submit">Post your comment</button> <button type="button" class="u-button-reset button button--large button--primary submit-input--behaviour d-comment-box__onboarding-cancel">Cancel</button> </div> <div class="d-comment-box__content"> <div class="d-comment-box__messages"></div> <div class="d-discussion__error d-comment-box__premod"> <span class="inline-status-alert inline-icon " > <svg width="18" height="18" viewbox="0 0 18 18" class="inline-status-alert__svg inline-icon__svg"> <circle fill="#d61d00" cx="9" cy="9" r="9" /> <path fill="#fff" d="M9.7 11.3H8.3L6.9 3.6l.7-.7h2.8l.7.8-1.4 7.6zM9 15.4c-.8 0-1.4-.6-1.4-1.4 0-.8.6-1.4 1.4-1.4s1.4.6 1.4 1.4c0 .8-.6 1.4-1.4 1.4z" /> </svg> </span> <span class="d-discussion__error-text">Your comments are currently being pre-moderated (<a href="/community-faqs#311" target="_blank">why?</a>)</span> </div> <div class="d-comment-box__community-standards">Please keep comments respectful and abide by the <a href="/community-standards">community guidelines</a>.</div> <label for="d-comment-box" class="u-h">Enter comment</label> <textarea name="body" class="textarea d-comment-box__body" placeholder="Join the discussion…" id="d-comment-box"></textarea> <button type="submit" data-link-name="post comment" class="u-button-reset button button--large button--primary submit-input--behaviour d-comment-box__submit">Post your comment</button> <span class="u-fauxlink d-comment-box__preview" role="button">Preview</span> <span class="u-fauxlink d-comment-box__hide-preview" role="button">Hide preview</span> <span class="u-fauxlink d-comment-box__cancel" role="button">Cancel</span> <ul class="d-comment-box__formatting-controls"> <li class="d-comment-box__formatting-bold" title="Bold">B</li> <li class="d-comment-box__formatting-italic" title="Italic">i</li> <li class="d-comment-box__formatting-quote" title="Quote">&#8221;</li> <li class="d-comment-box__formatting-link" title="Link">Link</li> </ul> <div class="d-comment-box__preview-wrapper"> <div class="d-comment-box__preview-spout"></div> <div class="d-comment-box__preview-block"> <div class="d-comment-box__preview-body"></div> </div> </div> </div> </form> Most popular Most viewed Across The Guardian Most viewed in Opinion Senate set to reject Trump's national emergency declaration Senate set to reject Trump's national emergency declaration Clintons accused of nepotism in book on US-Ireland relations Clintons accused of nepotism in book on US-Ireland relations Age of the autosexual: the people sexually attracted to themselves Age of the autosexual: the people sexually attracted to themselves Hillary Clinton rules out running for president in 2020 Hillary Clinton rules out running for president in 2020 'Ridiculous' micro handbag that can fit only a few mints becomes fashion sensation 'Ridiculous' micro handbag that can fit only a few mints becomes fashion sensation Hotels at centre of rape allegations promoted on TripAdvisor Hotels at centre of rape allegations promoted on TripAdvisor Live Michael Cohen's lawyer reportedly sought pardon from Trump – live Michael Cohen's lawyer reportedly sought pardon from Trump – live Revealed: AmazonSmile helps fund anti-vaccine groups Revealed: AmazonSmile helps fund anti-vaccine groups The last great tree: a majestic relic of Canada's vanishing rainforest The last great tree: a majestic relic of Canada's vanishing rainforest ‘Starbucks on steroids’: can America’s new weed cafes make smoking social? ‘Starbucks on steroids’: can America’s new weed cafes make smoking social? If Democrats lure Amazon back to NYC, they won't be forgiven If Democrats lure Amazon back to NYC, they won't be forgiven Donald Trump tells a fake American story. We must tell the real one Donald Trump tells a fake American story. We must tell the real one Instagram is stripping its devotees of their basic humanity Instagram is stripping its devotees of their basic humanity As foreign secretary I argued against an EU referendum. Now I back one As foreign secretary I argued against an EU referendum. Now I back one Science never quite clicked for me at school. Then I discovered science YouTube Science never quite clicked for me at school. Then I discovered science YouTube Dear Europe, Brexit is a lesson for all of us: it’s time for renewal Dear Europe, Brexit is a lesson for all of us: it’s time for renewal Victoria's Secret, your airbrushed grip on the lingerie world is loosening Victoria's Secret, your airbrushed grip on the lingerie world is loosening Virgin Atlantic’s sexism goes deeper than telling women what to wear Virgin Atlantic’s sexism goes deeper than telling women what to wear Enough is enough: Michael Jackson's music is dead to me now Enough is enough: Michael Jackson's music is dead to me now If Trump loses, we know what to expect: anger, fear and disruption If Trump loses, we know what to expect: anger, fear and disruption As foreign secretary I argued against an EU referendum. Now I back one David Miliband Tests on London patient offer hope of HIV ‘cure’ The Guardian view Columnists Letters Opinion videos Cartoons About us Contact us Complaints & corrections Secure Drop Work for us Privacy policy Cookie policy Terms & conditions Help All topics All writers Digital newspaper archive Facebook Twitter Advertise with us Guardian Labs Search jobs Dating Discount Codes Support The Guardian Available for everyone, funded by readers Contribute Subscribe Back to top © 2019 Guardian News & Media Limited or its affiliated companies. All rights reserved. Close As we begin 2019, please make a contribution to The Guardian to help us protect independent journalism at a time when factual, trustworthy reporting is under threat. Our editorial independence means we can pursue difficult investigations, challenging the powerful and holding them to account. And our journalism is open to everyone, regardless of what they can afford. But we depend on voluntary contributions from readers. We’re in this together – please make a contribution today to help us deliver the independent journalism the world needs for 2019 and beyond. Support The Guardian from as little as $1. Support The Guardian Close try{(function(isVeryModern,document,window){if(isVeryModern){var decodeBase64=function(str){return decodeURIComponent(atob(str.replace(/-/g,"+").replace(/_/g,"/").replace(/,/g,"\x3d")))};var cookieData=function(a){var d=[],e=document.cookie.split(";");a=RegExp("^\\s*"+a+"\x3d\\s*(.*?)\\s*$");for(var b=0;b<e.length;b++){var f=e[b].match(a);f&&d.push(f[1])}if(d.length>0)return d[0];return null}("GU_U");var userData=cookieData?JSON.parse(decodeBase64(cookieData.split(".")[0])):null;if(userData){var displayName=decodeURIComponent(userData[2]);window.guardian.config.user={id:userData[0],displayName:displayName,accountCreatedDate:userData[6],emailVerified:userData[7],rawResponse:cookieData}}}})(guardian.isEnhanced&&"atob"in window,document,window)}catch(e){};try{(function(document,window){if(typeof window.getComputedStyle!=="function")return;var ad=document.createElement("div");ad.style.position="absolute";ad.style.left="0";ad.style.WB_wombat_top="0";ad.style.height="10px";ad.style.zIndex="-1";ad.innerHTML="\x26nbsp;";ad.setAttribute("class","ad_unit");window.requestAnimationFrame(function(){document.body.appendChild(ad);window.requestAnimationFrame(function(){var adBlockers=window.guardian.adBlockers;var adStyles=window.getComputedStyle(ad);var displayProp=adStyles&&adStyles.getPropertyValue("display");var mozBindingProp=adStyles&&adStyles.getPropertyValue("-moz-binding");adBlockers.active=displayProp==="none"||mozBindingProp&&mozBindingProp.indexOf("about:")!==-1;runEachListener(adBlockers.onDetect);adBlockers.onDetect={push:function(){var toRun=Array.prototype.slice.call(arguments,0);runEachListener(toRun)}};function runEachListener(listeners){for(var i=0;i<listeners.length;i++)try{listeners[i](adBlockers.active)}catch(e){}}})})})(document,window)}catch(e){};try{(function(isVeryModern,document,window){var user=window.guardian.config.user;if(isVeryModern&&user)window.requestAnimationFrame(function(){var $profileInfoElem=document.getElementsByClassName("js-profile-info")[0];var $profileNavElem=document.getElementsByClassName("js-profile-nav")[0];if(!$profileInfoElem&&!$profileNavElem)return;$profileInfoElem.innerHTML=user.displayName;$profileNavElem.classList.add("is-signed-in");var $signInLinkElem=$profileNavElem.getElementsByTagName("a")[0];if($signInLinkElem)if(user.id)$signInLinkElem.addEventListener("click",function(e){e.preventDefault()});else $signInLinkElem.setAttribute("href",$signInLinkElem.getAttribute("href").replace("signin","public/edit/"));var $register=document.getElementsByClassName("js-profile-register");if($register.length){$register=$register[0];$register.parentElement.removeChild($register)}})})("classList"in document.documentElement,document,window)}catch(e){};try{(function(document,window){if(!window.__cmp)window.__cmp=function(){var listen=window.attachEvent||window.addEventListener;listen("message",function(event){window.__cmp.receiveMessage(event)},false);function addLocatorFrame(){if(!window.frames["__cmpLocator"])if(document.body){var frame=document.createElement("iframe");frame.style.display="none";frame.name="__cmpLocator";frame.setAttribute("aria-hidden",true);document.body.appendChild(frame)}else setTimeout(addLocatorFrame,5)}addLocatorFrame();var commandQueue=[];var cmp=function(command,parameter,callback){if(command==="ping"){if(callback)callback({gdprAppliesGlobally:!!(window.__cmp&&window.__cmp.config&&window.__cmp.config.storeConsentGlobally),cmpLoaded:false})}else commandQueue.push({command:command,parameter:parameter,callback:callback})};cmp.commandQueue=commandQueue;cmp.receiveMessage=function(event){var data=event&&event.data&&event.data.__cmpCall;if(data)commandQueue.push({callId:data.callId,command:data.command,parameter:data.parameter,event:event})};cmp.config={storeConsentGlobally:false,storePublisherData:false,logging:false,gdprApplies:false};return cmp}()})(document,window)}catch(e){};try{(function(document,window){function shouldServeLotame(){try{var geo=JSON.parse(window.localStorage.getItem("gu.geolocation")).value;if(geo==="US"||geo==="CA"||geo==="AU"||geo==="NZ")return false;return true}catch(e){}return false}if(shouldServeLotame()){var script=document.createElement("script");script.src="https://tags.crwdcntrl.net/c/12666/cc.js";document.body.appendChild(script)}})(document,window)}catch(e){};(function(window,document){function getCookieValue(name){var nameEq=name+"\x3d",cookies=document.cookie.split(";"),value=null;cookies.forEach(function(cookie){while(cookie.charAt(0)===" ")cookie=cookie.substring(1,cookie.length);if(cookie.indexOf(nameEq)===0)value=cookie.substring(nameEq.length,cookie.length)});return value}window.guardian.config.ophan.browserId=getCookieValue("bwid")})(window,document);window.curlConfig={baseUrl:'https://assets.guim.co.uk/javascripts',apiName:'require',paths:{'ophan/ng':'//j.ophan.co.uk/ophan.ng'}};window.curl=window.curlConfig;(function(){(function(l){function p(){}function v(a,b){return 0==T.call(a).indexOf("[object "+b)}function x(a){return a&&"/"==a.charAt(a.length-1)?a.substr(0,a.length-1):a}function D(a,b){var d,c,f,g;d=1;c=a;"."==c.charAt(0)&&(f=!0,c=c.replace(U,function(a,b,c,f){c&&d++;return f||""}));if(f){f=b.split("/");g=f.length-d;if(0>g)return a;f.splice(g,d);return f.concat(c||[]).join("/")}return c}function C(a){var b=a.indexOf("!");return{g:a.substr(b+1),d:0<=b&&a.substr(0,b)}}function A(){}function y(a,b){A.prototype=a||N;var d=new A;A.prototype=N;for(var c in b)d[c]=b[c];return d}function E(){function a(a,b,d){c.push([a,b,d])}function b(a,b){for(var d,f=0;d=c[f++];)(d=d[a])&&d(b)}var d,c,f;d=this;c=[];f=function(d,n){a=d?function(a){a&&a(n)}:function(a,b){b&&b(n)};f=p;b(d?0:1,n);b=p;c=s};this.m=function(b,c,f){a(b,c,f);return d};this.h=function(a){d.C=a;f(!0,a)};this.f=function(a){d.qa=a;f(!1,a)};this.w=function(a){b(2,a)}}function z(a){return a instanceof E||a instanceof h}function t(a,b,d,c){z(a)?a.m(b,d,c):b(a)}function B(a,b,d){var c;return function(){0<=--a&&b&&(c=b.apply(s,arguments));0==a&&d&&d(c);return c}}function e(){var a,b;r="";a=[].slice.call(arguments);v(a[0],"Object")&&(b=a.shift(),b=w(b));return new h(a[0],a[1],a[2],b)}function w(a,b,d){var c;r="";if(a&&(k.R(a),q=k.b(a),"preloads"in a&&(c=new h(a.preloads,s,d,I,!0),k.l(function(){I=c})),a=a.main))return new h(a,b,d)}function h(a,b,d,c,f){var g;g=k.k(q,s,[].concat(a),f);this.then=this.m=a=function(a,b){t(g,function(b){a&&a.apply(s,b)},function(a){if(b)b(a);else throw a;});return this};this.next=function(a,b,c){return new h(a,b,c,g)};this.config=w;(b||d)&&a(b,d);k.l(function(){t(f||I,function(){t(c,function(){k.r(g)},d)})})}function K(a){var b,d;b=a.id;b==s&&(J!==s?J={I:"Multiple anonymous defines encountered"}:(b=k.da())||(J=a));if(b!=s){d=u[b];b in u||(d=k.j(b,q),d=k.F(d.b,b),u[b]=d);if(!z(d))throw Error("duplicate define: "+b);d.ha=!1;k.G(d,a)}}function F(){var a=k.aa(arguments);K(a)}var r,q,G,H,m=l.document,O=m&&(m.head||m.getElementsByTagName("head")[0]),V=O&&O.getElementsByTagName("base")[0]||null,Q={},R={},L={},W="addEventListener"in l?{}:{loaded:1,complete:1},N={},T=N.toString,s,u={},M={},I=!1,J,S=/^\/|^[^:]+:\/\//,U=/(\.)(\.?)(?:$|\/([^\.\/]+.*)?)/g,X=/\/\*[\s\S]*?\*\/|\/\/.*?[\n\r]/g,Y=/require\s*\(\s*(["'])(.*?[^\\])\1\s*\)|[^\\]?(["'])/g,Z=/\s*,\s*/,P,k;k={n:function(a,b,d){var c;a=D(a,b);if("."==a.charAt(0))return a;c=C(a);a=(b=c.d)||c.g;a in d.c&&(a=d.c[a].M||a);b&&(0>b.indexOf("/")&&!(b in d.c)&&(a=x(d.P)+"/"+b),a=a+"!"+c.g);return a},k:function(a,b,d,c){function f(b,c){var d,g;d=k.n(b,n.id,a);if(!c)return d;g=C(d);if(!g.d)return d;d=u[g.d];g.g="normalize"in d?d.normalize(g.g,f,n.b)||"":f(g.g);return g.d+"!"+g.g}function g(b,d,g){var e;e=d&&function(a){d.apply(s,a)};if(v(b,"String")){if(e)throw Error("require(id, callback) not allowed");g=f(b,!0);b=u[g];if(!(g in u))throw Error("Module not resolved: "+g);return(g=z(b)&&b.a)||b}t(k.r(k.k(a,n.id,b,c)),e,g)}var n;n=new E;n.id=b||"";n.ea=c;n.H=d;n.b=a;n.A=g;g.toUrl=function(b){return k.j(f(b,!0),a).url};n.n=f;return n},F:function(a,b,d){var c,f,g;c=k.k(a,b,s,d);f=c.h;g=B(1,function(a){c.q=a;try{return k.V(c)}catch(b){c.f(b)}});c.h=function(a){t(d||I,function(){f(u[c.id]=M[c.url]=g(a))})};c.J=function(a){t(d||I,function(){c.a&&(g(a),c.w(R))})};return c},U:function(a,b,d,c){return k.k(a,d,s,c)},ca:function(a){return a.A},K:function(a){return a.a||(a.a={})},ba:function(a){var b=a.t;b||(b=a.t={id:a.id,uri:k.L(a),exports:k.K(a),config:function(){return a.b}},b.a=b.exports);return b},L:function(a){return a.url||(a.url=k.D(a.A.toUrl(a.id),a.b))},R:function(a){var b,d,c,f,g;b="curl";d="define";c=f=l;if(a&&(g=a.overwriteApi||a.oa,b=a.apiName||a.ja||b,c=a.apiContext||a.ia||c,d=a.defineName||a.la||d,f=a.defineContext||a.ka||f,G&&v(G,"Function")&&(l.curl=G),G=null,H&&v(H,"Function")&&(l.define=H),H=null,!g)){if(c[b]&&c[b]!=e)throw Error(b+" already exists");if(f[d]&&f[d]!=F)throw Error(d+" already exists");}c[b]=e;f[d]=F},b:function(a){function b(a,b){var d,c,n,e,q;for(q in a){n=a[q];v(n,"String")&&(n={path:a[q]});n.name=n.name||q;e=f;c=C(x(n.name));d=c.g;if(c=c.d)e=g[c],e||(e=g[c]=y(f),e.c=y(f.c),e.e=[]),delete a[q];c=n;var r=b,h=void 0;c.path=x(c.path||c.WB_wombat_location||"");r&&(h=c.main||"."+"/"+"main","."==h.charAt(0)||(h="."+"/"+""+h),c.M=D(h,c.name+"/"));c.b=c.config;c.b&&(c.b=y(f,c.b));c.S=d.split("/").length;d?(e.c[d]=c,e.e.push(d)):e.o=k.Q(n.path,f)}}function d(a){var b=a.c;a.O=RegExp("^("+a.e.sort(function(a,c){return b[c].S-b[a].S}).join("|").replace(/\/|\./g,"\\$&")+")(?=\\/|$)");delete a.e}var c,f,g,n;"baseUrl"in a&&(a.o=a.baseUrl);"main"in a&&(a.M=a.main);"preloads"in a&&(a.pa=a.preloads);"pluginPath"in a&&(a.P=a.pluginPath);if("dontAddFileExt"in a||a.i)a.i=RegExp(a.dontAddFileExt||a.i);c=q;f=y(c,a);f.c=y(c.c);g=a.plugins||{};f.plugins=y(c.plugins);f.v=y(c.v,a.v);f.u=y(c.u,a.u);f.e=[];b(a.packages,!0);b(a.paths,!1);for(n in g)a=k.n(n+"!","",f),f.plugins[a.substr(0,a.length-1)]=g[n];g=f.plugins;for(n in g)if(g[n]=y(f,g[n]),a=g[n].e)g[n].e=a.concat(f.e),d(g[n]);for(n in c.c)f.c.hasOwnProperty(n)||f.e.push(n);d(f);return f},j:function(a,b){var d,c,f,g;d=b.c;f=S.test(a)?a:a.replace(b.O,function(a){c=d[a]||{};g=c.b;return c.path||""});return{b:g||q,url:k.Q(f,b)}},Q:function(a,b){var d=b.o;return d&&!S.test(a)?x(d)+"/"+a:a},D:function(a,b){return a+((b||q).i.test(a)?"":".js")},s:function(a,b,d){var c=m.createElement("script");c.onload=c.onreadystatechange=function(d){d=d||l.event;if("load"==d.type||W[c.readyState])delete L[a.id],c.onload=c.onreadystatechange=c.onerror="",b()};c.onerror=function(){d(Error("Syntax or http error: "+a.url))};c.type=a.N||"text/javascript";c.charset="utf-8";c.async=!a.fa;c.src=a.url;L[a.id]=c;O.insertBefore(c,V);return c},W:function(a){var b=[],d;("string"==typeof a?a:a.toSource?a.toSource():a.toString()).replace(X,"").replace(Y,function(a,f,g,e){e?d=d==e?s:d:d||b.push(g);return""});return b},aa:function(a){var b,d,c,f,g,e;g=a.length;c=a[g-1];f=v(c,"Function")?c.length:-1;2==g?v(a[0],"Array")?d=a[0]:b=a[0]:3==g&&(b=a[0],d=a[1]);!d&&0<f&&(e=!0,d=["require","exports","module"].slice(0,f).concat(k.W(c)));return{id:b,q:d||[],B:0<=f?c:function(){return c},p:e}},V:function(a){var b;b=a.B.apply(a.p?a.a:s,a.q);b===s&&a.a&&(b=a.t?a.a=a.t.exports:a.a);return b},G:function(a,b){a.B=b.B;a.p=b.p;a.H=b.q;k.r(a)},r:function(a){function b(a,b,c){e[b]=a;c&&r(a,b)}function d(b,c){var d,f,g,e;d=B(1,function(a){f(a);m(a,c)});f=B(1,function(a){r(a,c)});g=k.Y(b,a);(e=z(g)&&g.a)&&f(e);t(g,d,a.f,a.a&&function(a){g.a&&(a==Q?f(g.a):a==R&&d(g.a))})}function c(){a.h(e)}var f,g,e,q,h,r,m;e=[];g=a.H;q=g.length;0==g.length&&c();r=B(q,b,function(){a.J&&a.J(e)});m=B(q,b,c);for(f=0;f<q;f++)h=g[f],h in P?(m(P[h](a),f,!0),a.a&&a.w(Q)):h?d(h,f):m(s,f,!0);return a},Z:function(a){k.L(a);k.s(a,function(){var b=J;J=s;!1!==a.ha&&(!b||b.I?a.f(Error(b&&b.I||"define() missing or duplicated: "+a.url)):k.G(a,b))},a.f);return a},Y:function(a,b){var d,c,f,g,e,h,r,m,w,l,p,s;d=b.n;c=b.ea;f=b.b||q;e=d(a);e in u?h=e:(g=C(e),m=g.g,h=g.d||m,w=k.j(h,f));if(!(e in u))if(s=k.j(m,f).b,g.d)r=h;else if(r=s.moduleLoader||s.na||s.loader||s.ma)m=h,h=r,w=k.j(r,f);h in u?l=u[h]:w.url in M?l=u[h]=M[w.url]:(l=k.F(s,h,c),l.url=k.D(w.url,w.b),u[h]=M[w.url]=l,k.Z(l));h==r&&(g.d&&f.plugins[g.d]&&(s=f.plugins[g.d]),p=new E,t(l,function(a){var b,f,g;g=a.dynamic;m="normalize"in a?a.normalize(m,d,l.b)||"":d(m);f=r+"!"+m;b=u[f];if(!(f in u)){b=k.U(s,f,m,c);g||(u[f]=b);var e=function(a){g||(u[f]=a);b.h(a)};e.resolve=e;e.reject=e.error=b.f;a.load(m,b.A,e,s)}p!=b&&t(b,p.h,p.f,p.w)},p.f));return p||l},da:function(){var a;if(!v(l.opera,"Opera"))for(var b in L)if("interactive"==L[b].readyState){a=b;break}return a},$:function(a){var b=0,d,c;for(d=m&&(m.scripts||m.getElementsByTagName("script"));d&&(c=d[b++]);)if(a(c))return c},X:function(){var a,b="";(a=k.$(function(a){(a=a.getAttribute("data-curl-run"))&&(b=a);return a}))&&a.setAttribute("data-curl-run","");return b},T:function(){function a(){k.s({url:c.shift()},b,b)}function b(){r&&(c.length?(k.l(d),a()):d("run.js script did not run."))}function d(a){throw Error(a||"Primary run.js failed. Trying fallback.");}var c=r.split(Z);c.length&&a()},l:function(a){setTimeout(a,0)}};P={require:k.ca,exports:k.K,module:k.ba};e.version="0.8.9";e.config=w;F.amd={plugins:!0,jQuery:!0,curl:"0.8.9"};q={o:"",P:"curl/plugin",i:/\?|\.js\b/,v:{},u:{},plugins:{},c:{},O:/$^/};G=l.curl;H=l.define;G&&v(G,"Object")?(l.curl=s,w(G)):k.R();(r=k.X())&&k.l(k.T);u.curl=e;u["curl/_privileged"]={core:k,cache:u,config:function(){return q},_define:K,_curl:e,Promise:E}})(this.window||"undefined"!=typeof global&&global||this);(function(l,p){function v(){if(!p.body)return!1;F||(F=p.createTextNode(""));try{return p.body.removeChild(p.body.appendChild(F)),F=K,!0}catch(e){return!1}}function x(){var r;r=A[p[C]]&&v();if(!z&&r){z=!0;for(clearTimeout(h);e=w.pop();)e();E&&(p[C]="complete");for(var q;q=y.shift();)q()}return r}function D(){x();z||(h=setTimeout(D,t))}var C="readyState",A={loaded:1,interactive:1,complete:1},y=[],E=p&&"string"!=typeof p[C],z=!1,t=10,B,e,w=[],h,K,F;B="addEventListener"in l?function(e,h){e.addEventListener(h,x,!1);return function(){e.removeEventListener(h,x,!1)}}:function(e,h){e.attachEvent("on"+h,x);return function(){e.detachEvent(h,x)}};p&&!x()&&(w=[B(l,"load"),B(p,"readystatechange"),B(l,"DOMContentLoaded")],h=setTimeout(D,t));define("curl/domReady",function(){function e(h){z?h():y.push(h)}e.then=e;e.amd=!0;return e})})(this,this.document);(function(l,p,v){define("curl/plugin/js",["curl/_privileged"],function(l){function D(e,w,h){function p(){r||(t<new Date?h():setTimeout(p,10))}var t,r,q;t=(new Date).valueOf()+(e.ga||3E5);h&&e.a&&setTimeout(p,10);q=l.core.s(e,function(){r=!0;e.a&&(e.C=v(e.a));!e.a||e.C?w(q):h()},function(e){r=!0;h(e)})}function C(e,l){D(e,function(){var h=y.shift();t=0<y.length;h&&C.apply(null,h);l.h(e.C||!0)},function(e){l.f(e)})}var A={},y=[],E=p&&!0==p.createElement("script").async,z,t,B=/\?|\.js\b/;z=l.Promise;return{dynamic:!0,normalize:function(e,l){var h=e.indexOf("!");return 0<=h?l(e.substr(0,h))+e.substr(h):l(e)},load:function(e,l,h,p){function v(e){(h.error||function(e){throw e;})(e)}var r,q,x,H,m;r=0<e.indexOf("!order");q=e.indexOf("!exports=");x=0<q?e.substr(q+9):p.a;H="prefetch"in p?p.prefetch:!0;e=r||0<q?e.substr(0,e.indexOf("!")):e;q=(q=p.dontAddFileExt||p.i)?RegExp(q):B;m=l.toUrl(e);q.test(m)||(m=m.lastIndexOf(".")<=m.lastIndexOf("/")?m+".js":m);m in A?A[m]instanceof z?A[m].m(h,v):h(A[m]):(e={name:e,url:m,fa:r,a:x,ga:p.timeout},A[m]=l=new z,l.m(function(e){A[m]=e;h(e)},v),r&&!E&&t?(y.push([e,l]),H&&(e.N="text/cache",D(e,function(e){e&&e.parentNode.removeChild(e)},function(){}),e.N="")):(t=t||r,C(e,l)))},cramPlugin:".."+"/"+"cram/js"}})})(this,this.document,function(l){try{return eval(l)}catch(p){}});define("curl/plugin/domReady",[".."+"/"+"domReady"],function(l){return{load:function(p,v,x){l(x)}}});}).call(this);[].slice.apply(document.querySelectorAll('figure.interactive[data-interactive]')).forEach(function(el){require([el.getAttribute('data-interactive')],function(interactive){interactive.boot(el,document,window.guardian.config);},function(err){console.log('Interactive failed',mainJS);console.log('Error:',err);});require(['ophan/ng'],function(ophan){var a=el.querySelector('a');var href=a&&a.href;if(href){ophan.trackComponentAttention(href,el);}});[].slice.apply(document.querySelectorAll('iframe.interactive-atom-fence')).forEach(function(el){var srcdoc;if(!el.srcdoc){srcdoc=el.getAttribute('srcdoc');el.contentWindow.contents=srcdoc;el.src='javascript:window["contents"]';}});}); const pillar='Opinion';(function(){function convertContentType(contentType){var result=contentType;if(typeof contentType==='string'){result=contentType.toLowerCase().split(' ').join('');}return result;}function getQueryParam(key){var query=window.WB_wombat_location.search.substring(1);var vars=query.split("&");var pairs=vars.map(function(x){return x.split('=')});return pairs.filter(function(xs){return xs.length==2&&xs[0]==key}).map(function(xs){return xs[1]})[0];}function getAnalyticsEdition(){var edition=(guardian.config.page.edition||'').toLowerCase() return edition==='int'?'international':edition;}function getAnalyticsTitle(){var analyticsTitle=(guardian.config.page.webTitle||'');return(analyticsTitle==='Network Front')?getAnalyticsEdition()+' network front':analyticsTitle;}function getExperienceValue(){return'none';}var identityId=null;if(guardian.config.user){identityId=guardian.config.user.id;}var isLoggedIn=(!!identityId).toString();(function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){(i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o),m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m)})(window,document,'script','//www.google-analytics.com/analytics.js','ga');ga('create','UA-78705427-1','auto','allEditorialPropertyTracker',{'sampleRate':100,'siteSpeedSampleRate':0.1,'userId':identityId});ga('create','UA-33592456-1','auto','guardianTestPropertyTracker',{'sampleRate':5,'siteSpeedSampleRate':0.1,'userId':identityId});ga('allEditorialPropertyTracker.set','forceSSL',true);ga('allEditorialPropertyTracker.set','title',getAnalyticsTitle());ga('allEditorialPropertyTracker.set','anonymizeIp',true);ga('allEditorialPropertyTracker.set','dimension1',guardian.config.ophan.pageViewId);ga('allEditorialPropertyTracker.set','dimension2',guardian.config.ophan.browserId);ga('allEditorialPropertyTracker.set','dimension3','theguardian.com');ga('allEditorialPropertyTracker.set','dimension4',guardian.config.page.section);ga('allEditorialPropertyTracker.set','dimension5',convertContentType(guardian.config.page.contentType));ga('allEditorialPropertyTracker.set','dimension6',guardian.config.page.commissioningDesks);ga('allEditorialPropertyTracker.set','dimension7',guardian.config.page.contentId);ga('allEditorialPropertyTracker.set','dimension8',guardian.config.page.authorIds);ga('allEditorialPropertyTracker.set','dimension9',guardian.config.page.keywordIds);ga('allEditorialPropertyTracker.set','dimension10',guardian.config.page.toneIds);ga('allEditorialPropertyTracker.set','dimension11',guardian.config.page.seriesId);ga('allEditorialPropertyTracker.set','dimension15',identityId);ga('allEditorialPropertyTracker.set','dimension16',isLoggedIn);ga('allEditorialPropertyTracker.set','dimension21',getQueryParam('INTCMP'));ga('allEditorialPropertyTracker.set','dimension22',getQueryParam('CMP_BUNIT'));ga('allEditorialPropertyTracker.set','dimension23',getQueryParam('CMP_TU'));ga('allEditorialPropertyTracker.set','dimension26',(!!guardian.config.page.isHosted).toString());ga('allEditorialPropertyTracker.set','dimension27',navigator.userAgent);ga('allEditorialPropertyTracker.set','dimension29',window.WB_wombat_location.href);ga('allEditorialPropertyTracker.set','dimension30',getAnalyticsEdition());ga('allEditorialPropertyTracker.set','dimension43',getExperienceValue());ga('allEditorialPropertyTracker.set','dimension50',pillar);if(document.WB_wombat_location.hash==='#fbLogin'){ga('allEditorialPropertyTracker.set','referrer',null);document.WB_wombat_location.hash='';}ga('guardianTestPropertyTracker.set','forceSSL',true);ga('guardianTestPropertyTracker.set','title',getAnalyticsTitle());ga('guardianTestPropertyTracker.set','anonymizeIp',true);ga('guardianTestPropertyTracker.set','dimension1',guardian.config.ophan.pageViewId);ga('guardianTestPropertyTracker.set','dimension2',guardian.config.ophan.browserId);ga('guardianTestPropertyTracker.set','dimension3','theguardian.com');ga('guardianTestPropertyTracker.set','dimension4',guardian.config.page.section);ga('guardianTestPropertyTracker.set','dimension5',convertContentType(guardian.config.page.contentType));ga('guardianTestPropertyTracker.set','dimension6',guardian.config.page.commissioningDesks);ga('guardianTestPropertyTracker.set','dimension7',guardian.config.page.contentId);ga('guardianTestPropertyTracker.set','dimension8',guardian.config.page.authorIds);ga('guardianTestPropertyTracker.set','dimension9',guardian.config.page.keywordIds);ga('guardianTestPropertyTracker.set','dimension10',guardian.config.page.toneIds);ga('guardianTestPropertyTracker.set','dimension11',guardian.config.page.seriesId);ga('guardianTestPropertyTracker.set','dimension15',identityId);ga('guardianTestPropertyTracker.set','dimension16',isLoggedIn);ga('guardianTestPropertyTracker.set','dimension21',getQueryParam('INTCMP'));ga('guardianTestPropertyTracker.set','dimension22',getQueryParam('CMP_BUNIT'));ga('guardianTestPropertyTracker.set','dimension23',getQueryParam('CMP_TU'));ga('guardianTestPropertyTracker.set','dimension26',(!!guardian.config.page.isHosted).toString());ga('guardianTestPropertyTracker.set','dimension27',navigator.userAgent);ga('guardianTestPropertyTracker.set','dimension29',window.WB_wombat_location.href);ga('guardianTestPropertyTracker.set','dimension30',getAnalyticsEdition());ga('guardianTestPropertyTracker.set','dimension43',getExperienceValue());ga('guardianTestPropertyTracker.set','dimension50',pillar);if(document.WB_wombat_location.hash==='#fbLogin'){ga('guardianTestPropertyTracker.set','referrer',null);document.WB_wombat_location.hash='';}ga('allEditorialPropertyTracker.send','pageview',{hitCallback:function(){var image=new Image();image.src="//phar.gu-web.net/count/pvg.gif";}});try{var NG_STORAGE_KEY='gu.analytics.referrerVars';var referrerVarsData=window.sessionStorage.getItem(NG_STORAGE_KEY);var referrerVars=JSON.parse(referrerVarsData);if(referrerVars&&referrerVars.value){var d=new Date().getTime();if(d-referrerVars.value.time<60*1000){ga('allEditorialPropertyTracker.send','event','Click','Internal',referrerVars.value.tag,{nonInteraction:true,dimension12:referrerVars.value.path});}window.sessionStorage.removeItem(NG_STORAGE_KEY);}}catch(e){}guardian.app&&guardian.app.mediator&&guardian.app.mediator.emit('modules:ga:ready');})(); <img id="googleConfidenceNoScriptImage" alt="" src="//via.hypothes.is/im_///phar.gu-web.net/count/pvg.gif" width="1" height="1" class="u-h"/> var _comscore=_comscore||[];_comscore.push({c1:"2",c2:"6035250",comscorekw:guardian.config.page.keywords});(function(){var s=document.createElement("script"),el=document.getElementsByTagName("script")[0];s.async=true;s.src="https://sb.scorecardresearch.com/beacon.js";el.parentNode.insertBefore(s,el);})(); <img src="https://via.hypothes.is/im_/https://sb.scorecardresearch.com/p?c1=2&c2=6035250&cv=2.0&cj=1&comscorekw=Rail+fares%2CTransport+policy%2CTransport%2CPolitics"/> <div style="display:inline;"> <img height="1" width="1" style="border-style:none;" alt="" src="//via.hypothes.is/im_///googleads.g.doubleclick.net/pagead/viewthroughconversion/971225648/?value=0&amp;guid=ON&amp;script=0"/> </div> !function(e,t,n,s,u,a){e.twq||(s=e.twq=function(){s.exe?s.exe.apply(s,arguments):s.queue.push(arguments);},s.version='1.1',s.queue=[],u=t.createElement(n),u.async=!0,u.src='//static.ads-twitter.com/uwt.js',a=t.getElementsByTagName(n)[0],a.parentNode.insertBefore(u,a))}(window,document,'script');twq('init','nyl43');twq('track','PageView');  

      claimed that " a better, cheaper more effective service for the commuter", what is the ideology in there?

    1. Thus, when an individual appears in the presence of others, there will usually be some reason for him to mobilize his activity so that it will convey an impression to others which it is in his interests to convey.I h a v e s a i d t h a t w h e n a n i n d i v i d u a l a p p e a r s b e f o r e o t h e r s his actions will influence the definition of the situation which they come to have. Sometimes the individual will act in a thoroughly calculating manner, expressing him self in a given way solely in order to give the kind of im pression to oth ers that is likely to evoke from them a specific response he is concern ed to obtain.

      So when I want someone to do something I frame it in a certain way in order to make them do it.

    1. Slot filling

      填槽这个问题更多的是看成一个序列标注的问题。句子中的每个词都打上一个语义标签。输入是由词组成的句子,输出是每个词对应的slot/concept IDs.

      DBN 类的处理:

      • A Deoras and R. Sarikaya. Deep belief network basedsemantic taggers for spoken language understanding.

        L. Deng, G. Tur, X. He, and D. Hakkani-Tur. Use ofkernel deep convex networks and end-to-end learningfor spoken language understanding

      RNN:

      • G. Mesnil, X. He, L. Deng, and Y. Bengio. Investi-gation of recurrent-neural-network architectures andlearning methods for spoken language understanding.Interspeech, 2013.
      • K. Yao, G. Zweig, M. Y. Hwang, Y. Shi, and D. Yu.Recurrent neural networks for language understand-ing. InInterspeech, 2013
      • R. Sarikaya, G. E. Hinton, and B. Ramabhadran.Deep belief nets for natural language call-routing
      • K. Yao, B. Peng, Y. Zhang, D. Yu, G. Zweig, andY. Shi. Spoken language understanding using longshort-term memory neural networks. InIEEE Insti-tute of Electrical & Electronics Engineers, pages 189 –194, 2014
    2. Language Understanding

      目标是根据一个用户utterance/query 得到其对应的语义slot。slots是预先根据场景定于的。通常来说有两种类型的表示,一个是句子级别的类别,例如用户的意图和utterance的类别。另外一个是单词级别的信息抽取,例如命名实体和槽位填充。

      意图识别是根据一句话来检测用户的意图。 基于深度学习的意图识别: L. Deng, G. Tur, X. He, and D. Hakkani-Tur. Use ofkernel deep convex networks and end-to-end learningfor spoken language understanding. InSpoken Lan-guage Technology Workshop (SLT), 2012 IEEE, pages210–215. IEEE, 2012

      G. Tur, L. Deng, D. Hakkani-T ̈ur, and X. He. Towardsdeeper understanding: Deep convex networks for se-mantic utterance classification. InAcoustics, Speechand Signal Processing (ICASSP), 2012 IEEE Interna-tional Conference on, pages 5045–5048. IEEE, 2012.

      D. Yann, G. Tur, D. Hakkani-Tur, and L. Heck. Zero-shot learning and clustering for semantic utteranceclassification using deep learning. 2014.

      尤其是这个用CNN来抽取query vector进行query分类。 H. B. Hashemi, A. Asiaee, and R. Kraft. Query intentdetection using convolutional neural networks. InIn-ternational Conference on Web Search and Data Min-ing, Workshop on Query Understanding, 2016

      P.-S. Huang, X. He, J. Gao, L. Deng, A. Acero, andL. Heck. Learning deep structured semantic modelsfor web search using clickthrough data. InProceedingsof the 22nd ACM international conference on Confer-ence on information & knowledge management, pages2333–2338. ACM, 2013

      Y. Shen, X. He, J. Gao, L. Deng, and G. Mesnil.Learning semantic representations using convolutionalneural networks for web search. InProceedings of the23rd International Conference on World Wide Web,pages 373–374. ACM, 2014.

  17. Feb 2019
    1. T h e c l u b h o u s e c o o r d i n a t o r s i n c l u d e d L u i s i n fi e l d t r i p s c o n n e c t e d t o h i s i n t e rests, including one to the game design company Electronic Arts. Luis remembered, “That was pretty cool. We learned a lot about its history. We got to try some games that hadn’t come out yet.” The coordinators also often promoted his work by showing his movies to guests and new members.

      I think this is an example of an effective learning method that could be applied to a lot of public schools. sometimes people learn better when they'e motivated by interest, even if it doesn't follow the criteria of what they think is best. he even enjoyed learning about history this way.

    2. . O u r m e t h o d s i n v o l v e o b s e r v ation, interviews, analysis of the artifacts learners create, and data collection through an occasional questionnaire. To advance our conceptualization of learning over time and settings, we create visualizations that map key learning activities, relationships between activities, where they take place, and the people and resources involved in each activity.

      Our learning process is not limited within small circle. We try to get involved with varieties of resources to broaden our knowledge. Also, best ways of learning, understanding, in fact, is a main concern of the people. We learn mostly by watching because it create a images in our brain, relate object and map with each things we learn and comprehend the phenomena in wide angle.

    3. Online communities that re fl ect “cultures of participa-tion” (Jenkins, 2006, 2009 ) a l l o w c r e a t o r s t o s h a r e t h e i r w o r k , r e c e i v e f e e d b a c k , and expand their social networks. Informal collaborative relationships develop as learners share knowledge and codevelop interests.

      This illustrates the affinity group concept really well, and I really like how this is clearly visible in modern-day Internet interactions as well, like fandoms. The idea behind them is that no matter who you are, you're participating and interacting within the fandom because you appreciate that One Thing, and this seems like the perfect description of that kind of thing.

    4. Digital technologies offer children and adolescents rich opportunities to design and create artwork, movies, games, animations, interactive robots, and other artifacts. Online communities that re fl ect “cultures of participa-tion” (Jenkins, 2006, 2009 ) a l l o w c r e a t o r s t o s h a r e t h e i r w o r k , r e c e i v e f e e d b a c k , and expand their social networks.

      I think this really puts into perspective how new medias, especially networked medias (where people share and interact e.i. gaming, chatrooms, blogs, virtual spaces, etc.), create unique opportunities to connect individuals from diverse backgrounds allowing them to build from their similarities. I feel the entire online experience of being a user within a interconnected community reflects our own nature as individuals organisms living within the collective consciousness.

  18. Jan 2019
    1. the bmj|BMJ 2018;363:k5094 | doi: 10.1136/bmj.k50941RESEARCHParachute use to prevent death and major trauma when jumping from aircraft: randomized controlled trialRobert W Yeh,1 Linda R Valsdottir,1 Michael W Yeh,2 Changyu Shen,1 Daniel B Kramer,1Jordan B Strom,1 Eric A Secemsky,1 Joanne L Healy,1 Robert M Domeier,3 Dhruv S Kazi,1Brahmajee K Nallamothu4 On behalf of the PARACHUTE InvestigatorsABSTRACTOBJECTIVETo determine if using a parachute prevents death or major traumatic injury when jumping from an aircraft.DESIGNRandomized controlled trial.SETTINGPrivate or commercial aircraft between September 2017 and August 2018.PARTICIPANTS92 aircraft passengers aged 18 and over were screened for participation. 23 agreed to be enrolled and were randomized.INTERVENTIONJumping from an aircraft (airplane or helicopter) with a parachute versus an empty backpack (unblinded).MAIN OUTCOME MEASURESComposite of death or major traumatic injury (defined by an Injury Severity Score over 15) upon impact with the ground measured immediately after landing.RESULTSParachute use did not significantly reduce death or major injury (0% for parachute v 0% for control; P>0.9). This finding was consistent across multiple subgroups.

      The take-away: Look deeper. Be more skeptical. Find other sides to things.

    1. 28. K. A. Lehmann, B. L. Bass, Biochemistry 39, 12875–12884 (2000)

      The authors of this work investigated and described the activity of the human ADAR1 and ADAR2 deaminases.

      They showed that ADAR proteins had certain sequence preferences, including the nucleotides around the target and the position of the target relative to the RNA duplex ends. Additionally, they determined that ADARs did not edit all accessible adenosines. That implied these proteins possessed some specificity with unknown mechanism.

    2. 21. A. Kuttan, B. L. Bass, Proc. Natl. Acad. Sci. U.S.A. 109, E3295–E3304 (2012).

      The authors of the paper mutated the ADAR2 protein and, by screening of multiple mutants, identified the E488Q variant that could edit adenosine in all possible triplet targets.

    1. Being able to create a web page that has a high level of interactivity is essential to the vision I have for this project which aims to combine historical fact and narrative fiction in an electronic format that appeals to the children of the 21st century. According to Zhang-Kennedy, Abdelaziz & Chiasson, 2017, 96.6% of all Canadian children ages six months to 4 years use mobile devices everyday, so learning how to create interactive narratives in digital form is an important skill for emerging writers to obtain (10). Children and youth are exposed to varied forms of reading experiences on a daily basis that are both print and digital. While print requires linear reading skills, digital literature taps into both linear and tabular reading skills, and can therefore enhance not only the reader’s learning, but their pleasure as well (Durant, 2017). Electronic platforms have the potential to weave layers of complexity into a narrative fiction that can guide readers to a richer experience than available in print alone. However, it is important for a digital narrative to provide interaction that is consistent with the story, otherwise, the reader may become too distracted by the inserted hypermedia and lose track of the narrative (Kao, Tsai, Liu, Chen-Han, 2015, Sargeant, 2015, ZhangKennedy, et al, 2017). Producing fiction for children using electronic platforms is an effective way to improve reader engagement with the text (Kao, Tsai, et al, 2015, Sargeant, 2015, Zhang-Kennedy, et al, 2017). The interactive nature of digital literature provides children with a “rich sensory experience” that cannot be replicated in static e-books or print texts (Sargeant, 457). Furthermore, not only has highly interactive electronic literature been shown to “support … knowledge acquisition, retention, and transfer”, it also increases the enthusiasm with children approach reading; important considerations when designing a story for children using interactive digital technologies (Zhang-Kennedy, et al, 17). As well, the researchers assert that creating a story that is designed to impart knowledge in a pleasurable way enhances the overall experience of the reader; and to design a story using interactive electronic platforms has been shown to attract the reader’s attention, improve reading comprehension, and increase reader motivation to engage with the text (Kao, Tsai, et al, 2015, Sargeant, 2017, ZhangKennedy, et al, 2017). Zhang-Kennedy, et al. contend that this is because interactive literature can “decrease the cognitive overload, burden of decoding words or grammar, and usage of working memory” (57), making this kind of fiction exceedingly attractive to weaker readers who struggle with those issues. This insertion of hypermedia into the fictional text can do the work of reading that some people find difficult so that reader comprehension and pleasure are enhanced by using electronic platforms to write fictional texts. However, research also indicates that overdoing the hypermedia and interactivity in the digital text can distract the reader from the narrative which then may interfere with any learning that might occur. It is important to make any of the hypermedia have a high level of correspondence to the text or the links will only be distracting and not enhance the work (Kao, et al., 2015, Sargeant 2017, ZhangKennedy et al., 2017). To avoid having hyperlinks that only distract the reader and not enhance the narrative is to design the digital text to include high interactivity “coupled with reflection, feedback and guidance” (Kao, et al., 2015, 58). Zhang-Kennedy et al., note that their interactive e-book, Cyberheroes, “fostered child-parent discussion”, promoting adult guidance in children’s learning, congruent with the child development theories of Lev Vygotsky that I learned about in Psychology 204 – Child Development. Vygotsky recognized the importance of the child-adult interaction, and Kao, et al., Sargeant and Zhang-Kennedy, et al., all found that children who consume interactive electronic books that offer reflection and feedback in their design, but also include adult guidance, are the most effective in promoting reading comprehension and pleasure.

      Works Cited

      Durant, David. “Reading in a Digital Age”, (2017). Charleston Briefings, Michingan Publishing. doi: http://dx.doi.org/10.3998/mpub.9944117

      Kao, G., Tsai, C., Liu, C., & Chen-Hang, Y. (2015). “The Effects of High/Low Interactive Electronic Storybooks on Elementary School Students’ Reading Motivation, Story Comprehension and Chromatics Concepts.” Computers & Education, 100, 56–70. EBSCOhost. doi:10.1016/j.compedu.2016.04.013.

      Sargeant, B. (2015). “What Is an Ebook? What Is a Book App? And Why Should We Care? An Analysis of Contemporary Digital Picture Books.” Children’s Literature in Education, 46: 4, 454–

      1. EBSCOhost. doi:10.1007/s10583-015-9243-5.

      Zhang-Kennedy, L., Abdelaziz, Y., & Chiasson, S. (2107). “Cyberheroes: The design and evaluation of an interactive ebook to educate children about online privacy.” International Journal of ChildComputer Interaction. EBSCOhost. doi:10.1016/j.ijcci.2017.05.001.

    1. click

      OED defines:

      click, v.1

      (klɪk)

      [Found only since 16th c.: it agrees in form and sense with Du., LG., dial. Ger. klikken; also partly in sense with OF. cliquer (Cotgr.). How far these are connected is uncertain: the word is of echoic origin, and may have arisen independently in different langs. In English and Teutonic generally, it appears to stand in ablaut relation to clack, as expressing a thinner and lighter sound; cf. chip, chap, clip, clap, clink, clank.]

      1. a.1.a intr. To make the thin, dry, hard sound described under click n.1 1; spec. of a camera or of a person operating one. Also (in various senses) with following adv.

         1611 Cotgr., Cliquer, to clacke, clap, clatter, clicke it.    a 1682 [see clicking ppl. a.]    1714 Gay Sheph. Week Frid. 101 The solemn death-watch click'd the hour she died.    1816 Kirby & Sp. Entomol. (1843) II. 302 It clicks as if it was walking in pattens.    1853 Kane Grinnell Exp. xxxiii. (1856) 287 The ice sounded‥ like some one hammering a nail against the ship's side, clicking at regular intervals.    1929 C. Day Lewis Transitional Poem ii. 32 Desire clicks back Like cuckoo into clock.    1937 C. Beaton Diary 3 June in Wand. Years (1961) 311, I clicked away.    1948 Mind LVII. 485 After trying to recall a face, one often says, ‘Ah, now I remember the man you mean.’ In such cases we seem to feel something happen: something, as it were, clicks to.    1950 D. Gascoyne Vagrant 14 When Abbott's camera clicked.

      b.1.b with object of result.

         1819 Crabbe T. of Hall x. Wks. 1834 VI. 236 Who would bear his chains And hear them clicking every wretched hour.    a 1832 ― Posth. T. Wks. VIII. 17 The clock that both by night and day Click'd the short moments.

      c.1.c Of a horse: see click n.1 3.

         1713 Lond. Gaz. No. 5170/4 Sometimes clicks in his Pace.

      d.1.d fig. To meet or fall in with (a person) fortunately or at the right moment; to be successful; to fit together or agree exactly; to become friendly with someone; to strike up a rapport with (a person); to be a success in the theatre or other form of entertainment. colloq.

         1915 T. Burke Nights in Town 107 The bright boys‥saunter‥up and down that parade until they ‘click’ with one of the ‘birds’.    Ibid. 108 You have ‘clicked’. You have ‘got off’.    1921 Wodehouse Jill the Reckless viii. 120 A grey world in which, hoping to click, we merely get the raspberry.    1922 ― (title) The Clicking of Cuthbert.    1923 ― Inimit. Jeeves iv. 40 ‘Did you click?’ He sighed heavily. ‘If you mean was I successful, I must answer in the negative.’    1926 Amer. Speech I. 436/2 [Show business slang]. A turn is said to click when it proves to be successful, or in the vernacular, ‘gets across with a bang’.    1927 Vanity Fair Nov. 67/2 He doesn't hope that he makes good. He hopes that he ‘clicks’. He trusts that he doesn't ‘flop’.    1930 Times 29 Mar. 10/4 The objects are arranged but not composed‥so that they remind you a little of people assembled harmoniously but lacking some common emotion. They don't ‘click’.    1931 J. Cannan High Table xi. 164 Getting drunk when he was trying to click with a Glasgow buyer.    1934 C. Lambert Music Ho! iii. vii. 208 Receiving the glad eye from presumably attractive girls with whom he ultimately and triumphantly ‘clicks’.    1952 V. Gollancz My Dear Timothy xx. 316 To prove satisfactorily that a lot of these devices wouldn't ‘click’.    1958 Observer 20 Apr. 14/6 Put out under pressure to fill the gap‥it [sc. the B.B.C. television programme To-Night] clicked instantly and is still the pride of British television.

      e.1.e To come in for something; spec. to get killed. Mil. colloq.

         1917 Empey From Fire Step 81, No. 1 Section had clicked for another blinking digging party.    1917 W. Muir Observ. Orderly 226 To click can be either advantageous or baneful, according to the circumstances. A soldier asks a superior for a favour, and it is granted. That soldier has clicked.‥ But he has also clicked if he is suddenly seized on to do some menial duty.    1919 Athenæum 11 July 582/2 The verb ‘click’‥has developed some passive meanings, such as to get killed.    Ibid. 8 Aug. 729/1 To ‘click for fatigue’ is to ‘come in for’ a fatigue duty at the psychological moment.    1966 Listener 22 Dec. 927/1, I came out of hibernation‥to find that I had clicked for a most alarming job.

      f.1.f To become pregnant, to conceive. colloq.

         1936 N. Coward Fumed Oak ii. ii. 58 A couple of months later you'd told me you'd clicked, you cried a hell of a lot, I remember.    1954 Landfall VIII. 228 In Wellington, just before he came down there was Heather, who had ‘clicked for a baby’.

      g.1.g To ‘ring a bell’, fall into context. colloq.

         1939 ‘M. Innes’ Stop Press ii. iv. 269 Something clicks. Tell me.    1960 A. Burgess Right to Answer ii. 37 Then the name clicked, because somebody in the town had talked about Everett.

      1. a.2.a trans. To strike with a click; to cause (anything) to make such a noise.

         1581 T. Lovell Dial. Dancing, He trips her toe, and clicks her cheek, to show what he doth crave.    1605 B. Jonson Sejanus ii. ii, Jove‥at the stroke click'd all his marble thumbs.    1654 Gayton Pleas. Notes iii. viii. 124 Humble your selves, and click your Chains to th' ground.    1830 Marryat King's Own xxxiv, They‥clicked their glasses together.    1830 Tennyson Owl, Merry milkmaids click the latch.    1918 W. Owen Let. 20 Mar. (1967) 541 Mrs. A. can click the piano quite quickly.    1930 C. V. Grimmett Getting Wickets iii. 59 The method of spinning is similar to that used in clicking the finger and thumb to attract attention.    1936 Wodehouse Laughing Gas xviii. 203 He was clicking his tongue in gentle self-reproach.    1938 J. Hilton To You, Mr. Chips i. 51 No upstart authority has yet compelled him to click his heels and begin the day with juju incantations of Heils and Vivas.    1958 M. L. Hall et al. Newnes Complete Amat. Photogr. 156 All one has to do is to point the camera and click the shutter.

      b.2.b Also with adv., as click out, click up, etc.

         1895 Westm. Gaz. 17 Apr. 8/1 How assiduously some of the political typists must have been clicking out these words of late.    1930 ‘A. Armstrong’ Taxi v. 46 And so for the next seven years the meters clicked up 1/- a mile.    1962 J. Dill in Into Orbit p. xix, A robot could easily click off pictures automatically or take measurements of radiation and heat.

      c.2.c To get, receive. Mil. colloq.

         1917 Empey From Fire Step 39 Shut your blinkin' mouth, you bloomin' idiot; do you want us to click it from the Boches?    Ibid. 65 Trench mortars started dropping ‘Minnies’ in our front line. We clicked several casualties.    1944 J. H. Fullarton Troop Target xxx. 213 They tell me Micca's a good picquet to click.

      3.3 techn. To rule with a machine pen, the wheel of which clicks.

         1869 Eng. Mech. 5 Nov. 166/1 This operation of clicking [i.e. ruling the pattern on paper] is the really curious part of the manufacture [of tartan woodwork.]    Ibid. 166/3 He ‘clicks’ his pen to the first white line‥Over sheet after sheet he clicks away.

      4.4 Printers' slang. (See quot. and clicking vbl. n. d.)

         1860 Ruse & Straker Printing 121 A work is said to be ‘clicked’ when each man works on his lines, and keeps an account thereof.


      Draft partial entry June 2001

      ▸ Computing. a.a trans. To press (one of the buttons on a mouse) and release instantaneously or hold down while performing another action; to activate (a program function) or select (a particular item) in this way, having first positioned the cursor on the appropriate part of the computer screen.

         1982 Byte (Nexis) Apr. 242 They would be selected by pointing to them with the mouse and clicking one of the buttons.    1991 Macintosh User's Guide for Macintosh PowerBook Computers ii. 11 When you click an icon, it becomes highlighted (the icon is darkened). A highlighted icon is said to be selected. A selected icon is the object of whatever action you choose next.    2000 PC World Nov. 250/3 Click an entry and drag it to the Insert menu‥When the Insert menu drops down, drag the mouse pointer to where you want the command, then release the mouse button.

      b.b intr. To press (and release) one of the buttons on a mouse; to activate a program function or select a particular item in this way, having first positioned the mouse pointer on the appropriate part of the computer screen. Freq. with on.

         1984 PC Mag. (Nexis) 17 Apr. 214 To move a window intact with a mouse, you would first click on the top left of a window and then click at the desired new location of the left-hand corner.    1989 Computer Buyer's Guide & Handbk. 7 vi. 29/2 You insert the program disk and click on the Install icon.    1991 UnixWorld Oct. 102/1 You choose the text tool and click to invoke the text dialog box.    1997 J. Seabrook Deeper v. 163 The trick was to hit a site, browse it, see a link, click on it, and get transferred to another site.

  19. wendynorris.com wendynorris.com
    1. Ta b l e 3DERMIS design premises [29]

      Muhren and Walle use the 6 of the 9 most relevant design premises for the future information system design guidelines for DERMIS, another crisis management system

      Information focus (dealing with complexity)

      Crisis memory (creating historical frames of reference)

      Exceptions as norms (support changing frames of reference in fluid, unpredictable scenario)

      Scope and nature of crisis (support adaptable management depending on type of crisis)

      Information validity and timeliness (synergy of coping with uncertainty and creating frames of reference from relevant, known information)

      Free exchange of information (synergy of social context and creating useful/sharable frames of reference)

    1. It should be no surprise recognizing the problematic-theoretical simi­larities between disaster research and its "half-sibling" (e.g., see Wenger 1987), collective behavior. Both disaster research and collective behavior are at a theoretical standstill (e.g., see Aguirre and Quarantelli 1983), and both still rely upon every-day language rather than a broader scheme for describing events (e.g., see Weller and Quarantelli 1973, McPhail 1992). Works by Kreps and Bosworth (1994) and Dombrowsky (1981; 1987), (and perhaps Barton's 1970 classic work) reflect the theoretical attention disaster research needs to build.

      Connects crisis informatics research with collective behavior.

      I wonder though does Neal define collective behavior and collection action differently?

      Look at these citations:

      Quarantelli, E.L. 1985. Emergent Citizen Groups in Disaster Preparedness and Recovery Activities. Final Report 33. Newark, Delaware: Disaster Research Center, University of Delaware

      Turner, Ralph and Lewis Killian. 1987. Collective Behavior. Third Edition. Engle­wood Cliffs, New Jersey: Prentice Hall.

      Weller, Jack M. and E. L. Quarantelli. 1973. "Neglected Characteristics of Collec­tive Behavior," American Journal of Sociology 79:665-85.

      Wenger, Dennis. 1987. "Collective Behavior and Disaster Research." Pp. 213-237 in Sociology of Disasters, edited by R. Dynes, B. De Marchi and C. Pelanda. Milan, Italy: Franco Angeli.